Page 1
Role of Patched-1 Intracellular Domains in Canonical and Non-Canonical Hedgehog Signalling Events
by
Malcolm Harvey
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Laboratory Medicine & Pathobiology University of Toronto
© Copyright by Malcolm Harvey 2013
Page 2
ii
Role of Patched-1 Intracellular Domains in Canonical and Non-
Canonical Hedgehog Signalling Events
Malcolm Harvey
Master of Science
Department of Laboratory Medicine & Pathobiology
University of Toronto
2013
Abstract
Patched-1 (Ptch1) is the primary receptor for Hedgehog (Hh) ligands and mediates both
canonical and non-canonical Hh signalling. Previously, our lab identified that mice possessing a
Ptch1 C-terminal truncation display blocked mammary gland development at puberty that is
overcome by overexpression of activated c-src. Testing the hypothesis that this involves a direct
interaction between Ptch1 and c-src, we identified through co-immunoprecipitation that Ptch1
and c-src associate in an Hh-dependent manner, and that the Ptch1 C-terminus regulates
activation of c-src in response to Hh ligand. Since the effects of Ptch1 intracellular domain
deletions on canonical Hh signalling are ill-defined, we assayed this through luciferase reporter
assays and qRT-PCR. Transient assays revealed that the Ptch1 middle intracellular loop is
required for response to ligand, while qRT-PCR from primary cells showed that C-terminal
truncation impairs canonical Ptch1 function. Together, this indicates that the intracellular
domains of Ptch1 mediate distinct canonical and non-canonical functions.
Page 3
iii
Acknowledgments
First, I would like to thank my supervisor Dr. Paul A. Hamel for offering me the
opportunity to pursue graduate studies in his lab and for his guidance, advice, support, and
patience along the way. I also give my sincere thanks to Drs. Stephane Angers and Reinhart
Reithmeier for being a part of my advisory committee and contributing their valuable insight,
suggestions, and time. Additionally, I would like to thank Drs. Jorge Filmus and Herman Yeger
for agreeing to participate in my thesis defense.
I would also like to thank present and former Hamel lab members Dr. Laurent Balenci,
Dr. Hong Chang, Andrew Fleet, Melissa Hicuburundi, Jennifer Lee, Nadia Okolowsky, and
Aaliya Tamachi for their assistance, friendship, and kindness. I am especially grateful to Aaliya
for assisting with cloning, Nadia for assisting with primary cell isolation, and both of them for
always being there through the many ups and downs.
And most importantly, I would like to thank my family for their endless love and support.
Assuming this thesis is defended successfully, I may at last have an answer to the question of
"When are you coming home!?"
Page 4
iv
Table of Contents
ABSTRACT .................................................................................................................................. II
ACKNOWLEDGEMENTS ....................................................................................................... III
TABLE OF CONTENTS ........................................................................................................... IV
LIST OF FIGURES .................................................................................................................... VI
ABBREVIATION KEY ............................................................................................................ VII
INTRODUCTION ......................................................................................................................... 1
1 THE CANONICAL HEDGEHOG SIGNALLING PATHWAY .......................................... 1
1.1 LIGAND SYNTHESIS AND SECRETION ..................................................................................... 2
1.2 LIGAND RECEPTION ..................................................................................................................... 4
1.3 SIGNAL TRANSDUCION THROUGH SMOOTHENED .............................................................. 7
1.4 REGULATION OF GLI-MEDIATED TRANSCRIPTION ........................................................... 10
1.5 TRANSCRIPTION OF HEDGEHOG TARGET GENES .............................................................. 14
2 PTCH1 STRUCTURE AND FUNCTION ............................................................................. 14
2.1 MOLECULAR CHARACTERIZATION ....................................................................................... 14
2.1.1 The sterol sensing domain ...................................................................................................... 15
2.1.2 Ptch1 splice variants .............................................................................................................. 16
2.1.3 Function of the Ptch1 C-terminus .......................................................................................... 17
2.2 MECHANISM OF SMOOTHENED INHIBITION ....................................................................... 18
2.3 EFFECT OF PTCH1 MUTATION IN NEOPLASIA AND DEVELOPMENTAL DISORDER .. 20
2.3.1 Nevoid basal cell carcinoma syndrome .................................................................................. 20
2.3.2 Basal cell carcinoma .............................................................................................................. 22
2.3.3 Medulloblastoma .................................................................................................................... 24
2.3.4 Holoprosencephaly ................................................................................................................. 25
2.4 RELATION TO PTCH2 .................................................................................................................. 26
3 NON-CANONICAL HEDGEHOG SIGNALLING ............................................................. 27
Page 5
v
3.1 NON-CANONICAL HEDGEHOG SIGNALLING EVENTS ACTING THROUGH PTCH1 ..... 28
3.2 IDENTIFICATION OF A NOVEL PTCH1-MEDIATED SIGNALLING CASCADE
INVOLVING C-SRC ...................................................................................................................... 30
RATIONALE .............................................................................................................................. 33
HYPOTHESIS & OBJECTIVES .............................................................................................. 33
MATERIALS & METHODS ..................................................................................................... 34
CELL CULTURE ........................................................................................................................................ 34
PRIMARY CELL CULTURE .................................................................................................................... 34
CLONING & EXPRESSION CONSTRUCTS ........................................................................................... 35
WESTERN BLOTTING AND IMMUNOPRECIPITATION .................................................................... 35
GLYCOSIDASE TREATMENT ................................................................................................................ 36
PREPARATION OF SHH-CONDITIONED MEDIA ................................................................................ 36
LUCIFERASE ASSAYS............................................................................................................................. 37
RT-PCR AND qRT-PCR ............................................................................................................................ 38
IMMUNOFLUORESCENCE AND IMAGING ......................................................................................... 39
IN VITRO BINDING ASSAYS ................................................................................................................... 39
RESULTS .................................................................................................................................... 41
DELETION MUTANT ANALYSIS OF THE PTCH1-C-SRC INTERACTION ...................................... 41
EFFECT OF HEDGEHOG LIGAND STIMULATION ON THE PTCH1-C-SRC INTERACTION ........ 45
DIFFERENTIAL EFFECTS OF PTCH1 AND THE MES MUTANT ON SIGNAL TRANSDUCTION
CASCADES ................................................................................................................................................ 47
CANONICAL HEDGEHOG SIGNALLING CONSEQUENCES OF PTCH1 INTRACELLULAR
DOMAIN DELETIONS .............................................................................................................................. 48
DISCUSSION .............................................................................................................................. 55
EXOGENOUS PTCH1 AND C-SRC INTERACT IN VITRO ................................................................... 55
MODULATION OF THE PTCH1-C-SRC ASSOCIATION IN RESPONSE TO SHH LIGAND ............ 58
THE MES ALLELE IS HYPOMORPHIC IN MAMMARY FIBROBLASTS .......................................... 59
LOSS OF THE PTCH1 MIDDLE INTRACELLULAR LOOP RESULTS IN AN INABILITY TO
RESPOND TO SHH STIMULATION ....................................................................................................... 62
CONCLUSIONS ......................................................................................................................................... 64
Page 6
vi
REFERENCES ............................................................................................................................ 66
Page 7
vii
List of Figures
FIGURE 1. MAJOR INTRACELLULAR DOMAINS OF VERTEBRATE PTCH1 CONTAIN
PUTATIVE SH2- AND SH3-BINDING DOMAINS ................................................................................. 42
FIGURE 2. PTCH1 DELETION MUTANTS EXHIBIT CORRECT SECRETORY PATHWAY
TRAFFICKING IN HEK 293 CELLS ........................................................................................................ 43
FIGURE 3. OVEREXPRESSED PTCH1 AND ACTIVATED C-SRC CO-IMMUNOPRECIPITATE BY
AN INTERACTION REQUIRING THE PTCH1 C-TERMINUS ............................................................. 44
FIGURE 4.OVEREXPRESSED PTCH1 IS A TARGET FOR TYROSINE PHOSPHORYLATION BY
OVEREXPRESSED ACTIVATED C-SRC ............................................................................................... 45
FIGURE 5. ASSOCIATION OF PTCH1 AND C-SRC IS ABOLISHED IN RESPONSE TO SHH
STIMULATION .......................................................................................................................................... 46
FIGURE 6. PRIMARY MAMMARY MESENCHYMAL CELLS CONTAINING A PTCH1 C-
TERMINAL MUTATION FAIL TO ACTIVATE C-SRC IN RESPONSE TO SHH STIMULATION ... 47
FIGURE 7. PRIMARY MAMMARY MESENCHYMAL CELLS CONTAINING A PTCH1 C-
TERMINAL MUTATION DISPLAY CONSTITUTIVE ACTIVATION OF GLI1 ................................. 49
FIGURE 8. PTCH1 MUTANTS LACKING THE LARGE INTRACELLULAR LOOP FAIL TO
RESPOND TO SHH STIMULATION ....................................................................................................... 50
FIGURE 9. DELETION OF THE PTCH1 LARGE INTRACELLULAR LOOP DOES NOT AFFECT
SHH-BINDING CAPABILITY .................................................................................................................. 51
FIGURE 10. DELETION OF PTCH1 LARGE INTRACELLULAR DOMAINS DOES NOT ABOLISH
THE CAPABILITY TO LOCALIZE TO THE PRIMARY CILIUM ........................................................ 52
FIGURE 11. DELETION OF THE PTCH1 LARGE INTRACELLULAR LOOP RESULTS IN
INCREASED CILIARY LENGTH ............................................................................................................ 53
FIGURE 12. HA-TAGGED PTCH1 RESULTS IN ALTERED BINDING AND TYROSINE
PHOSPHORYLATION PROPERTIES IN RESPONSE TO ACTIVATED C-SRC OVEREXPRESSION
..................................................................................................................................................................... 57
Page 8
viii
Abbreviation Key
ANOVA analysis of variance
AP alkaline phosphatase
Arbp 60S acidic ribosomal protein P0
BBS Bardet-Biedl syndrome
BCC basal cell carcinoma
Bcl-2 B cell lymphoma-2
Boc brother of Cdo
BSA bovine serum albumin
cAMP cyclic adenosine monophosphate
Cdo cell adhesion molecule-related/down-regulated by oncogenes
cGCP cerebellar granule cell progenitor
CK1 casein kinase 1
DDM n-dodecyl-β-d-maltoside
Dhh desert hedgehog
Disp1 dispatched-1
DMEM Dulbecco's modified eagle medium
dpc days post-coitum
DRAL downregulated in rhabdomyosarcoma LIM-domain protein
EDTA ethylenediaminetetraacetic acid
EGF epidermal growth factor
Endo H endoglycosidase H
ENU n-ethyl-n-nitrosourea
ER endoplasmic reticulum
ERK extracellular signal-regulated kinase
EVC Ellis-van Creveld syndrome protein
FBS fetal bovine serum
FITC fluorescein isothiocyanate
FoxM1 forkhead box protein M1
FRET fluorescence resonance energy transfer
GAPDH glyceraldehyde-3-phosphate-dehydrogenase
Gas-1 growth arrest specific 1
Gli glioma-associated oncogene
GRK2 G-protein coupled receptor kinase 2
GSK3β glycogen synthase kinase 3β
GST glutathione-s-transferase
GTP guanosine triphosphate
HA hemagglutinin
HBAH Hank's balanced salt solution
Page 9
ix
HBS Hank's buffered saline
HEK human embryonic kidney
Hh hegdehog
Hhat hegdehog acetyltransferase
Hip1 hedgehog interacting protein 1
HPE holoprosencephaly
IFT intraflagellar transport
Ig immunoglobulin
Ihh indian hedgehog
IR ionizing radiation
Kif3a kinesin-like protein Kif3a
Kif7 kinesin-like protein Kif7
LOH loss of heterozygosity
LRP2 low-density lipoprotein related receptor 2
MEF mouse embryonic fibroblast
MEK mitogen activated protein kinase-kinase
MMTV mouse mammary tumour virus
NALP1 NLR family, pyrin domain containing 1
NBCCS nevoid basal cell carcinoma syndrome
NEDD4 neural precursor cell expressed developmentally down-regulated protein 4
N-Myc N-myc proto-oncogene protein
PACAP pituitary adenylate cyclase-activating polypeptide
PBS phosphate buffered saline
PCR polymerase chain reaction
PDAC pancreatic ductal adenocarcinoma
PEI polyethylenimine
PI3K phosphatidylinositol-3-kinase
PKA protein kinase A
PMSF phenylmethylesulfonyl fluoride
PNGase F peptide-n-glycosidase F
Ptch1 patched-1
Ptch2 patched-2
RNA ribonucleic acid
RNAi ribonucleic acid interference
RND resistance, nodulation, disease
RT reverse transcription
SAG smoothened agonist
SANT-1 smoothened antagonist 1
Scube signal sequence, cubulin domain, EGF-related
SDS sodium-dodecyl-sulfate
SDS-PAGE SDS-polyacrylamide gel electrophoresis
SFK src family kinase
Page 10
x
SH2 src homology 2
SH3 src homology 3
Shh sonic hedgehog
SIX3 homeobox protein SIX3
Smo smoothened
SSD sterol sensing domain
SSP sterol synthesis pathway
Sufu suppressor of fused
TBS tris buffered saline
TGF-β tumour growth factor β
TGIF TGF-β induced factor
TUCAN tumour up-regulated CARD-containing antagonist of caspase-9
UV ultraviolet
WW tryptophan-tryptophan
YFP yellow fluorescent protein
ZIC2 zinc finger protein ZIC2
Page 11
1
Introduction
1 The canonical Hedgehog signalling pathway
Showing conservation of core components from flies to mammals, the Hedgehog (Hh)
signalling pathway is an evolutionarily-conserved signal transduction cascade that plays an
essential role in development by governing cell proliferation, differentiation, and morphogenesis
(Ingham et al., 2011). Well-characterized examples in vertebrates include specifying ventral cell
fate of neural progenitors in the developing neural tube via a ventral to dorsal morphogen
gradient (Dessaud et al., 2008), specifying digit formation along the anterio-posterior axis in the
developing limb bud via a posterior to anterior morphogen gradient (Suzuki, 2013), and driving
proliferation of granule neuron precursors in the developing cerebellum (Vaillant and Monard,
2009). Loss-of-function mutations or genetic aberrations affecting factors promoting pathway
activation result in developmental defects such as holoprosencephaly (Roessler and Muenke,
2010), while ectopic pathway activation is associated with the tumourigenesis of basal cell
carcinoma, medulloblastoma, and rhabdomyosarcoma (Barakat et al., 2010).
Although core pathway components are conserved between Drosophila and vertebrates,
Hh-signalling in vertebrates is dependent on the primary cilium, a microtubule-based organelle
involved in the signal transduction response to the surrounding cellular environment (Goetz and
Anderson, 2010). In the absence of ligand, the primary Hh receptor and negative regulator
Patched-1 (Ptch1) localizes to the primary cilium and represses the activity and ciliary
localization of Smoothened (Smo) (Rohatgi et al., 2007). In response to Hh ligand Ptch1 is
internalized, allowing to Smo to translocate to the primary cilium and promote downstream
signal transduction (Corbit et al., 2005; Rohatgi et al., 2007). This involves the dissociation of a
complex consisting of the downstream negative regulator Suppressor of Fused (Sufu) and either
of the transcription factors glioma-associated oncogene 2 or 3 (Gli2/3), allowing Gli2/3 to
translocate to the nucleus and promote transcription of Hh target genes (Humke et al., 2010;
Tukachinsky et al., 2010).
Page 12
2
1.1 Ligand synthesis and secretion
Mammals possess three Hedgehog family ligands – Sonic Hedgehog (Shh), Desert
Hedgehog (Dhh), and Indian Hedgehog (Ihh) (Echelard et al., 1993). After translation, the signal
peptide of trafficking Hh ligands is removed and the molecule undergoes an autocatalytic
processing event, producing a 19 kDa N-terminal peptide and a 27 kDa C-terminal peptide
(Chang et al., 1994; Lee et al., 1994). A recent study has shown that self-cleavage of the Hh
precursor takes place in the endoplasmic reticulum, and that the C-terminal fragment is
subsequently degraded by the ER-associated degradation pathway (Chen et al., 2011a). The N-
terminal fragment, termed N-Shh, was identified as being responsible for signalling activity in
both flies and vertebrates by early work in Drosophila and the developing chick limb bud and
neural plate (Fietz et al., 1995; López-Martínez et al., 1995; Martí et al., 1995; Porter et al.,
1995). Significance of this cleavage event is emphasized by the fact that many mutations in
human SHH associated with holoprosencephaly are due to disruption of the proper processing
and formation of N-SHH (Maity et al., 2005; Roessler et al., 2009a; Traiffort et al., 2004).
During autoproteolysis, the C-terminal fragment of the full-length Hh molecule mediates
the attachment of a cholesterol moiety to the C-terminus of the N-terminal peptide via an ester
linkage (Porter et al., 1996a, 1996b). In addition to this cholesterol modification, N-Shh is
palmitoylated via an amide linkage at its N-terminal cysteine. This modification results in
increased activity of the ligand, as measured by induction of alkaline phosphatase activity in
C3H10T1/2 cells (Pepinsky et al., 1998). Four independent genetic screens in Drosophila
identified a novel protein sharing homology with transmembrane acetyltransferases whose
mutation did not affect Hh transcription or cleavage, but was required for Hh target gene
expression (Amanai and Jiang, 2001; Chamoun et al., 2001; Lee and Treisman, 2001; Micchelli
et al., 2002). A knockout model of the mouse homolog to this putative acetyltransferase, termed
Hedgehog acetyltransferase (Hhat), resulted in long-range signalling defects in the developing
limb bud and neural tube, which was attributed to the inability of Shh lacking palmitate
modification to form soluble multimers (Chen et al., 2004a). Biochemical evidence that Hhat is a
Shh palmitoylacetyltransferase was provided in a later study which demonstrated in vitro
specificity of Hhat for Shh, and that this modification takes place in the secretory pathway and is
not dependent on autoproteolysis or cholesterol modification of Shh (Buglino and Resh, 2008).
Page 13
3
Initial work using a transgenic mouse expressing only an allele of N-Shh which cannot be
modified with cholesterol suggested that the cholesterol modification is required for long-range
signalling, based on the inability of this mutant allele to specify anterior digits in the developing
limb bud (Lewis et al., 2001). A more recent study contradicted this conclusion by showing that
conditional expression of an allele of N-Shh that cannot be cholesterol modified results in
increased propensity of N-Shh to spread from its site of synthesis (Li et al., 2006). In their
manuscript, Li et al. reason that this discrepancy is a result of a difference in Shh mRNA
stability, and consequently, levels of N-Shh protein expression between the two models. They
propose that the use of a truncating stop codon by Lewis et al. resulted in nonsense-mediated
mRNA decay, as opposed to their model, which utilized conditional deletion of the C-terminal
Shh autoprocessing domain. Biochemical analysis of Shh lipid modification has suggested that
hydrophobic modification of the N-Shh N-terminus increases potency, while cholesterol
modification of the C-terminus promotes cell surface expression (Grover et al., 2011; Taylor et
al., 2001).
More recent studies have furthered the current understanding of the role of lipid
modification in Shh processing and secretion. In vitro studies have shown that both the
cholesterol and palmitate moieties are cleaved prior to release, and that this cleavage is mediated
by a disintegrin and metalloprotease (ADAM) family members (Dierker et al., 2009; Ohlig et al.,
2011). Furthermore, the N-terminal cleavage of the palmitate moiety is especially important.
Although the palmitate modification is required for membrane association and shedding (Ohlig
et al., 2012), N-terminal peptide cleavage is vital to expose the zinc coordination site required for
Ptch1 binding (Ohlig et al., 2011). Additionally, the C-terminal cholesterol moiety and heparin
sulfate proteoglycans (HSPGs) have been implicated in mediating the formation of Shh
multimers at the cell surface (Chang et al., 2011; Ohlig et al., 2011)
A genetic screen in Drosophila yielded the discovery of the twelve-pass transmembrane
sterol sensing domain-containing protein, dispatched (disp), which was shown to be essential for
the release of cholesterol-modified Hh from producing cells (Burke et al., 1999). Subsequent
murine knockout models identified that the first of two mouse disp homologs, Disp1, is essential
for Shh embryonic patterning activity, as Disp1-null mice exhibit embryonic lethality in a
manner similar to that of Smo-null animals (Kawakami et al., 2002; Ma et al., 2002). These
studies also identified a conserved role of Disp1 in the export, but not synthesis or processing of
Page 14
4
cholesterol-modified N-Shh (Kawakami et al., 2002; Ma et al., 2002). Additional work from a
forward genetics ENU screen in mice would produce a Disp1 mutant that identified Disp1 as
being essential for long-range Hh signalling, but not juxtacrine signalling, based on the
observation that, unlike loss-of-function Smo mutants, Shh expression is maintained in the
notochord of Disp1 mutants (Caspary et al., 2002). Further characterization of Disp1 has been
limited, although a recent study has posited that Disp1 functions as a trimer and may have a role
outside of Shh-producing cells for long-range signalling (Etheridge et al., 2010).
The Scube (signal sequence, cubulin domain, EGF-related) family of proteins are
secreted glycoproteins that have been implicated as upstream factors in long-range Hh-signalling
in zebrafish (Hollway et al., 2006; Kawakami et al., 2005; Woods and Talbot, 2005). While early
zebrafish studies focused on scube2, recent work involving knockdown of all three family
members (scube1-3) has determined that the combined activity of all three family members is
essential for Hh signalling in zebrafish (Johnson et al., 2012). The first molecular
characterization of mammalian Scube2 in the context of Hh signalling identified human
SCUBE2 as a positive regulator of Hh signalling in in vitro reporter assays (Tsai et al., 2009).
This group also showed that SCUBE2 is able to complex with PTCH1 and SHH, and that this
association with SHH occurs in caveolin-1-enriched lipid raft microdomains (Tsai et al., 2009).
Recently, more comprehensive molecular analysis has identified a role for Scube2 in the release
of lipid-modified Shh from producing cells, in conjunction with Disp1 (Creanga et al., 2012;
Tukachinsky et al., 2012). Creanga et al. demonstrated that Scube2 mediates the release of N-
Shh from both cultured cell lines and cell-free lipid rafts, and that this release is dependent on
Disp1 expression. Additionally, work from Tukachinsky et al. was able to show through cross-
link assays that Disp1 and Scube2 both associate with the cholesterol moiety of Shh, but at
different locations, establishing the hypothesis that Shh secretion might involve a "hand-off"
mechanism from Disp1 to Scube2.
1.2 Ligand reception
Reception of the Hh signal is mediated by the binding of Hh ligand to the twelve-pass
transmembrane receptor, Patched-1 (Ptch1) (Goodrich et al., 1996; Marigo et al., 1996; Stone et
al., 1996). Ptch1 is essential not only for reception of Hh ligand, but also for inhibiting
Page 15
5
downstream signalling in the absence of ligand, as loss of Ptch1 in mice results in complete
ventralization of the neural tube and embryonic lethality at E9.5 (Goodrich et al., 1997; Hahn et
al., 1998).
In addition to Ptch1, work in both Drosophila and mammals has identified multiple co-
receptors whose activity is required for proper Hh signal transduction. Two of these are cell
adhesion molecule-related/downregulated by oncogenes (Cdo) and brother of Cdo (Boc), which
were discovered as Ig superfamily members involved in myogenic differentiation (Kang et al.,
1997, 2002). The observation that Cdo-/-
mice display microform holoprosencephaly was the first
suggestion of a possible role for these molecules in Hh signalling (Cole and Krauss, 2003).
Subsequent work from the same group identified Cdo as a positive regulator of Hh signalling by
demonstrating downregulation of Shh target genes in the developing forebrain of Cdo-/-
mice, as
well as in vitro reporter assays that showed an increased Hh response in the presence of Cdo
(Zhang et al., 2006). Additionally, ectopic expression of Boc and Cdo in chick neural tube
induced ventral cell fate. Both molecules were shown further to be capable of binding Shh via
their fibronectin repeats, strongly suggesting that Boc and Cdo function as positive regulators of
Hh signal transduction (Okada et al., 2006; Tenzen et al., 2006).
Growth arrest specific gene 1 (Gas-1) was first implicated in Hh signalling in a screen for
molecules capable of interacting with Shh at the cell surface (Lee et al., 2001). In addition to
being capable of binding Shh, initial work in vitro first suggested that Gas-1 functioned as a
negative regulator of Hh signalling (Cobourne et al., 2004; Lee et al., 2001). However, later
genetic and in vitro analyses contradicted this result, and establish Gas-1 as a positive regulator
of vertebrate Hh signalling (Allen et al., 2007; Martinelli and Fan, 2007; Seppala et al., 2007).
Analyses of Gas-1-/-
mice demonstrated craniofacial and limb defects associated with reduced
Shh signalling that were exacerbated in Gas-1-/-
mice missing one Shh allele; furthermore,
ectopic expression of Gas-1 in chick neural tube resulted in induction of Shh-dependent cell fate
(Allen et al., 2007; Martinelli and Fan, 2007; Seppala et al., 2007). Additionally, mutations in
either SHH or GAS-1 that disrupt the SHH-GAS-1 interaction have been identified in
holoprosencephaly patients, further suggesting a positive role in Hh signalling for GAS-1
(Martinelli and Fan, 2009; Pineda-Alvarez et al., 2012).
Page 16
6
Analysis of mice deficient for two or more of Cdo, Boc, and Gas-1 has provided further
insight into the co-receptor requirements for proper Shh signal transduction. Compound Cdo-/-
Gas-1-/-
mice display a severe increase in craniofacial abnormalities compared to single mutants,
yet they still possess an intact notochord, suggesting that there is not a complete loss of Shh
signalling (Allen et al., 2007). Furthermore, a study of Cdo-/-
Boc-/-
mice demonstrated that, while
loss of Boc does not result in holoprosencephaly, loss simultaneously of Boc and Cdo results in a
more severe holoprosencephaly phenotype than that exhibited by Cdo-/-
mice (Zhang et al.,
2011). Despite this, the holoprosencephaly phenotype displayed by compound Cdo-/-
Boc-/-
mice
is not as severe as that of Shh-/-
animals, indicating that there is not complete abrogation of Shh
signalling (Zhang et al., 2011). A study of Boc-/-
Gas-1-/-
cerebellar granular neural progenitors,
which lack endogenous Cdo expression, showed that lack of the three co-receptors resulted in a
complete inability to proliferate in response to Shh (Izzi et al., 2011). Biochemical analysis by
the same group also demonstrated that Gas-1 and Boc form distinct receptor complexes with
Ptch1, in line with a previous study that identified synergy between Ptch1 and Gas-1 or Cdo, but
not Cdo and Gas-1 (Izzi et al., 2011; Martinelli and Fan, 2007). Finally, a study of compound
Boc-/-
Cdo-/-
Gas-1-/-
mice demonstrated that the three co-receptors are essential for Shh signal
transduction in vertebrates, as the triple-deficient mice display severe developmental defects
similar to Shh-/-
Ihh-/-
and Smo-/-
animals, and are embryonic lethal by E9.5 (Allen et al., 2011).
The first piece of evidence suggesting a possible role for megalin/LRP2 (low-density
lipoprotein related receptor 2) in Hh signalling came from the observation that LRP2-/-
mice
display holoprosencephaly (Willnow et al., 1996). Later biochemical and genetic work would
then demonstrate that N-Shh can bind LRP2 in vitro, and that conditional knockout of LRP2
results in loss of Shh expression in the ventral forebrain (McCarthy et al., 2002; Spoelgen et al.,
2005). While further characterization of the role of LRP2 in Hh signalling has been limited, a
recent study has shown that LRP2 is required for Shh signalling in the murine forebrain
neuroepithelium, and that in vitro expression of recombinant LRP2 can increase Hh reporter
activity in a manner similar to Boc and Cdo (Christ et al., 2012).
Discovered in a biochemical screen for mouse limb bud cDNA library products capable
of binding mammalian Hh ligands, Hip1 (Hedgehog interacting protein 1) was identified as a
transmembrane protein that is upregulated in response to Shh stimulation (Chuang and
McMahon, 1999). Additionally, the observation that overexpression of Hip1 in chondrocytes
Page 17
7
impairs Ihh signalling led to the postulation that the primary function of Hip1 is sequestration of
Hh ligands and attenuation of signal transduction (Chuang and McMahon, 1999). While the
murine knockout of Hip1 did not reveal any defects in limb bud or neural tube patterning,
possibly due to functional redundancy with Ptch1, they did display defects in lung branching,
indicating a tissue-specific requirement for Hip1 function (Chuang et al., 2003).
Taken together, this information indicates that while Ptch1 is essential for reception of
Hh ligand, the tissue-specific expression of both positive and negative co-receptors and
regulators is also critical for proper Hh signal transduction.
1.3 Signal transduction through Smoothened
The seven-pass transmembrane protein Smoothened (Smo) is an essential component of
the Hh machinery, and is responsible for transducing signalling by Hh ligands in both Drosophila
and vertebrates (Alcedo et al., 1996; van den Heuvel and Ingham, 1996; Murone et al., 1999).
Loss of Smo in mice results in severe developmental defects resembling Shh-/-
Ihh-/-
double
mutants, indicating complete loss of Hh signalling activity (Zhang et al., 2001). In the absence of
Shh ligand, Smo activity is indirectly repressed by sub-stoichiometric amounts of Ptch1 (Taipale
et al., 2002). Upon reception of Shh ligand, Ptch1 is internalized and Smo traffics to the primary
cilium and promotes downstream Hh transcriptional activation (Corbit et al., 2005; Rohatgi et
al., 2007).
Multiple studies have shown that the primary cilium is essential for both Smo function
and downstream Hh signal transduction. Both ciliary assembly and the trafficking of cilia-
localized proteins are dependent upon the function of two multi-protein intraflagellar transport
(IFT) complexes, IFT-A and IFT-B (Cole et al., 1998; Follit et al., 2009; Taschner et al., 2012).
IFT-B is typically associated with anterograde transport, while IFT-A is typically associated with
retrograde transport (Taschner et al., 2012). Loss of either of the anterograde IFT-B components
IFT172 or IFT88, or the anterograde motor kinesin Kif3A, results in loss of cilia formation and
loss of the ability to respond to Hh ligand (Huangfu et al., 2003; Kolpakova-Hart et al., 2007;
Liu et al., 2005; Ocbina and Anderson, 2008). Interestingly, loss of the IFT-B component IFT25
Page 18
8
does not produce any defects in cilia assembly, but results in impaired ciliary export of Smo,
indicating a role for IFT-B in retrograde transport (Keady et al., 2012).
Loss of function of the retrograde motor component Dync2h1 results in constitutive
localization of Smo to the primary cilium, but loss of Hh signalling, indicating that Smo traffics
transiently in and out of the cilium in the absence of stimulation, and that retrograde IFT activity
is required for its exit (Kim et al., 2009a; Ocbina and Anderson, 2008; Ocbina et al., 2011). In
the absence of the small GTPase Arl13b, Smo displays constitutive ciliary localization with a
muted ability to transduce signal, while loss of the IFT-A component IFT144 prevents both Smo
and Arl13b from localizing to cilia, indicating a potential role for IFT-A in anterograde transport
(Larkins et al., 2011; Liem et al., 2012). Additionally, proper ciliary localization of Smo has
been shown to require the ciliary membrane diffusion barrier protein Septin 2, the transition
zone-localized Tctn1, and the Bardet-Biedl Syndrome (BBS) complex (Garcia-Gonzalo et al.,
2011; Hu et al., 2010; Zhang et al., 2012). Altogether this information indicates that the ciliary
trafficking of Smo is dependent upon complex interactions between ciliary machinery
components, yet further work is required to deduce the complete mechanism, since disruption of
core components that impair cilia assembly makes it difficult to distinguish specific defects in
Hh transduction from general defects in cilia integrity.
Recent in vitro analysis has shed more light on the mechanism of Smo activation in
response to Shh ligand. Multiple studies have demonstrated that translocation of Smo to the
primary cilium is an essential step for pathway activation (Corbit et al., 2005; Kovacs et al.,
2008). Furthermore, this process is dependent on the ability of Smo to form a complex with β-
arrestin 1 or 2, and the kinesin Kif3A (Kovacs et al., 2008). Although translocation of Smo to the
primary cilium is necessary for downstream signalling, multiple studies have shown that it is not
sufficient. The small-molecule Smo inhibitors cyclopamine (Taipale et al., 2000) and SANT-1
(Chen et al., 2002) have been used to demonstrate differential trafficking of inactive Smo,
SANT-1 preventing ciliary localization and while cyclopamine induces it, indicating that a
conformational switch is required for Smo activation in addition to ciliary localization (Rohatgi
et al., 2009; Wang et al., 2009; Wilson et al., 2009). These data support previous FRET analysis
showing a conformational switch in Smo in response to Shh stimulation (Zhao et al., 2007).
Moreover, recent studies have indicated that Smo exists both on the cell surface and in
intracellular vesicles in the absence of ligand, and that upon Shh stimulation Smo on the cell
Page 19
9
surface translocates laterally to the primary cilium before intracellular Smo (Milenkovic et al.,
2009; Wang et al., 2009; Wu et al., 2012).
Phosphorylation of the Smo C-terminus by protein kinase A (PKA) and casein kinase I
(CKI) is a critical event in Hh signal transduction in Drosophila. However, these C-terminal
PKA phosphorylation sites are not conserved in vertebrate Smo (Apionishev et al., 2005; Jia et
al., 2004; Zhao et al., 2007). Regardless, multiple studies have suggested that phosphorylation of
vertebrate Smo is a critical step in its activation. G-protein coupled receptor kinase 2 (GRK2)
phosphorylates exogenous Smo, and acts as a positive regulator of Shh signalling in in vitro
reporter assays (Chen et al., 2004b; Meloni et al., 2006; Philipp et al., 2008). Additionally, casein
kinase 1α (CK1α) was suggested to act as a positive regulator of mammalian Hh signalling by a
kinome siRNA library screen (Evangelista et al., 2008). Recently, a comprehensive molecular
analysis assessing the role of GRK2 and CK1α identified that the two kinases phosphorylate the
C-terminus of Smo and regulate its conformation and activity in response to Shh ligand, and that
these phosphorylation events are dependent on Kif3A (Chen et al., 2011b). Although this group
used a phospho-specific Smo antibody to identify Smo phosphorylation, exogenous expression
of Smo was required for detection, hence phosphorylation of endogenous mammalian Smo in
response to Hh ligand has yet to be confirmed.
Insight into Shh signal transduction immediately downstream of Smo has been gained
from recent work focused on the molecular mechanisms behind the autosomal recessive skeletal
dysplasia, Ellis-van Creveld syndrome (Ruiz-Perez et al., 2000). Ellis-van Creveld syndrome
arises from mutation of one or both of the transmembrane proteins EVC or EVC2 (Galdzicka et
al., 2002; Ruiz-Perez et al., 2000). Analysis of mice deficient for the murine homolog, Evc,
revealed a function for Evc downstream of Smo in the response to Ihh stimulation, and that Evc
localizes to the primary cilium (Ruiz-Perez et al., 2007). Subsequent in vitro work demonstrated
Evc2 to also be a positive regulator of Hh signalling, and that Evc and Evc2 co-localize at the
basal body of the primary cilium in a co-dependent manner (Blair et al., 2011).
Recent molecular analysis from multiple groups has confirmed that Evc/Evc2 are capable
of complexing with, yet function downstream of Smo, as loss of expression of either protein does
not impair Smo localization, but results in attenuation of downstream signalling (Caparrós-
Martín et al., 2013; Dorn et al., 2012; Yang et al., 2012). Additionally, Evc was shown to
Page 20
10
promote dissociation of Sufu and Gli3, despite not co-immmunoprecipitating with either
(Caparrós-Martín et al., 2013). A more detailed focus on the localization of Evc/Evc2 suggested
that they do not localize to the ciliary basal body, but instead adjacent to the transition zone
(Dorn et al., 2012). One unresolved issue with the molecular studies to date is the effect of
Evc/Evc2 loss or overexpression in the absence of Sufu expression. Work from two groups
employing RNAi knockdown of Evc/Evc2 or overexpression of Evc2 in Sufu-/-
MEFs displayed
no apparent change in downstream Hh signalling in response to changes in Evc/Evc2 expression,
indicating that Evc/Evc2 function entirely upstream of Sufu (Dorn et al., 2012; Yang et al.,
2012). However, results from RNAi knockdown of Evc or Evc2 in Sufu-/-
MEFs by a third group
showed a decrease in Hh activity in response to loss of Evc/Evc2, suggesting that Evc/Evc2 may
also possess function downstream of Sufu (Caparrós-Martín et al., 2013).
While the characterization of Evc/Evc2 represents a step forward in identifying the
mechanistic link between Smo activation and Gli-mediated transcription, the tissue-specific
effects exhibited by knockout animals indicate that in other tissues, different molecules are likely
responsible for this link. There may also exist entirely different mechanisms of transduction from
Smo to Sufu and Gli that are not present in cells expressing Evc/Evc2.
1.4 Control of Gli-mediated transcriptional regulation
Transcription of Hh target genes in vertebrates is mediated by the Gli family of
transcription factors (Ruppert et al., 1988). Mammals possess three family members – Gli1, Gli2,
and Gli3. Gli2 and Gli3 are the main mediators of activation and repression of Hh target genes,
respectively (Bai et al., 2002; Ding et al., 1998; Lipinski et al., 2006; Litingtung et al., 2002;
Sasaki et al., 1997; Wang et al., 2000; te Welscher et al., 2002; Wijgerde et al., 2002). Evidence
exists that Gli3 also possesses weak activating capabilities and that Gli2 possesses weak
repressing capabilities, both often only becoming apparent in the absence of the other family
member (Bai et al., 2004; Buttitta et al., 2003; McDermott et al., 2005; Mo et al., 1997;
Motoyama et al., 1998a, 2003). The ability of Gli-proteins to act as transcriptional activators
depends on the presence of a C-terminal activation domain, and truncation of this domain results
in the formation of N-terminal Gli repressor (Gli-R) (Sasaki et al., 1999). Gli1 lacks an N-
terminal repressor domain and can therefore only function as an activator (Dai et al., 1999).
Page 21
11
Furthermore, Gli1 is dispensable for mammalian development, as Gli1-/-
mice are viable and
maintain a normal appearance (Park et al., 2000).
In addition to Ptch1, two other regulating factors promote repression of mammalian Hh
signalling in the absence of ligand, both by exerting direct influence on Gli-family transcription
factors. The first of these is Suppressor of Fused (Sufu), which initial in vitro work demonstrated
as being able to bind Gli1, Gli2, and Gli3, as well as downregulate Hh activity upon
overexpression, presumably by sequestering the Gli proteins in the cytoplasm (Ding et al., 1999;
Kogerman et al., 1999). Subsequent murine knockout models revealed that Sufu is an essential
Hh pathway component, as Sufu-/-
mice exhibit embryonic lethality at 9.5 dpc with severe neural
tube defects in a manner similar to Ptch1-/-
mice (Cooper et al., 2005; Svärd et al., 2006). The
other negative regulator of mammalian Hh signalling is Protein Kinase A (PKA) (Epstein et al.,
1996; Huang et al., 2002; Wang et al., 2000). Mice with complete loss of PKA activity display
ectopic Hh pathway activation resulting in severe neural tube defects and embryonic lethality at
9 dpc, akin to Ptch1-/-
and Sufu-/-
animals (Tuson et al., 2011).
Formation of Gli-R requires initial phosphorylation of full-length Gli by PKA, which
allows for subsequent phosphorylation by glycogen synthase kinase 3β (GSK3β) and casein
kinase 1 (CK1) (Tempe et al., 2006; Wang and Li, 2006; Wang et al., 2000). Additionally, the
recruitment of GSK3β has been shown to be mediated by Sufu (Kise et al., 2009).
Phosphorylated Gli is then recognized by the β-transducin repeat containing protein (β-TrCP) E3
ubiquitin ligase, ubiquitylated, and processed by the proteasome (Tempe et al., 2006; Wang and
Li, 2006). While Gli3 is preferentially processed to its repressor form, the processing of Gli2 is
much less efficient, resulting in complete proteasomal degradation (Bhatia et al., 2006; Pan et al.,
2006). In vitro analysis identified that the difference in processing between Gli2 and Gli3 is due
to differences in a C-terminal domain that determines partial or complete proteasomal
degradation, termed the processing determinant domain (PDD) (Pan and Wang, 2007). Like
Ptch1 and Smo, the Gli-proteins and Sufu display dynamic localization to the primary cilium,
and mutations in both anterograde and retrograde ciliary machinery components impair proper
Gli2/3 processing and trafficking (Haycraft et al., 2005; Huangfu and Anderson, 2005; Keady et
al., 2012; Liu et al., 2005; Qin et al., 2011). Recent genetic experiments have also shown that
cilia integrity is vital for PKA function, as mice with a partial loss of PKA and a complete loss of
IFT172 exhibit a complete loss of Hh signalling akin to IFT172-/-
mice, instead of the increased
Page 22
12
pathway activation produced by loss of PKA activity (Tuson et al., 2011). Conversely, studies
using Kif3A-/-
and IFT88-/-
MEFs have demonstrated that the repressive function of Sufu is
maintained in the absence of cilia formation (Chen et al., 2009; Jia et al., 2009).
Recent in vitro work using endogenous protein has provided new information on the
mechanism of Gli-mediated transcriptional activation in response to Shh ligand. These studies
determined that Shh ligand stimulation results in the trafficking of a Sufu-full length Gli complex
to the tip of the primary cilium and the dissociation of the Sufu-Gli interaction, allowing Gli to
traffic to the nucleus (Humke et al., 2010; Tukachinsky et al., 2010). This event requires active,
cilia-localized Smo, and the trafficking of Sufu is dependent on the presence of Gli (Chen et al.,
2011c; Kim et al., 2009a; Tukachinsky et al., 2010; Zeng et al., 2010). Furthermore, analysis of
Gli stability has demonstrated that the Sufu-Gli interaction is required to maintain stability of
full-length Gli2 and Gli3, as they are both degraded at a faster rate than Gli3-R in response to
Shh ligand or in cells lacking Sufu expression (Humke et al., 2010; Wang et al., 2010; Wen et
al., 2010). Overexpression and knockdown assays in cultured cells have demonstrated that the
degradation of full-length Gli proteins is mediated by the speckle-type POZ protein (SPOP)-
Cullin3 (Cul3) E3 ubiquitin ligase complex (Chen et al., 2009; Wang et al., 2010; Wen et al.,
2010). Additionally, SPOP is also capable of mediating the processing of Gli3 to its repressor
form in the presence of Sufu (Wang et al., 2010).
While experiments in NIH-3T3 cells using the adenylate cyclase activator forskolin as a
means of activating PKA displayed a prevention of Shh-induced ciliary localization of Gli2/3,
the same experiment performed in PKA-/-
MEFs showed that the translocation of Gli2 to the tip
of the primary cilium was also blocked (Tukachinsky et al., 2010; Tuson et al., 2011).
Furthermore, Gli2/3 deletion analysis has demonstrated that loss of PKA phosphorylation sites
does not prevent the forskolin-induced block in ciliary localization (Zeng et al., 2010). Taken
together, these data indicate that the forskolin-mediated block in ciliary Gli trafficking is at least
partially independent of PKA activity. Although the effects of forskolin treatment on Gli2/3
trafficking are difficult to interpret, recent work in cerebellar granule cell progenitors (cGCP),
using a combination of phospho-specific antibodies and chemical inhibitors, showed that
treatment with pituitary adenylate cyclase-activating polypeptide (PACAP) antagonizes both Shh
target expression and SAG-induced Gli2 ciliary localization via activation of PKA
(Niewiadomski et al., 2013). Moreover, work from the same study has also suggested that Shh
Page 23
13
stimulation modulates only a specific compartment of PKA activity, as treatment of cGCPs with
both N-Shh and a reduced dose of PACAP results in both Hh target transcription and increased
levels of total PKA activity. The intuitive hypothesis would be that Shh only affects the activity
of cilia-associated PKA, as PKA has been shown to localize to the base of the cilium (Barzi et
al., 2010; Tuson et al., 2011).
Identification of the G-protein coupled receptor Gpr161 has provided a potential link
between PKA activity, Shh stimulation, and the primary cilium. Gpr161 localizes to the primary
cilium in an IFT-A-dependent manner where it increases intracellular cAMP levels, thereby
negatively regulating Hh signalling through the assumed activation of PKA (Mukhopadhyay et
al., 2013). Furthermore, Gpr161 is internalized upon Hh stimulation, providing a potential
mechanism for PKA inhibition in response to Hh ligand (Mukhopadhyay et al., 2013). Despite
these observatoins, additional work will be required to identify specific modulation of PKA
activity by Gpr161.
Another factor involved in the regulation of Gli-mediated transcription is the kinesin
Kif7, which is one of two mammalian homologs of the essential Drosophila Hh factor, Costal2
(Cos2) (Varjosalo et al., 2006). While initial in vitro studies using NIH-3T3 cells and involving
overexpression and RNAi knockdown did not indicate a role for Kif7 in mammalian Hh
signalling, subsequent genetic and cell-based experiments identified it as being a critical
regulator with tissue-specific negative and positive functions (Varjosalo et al., 2006). Kif7-/-
mice
exhibit polydactyly and exencephaly similar to the phenotype of Gli3-/-
animals; furthermore,
biochemical analysis of Kif7-/-
embryos identified a decreased Gli3R/Gli3Fl ratio, indicating a
role for Kif7 in the production of Gli3-R (Cheung et al., 2009; Endoh-Yamagami et al., 2009;
Liem et al., 2009). Kif7 function is dependent upon the primary cilia, as mice possessing
mutations in Kif7 and IFT172 exhibit a complete loss of Hh signalling, phenocopying IFT172
single mutants (Liem et al., 2009). Experiments performed in whole embryo lysates and MEFs,
respectively, showed that Kif7 is capable of binding Gli2/3 and promotes the Smo-dependent
trafficking of, and travels with, Gli2/3 to the cilia tip in response to pathway stimulation, further
suggesting a role for Kif7 in Gli processing (Cheung et al., 2009; Endoh-Yamagami et al., 2009).
In contrast to work in fibroblasts, studies employing other cell types have indicated a
positive role for Kif7 in Hh signalling. Experiments in proliferating Kif7-/-
chondrocytes
Page 24
14
identified an increased amount of Gli2/3 and Sufu at the cilia tip as compared to wild type cells
(Hsu et al., 2011). The same study would also demonstrate an increased amount of complexed
Sufu and Gli2 in Kif7-/-
chondrocytes, suggesting that Kif7 is required for the dissociation of
Sufu and Gli2. Additionally, loss of Kif7 was associated with increased Sufu protein levels,
indicating that Kif7 may also function as a positive regulator by controlling Sufu stability.
Recent work in keratinocytes has also demonstrated a positive role for Kif7 in the dissociation of
Sufu and Gli2 (Li et al., 2012). Multiple studies have also presented genetic evidence for the
ability of Kif7 to function as a positive regulator, as compound loss of Kif7 partially rescues the
complete neural tube ventralization observed in Ptch1-/-
mice (Law et al., 2012; Liem et al.,
2009). While the precise mechanism of Kif7 function is not fully elucidated, current
understanding proposes a model in which Kif7 can act as a tissue-specific positive or negative
regulator of mammalian Hh signalling based on its ability to regulate the trafficking and
processing of Gli2/3 and Sufu.
Taken together, the control of Gli-mediated transcription involves a complex network of
regulatory factors acting in concert to produce processed Gli activator or repressor. The integrity
of the primary cilium and the trafficking of Gli2/3 to the tip of the primary cilium are both
essential for proper Gli processing. The dissociation of the Sufu-Gli complex in response to
ligand is also a crucial event, and current knowledge suggests that in addition to ciliary-localized
activated Smo, Kif7 and, in some tissues, Evc/Evc2 are involved in this process.
1.5 Transcription of Hedgehog target genes
Gli transcription factors control the tissue-specific regulation of genes involved in cell
proliferation, differentiation, survival, and migration, and examples include Cyclins D1, D2, and
E; N-Myc; Bcl-2; FoxM1; and osteopontin (Kenney and Rowitch, 2000; Kenney et al., 2003;
Regl et al., 2004; Teh et al., 2002; Yoon et al., 2002). Additionally, several Hh pathway
components are themselves regulated by pathway stimulation. Gli1 is a well-characterized
universal target that is upregulated in response to signalling, demonstrating a positive feedback
mechanism (Dai et al., 1999). Conversely, Ptch1, Ptch2, and Hip1 are upregulated, while Boc,
Cdo, and Gas-1 are downregulated in response to signalling, producing a negative feedback
response (Agren et al., 2004; Chuang and McMahon, 1999; Martinelli and Fan, 2007; Rahnama
Page 25
15
et al., 2004; Tenzen et al., 2006). Together these feedback mechanisms allow for increased
control of both the initial response and the ability to respond to future stimulation.
2 Ptch1 structure and function
2.1 Molecular characterization
Murine Ptch1 is a 1434 amino acid predicted 12-pass transmembrane protein that is
encoded by a 23-exon 4305bp mRNA transcript (Goodrich et al., 1996; Stone et al., 1996). The
predicted topology of Ptch1 is characterized by a cytoplasmic N-terminal domain (residues 1-
86), two large extracellular loops (residues 108-422 and 756-1013), one large intracellular loop
(residues 585-734), and a cytoplasmic C-terminal tail (residues 1162-1434). Deletion analysis
showed that loss of either extracellular loop abolishes the ability to bind Shh in vitro (Marigo et
al., 1996). Furthermore, experiments in both cultured fibroblasts and chick neural tube further
demonstrated that deletion of the second extracellular loop produces a Hh-insensitive dominant-
negative variant that retains Smo-inhibitory activity (Briscoe et al., 2001; Taipale et al., 2002).
2.1.1 The sterol sensing domain
The predicted topology of Ptch1 resembles bacterial resistance, nodulation, and disease
(RND) transporters, which are multi-pass transmembrane proton motive force efflux pumps
associated with the transport of heavy metals and hydrophobic compounds (Tseng et al., 1999).
Additionally, Ptch1 also shares homology with eukaryotic multi-pass transmembrane proteins
involved in cholesterol transport via its sterol sensing domain (SSD), which spans from its
second to fifth transmembrane helices (Chang et al., 2006; Tseng et al., 1999). Various mutations
in the SSD of the Ptch1-related protein involved in the lipid storage disorder Niemann-Pick Type
C disease (NPC1) produce both gain- and loss-of-function effects on its ability to transport
cholesterol out of lysosomes and late endosomes (Millard et al., 2005).
Multiple studies assessing the effect of missense mutations in the SSD on Drosophila
Ptch function have identified the conference of dominant negative activity. Drosophila Ptch-SSD
mutants retain the ability to bind Hh, but lose the ability to repress Smo (Hime et al 2
art n et al 2 1 Strutt et al 2 1). Furthermore, these studies also indicated that certain
Page 26
16
Drosophila Ptch-SSD mutants can activate Hh signalling in the absence of ligand, as expression
of SSD mutants in cells that typically do not receive Hh ligand causes activation of Hh pathway
targets (Strutt et al., 2001).
An analysis of SSD mutations in mammalian Ptch1 identified via luciferase reporter
assays in a Ptch1-/- MEF-derived cell line that missense mutations in the SSD can abolish the
repressive function of Ptch1 (Taipale et al., 2002). Because these experiments were performed in
the absence of endogenous Ptch1 expression, the potential for these Ptch1-mutants to function as
dominant-negatives was not assessed. One study focusing specifically on characterizing a
truncation-producing Ptch1 mutation, first identified in basal cell carcinoma patients, suggested
that the SSD of mammalian Ptch1 can also confer dominant negative activity (Barnes et al.,
2005). The Q688X mutation produces a truncation in the middle intracellular loop just after the
fifth transmembrane domain, truncating the C-terminal half of the molecule but leaving an intact
SSD. Overexpression of this mutant in NIH-3T3 cells resulted in an increase in pathway
activation in the absence of Shh ligand; however, the relative expression levels of mutant and
endogenous Ptch1 were not taken into account (Barnes et al., 2005). This deficiency leaves the
possibility that a gross excess of non-functional Q688X impaired the trafficking of endogenous
Ptch1, thereby producing an apparent dominant negative phenomenon.
2.1.2 Ptch1 splice variants
The existence of alternative first exons and 5`splicing events has been identified for both
human PTCH1 and murine Ptch1, providing insight into the role of the cytoplasmic N-terminus
in Ptch1 function. Both human PTCH1 and murine Ptch1 possess 5 first exons termed, in the 5'
to 3' direction, exons 1A-1E (Nagao et al., 2005a). Two of these exons (1A & 1C) possess
alternative splice sites in humans; furthermore, the skipping of exon 2 has been characterized for
isoforms containing exon 1A, resulting in nine identified PTCH1 5`splice variants (Nagao et al.,
2005a; Shimokawa et al., 2007). Together, these nine isoforms result in four protein isoforms
that differ in their N-terminal amino acid sequence. The protein isoform resulting from
transcripts containing exons 1C, 1D, or 1E, lack the first 152 residues of full-length PTCH1, and
subsequently, the first transmembrane domain (Nagao et al., 2005a). This isoform exhibits
decreased protein stability, as well as a decreased ability to repress Smo activity in luciferase
reporter assays compared to the other three isoforms (Nagao et al., 2005a; Shimokawa et al.,
Page 27
17
2007). The protein isoforms resulting from transcripts containing exons 1A or 1B are both
upregulated in response to Shh signalling, and those from exon 1B-containing transcripts display
the strongest repressive function (Kogerman et al., 2002; Shimokawa et al., 2004, 2007). Taken
together, these data indicate that the presence of the first transmembrane domain is important for
PTCH1 repressive function as well as protein stability and that the former may be a product of
the latter. Furthermore, Shh signalling results in the upregulation of the 5' PTCH1 splice variants
encoding the protein isoforms that possess the strongest repressive capability.
In addition to 5' alternative splicing events, an alternative exon 12, termed exon 12B, was
identified in human and murine Ptch1 (Nagao et al., 2005b). This exon contains an in-frame stop
codon, and its incorporation results in a truncated PTCH1 protein containing only the first 607
amino acids. The truncation occurs in the middle intracellular loop, just after the SSD, similar to
the aforementioned Q688X mutant. Co-expression of this PTCH1 variant with an equal amount
of wild type PTCH1 resulted in Gli-luciferase reporter activity above that of wild type PTCH1
by itself, and similar to the elevated levels of PTCH1-exon12B by itself, indicating dominant
negative activity of this truncated variant (Uchikawa et al., 2006).
2.1.3 Function of the Ptch1 C-terminus
Initial analysis of the role of the Ptc C-terminus in Drosophila identified that truncation of
the C-terminus produced ligand-independent pathway activation, yet maintained Hh-binding
capability (Johnson et al., 2000). A later study in Drosophila supported this result, but also
showed through FRET and co-immunoprecipitation that full length Drosophila Ptc, Ptc with a C-
terminal truncation, or the isolated C-terminus itself are all capable of forming trimers when
overexpressed (Lu et al., 2006). This study also demonstrated that truncation of the C-terminus
or mutation of a C-terminal Nedd4 ubiquitin ligase-binding site confers protein stability. The
extent of conservation of Ptch1 function between Drosophila and mammals is currently
unknown, since the precise mechanism of Ptch1 repression remains undefined and Hh signalling
in Drosophila does not depend on the primary cilium. Despite these limitations, one study
demonstrated that stable expression of human PTCH1 in Drosophila S2 cells that had
endogenous Ptc knocked-down resulted in a rescue of both Smo repression and the upstream
response to Hh, suggesting that human PTCH1 and Drosophila Ptc share conserved functions
(De Rivoyre et al., 2006).
Page 28
18
Although the trimerization of mammalian Ptch1 has not yet been identified, a group
working with Ptch1-/-
MEFs demonstrated that viral co-expression of the isolated, truncated, C-
and N-terminal halves of the molecule restores Ptch1 repressive function, while expression of
either individual C- or N-terminal half does not (Bailey et al., 2002). These data suggest that the
two halves of the Ptch1 protein can assemble into a functional conformation via non-covalent
interactions, supporting the possibility of functioning as a multimer. Analysis of the contribution
of the murine Ptch1 C-terminus to protein stability has shown through cyloheximide experiments
that, like in Drosophila, loss of the C-terminus confers stability under conditions of
overexpression, and that mutation of a conserved C-terminal PPPY motif also confers stability
(Kawamura et al., 2008).
Further insight into the role of the Ptch1 C-terminus in mice has been gained from
analysis of the spontaneous mesenchymal dysplasia (mes) mutant (Sweet et al., 1996). The mes
mutation constitutes a 32bp deletion in the C-terminus of Ptch1, resulting in the last 220 amino
acids being replaced by a 68 amino acid nonsense peptide (Makino et al., 2001). Homozygous
mes mice are viable and do not display abnormalities in neural tube development, but do exhibit
pre-axial polydactyly and increased body weight (Makino et al., 2001), characteristics that are
indicative of ectopic Hh signalling in the absence of Ptch1 (Milenkovic et al., 1999). Thus, mes
appears to function as a tissue-specific, hypomorphic allele of Ptch1. The limited molecular
analysis performed to date also supports this contention, with elevated steady state levels of Hh
target genes in mes mice being identified in epididymal white adipose tissue (Li et al., 2008a),
but not in total skin (Nieuwenhuis et al., 2007).
2.2 Mechanism of Smoothened inhibition
Taking into consideration that Ptch1 possesses a sterol sensing domain, that missense
mutation of select SSD residues attenuates repressive function, that Smo activity can be
modulated by steroidal alkaloids, and that genetic loss of key sterol synthesis pathway (SSP)
components results in holoprosencephaly, multiple studies have been performed to assess the
role of cholesterol derivatives in Hh signal transduction (Taipale et al., 2000, 2002; Wassif et al.,
1998; Waterham et al., 2001).
Page 29
19
Early experiments investigating the effects of cholesterol depletion on Hh signalling
identified that both pharmacological depletion and genetic loss of cholesterol biosynthesis
inhibited the ability of fibroblasts to respond to Shh stimulation (Cooper et al., 2003).
Furthermore, this effect was shown to depend on events occurring between Ptch1 and Smo, as
cholesterol depletion inhibited the constitutive pathway activation displayed by Ptch1-/-
MEFs,
but not that of cells expressing a constitutively active Smo mutant (Cooper et al., 2003). Studies
following this would show that stimulation of fibroblasts or medulloblastoma cells with select
oxysterols induced Smo ciliary localization and Hh target gene activation (Corcoran and Scott,
2006; Dwyer et al., 2007; Rohatgi et al., 2007). Additionally, Corcoran and Scott employed the
use of multiple SSP inhibitors to confirm that it is in fact a cholesterol derivative that is required
for Hh pathway activation, since blocking the conversion of cholesterol to steroid precursors or
supplementing with the steroid precursor pregnenolone did not affect Hh pathway activity
(Corcoran and Scott, 2006).
While Dwyer et al. demonstrated through the use of Smo-/-
MEFs that the activation of
Hh signalling in response to oxysterols is Smo-dependent, they hypothesized that oxysterols are
unlikely to act directly on Smo, since the oxysterol mixture they employed did not compete with
a fluorescently-labelled cyclopamine derivative for Smo binding (Dwyer et al., 2007). However,
a later study from Nachtergaele et al. presented multiple lines of evidence that oxysterols act via
a direct interaction with Smo, the strongest being the ability of a magnetic bead-conjugated 20-S-
hydroxycholesterol (20-S-OHC) derivative to bind Smo in vitro (Nachtergaele et al., 2012). The
same group also observed that the target of 20-S-OHC is enantioselective, which supports a
protein target since lipid interactions typically don't depend on stereochemistry (Mannock et al.,
2003; Westover et al., 2003). The observation that 20-S-OHC and Smoothened agonist (SAG)
show synergistic activation of Hh signalling lent further support to the existence of a separate
binding site for oxysterols that is distinct from the site occupied by the characterized modulators
cyclopamine, SANT-1, and SAG (Nachtergaele et al., 2012). Indeed, a recent comprehensive
molecular analysis has confirmed this by demonstrating that oxysterols bind the cysteine-rich N-
terminus of Smo, as opposed to the heptahelical bundle site occupied by cyclopamine (Nedelcu
et al., 2013). Interestingly, mutation of the Smo residues required for oxysterol binding
decreased, but did not abolish, the ability of re-constituted Smo-/-
MEFs to respond to Shh
stimulation (Nedelcu et al., 2013). This suggests that Ptch1 regulates Smo through the control of
Page 30
20
at least two separate mechanisms – one acting on the cysteine-rich N-terminus, and perhaps
another through the cyclopamine-binding site.
Although the inhibitory function of Ptch1 is assumed to be cell-autonomous, one study
has suggested otherwise. This group used overexpressed Smo and Gli-reporter plasmids in a pool
of reporter cells to measure the Hh response to treatment with conditioned media from
C3H10T1/2 fibroblasts or MDA-MB-231 breast carcinoma cells possessing overexpressed or
siRNA-knocked down Ptch1. Media from cells overexpressing Ptch1 was shown to inhibit Hh
activity in the reporter cells; furthermore, analysis of the media from Ptch1-overexpressing cells
revealed elevated amounts of 3β-hydroxysteroids (Bijlsma et al., 2006). The authors would also
identify that vitamin D3 acts as a Smo antagonist and is capable of in vitro binding to Smo in a
cylopamine-competitive manner. It has been noted, however, that vitamin D3 is unlikely to be
the repressive molecule responsible for the inhibitory effects of their Ptch1-conditioned media,
since de novo synthesis of vitamin D3 requires UV irradiation (Eaton, 2008). Furthermore, pro-
vitamin D3, 7-dehydrocholesterol (7-DHC), is also unlikely to be responsible, as its inhibitory
effect on Hh signalling is not significant under most conditions (Bijlsma et al., 2006; Tang et al.,
2011). While there has yet to be any further characterization of the ability of Ptch1 to secrete a
sterol-derived Smo antagonist, studies investigating the therapeutic potential of vitamin D3 as a
Smo antagonist have confirmed that it can inhibit Hh signalling independent of vitamin D
receptor, providing support for Smo being one of its targets (Tang et al., 2011; Uhmann et al.,
2011).
Taken together, this information proposes a model in which the activation of Smo is
regulated endogenously by at least two different factors. Although the identities of the
endogenous regulatory molecules have not yet been discovered, the evidence to date suggests
that the N-terminus of Smo is agonistically regulated, possibly by an oxysterol, and that a
separate site is antagonistically regulated. The mechanism by which Ptch1 would control the
trafficking of these regulating factors remains undefined, although Ptch1 has been shown to both
bind and promote the cellular efflux of a fluorescently labelled cholesterol derivative in an in
vitro system (Bidet et al., 2011).
Page 31
21
2.3 Effect of Ptch1 mutation in neoplasia and developmental disorder
2.3.1 Nevoid basal cell carcinoma syndrome
Nevoid basal cell carcinoma syndrome (NBCCS), also referred to as basal cell nevus
syndrome or Gorlin syndrome, is an autosomal dominant disorder with an estimated prevalence
of 1 in 19,000 (Evans et al., 2010), resulting in multiple developmental anomalies and an
increased likelihood of developing certain neoplasias (Gorlin, 2004). Most notably, these include
an estimated 90% likelihood of developing basal cell carcinoma (BCC) and odontogenic
keratocysts by age 40 (Evans et al., 1993), as well as a 5% chance of developing
medulloblastoma, often within the first two years of life (Cowan et al., 1997). Developmental
anomalies associated with NBCCS include macrocephaly, rib and vertebral abnormalities, and
less often, pre- or post-axial polydactyly (Gorlin, 2004).
Early studies mapping the gene responsible for NBCCS identified that loss of
heterozygosity (LOH) in a region of chromosome 9q22-31 was associated with the spontaneous
development of NBCCS-associated tumours, indicating the loss of a tumour suppressor (Farndon
et al., 1992; Gailani et al., 1992). The subsequent cloning of PTCH1 and mapping it to
chromosome 9q22.3 allowed for the identification of PTCH1 mutations in both NBCCS patients
and spontaneous BCCs, thus indicating its function as a tumour suppressor (Hahn et al., 1996;
Johnson et al., 1996). An initial screen of PTCH1 mutations in 71 independent NBCCS patients
revealed that a large majority (86%) were nonsense or frameshift mutations resulting in a
truncated protein (Wicking et al., 1997). Furthermore, no correlation between phenotype and the
type or location of PTCH1 mutation was identified (Wicking et al., 1997). A more recent study
assessing the relationship between BCC incidence and PTCH1 mutation type in NBCCS patients
also found no correlation (Jones et al., 2011).
A 2005 meta-analysis of 132 published NBCCS PTCH1 mutations confirmed what prior
independent case studies had suggested – that the majority are truncating nonsense or frameshift
mutations (73%), as compared to missense (17%) or putative splice site (10%) mutations
(Lindström et al., 2006). Analysis of the identified missense mutations indicated that 9 out of 23
were in the SSD, and a total of 15 out of 23 were located in transmembrane regions, highlighting
the importance of these regions for PTCH1 function (Lindström et al., 2006). Subsequent case
Page 32
22
reports have continued to identify missense and in-frame deletion mutations occurring in the
SSD (Lü et al., 2008; Marsh et al., 2005; Matsuzawa et al., 2006; Nakamura and Tokura, 2009).
Heterozygous Ptch1 mice recapitulate several features of NBCCS, including increased
body size, increased incidence of medulloblastoma and rhabdomyosarcoma, as well as
polydactyly and rib abnormalities (Goodrich et al., 1997; Hahn et al., 1998). Additionally, recent
work from an ENU screen for facial defect mutants in mice has identified a hypomorphic allele
of Ptch1, Dogface-like (Ptch1DL), that results in NBCCS-like limb, rib, and craniofacial defects
(Feng et al., 2013). Ptch1DL mice possess a point mutation at the exon 13-intron 13 junction,
producing a splice site mutation that results in two aberrant protein isoforms – a more
prominently expressed 571 amino acid isoform truncated in the SSD, and a 1446 amino acid
isoform possessing a 12 residue insertion in the large intracellular loop. While further work will
be required to identify the molecular characteristics of the two Ptch1DL isoforms, the Ptch1DL
allele may be a useful genetic tool in characterizing in vivo Ptch1 function.
2.3.2 Basal cell carcinoma
Basal cell carcinoma (BCC) is the most common cancer affecting Caucasians, with a
current estimated lifetime risk of 30% (Miller and Weinstock, 1994). Increased risk is associated
with male sex, increased age, fair complexion, sun sensitivity, UV exposure, and ionizing
radiation (Wong et al., 2003). Typically lesions present themselves on head and neck areas
exposed to sun, but development on other parts of the body is also possible (Wong et al., 2003).
BCCs are named thus as they resemble basal keratinocytes of the epidermis. Although they
rarely metastasize, they can display aggressive invasive growth and cause local tissue destruction
(Lo et al., 1991; Walling et al., 2004). BCCs can be subdivided into two main subsets, indolent-
growth and aggressive-growth, based on their behaviour (Crowson, 2006). Indolent-growth
BCCs include the histological classes nodular, micronodular, and superficial, while aggressive-
growth BCCs are comprised of the infiltrative, metatypical, and morpheaform histological
classes (Crowson, 2006). BCCs express the Hh pathway targets PTCH1 and GLI1 (Dahmane et
al., 1997; Nagano et al., 1999; Undén et al., 1997), and transgenic mice overexpressing positive
Hh effectors have been shown to develop BCC (Grachtchouk et al., 2000; Nilsson et al., 2000;
Oro et al., 1997; Xie et al., 1998).
Page 33
23
As mentioned, PTCH1 mutations are commonly identified in spontaneous BCCs
(Aszterbaum et al., 1998; Gailani et al., 1996; Unden et al., 1996), with more recent analyses
identifying PTCH1 mutations in 67% of 42 (Reifenberger et al., 2005), 48% of 60 (Heitzer et al.,
2007), and 55% of 31 (Huang et al., 2013) spontaneous BCC tumours analyzed. In addition to
mutation, loss of heterozygosity at the PTCH1 locus is also common, with studies reporting LOH
in 40-60% of tumours analyzed (Danaee et al., 2006; Huang et al., 2013; Reifenberger et al.,
2005). Interestingly, distribution analysis of PTCH1 mutations in 86 sporadic BCCs revealed that
while the majority of mutations were truncating, the majority of missense mutations were located
in the two large extracellular loops, the large intracellular loop, and the C-terminus, which is
different from the pattern observed for germline missense mutations in NBCCS patients
(Lindström et al., 2006). Also, in contrast to the high percentage of deletions and insertions
found in germline NBCCS mutations, PTCH1 mutations in sporadic BCCs are primarily
substitutions, with studies identifying 40-50% as being C > T or CC > TT UVB-associated
mutations, highlighting the importance of UVB exposure in development of BCC (Brash, 1997;
Daya-Grosjean and Sarasin, 2000; Lindström et al., 2006; Reifenberger et al., 2005). It is
interesting to note, however, that in a study analyzing both PTCH1 and tumor suppressor p53
mutations a larger percentage (72%) of p53 mutations found in BCC, which occured in 40% of
cases, were UVB associated compared to PTCH1(40%), indicating the presence of UV-
independent mechanisms of inactivation of PTCH1. Higher p53 protein expression levels have
been correlated with aggressive-growth BCCs (Ansarin et al., 2006; Auepemkiate et al., 2002),
and one study has shown a modest correlation between aggressive-growth BCC and frequency of
p53 mutation (Bolshakov et al., 2003). In addition to mutations in PTCH1, multiple studies have
also identified the presence of activating Smo mutations in BCC, with frequencies of occurrence
ranging from 6-13% of tumours analyzed (Reifenberger et al., 1998, 2005; Xie et al., 1998).
Ptch1 transgenic mouse models have been employed extensively in studies focused on
identifying the underlying mechanism of BCC. Although Ptch1+/-
mice do not spontaneously
develop macroscopic BCCs (Goodrich et al., 1997; Hahn et al., 1998), they do in response to
UVB or ionizing radiation (IR) treatment (Aszterbaum et al., 1999; Mancuso et al., 2004).
Additionally, BCCs from UVB treated Ptch1+/-
mice exhibit UV-associated p53 mutations and
exposure to UVB or IR treatment can produce BCCs with LOH at the Ptch1 locus, demonstrating
that tumours from irradiated Ptch1+/-
mice recapitulate key features of sporadic BCCs in human
Page 34
24
patients (Aszterbaum et al., 1999; Mancuso et al., 2004). Further analysis of irradiated Ptch1+/-
mice would reveal that the susceptibility to tumour development is influenced by the hair follicle
cycle during irradiation, with the greatest susceptibility being displayed during early anagen
phase when hair follicle bulge stem cells are proliferating (Mancuso et al., 2006). Ptch1+/-
mice
have also been used in studies attempting to identify the cell of origin in mouse BCC. Work from
Wang et al. used IR treated Ptch1+/-
mice in combination with inducible YFP expression under
control of the follicle bulge cell marker keratin 15 (K15) promoter to show that BCCs in
irradiated Ptch1+/-
mice arise primarily from this cell population (Wang et al., 2011).
Interestingly, expression of constitutively active Smo (SmoM2) in follicle bulge stem cells does
not induce BCC formation (Wong and Reiter, 2011; Youssef et al., 2010). Wang et al. suggested
in their manuscript that the difference between the two models may be explained by an increase
of nuclear cyclin B1 in Ptch1+/-
mice, as compared to those expressing SmoM2 (Wang et al.,
2011). Support for Smo-independent regulation of cyclin B1 localization by Ptch1 comes not
only from earlier molecular studies (described in section 3.1, Barnes et al., 2001), but also from
work using an inducible knockout of Ptch1 that produces BCC and increased nuclear cyclin B1
and D1 upon Ptch1 elimination (Adolphe et al., 2006). Inducible Ptch1 knockout mice have also
been used to show that bi-allelic, but not mono-allelic loss of Ptch1 is required for BCC
formation in mice, supporting a two-hit hypothesis of BCC tumourigenesis (Zibat et al., 2009).
Moreover, inducible Ptch1 ablation has identified a role for Hh signalling in promoting hair
follicle stem cell proliferation at the expense of differentiation, through the upregulation of
insulin-like growth factor binding protein 2 (Igfbp2) (Villani et al., 2010).
2.3.3 Medulloblastoma
The cerebellar cancer medulloblastoma is the most common nervous system malignancy
affecting infants (Rutkowski et al., 2010). Medulloblastomas are currently categorized into one
of four molecular groups, SHH, WNT, Group 3, or Group 4, based on their transcriptional
profiling (Kool et al., 2012). Of these, the WNT group generally has the best prognosis, with
Group 3 having the least favourable, and SHH and Group 4 lying in the middle (Kool et al.,
2012). More than half of medulloblastomas in adults and infants, and 14% in children ages 4-16
fall into the SHH group (Kool et al., 2012). Transcriptional profiling of infant and adult SHH
medulloblastomas suggests that these two categories comprise distinct sub-groups within the
SHH group (Northcott et al., 2011). SHH medulloblastomas are known to display mutation in
Page 35
25
PTCH1 (Dong et al., 2000; Pietsch et al., 1997; Raffel et al., 1997; Wolter et al., 1997; Zurawel
et al., 2000a) and SUFU (Brugières et al., 2010, 2012; Taylor et al., 2002), with recent studies
showing mutation of PTCH1 in 23-30% of SHH group tumours (Jones et al., 2012; Kool et al.,
2008; Pugh et al., 2012; Robinson et al., 2012). Additionally, a recent meta-analysis of
medulloblastoma copy-number aberration data has indicated that about 47% of SHH group
tumours display partial or complete loss of chromosome 9q (Kool et al., 2012). An earlier
distribution analysis of 23 PTCH1 mutation-containing sporadic medulloblastoma samples
revealed that the large majority of mutations are truncating, and that 4 of the 5 missense
mutations analyzed localized to transmembrane regions (Lindström et al., 2006).
Ptch1+/-
mice develop spontaneous medulloblastomas at a frequency of about 14% within
a span of 10 months (Goodrich et al., 1997; Wetmore et al., 2000). The incidence of
medulloblastoma development in these animals is increased greatly when combined with
ionizing radiation treatment or p53 loss (Pazzaglia et al., 2002; Wetmore et al., 2001). The
Ptch1+/-
mouse medulloblastoma model has been used extensively in studies focused on genetic
interactions between Ptch1 and downstream Hh targets (Kimura et al., 2005; Pogoriler et al.,
2006) or other tumour suppressors (Ayrault et al., 2009; Briggs et al., 2008), as well as studies
investigating the therapeutic potential of Hh pathway inhibitors (Berman et al., 2002; Romer et
al., 2004). Although earlier work suggested that medulloblastomas from Ptch1+/-
mice retain
expression of the wild type allele (Wetmore et al., 2000; Zurawel et al., 2000b), later studies in
both the exon 1-2 and exon 6-7 neomycin insertion models used primers capable of
differentiating between the wild type and insertion alleles to demonstrate that expression of wild
type Ptch1 is lost in cerebellar tumours from these animals, supporting a two-hit model of
tumourigenesis (Oliver et al., 2005; Pazzaglia et al., 2006). In addition to Ptch1 heterozygotes,
conditional deletion of Ptch1 has also been used, most notably to show that conditional bi-allelic
loss of Ptch1 in neural stem cells or granule neuron precursors can result in medulloblastomas
arising from either respective Ptch1-deficient cell population (Yang et al., 2008).
2.3.4 Holoprosencephaly
Holoprosencephaly (HPE) results from failure of the prosencephalon to separate into
cerebral hemispheres, and is the most commonly observed developmental anomaly of the
forebrain in humans (Dubourg et al., 2007). Although considered an autosomal dominant
Page 36
26
disorder, high inter- and intra-family phenotypic variability indicates that HPE is the result of a
complex interaction between multiple genetic and environmental factors (Hehr et al., 2004).
SHH is one of four genes most commonly mutated in HPE, along with ZIC2, SIX3, and TGIF,
and mutations in SHH occur in roughly 9% of cases (Dubourg et al., 2004). In addition to SHH,
mutations in other Hh pathway factors have also been identified, including GLI2 (Bertolacini et
al., 2012; Roessler et al., 2003), DISP1 (Roessler et al., 2009b), GAS-1 (Pineda-Alvarez et al.,
2012), CDO (Bae et al., 2011), and PTCH1 (Ming et al., 2002; Rahimov et al., 2006; Ribeiro et
al., 2006). Analysis of the 11 cases of PTCH1 mutation identified to date reveals that 5 occur in
the large extracellular loops, 4 occur in intracellular loops, and 2 occur in transmembrane
domains. In contrast to PTCH1 mutations identified in NBCCS or sporadic neoplasia, mutations
associated with HPE would be assumed to produce a gain-of-function effect with respect to
pathway inhibition. Thus, the mutations in the extracellular loops would be expected, based on
previous characterization of extracellular loop deletions (Marigo et al., 1996; Taipale et al.,
2002). However, the mechanism by which intracellular loop mutants would produce increased
pathway inhibition still remains unresolved.
2.4 Relation to Ptch2
In addition to Ptch1, mammals possess Ptch2, a second 12-pass transmembrane SSD-
containing hedgehog receptor. Murine Ptch2 consists of 1182 amino acids and shares 56%
sequence identity with Ptch1 (Motoyama et al., 1998b). Its predicted topology is similar to Ptch1,
although its cytoplasmic N- and C- termini are both shorter and show the most variability, along
with the hydrophilic region between transmembrane domains 6 and 7 (Motoyama et al., 1998b).
The shorter C-terminus has been suggested to confer increased protein stability relative to Ptch1
(Kawamura et al., 2008). Early characterization of Ptch2 identified that it is capable of binding
all three Hh ligands with an affinity similar to Ptch1 (Carpenter et al., 1998), and that it itself is a
direct transcriptional target of Hh pathway activation (Rahnama et al., 2004).
It has been well established through luciferase reporter assays that Ptch2 is capable of
pathway repression, although the relative strength of its repressive capability in comparison to
Ptch1 remains less well defined, with two studies showing a slightly weaker repression by Ptch2
and one showing no apparent difference (Holtz et al., 2013; Nieuwenhuis et al., 2006; Rahnama
Page 37
27
et al., 2004). There have also been splice variants characterized for both murine Ptch2 and
human PTCH2. These include a murine Ptch2 variant that skips exons 6 and 7, resulting in
slightly attenuated repressive capability (Nieuwenhuis et al., 2006), as well as human PTCH2
variants that skip exon 22 or exons 9 and 10, resulting in increased repressive capability for the
variant that skips exon 22 and no apparent change in repressive capability for the variant that
skips exons 9 and 10 (Rahnama et al., 2004). A recent study has further characterized the
molecular function of Ptch2, showing that it is capable of localizing to the primary cilium upon
overexpression; capable of complexing with Boc, Cdo, and Gas-1; and that mutation of SSD
residues showing conservation with bacterial RND transporters impairs its repressive capability,
akin to Ptch1 (Holtz et al., 2013).
Unlike Ptch1-/-
mice, Ptch2-/-
mice are both viable and fertile, and do not display any
defects in neural tube or limb bud patterning (Holtz et al., 2013; Lee et al., 2006; Nieuwenhuis et
al., 2006). However, analysis of mice homozygous for a hypomorphic Ptch2 allele did reveal the
presence of alopecia and epidermal hyperplasia in male mice with increased age, suggesting a
requirement for Ptch2 in the maintenance of skin homeostasis (Nieuwenhuis et al., 2006). While
Ptch2-/-
mice do not display overt developmental defects, experiments employing compound
mutants have helped to dissect its regulatory function. First, loss of Ptch2 increases the incidence
of tumourigenesis in Ptch1+/-
mice. Although IR treatment or compound p53 loss does not
produce any synergistic effects with Ptch2 deficiency in tumourigenesis, compound loss of one
or both Ptch2 alleles does increase the incidence of medulloblastoma and rhabdomyosarcoma
development in Ptch1+/-
mice, suggesting a compensatory role for Ptch2 in the presence of Ptch1
haploinsufficiency (Lee et al., 2006). It is also worth mentioning that, although rare, there have
been case reports identifying PTCH2 mutations in NBCCS patients (Fan et al., 2008; Fujii et al.,
2013), as well as sporadic BCCs and medulloblastomas (Smyth et al., 1999).
Additionally, a recent study has used mice with compound Ptch1, Ptch2, and Hip1
deficiencies to identify the genetic interactions between the three receptors in embryonic neural
patterning. Holtz et al. employed the use of Ptch1-/-
mice expressing low levels of a Ptch1
transgene under a metallothionein promoter (MT-Ptch1;Ptch1-/-
), which is assumed to express
enough Ptch1 to allow for Smo inhibition but not proper sequestration of Hh ligand (Milenkovic
et al., 1999). MT-Ptch1; Ptch1-/-
Ptch2-/-
mice displayed an expansion of ventral progenitor
domains in the developing neural tube at E10.5 compared to MT-Ptch1; Ptch1-/-
mice, similar to
Page 38
28
previous work using MT-Ptch1; Ptch1-/-
Hip1-/-
mice (Holtz et al., 2013; Jeong and McMahon,
2005). Furthermore, triple deficient MT-Ptch1; Ptch1-/-
Ptch2-/-
Hip1-/-
mice showed complete
ventralization of the neural tube at E10.5, similar to Ptch1-/-
animals, indicating that in the
absence of Ptch1 and Hip1, Ptch2 is required for proper establishment of the Shh morphogen
gradient in the developing neural tube (Holtz et al., 2013).
3 Non-canonical Hedgehog signalling
Although the canonical Hh signalling pathway involving reception of Hh ligand,
activation and transduction through Smo, and Gli-mediated transcriptional regulation has been
well characterized, growing evidence indicates the existence of other signalling cascades
involving select core Hh components. These include signalling events occurring through Ptch1
that are independent of Smo, as well as events acting through Smo that are independent of Gli-
mediated transcription. A well-characterized example of the latter is the ability of Shh to induce
cytoskeletal re-organization. Specifically, it has been demonstrated that stimulation of
endothelial cells that lack a transcriptional response to Hh ligands results in cyclopamine-
sensitive activation of the small GTPase RhoA and actin stress fiber formation (Chinchilla et al.,
2010). Follow-up work in cultured fibroblasts has also shown through chemical inhibition that
the Smo-mediated activation of Rac1 and RhoA small GTPases is dependent on PI3K and Gi
activity (Polizio et al., 2011).
3.1 Non-canonical Hedgehog signalling events acting through Ptch1
A role for Ptch1 in the regulation of a cell cycle G2/M checkpoint was first identified
through the molecular characterization of a direct interaction with cyclin B1 (Barnes et al.,
2001). This study first identified Ptch1 as being a cyclin B1 interactor via a yeast two hybrid
screen using a phospho-mimetic cyclin B1 mutant as bait. Subsequent biochemical analysis
would reveal that that the two endogenous proteins co-immunoprecipitate, likely requiring the
middle intracellular loop of Ptch1, and that Ptch1 binds a phospho-mimetic, but not a
constitutively non-phosphorylated cyclin B1. Furthermore, treatment with Shh ligand resulted in
Page 39
29
translocation of cyclin B1 to the nucleus. This creates a model in which Ptch1 tethers
phosphorylated cyclin B1 in the cytoplasm in the absence of ligand, while stimulation with Shh
breaks this interaction and allows cyclin B1 to translocate to the nucleus and promote mitosis.
Subsequent in vivo studies have provided support for this model. First, a study in mice
employing a conditional knockout of Ptch1 in interfollicular epithelium basal cells demonstrated
that conditional deletion of Ptch1 results in a 30% increase in nuclear cyclin B1 compared to
non-induced controls, as measured by immunohistochemical analysis (Adolphe et al., 2006).
Additionally, work analyzing via immunohistochemistry the expression of PTCH1 and SHH in
human urinary tract development identified a downregulation of SHH in the medullary collecting
duct at 28 weeks, as compared to 26 weeks (Jenkins et al., 2007). Jenkins et al. used this
observation as a basis to compare the localization of cyclin B1 in PTCH1-expressing cells in the
presence or absence of SHH expression. They identified that at 28 weeks when SHH expression
is downregulated, cyclin B1 localizes to the apical cell surface, similar to the localization of
PTCH1. However, at 26 weeks when SHH expression is high, cyclin B1 displayed a diffuse
cytoplasmic localization with occasional nuclear localization, supporting a model in which cyclin
B1 localization is influenced by Shh stimulation.
In addition to cell cycle regulation, a role for Ptch1 in the promotion of apoptosis has also
been identified. In HEK293 cells and in the chick neural tube, overexpression of Ptch1 induces
apoptosis via activation of caspase activity. This pro-apoptotic activity is inhibited in the
presence of Shh ligand (Thibert et al., 2003). This study would also identify that the C-terminus
of Ptch1 is itself a substrate of caspases-3,7, and 8, and that the caspase-mediated cleavage of
Ptch1 depends on a conserved aspartic acid at residue 1392 of human Ptch1. Mutation of D1392
to asparagine abrogated the ability of Ptch1 to promote apoptosis, while a truncation of Ptch1 at
residue 1392 resulted in the promotion of apoptosis even in the presence of Shh, suggesting that
cleavage at this residue exposes the domain of the Ptch1 C-terminus required for promotion of
apoptosis. The results of this study led the authors to classify Ptch1 as a dependence-receptor,
which are defined loosely as a family of receptors involved in cell survival and differentiation
that promote apoptosis in the absence of their ligand via a cytoplasmic caspase cleavage site, but
have this pro-apoptotic activity inhibited in the presence of their respective ligands (Mehlen and
Bredesen, 2004). A more recent study in human umbilical vein endothelial cells has also
supported a non-canonical, pro-apoptotic function of Ptch1 by demonstrating that Shh
Page 40
30
stimulation in the presence of Smo inhibition, or RNAi knockdown of Ptch1, both lead to a
reduction in caspase-3 activity (Chinchilla et al., 2010).
Subsequent in vitro work aimed at identifying the mechanism by which Ptch1 promotes
apoptosis showed that in the absence of Shh, Ptch1 recruits via its C-terminus a pro-apoptotic
complex consisting of the adaptor protein DRAL, either of the caspase recruitment domain-
containing proteins TUCAN or NALP1, and caspase-9 (Mille et al., 2009). Moreover, RNAi
knockdown of individual complex members demonstrated their requirement for Ptch1-induced
apoptosis. A follow-up study by the same group has recently identified that Ptch1 associates with
the E3 ubiquitin ligase NEDD4 in a Shh-independent manner, and that the recruitment of
NEDD4 to the pro-apoptotic DRAL complex is required for the ubiquitination of caspase-9 and
subsequent caspase-mediated apoptotic activity (Fombonne et al., 2012). Despite this, the
mechanistic association between caspase cleavage of Ptch1 and the recruitment of the pro-
apoptotic DRAL/caspase-9 complex has yet to be elucidated.
The discovery of a C-terminal Ptch1 polymorphism in the FVB strain of mice led to the
identification of another potential non-canonical interaction involving Ptch1. FVB mice contain a
T1267N polymorphism that makes them susceptible to squamous cell carcinoma induced by an
oncogenic H-Ras transgene; furthermore, this polymorphism also results in a decreased ability of
Ptch1 to complex the tumour suppressor Tid1 (Wakabayashi et al., 2007). While the significance
of this interaction has yet to be fully defined, follow up work from the same group has
demonstrated that chemical activation of Protein Kinase C leading to extracellular signal-
regulated kinase 1/2 (ERK1/2) activation destabilizes the interaction between C57BL/6 variant
Ptch1 and Tid1, potentially linking Ras activation to the Ptch1-Tid1 interaction (Kang et al.,
2013).
Previous work from our lab has also identified a novel non-canonical Hh signalling
cascade. Experiments in cultured fibroblast mammary epithelial cell lines demonstrated that
stimulation with N-Shh results in MEK-dependent activation of ERK1/2 (Chang et al., 2010).
This event was shown to be Smo-independent, as ERK1/2 activation was still observed in the
presence of Smo-inhibition, as well as in the mammary epithelial cell line MCF10A, which lack
detectable Smo expression (Chang et al., 2010; Zhang et al., 2009). Although the precise
mechanism of this non-canonical signalling event remains undefined, biochemical analysis from
Page 41
31
the same study identified through GST pull-down assays and co-immunoprecipitation that the
isolated C-terminus of Ptch1 associates with multiple Src homology 3 (SH3)-domain-containing
factors, namely the non-receptor tyrosine kinase c-src, the PI3K regulatory subunit p85β and the
E3 ubiquitin ligase Smurf2.
3.2 Identification of a novel Ptch1-mediated signalling cascade involving c-src
Discovered as the cellular avian homolog of the oncogene responsible for transformation
via Rous-sarcoma virus (Stehelin et al., 1976; Takeya and Hanafusa, 1982), the proto-oncogene
c-src is a non-receptor tyrosine kinase that has function in multiple signal transduction pathways
(Kim et al., 2009b). Well characterized examples of these include promoting proliferation
through MEK-mediated ERK activation via the activation of growth factor receptor tyrosine
kinases, promotion of cell survival via PI3K/Akt activation, and the promotion of proliferation
through the activation of signal transducer and activator of transcription (STAT) family members
(Kim et al., 2009b; Silva, 2004). In addition to c-src, the Src family kinase (SFK) family also
includes Fyn, Lyn, Lck, Hck, Blk, Yes, Yrk, Yrg, and Fgr. All family members share four Src
homology (SH) protein domains: an SH1 domain that contains the catalytic residues, an SH2
domain that binds phosphotyrosine residues, an SH3 domain that binds poly-proline motifs, and
an SH4 domain that possesses a myristoylation sequence (Wheeler et al., 2009). Out of all SFK
family members, c-src, Fyn, and Yes are the three that display ubiquitous tissue expression
(Wheeler et al., 2009).
Roles for c-src have been identified in both mammary gland development and breast
cancer. Mice deficient for c-src display a delay in mammary gland development at puberty, and
further molecular analysis of mammary epithelial cells derived from these animals revealed
impairment in the ability to activate estrogen receptor alpha (ERα) and Akt in response to
estrogen treatment (Kim et al., 2005). Defects in lactation have also been identified in nursing c-
src-/-
mice (Watkin et al., 2008). Although analysis of transgenic mice expressing activated c-src
in mammary epithelial cells has indicated that c-src possesses mild oncogenic capacity in the
mammary gland (Webster et al., 1995), breast cancer samples and cell lines show elevated levels
of c-src protein and SFK kinase activity (Wheeler et al., 2009). Additionally, breast cancer
Page 42
32
mouse models employing transformation via mammary epithelium-expressed polyomavirus
(PyV) middle T antigen or overexpressed ErbB2 both display increased c-src kinase activity, and
disruption of c-src impairs tumourigenesis via PyV (Guy et al., 1994; Marcotte et al., 2012;
Muthuswamy et al., 1994).
A previous study from our lab, in collaboration with the lab of Dr. Michael Lewis,
identified that mes mice exhibit a block in mammary gland development during puberty.
Specifically, the mammary glands of mes mice fail to respond to ovarian hormones during
puberty and do not exhibit any ductal branching beyond the rudimentary structure formed during
embryogenesis (Moraes et al., 2009). The aforementioned GST-pulldown data in conjunction
with the observation that stimulation of cultured fibroblasts and mammary epithelial cells with
N-Shh can activate c-src led to the hypothesis that c-src may function downstream of Ptch1. To
test this, mice expressing a mammary epithelial cell-restricted activated c-src transgene (MMTV-
c-srcAct
) were crossed onto the mes background. At 24 weeks, mes mice possessing the MMTV-
c-srcAct
transgene displayed ductal branching to the edge of the fat pad, indicating rescue of the
block in mammary gland morphogenesis (Chang et al., 2012). Crossing mice possessing an
MMTV-ErbB2Act
transgene onto the mes background did not rescue the block in mammary gland
development, indicating that c-src is a specific downstream effector of Ptch1.
Page 43
33
Rationale
Taking into consideration that the isolated SH3-domain of c-src is capable of in vitro
binding to the isolated C-terminus of Ptch1 (Chang et al., 2010), and that mammary-epithelial
specific overexpression of an activated c-src transgene rescues the defect in mammary gland
development displayed by mes mice (Chang et al., 2012), we propose that the link between Ptch1
and c-src involves a physical association. Furthermore, characterization to date of the effect of
the mes allele on canonical Hh signalling is ambiguous, with studies showing elevated levels of
Hh target genes in some tissues (Li et al., 2008a), but not others (Nieuwenhuis et al., 2007). We
propose to clarify its canonical function through the use of both transient reporter assays and
direct transcriptional analysis of primary cells.
Hypothesis & Objectives
We hypothesize that the intracellular domains of Ptch1, in particular the C-terminus,
mediate distinct canonical and non-canonical functions, one being a direct association with c-src.
The objectives are as follows:
1. Identify the structural requirements for the interaction between Ptch1 and c-src.
Page 44
34
2. Identify the role of the Ptch1 C-terminus in non-canonical activation of c-src and ERK in
response to Shh stimulation.
3. Identify the role of the Ptch1 C-terminus in the transcriptional activation of canonical
Hedgehog targets.
Materials & Methods
Cell culture
HEK 293 cells (a kind gift of Prof. S. Girardin) and Ptch1-/-
MEFs (a kind gift of Prof. S. Angers)
were cultured in DMEM with 10% FBS and 1% penicillin-streptomycin. MCF10A cells were
cultured in D E /F12 with 5% horse serum 1 μg/ml insulin 5 μg/ml hydrocortisone 2
ng/ml EGF, 1 ng/ml cholera toxin, and 1% penicillin-streptomycin. Shh Light II fibroblasts
(ATCC) were cultured in DMEM.
For serum starvation of MCF10A cells, cells were trypsinized and replated in growth medium to
allow re-attachment. Four hours later, the medium was changed to DMEM/F12 with 0.5%
serum. After 24h of serum starvation the cells were stimulated with Shh- or pcDNA3-
conditioned media for 1 hour and lysed in DDM lysis buffer.
Primary cell culture
Wildtype and mes/mes littermate animals on C57Bl/6 background were sacrificed at 3 months.
Thoracic and inguinal mammary glands were then dissected and minced into as small of
fragments as possible. Next, the mammary glands were incubated in a solution of 3mg/ml
Page 45
35
collagenase A in DMEM/F12 for 45 minutes at 37°C. Mechanical dissociation was then
performed by slowly pipetting 10-15 times with a 5ml pipette, adding FBS to a final
concentration of 2%, and then pipetting harder 15 times. Epithelial (pelleted) and mesenchymal
(supernatant) layers were separated by centrifuging at 250rpm for 2 minutes. The mesenchymal
layer was then strained using a 40µm cell strainer, washed with 5ml of DMEM/F12, and plated
in D E /F12 with 1 % FBS 1 μg/ml insulin 1 μg/ml transferrin and 20 ng/ml EGF.
For c-src and ERK1/2 activation assays, primary mouse mammary mesenchymal cells were
starved for 48h in serum-free D E /F12 then stimulated with 1μg/ml N-Shh peptide (R & D
Systems), or 2 ng/μl EGF for 1h Cells were then lysed in 1% DD lysis buffer
For canonical pathway activation assays, primary mammary mesenchymal cells were starved as
described above, then stimulated with pcDNA3-conditioned media, Shh-conditioned media, or
Shh-conditioned media with 1 µM SANT-1 (Toronto Research Chemicals) for 24h.
Cloning & Expression Constructs
Wild type, full length mouse Ptch1, tagged at its C-terminus and the full length mes Ptch1 mutant
in pcDNA3 described previously (Chang et al., 2010; Nieuwenhuis et al., 2007) were kind gifts
of Prof. C.C. Hui (Hospital for Sick Children Research Institute). To make the untagged, full
length, wild type version of Ptch1, sequence encoding the C-terminus in the HA-tagged version
was removed at the Pflm1 site and replaced with untagged wild type sequence we isolated
previously (Nieuwenhuis et al., 2007). The Ptch1∆C mutant (∆1173-1311) was produced by
truncation of the full length cDNA at the PflM1 site (nt 3519) and religating the vector. The
Ptch1∆ L mutant (∆614-709) was produced by cutting out the sequence between the Stu I site
(nt 1845) and the Xho I site (nt 2127), blunt ending the Xho I site with Klenow and religating the
vector. The compound Ptch∆ L∆C mutant was produced from the Ptch1∆ L mutant and
cutting off the C-terminus at the PflMI site as described for the Ptch1∆C mutant Human
activated c-src (Y530F) was a kind gift of Prof. William J. Muller.
Page 46
36
Western blotting and immunoprecipitation
Western blots were performed as described previously (Chang et al., 2010). Briefly, adherent
cells in monolayer were washed 3 times in ice cold PBS. Cells in 100 mm plates were then
scraped following addition of 0.5 ml DDM lysis buffer containing protease and phosphatase
inhibitors (50mM Tris pH 7.6, 150mM NaCl, 2mM EDTA, 1% n-dodecyl-β-d-maltoside,
57m P SF 1 μ leupeptin 3μ aprotinin 1 m NaF 1m sodium orthovanadate)
Lysates were incubated for 20 minutes at 4°C and then centrifuged in a refrigerated
microcentrifuge for 30 minutes at 13,000 rpm to pellet insoluble material. Supernatant
concentrations were measured by Bradford assay using Bio-Rad Protein Assay reagent. For
straight western blots, 4x SDS-loading buffer (50mM Tris pH 6.8, 100mM DTT, 2% SDS, 0.1%
bromophenol blue, 10% glycerol) was added to lysates containing 40µg of protein and incubated
for 15 minutes at 37°C to avoid aggregation of membrane proteins. Samples were resolved by
10% SDS-PAGE and blotted onto nitrocellulose membrane. Blots were blocked with 5% skim
milk powder in TBS-T (137mM NaCl, 2.7mM KCl, 25mM Tris, 0.1% Triton X-100), and then
probed with primary antibody overnight at 4°C. Antibodies and dilutions used are as follows:
1:1 goat α-Ptch1 (Santa Cruz; sc-6149) 1:1 rabbit α-c-src (Cell Signaling), 1:1000 rabbit
α-p-src- 16 (Cell Signaling) 1:1 mouse α-non-p-src- 16 (Cell Signaling) 1:5 rabbit α-
actin (Sigma) 1:1 mouse α-p-ERK (Cell Signaling) 1:1 rabbit α-ERK (Cell Signaling),
1:1000 rabbit α-phosphotyrosine (BD) and 1:1 mouse α-HA (Applied Biological Materials).
Blots to be re-probed were stripped in stripping buffer (2% SDS, 62.5mM Tris pH 6.8, 100mM
β-mercaptoethanol) for 30 minutes at 72°C.
For immunoprecipitation 15 μg (HEK 293) or 6 μg ( CF1 A) of total cell lysate were
incubated with primary antibody overnight at °C in DD lysis buffer 15μl of Protein G-
agarose beads (Invitrogen) were added to each sample the following day and incubated at 4°C
for 90 minutes. Beads were washed 5 times with DDM lysis buffer and re-suspended in 25μl of
SDS loading buffer.
Glycosidase treatment
Page 47
37
For glycosidase treatment μg of DD cell lysate was incubated in a 3 μl reaction for 1h at
37°C with 250 U Endo H (New England Biolabs) or 500 U PNGase F (New England Biolabs).
Preparation of Shh-conditioned media
Shh- and pcDNA-conditioned media were prepared by transfecting 40% confluent 100mm plates
of HEK 293 cells in 5% FBS with 15µg of pCDNA3.1-N-Shh or pcDNA3 using 2mg/ml PEI at a
2:1 ratio. Cells were grown for 4-5 days and the media was harvested by centrifugation at 2500
rpm for 5 minutes at 4°C. The supernatant was then sterile-filtered with a 0.22μm syringe filter
Prior to use, conditioned media was diluted 10X in serum free media to a final serum
concentration of 0.5%. Activity of conditioned media was measured by luciferase assay in Shh
Light II fibroblasts as described below.
Shh:AP-conditioned media was prepared by transfecting 40% confluent 100mm plates of HEK
293 cells in 10% FBS with 15µg of pcDNA3-Shh:AP (a kind gift of Prof. F. Charron) using
2mg/ml PEI at a 2:1 ratio. Cells were grown for 4 days and the media was harvested by
centrifugation at 2500 rpm for 5 minutes at 4°C. The supernatant was then sterile-filtered with a
22μm syringe filter Alkaline phosphatase activity of conditioned media was measured by
absorbance at 405nm, as described below.
Luciferase assays
Activity of the Shh ligand (peptide or conditioned media) was assayed using Shh Light II
fibroblasts. Confluent cells were serum-starved in 0.5% serum for 24h and then stimulated with
conditioned media or Shh-peptide for 24h. Cells were then lysed in passive lysis buffer
(Promega) and luciferase activity was measured by Dual-Luciferase Reporter Assay System
(Promega). Shh Light II fibroblasts contain an 8X-Gli-binding-site Luciferase firefly reporter
transgene and a constitutive renilla luciferase transgene. Gli-reporter activity was normalized to
renilla activity.
Page 48
38
Activity of the wild type and deletion mutants of Ptch1 was determined using Ptch1-/-
MEFs. For
Hh-pathway repression activity of Ptch1, a confluent 100 mm plate of Ptch1-/-
MEFs cells were
seeded at a 1:5 ratio in 24-well plates. The following day, cells were transfected with Fugene 6
(3:1 ratio; Promega) mixed with 400ng 8X Gli-Luciferase reporter, 40ng pCMV5-Renilla
luciferase, and 25ng or 200ng Ptch1 and pcDNA3, the latter used to bring the total amount of
DNA to 640ng. Cells were grown for 48h, then lysed in passive lysis buffer and measured for
luciferase activity as described above. For assays measuring the ability of Ptch1 or Ptch1 mutants
to mediate Shh-ligand signalling, cells were plated and transfected as described above but using
only one concentration (25ng) of Ptch1 expression construct. Cells were grown for 48h, switched
to Shh- or pcDNA3-conditioned media in 0.5% serum for 24h, lysed in passive lysis buffer and
assayed as described.
RT-PCR and qRT-PCR
For RT-PCR, total RNA was isolated from primary mouse mammary mesenchymal cells using
Trizol reagent (Invitrogen). RT-PCR was performed using a SuperScript III One-Step RT-PCR
kit (Invitrogen) with 260ng of RNA per sample. Primer sequences were as follows:
mouse Ptch1 forward 5' GTCTTGGGGGTTCTCAATG 3';
mouse Ptch1 reverse 5' ATGGCGGTGGACGTTGGGTCCC 3';
mouse Gli1 forward 5' TGGACTCCATAGGGAGGTGAA 3';
mouse Gli1 reverse 5' CTCCTCCTCGGAGTTCAGTCA 3';
mouse GAPDH forward 5' TGAGAACGGGAAGCTTGTCA 3';
and mouse GAPDH reverse 5' GGAAGGCCATGCCAGTGA 3'.
Reaction conditions were 1 minute denaturation, 1 minute annealing, and 1 minute extension for
30 cycles. The annealing temperature for Ptch1 was 68°C, while the annealing temperature for
Gli1 and GAPDH was 56°C.
For quantitative RT-PCR, total RNA was isolated as above. DNAse treatment (Fermentas) was
performed on 400ng of RNA from each sample. Reverse transcription was then performed using
a SuperScript II Reverse Transcriptase (Invitrogen) and random hexamer primers (Fermentas). A
25X dilution of the resulting cDNA was subjected to qPCR using an iQ SYBR Green Supermix
Page 49
39
(Bio-Rad) with 1 ul reactions Results were quantified using the ΔΔCt method corrected for
primer efficiency with Arbp as a reference gene. Primers adapted from previously published
sequences were used as follows:
mouse Ptch1 forward 5' GGTGGTTCATCAAAGTGTCG 3';
mouse Ptch1 reverse 5' GGCATAGGCAAGCATCAGTA 3' (Zhou et al., 2012);
mouse Gli1 forward 5' CCCATAGGGTCTCGGGGTCTCAAAC 3';
mouse Gli1 reverse 5' GGAGGACCTGCGGCTGACTGTGTAA 3' (Svard et al., 2009);
mouse Arbp forward 5' GAAAATCTCCAGAGGCACCATTG 3';
and mouse Arbp reverse 5' TCCCACCTTGTCTCCAGTCTTTAT 3' (Pernot et al., 2010).
All reactions consisted of 40 cycles with 30s denaturation at 72°C and 30s annealing/extension at
60°C. Primer specificity was confirmed by a combination of agarose gel electrophoresis and melt
curve analysis.
Immunofluorescence and imaging
Ptch1-/-
MEFs grown on 2cm coverslips in 24-well plates were transfected with 1μg of plasmid
using Fugene 6 (3:1 ratio; Promega). Cells were grown for 24h and then switched to serum-free
media for 48h to promote cilia formation. After 2 washes with ice cold PBS, the cells were fixed
with freshly prepared 4% paraformaldehyde in PBS for 20 minutes at room temperature.
Blocking and permeabilization was performed by incubating with 5% donkey serum and 0.2%
Triton X-100 in PBS for 20 minutes at room temperature. Incubation with primary antibody was
performed overnight in a humidified chamber at 4°C in 5% donkey serum in PBS. Antibodies
and dilutions used were 1:500 goat α-Ptch1 (Santa Cruz; sc-61 9) and 1:1 mouse α-
acetylated tubulin (Sigma). After 3 washes with PBS, incubation with secondary antibody was
performed for 1h at room temperature in 5% donkey serum in PBS. Antibodies and dilutions
used were 1:200 Alexa Fluor 568 donkey α-mouse IgG (Invitrogen) and 1:400 FITC-conjugated
donkey α-goat IgG (Jackson ImmunoResearch). Coverslips were then washed 3 times with PBS
and mounted on slides with Vectashield Mounting Medium with DAPI (Vector Laboratories).
Slides were viewed on a Nikon Eclipse 80i microscope and images taken with a QImaging
Qicam Fast 1394 camera using QCapture Pro 6.0.
Page 50
40
In vitro binding assays
In vitro binding assays were performed as described (Flanagan and Cheng, 2000).
Briefly, HEK 293 cells were transfected with the indicated Ptch1 expression constructs and then
lysed in 1% DDM lysis buffer 24h post-transfection. Using an agarose bead-conjugated primary
antibody against Ptch1 (Santa Cruz; sc-6149 AC), immunoprecipitation was performed as
described above with 400µg of lysate. Following the final 1% DDM washes, the
immunoprecipitates were washed two times with cold HBAH (0.5 mg/ml BSA, 0.1% sodium
azide, 20mM HEPES pH 7.0) and then incubated with 400µl of Shh:AP-conditioned media for
two hours at room temperature. Immunoprecipitates were then washed 5 times with HBAH, once
with HBS (150mM NaCl, 20mM HEPES, pH 7.0), resuspended in 100µl of HBS, and heated at
65°C for 10 minutes. The samples were then transferred to ice and mixed with 100µl of 2X AP
substrate buffer (31mM p-nitrophenyl phosphate, 1mM MgCl2, 2M diethanolamine, pH 9.8) for
measurement of alkaline phosphatase activity via absorbance at 405nm in a kinetic microplate
reader.
Page 51
41
Results
Deletion mutant analysis of the Ptch1-c-src interaction
We showed previously that the C-terminus of Ptch1 was capable of binding to a number
of factors harbouring SH3- or WW-domains. A GST-SH3 fusion protein from one of these
candidates, c-src, bound to the C-terminal domain of mPtch1. Furthermore, genetic work from
our lab further demonstrated that mammary epithelial cell-restricted expression of an activated c-
src [c-srcAct
;(Webster et al., 1995)] transgene can rescued the block in mammary gland
development caused by mutation of the Ptch1 C-terminus (Chang et al., 2012). In order to
characterize the potential physical interaction between full length murine Ptch1 and c-src, co-
immunoprecipitation assays were performed using full length Ptch1 as well as mutants that
delete specific cytoplasmic domains of this 12-pass integral membrane protein.
Although the C-terminus of Ptch1 contains multiple putative SH2- and SH3-binding
domains, the large middle intracellular loop (residues 584-734) also contains potential SH2- and
SH3-binding consensus sequences (Figure 1). To determine the contribution of these
intracellular domains to a potential Ptch1-c-src interaction, deletion-mutants of the Ptch1 C-
terminus (residues 1173-1 3 "Ptch1ΔC") the large middle intracellular loop (residues 614-
7 9 "Ptch1Δ L") and of both of the aforementioned domains (residues 61 -709/1173-1434;
"Ptch1Δ C") were constructed (Figure 2A). Additionally, a construct containing the full-length
mesenchymal dysplasia (mes) allele of Ptch1 was cloned to further identify regions of the Ptch1
C-terminus contributing to the Ptch1-c-src interaction (Figure 2A). In order to confirm that these
deletion mutants underwent proper secretory pathway trafficking, Endo H/PNGase F analysis
was performed in HEK 293 cells (Figure 2B). All of the deletion mutants were partially resistant
to Endo H, indicating that they traffic beyond the medial Golgi apparatus. The truncation
Ptch1ΔStu (residues 615-1434) was used as a negative control.
HEK 293s were then transfected with an expression vector for activated c-src (c-srcAct
),
as well as an amount of expression vector for the Ptch1 mutants that produced roughly equal
levels of each protein as determined by immunoblot blot using an antibody directed to the N-
terminal region of Ptch1 (Figures 3A & D). Co-immunoprecipitations were then performed
using an agarose-conjugated goat α-Ptch1 antibody against the Ptch1 N-terminus (Figure 3B
Page 52
42
and E) or a rabbit α-c-src antibody (Figure 3C and F). Immunoprecipitation of Ptch1 mutants
∆C and ∆ L∆C revealed that loss of the entire C-terminus reduces to background levels the
ability of Ptch1 to co-immunoprecipitate activated c-src. In contrast, loss of the large middle
intracellular loop in the ∆ L mutant did not prevent Ptch1 from co-immunoprecipitating c-srcAct
(Figure 3B). In the reciprocal immunoprecipitation using antibody directed against c-src, only
wild type Ptch1 co-immunoprecipitated although a weak band for the Δ L mutant was apparent
(Figure 3C). Interestingly, co-immunoprecipaution assays interrogating the activity of the mes
mutant showed no apparent difference in the Ptch1-c-src interaction in wildtype Ptch1 versus
mes (Figure 3E & F). These data suggest that amino acids 1173-1215 harbour residues that are
critical for interaction between Ptch1 and c-src. Alternatively but less likely, the 63 amino acid
nonsense product of the mes deletion may itself confer ability to bind c-src.
Figure 1. Major intracellular domains of vertebrate Ptch1 contain conserved putative SH2- and SH3-binding domains. Sequence alignment of the middle intracellular loop (murine residues 585-734) and C-terminus (murine residues 1162-1434) of vertebrate Ptch1. Green text denotes intracellular domains, while conserved poly-proline motifs and tyrosines are highlighted in grey and blue, respectively.
Page 53
43
In addition to containing potential SH3-binding motifs, the C-terminus and large middle
Figure 2. Ptch1 deletion mutants exhibit correct secretory pathway trafficking in HEK 293 cells. Schematic of Ptch1 deletion mutants used in mapping experiments (A). Equal amounts of Ptch1-HA, Ptch1ΔC, Ptch1ΔML, Ptch1ΔMC, mes, and Ptch1ΔStu were transfected into HEK 293 cells. Cells were lysed in 1% DDM lysis buffer 24h post-transfection and 40μg aliquots of each lysate were taken and subjected to Endo H or PNGase F treatment. All of the Ptch1 constructs tested except Ptch1ΔStu are partially resistant to Endo H, indicating correct secretory pathway trafficking (B). The truncation Ptch1ΔStu is shown as a negative control to indicate failure to traffic through the secretory pathway. E = Endo H, P = PNGase F.
Page 54
44
intracellular loop of Ptch1 also contain multiple tyrosines that are potential phosphorylation
targets of c-src. These motifs are conserved between Ptch1 proteins in all vertebrates (Figure 1).
To determine if Ptch1 is a target for tyrosine phosphorylation by c-src, immunoprecipitations
were carried out in the same manner as described above and probed with an antibody against
phosphotyrosine. While wild type Ptch1 displayed the strongest phosphotyrosine signal relative
to the amount of protein immunoprecipitated, the three other deletion mutants assayed were all
Figure 3. Overexpressed Ptch1 and activated c-src co-immunoprecipitate via an interaction requiring the Ptch1 C-terminus. Ptch1 deletion mutants were transfected into HEK 293 cells with or without activated c-src and lysed in 1% DDM lysis buffer at 24h post-transfection. Expression levels of transfected plasmid were verified by western blot, shown in A and D. Immunoprecipitations were performed using a goat α-Ptch1 agarose conjugate antibody against the Ptch1 N-terminus, or a rabbit α-c-src antibody. The corresponding western blots were probed for Ptch1 and c-src (B and C, respectively). Immunoprecipitation with Ptch1 or c-src both indicate that the C-terminus of Ptch1 is required to co-immunoprecipitate activated c-src. The same experiment was performed to directly compare wildtype Ptch1 and the mes mutant, showing that unlike a complete truncation of the C-terminus, the mes allele is capable of co-immunoprecipitating activated c-src (E and F).
Page 55
45
Figure 4. Overexpressed Ptch1 is a target for tyrosine phosphorylation by overexpressed activated c-src. HEK 293 cells were transfected with the indicated Ptch1 construct with or without activated c-src and lysed in 1% DDM lysis buffer after 24h, shown by western blot in A and C. Immunoprecipitation of Ptch1 was performed with a goat α-Ptch1 agarose conjugate antibody and the subsequent western blot was probed with an antibody against phospho-tyrosine (B and D, top). This blot was then stripped and re-probed with α-Ptch1 (B and D, bottom). All of the Ptch1 constructs assayed display tyrosine phosphorylation in response to co-transfection with activated c-src.
detected by the anti-phosphotyrosine antibody upon overexpression of c-srcAct
(Figure 4A & B).
Furthermore, no apparent difference in the ability of c-src to mediate tyrosine phosphorylation in
wild type Ptch1 versus mes was evident, as shown by the similar ratio of phosphotyrosine signal
relative to the protein levels observed for Pcth1 and mes in the immunoblot (Figure 4C & D).
Taken together, these results show that Ptch1 is a target for tyrosine phosphorylation by c-srcAct
,
and that there exist c-src phosphorylation sites in Ptch1 outside of those predicted to reside in the
C-terminus or middle intracellular loop.
Effect of Hedgehog ligand stimulation on the Ptch1-c-src interaction
To further characterize the interaction between Ptch1 and c-src, we asked what effect Shh
ligand stimulation would have on this association. This analysis was performed using the human
immortal mammary epithelial cell line, MCF10A, since these cells i) lack detectable expression
of Smoothened (Chang et al., 2010; Zhang et al., 2009), ii) cannot transduce canonical Hh-
Page 56
46
signalling with Hh-ligand (Chang et al., 2010), and iii) remain able to activate ERK1/2 in
response to stimulation with N-Shh (Chang et al., 2010). Thus, the effects of Hh-ligand on the
association of Ptch with endogenous c-src can be determined in the absence of signalling through
the canonical Hh-pathway.
MCF10A cells were transfected with HA-tagged Ptch1, grown for 48h, serum starved for
24h, then stimulated with Shh-conditioned or control media for 1h and Ptch1
immunoprecipitated from 6 μg of lysate As Figure 5A reveals, Ptch1 co-immunoprecipitated
endogenous c-src when MCF10A cells were treated with control-conditioned media. This
association was lost, however, when these cells were stimulated with Shh-conditioned media.
The immunoblot of activated and total endogenous c-src in Figure 5B also shows that stimulation
of MCF10A cells with Shh-conditioned media increased the levels of endogenous, phospho416
(activated)-c-src (Figure 5B). These results indicate that Ptch1 and c-src form a transient
association that is disrupted upon Hh stimulation; furthermore, this dynamic interaction is
independent of Smo activity.
Figure 5. Association of Ptch1 and c-src is abolished in response to Shh stimulation. MCF10A cells were transfected with Ptch1-HA, grown for 48h, serum starved for 24h, and then stimulated with Shh- or pcDNA3-conditioned media for 1h. Cells were then lysed in 1% DDM lysis buffer and prepared for immunoprecipitation using a goat α-Ptch1 antibody. Treatment with Shh-conditioned media abolishes the association between Ptch1-HA and endogenous c-src, as compared to treatment with pcDNA3-conditioned media (A). The corresponding western blot indicates an increase in levels of p-src-416 in response to Shh stimulation (B).
Page 57
47
Differential effects of Ptch1 and the mes mutant on signal transduction
cascades
In order to assess whether activation of c-src by Hh-ligands was affected by the mutation
arising in Ptch1 in mes mice, primary mammary mesenchymal cells (fibroblasts) were isolated
from wildtype and mes/mes littermates. The mesenchymal cells were serum starved for 48h, then
stimulated with 1μg/ml N-Shh peptide or 200ng/ml EGF for 1h. Lysates were then prepared and
resolved by SDS-PAGE, and the subsequent western blots were probed with antibodies against
p416-src and p-ERK1/2. The blots were then stripped and re-probed for total c-src and ERK1/2
(Figure 6). Consistent with our previous observations, primary mammary mesenchymal cells
from wild type and mes/mes mice exhibited increases in p-ERK1/2 in response to N-Shh peptide.
In contrast, the primary mammary mesenchymal cells from the mes/mes animals exhibited a
higher level of endogenous p416-src relative to starved cells from wild type mice. Furthermore,
these levels did not change upon stimulation with the N-Shh peptide. These data suggest that
there is a defect in the regulation or activation of c-src in mes/mes mesenchymal cells, and that
activation of c-src and ERK1/2 in response to Shh stimulation occur through different
mechanisms.
Page 58
48
Figure 6. Primary mammary mesenchymal cells containing a Ptch1 C-terminal mutation fail to activate c-src in response to Shh stimulation. Primary mammary mesenchymal cells isolated from littermate wildtype and mes/mes mice were serum starved for 48h, then treated with Shh peptide for 1h. Cells were lysed in 1% DDM lysis buffer and lysates were separated by SDS-PAGE. Blots were probed for p-src-416 and p-ERK1/2, then stripped and re-probed for total c-src and total ERK1/2. Mesenchymal cells from wildtype animals displayed activation of both c-src and ERK1/2 in response to Shh peptide (1μg/ml) stimulation, while mes/mes mesenchymal cells displayed activation of ERK1/2, but not c-src. EGF (200ng/ml) was used as a positive control for c-src and ERK1/2 activation (A). Quantification of (A)
(B).
Canonical Hedgehog signalling consequences of Ptch1 intracellular domain
deletions
To date, molecular studies of the effect of the mes allele on canonical Hedgehog target
activation have all involved assaying the steady state levels of Hedgehog target mRNA by
endpoint RT-PCR (Chang et al., 2012; Li et al., 2008; Nieuwenhuis et al., 2007). These assays,
however, have not interrogated the ability of the mes variant of mPtch1 to respond to stimulation
by the Hh-ligands.
To identify if the mes allele alters the response to Shh-ligand stimulation, activation
assays were performed using primary mouse mammary mesenchymal cells isolated from
littermate wildtype and mes/mes animals as described above. Mammary mesenchymal cells were
serum starved for 48h, then stimulated with Shh-conditioned media, control-conditioned media,
or Shh-conditioned media with 1μ of the Smo inhibitor SANT-1, for 24h. Figure 7A shows
that in a qualitative endpoint RT-PCR analysis, mesenchymal cells isolated from both wild type
and mes/mes animals displayed similar basal levels of Ptch1 expression which responded with a
similar increase in expression in response to Shh stimulation. In contrast, mesenchymal cells
from the mes/mes animal displayed a constitutive level of Gli1 message that was not apparent in
cells from the wild type animal. Furthermore, wild type mesenchymal cells responded to
stimulation by Shh with a clear increase in Gli1 expression while Gli1 levels in the mes/mes
mesenchymal cells exhibited no apparent change.
To quantify more carefully the altered expression levels of these two Hh-pathway target
genes, qPCR was performed (Figure 7B). This analysis revealed that while the fold increase in
Ptch1 expression in response to Shh stimulation was similar for wild type and mes/mes
mammary mesenchymal cells (5-fold for wildtype versus 5.5-fold for mes/mes), the level for
Page 59
49
Ptch1 in starved mes/mes mammary mesenchymal cells was 3-fold that of wild type. Consistent
with the previous endpoint RT-PCR data, qPCR analysis of Gli1 revealed a large increase in
expression in wild type mesenchymal cells, while the mes/mes mesenchymal cells produced a
muted (< 2-fold) increase above their constitutively active expression. Taken together, these data
show that mes/mes mammary mesenchymal display elevated levels of Ptch1 and Gli1.
Furthermore, the constitutive Gli1 expression and low response to stimulation in comparison to
wild type cells suggests that there may be multiple mechanisms of Hh-target gene regulation
perturbed by the mes allele.
As an alternative approach to assay the
contribution of Ptch1 intracellular domains to
canonical Hedgehog pathway activation, a
Gli-luciferase reporter assay was performed in Ptch1-/-
MEFs. Previously reported assays have
only assessed the Hh-signalling repression function of Ptch in Ptch1-deficient cells and/or have
been performed in cell lines expressing endogenous Ptch1 (Nieuwenhuis et al., 2007; Rahnama
et al., 2006). Assays involving activation have primarily focused on changes in Ptch activity in
Figure 7. Primary mammary mesenchymal cells containing a Ptch1 C-terminal mutation display constitutive activation of Gli1. Primary mammary mesenchymal cells isolated from littermate wildtype and mes/mes mice were serum starved for 48h, then stimulated with pcDNA3-conditioned media, Shh-conditioned media, or Shh-conditioned media with 1μM SANT-1 for 24h. Qualitative RT-PCR indicates that Ptch1 mRNA levels in cells from both animals respond similarly in response to Shh stimulation, while mes/mes mesenchymal cells display a level of Gli1 expression in the absence of Shh ligand that is not present in mesenchymal cells from wild type animals (A). Quantitative RT-PCR of RNA from a separate cell isolate shows increased basal levels of Ptch1 and Gli1 in mes/mes mammary mesenchymal cells. Both wildtype and mes/mes cells show a similar Ptch1 fold expression response upon Shh stimulation; however, the constitutively active Gli1 expression in mes/mes mammary mesenchymal shows a muted increase in response to Shh stimulation, compared to that of the wildtype samples (B). Data are displayed as mean ± SD, n = 3.
Page 60
50
mutants that delete the extracellular, Hh-ligand-binding domains of Ptch1 or that harbour
specific point mutations (Taipale et al., 2002).
Thus, in order to assess the ability of Ptch1 to repress canonical Hh-signalling as well as
to respond to stimulation by the Hh-ligands, Ptch1-/-
MEFs were transfected with an 8X Gli1-
binding site-luciferase reporter construct, a constitutive renilla luciferase reporter, and expression
vectors for wild type or mutant mPtch1 (Figure 8). Initial experiments focused on the ability of
Ptch1 deletion mutants to repress pathway activity (Figure 8A). Two hundred ng or 25ng of the
Ptch1 expression vectors were transfected with the luciferase reporters, grown for 48h and
assayed for relative luciferase activity. All of the Ptch1 deletion mutants at both concentrations
were capable of repressing Hh-signalling to levels similar to the wild type protein. We then
assessed the ability of these mPtch1 mutants harbouring deletions of the cytoplasmic domains to
respond to Shh stimulation. Ptch1-/-
MEFs were transfected as above with 25ng of Ptch1
expression vectors, grown for 48h, then stimulated with Shh- or control-conditioned media for
24h in low serum (Chen et al., 2011) (Figure 8B). The resulting data were analyzed by two-way
Figure 8. Ptch1 mutants lacking the middle intracellular loop fail to respond to Shh stimulation. Ptch1
-/- MEFs were transfected with an 8X Gli-luciferase reporter, a constitutive renilla luciferase
plasmid, and 25ng or 200ng of the indicated Ptch1 mutant. After 48h the cells were lysed and relative luciferase activity was measured. At both amounts of transfected plasmid, deletions of the Ptch1 C-terminus and the middle intracellular loop both remained capable of repressing canonical Hedgehog signalling. Data are displayed as mean ± SD, n = 3 (A). Reporter constructs and 25ng of the indicated Ptch1 construct were transfected into Ptch1
-/- MEFs as above, grown for 48h, switched to Shh- or
pcDNA3-conditioned media in 0.5% serum for 24h, lysed, and measured for relative luciferase activity. Both Ptch1ΔC and mes produced a significant increase in reporter activity in response to Shh stimulation, while Ptch1ΔML and Ptch1ΔMC did not. Data were analyzed by two-way ANOVA followed by pairwise comparison of means using Tukey's Honest Significant Difference Test. Data are displayed as mean ± SD, n = 6. * p < 0.05, ** p < 0.01, *** p < 0.001 (B).
Page 61
51
Figure 9. Deletion of the Ptch1 large intracellular loop does not affect Shh-binding capability. HEK 293 cells were transfected with wildtype Ptch1, Ptch1 ΔML, or Ptch1ΔStu, and lysed in 1% DDM lysis buffer at 24h post-transfection. Immunoprecipitation of Ptch1 was performed, followed by incubation with Shh:AP-conditioned media. Measurement of the resulting AP activity indicates that Ptch1 and Ptch1ΔML bound similar amounts of the Shh:AP fusion protein, as compared to an untransfected control.
ANOVA followed by pairwise comparison of means using Tukey's Honest Significant
Difference test. Ptch1 (p< 0.001), mes (p= 3518) and Ptch1ΔC (p< 1) all exhibited
statistically significant increases in luciferase activity in response to Shh stimulation, revealing
that the repression of Hh-signalling by these mutants could be reversed by stimulation with Hh-
ligand similar to the wild type protein Interestingly while Δ L and Δ C were able to repress
Hh-signalling, addition of Shh-ligand did not reverse this activity for either ∆ L (p< 1
relative to Ptch1) or Δ C (p= 735 relative to Ptch1)
To ensure that inability of Δ L to respond to Shh stimulation was not caused by its
inability to complex Shh-ligand, an in vitro binding assay using an Shh:AP fusion protein was
performed (Flanagan and Cheng, 2000). Wild type Ptch1 Δ L or ΔStu the latter mutant
deleting the second extracellular loop previously defined as required for Shh-ligand binding
(Briscoe et al., 2001), were transfected into HEK 293s and Ptch1 was immunoprecipitated after
lysis. The immunoprecipitated proteins were then incubated with Shh:AP-conditioned media and
assessed for Shh-binding activity by assaying for alkaline phosphatase activity. Both wild type
mPtch1 and Δ L displayed a >1 -fold increase in alkaline phosphatase activity compared to the
ΔStu mutant or an untransfected control (Figure 9). These results demonstrate that deletion of
the Ptch1 large intracellular loop abrogates the ability to respond to Shh-ligand, despite retaining
the ability to bind.
Page 62
52
As an additional approach to assay the functional capabilities of the previously described
Ptch1 deletion mutants, and knowing that they all clear the secretory pathway, we asked which
of the mutants retained the ability to localize to the primary cilium. Ptch1-/-
MEFs were
Figure 10. Deletion of Ptch1 large intracellular domains does not abolish the capability to localize to the primary cilium. Ptch1
-/- MEFs were transfected with the indicated Ptch1
expression vector, grown for 24h, then serum starved for 48h to promote cilia formation. The cells were then fixed, and immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin. Despite varying expression patterns upon gross overexpression, all of the Ptch1 mutants assayed retained the capability to localize to the primary cilium.
Page 63
53
transfected with equal amounts of the indicated Ptch1 expression construct, grown for 24h, then
serum starved for 48h to promote cilia formation. The cells were then fixed and
immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin.
Although the expression patterns of the Ptch1 deletion mutants assayed varied depending on the
amount of protein being expressed by any given transfected cell, the cells displaying lower levels
of Ptch1 expression retained the ability to localize to the primary cilium. This was observed for
all of the deletion mutants
assayed (Figure 10). Because
commercially available
antibodies against the Ptch1 N-
terminus cannot detect
endogenous levels of Ptch1,
and overexpression of Hh
pathway components can result
in constitutive localization
patterns, we were not able to
assay trafficking in response to
Shh stimulation (Haycraft et
al., 2005; Kovacs et al., 2008).
Thus, we can only conclude
that deletion of Ptch1 large
intracellular domains does not
abolish the capability of
exogenously expressed protein
to localize to the primary
cilium
During the process of
localizing the Ptch1 deletion mutants, we observed an apparent increase in ciliary length for the
Ptch1Δ L mutant To quantify this increase and assay whether expression of other Ptch1
intracellular domain deletion mutants produces an increase in ciliary length, the primary cilia
from transfected and untransfected cells of the same slide were measured. The resulting data
Figure 11. Deletion of the Ptch1 large intracellular loop results in increased ciliary length. Ptch1
-/- MEFs were
transfected with the indicated Ptch1 expression vector, grown for 24h, then serum starved for 48h to promote cilia formation. The cells were then fixed, and immunofluorescence was performed using antibodies against Ptch1 and acetylated tubulin. After observation of an apparent increase in ciliary length in cells transfected with Ptch1ΔML, ciliary length was measured for all Ptch1 mutants assayed. The increase in ciliary length in Ptch ΔML-transfected samples was found to be significant. Data were analyzed by one-tailed Welch's t-tests between groups of transfected and untransfected cells from the same slide. A combined minimum of 28 cilia were analyzed from two independent experiments, and the resulting p-values were corrected for multiple comparisons using the Bonferroni method. Data are displayed as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Page 64
54
were analyzed by performing one-tailed Welch's t-tests between transfected and untransfected
cells of the same Ptch1 deletion mutant transfection and correcting for multiple comparisons
using the Bonferroni method. The increase in ciliary length in cells transfected with Ptch1Δ L
was found to be significant (p<0.001) (Figure 11). This suggests that overexpression of a Ptch1
mutant missing the middle intracellular loop exerts influence on the regulation of ciliary length.
Whether this occurs directly or indirectly, and whether this would occur with expression of Ptch
Δ L at endogenous levels are both yet to be determined
Page 65
55
Discussion
Exogenous Ptch1 and c-src interact in vitro
SH3 domain-mediated interactions are involved in multiple cellular processes, including
signal transduction, cytoskeletal arrangement, growth, and differentiation (Li, 2005). The basic
structure of SH3 domains is a roughly 6 kDa β-barrel structure consisting of two anti-parallel β
sheets, each comprised of three strands, which are connected by three loops and a 310 helix. SH3-
binding ligands are characterized by a three residue-per-turn left-handed helix polyproline type-
II (PPII) motif, and the minimum consensus sequence is a well-characterized PXXP motif (Li,
2005). Furthermore, consensus SH3-binding ligands can be classified as class I or class II, with
respective consensus sequences of +XΦPXΦP and ΦPXΦPX+ where "+" refers to any basic
residue and "Φ" refers to any hydrophobic residue (Li, 2005). Class I and class II consensus
sequences have been identified as assuming opposite orientations when binding to SH3 domains
(Lim et al., 1994; Yu et al., 1994). The study of multiple SH3-mediated interactions has also
revealed the presence of many non-consensus SH3-binding ligand motifs, and interestingly,
these are often associated with high-affinity or highly specific interactions (Saksela and Permi,
2012).
In addition to being able to bind polyproline motifs via their SH3 domain, SFKs can also
bind phosphotyrosine residues via their SH2 domain. The structure of SH2 domains is
characterized by a central β-sheet between two alpha helices, and binding of SH2-ligands
involves insertion of the phospho-tyrosine into a pocket of the central β-sheet via interactions
with arginine and histidine side chains of the SH2 domain (Liu et al., 2012; Waksman et al.,
1992). Different SH2 domains preferentially recognize different ligands usually, but not always,
on the basis of the 3-4 residues C-terminal of the phosphotyrosine (Liu et al., 2012). The SH2
domain of c-src in particular, recognizes preferentially a pYEEI motif (Songyang et al., 1993),
although it is also capable of binding to other sequences.
In this study we have expanded on and further characterized a putative interaction
between Ptch1 and c-src. These studies were suggested based on prior genetic evidence that
mammary epithelial cell-restricted expression of an activated c-src transgene rescued the block in
mammary gland development displayed by mice possessing the Ptch1 C-terminal truncation-
Page 66
56
producing mes allele. Furthermore, GST-pulldown data demonstrated an association between
the isolated C-terminus of Ptch1 and the isolated SH3 domain of c-src. Analysis of the primary
sequence of the large intracellular loop and C-terminus of Ptch1 reveals the presence of multiple
poly-proline motifs, as well as multiple potential tyrosine phosphorylation sites. I showed in
immunoprecipitation assays using intracellular domain deletions of Ptch1 that the C-terminus of
Ptch1 is likely required for this interaction, since truncation of Ptch1 at a.a. 1172 abrogates
strongly the ability to complex c-src. Although initial experiments employed HA-tagged Ptch1,
this tag was later removed since the HA-tag enhanced phosphorylation of full length Ptch1 by
activated c-src and appeared to enhance the strength of the interaction between these two factors
(Figure 12). Interestingly, the mes protein, which partially truncates the C-terminus of Ptch1,
was capable of complexing c-src to the same extent as wild type, indicating that residues
between amino acids 1172 and 1214 contain sequence capable of mediating this interaction. This
sequence contains a minimum SH3-ligand consensus site of PEPP from amino acids 1185 to
1188. It is predicted that point mutation of prolines 1185 and 1188 in conjunction with the mes
truncation may produce a mutant incapable of complexing c-srcAct
.
In addition to being able to complex activated c-src, tyrosine phosphorylation of Ptch1 in
response to c-srcAct
overexpression was also shown. Tyr-phosphorylation was observed for all
three of the intracellular domain deletion proteins assayed, although wild type Ptch1 exhibited
the greatest amount of phosphorylation relative to the amount of Ptch1 immunoprecipitated.
Interestingly, wild type Ptch1 and mes showed similar levels of tyrosine phosphorylation in
response to srcAct
overexpression. Together this indicates that although the C-terminus and
middle intracellular loop may contain tyrosines that are targets for phosphorylation by c-srcAct
,
there undoubtedly are other sites that can act as substrates. This further suggests that there are
other sites outside of the middle intracellular loop and C-terminus that c-srcAct
is capable of
binding to. Although Ptch1 does not possess a preferred c-src substrate motif of
EE(I/V)Y(G/E)EFF (Songyang et al., 1995), analysis with Group Based Prediction 2.1 (GPS
2.1), a primary sequence phospho-site prediction algorithm based on experimentally-verified
phospho-sites from the PhosphoELM database (Xue et al., 2011), predicts four c-src
phosphorylation sites in Ptch1 that are conserved between vertebrates – two in the middle
intracellular loop (Y616 and Y661), one in the second extracellular loop (Y774), and one in the
Page 67
57
C-terminus (Y1211). Thus, Y774 may be a target for tyrosine phosphorylation of Ptch1 even
when the C-terminus and middle intracellular loop are deleted.
The functional significance of this modification is not yet known, although one
possibility is that tyrosine phosphorylation is required for the docking of other SH2-domain-
containing factors. Identification of the exact phosphorylation sites would allow for the
construction c-src-phosphorylation site mutants. These mutants could be expressed virally in
Figure 12. HA-tagged Ptch1 results in altered binding and tyrosine phosphorylation properties in response to activated c-src overexpression. HA-tagged or untagged Ptch1 was transfected into HEK 293 cells with activated c-src and lysed in 1% DDM lysis buffer at 24h post-transfection. After verification of expression levels by western blot (A), immunoprecipitations were performed using a goat α-Ptch1 agarose conjugate antibody or a rabbit α-c-src antibody (B and C, respectively). These indicate a qualitative increase in the amount of protein co-immunoprecipitated by HA-tagged Ptch1 versus untagged Ptch1. The immunoprecipitation of Ptch1 was stripped and reprobed with an α-phosphotyrosine antibody, demonstrating an increased amount of tyrosine phosphorylation of HA-tagged Ptch1 versus untagged Ptch1 (D).
Page 68
58
Ptch1-/-
MEFs and assayed for their ability to mediate known non-canonical Hh signalling
cascades. It is proposed further that it is unlikely that this src-family kinase-mediated
modification is involved in canonical Hh activity since chemical inhibition of SFK activity in
cultured fibroblasts does not have any effect on Gli-luciferase reporter activity (Yam et al.,
2009).
Modulation of the Ptch1-c-src association in response to Shh ligand
In addition to demonstrating association of exogenous Ptch1 and c-srcAct
, the use of
MCF10A cells has identified a dynamic, Hh-ligand-dependent association between
overexpressed Ptch1-HA and endogenous c-src. Specifically, one-hour stimulation with Shh-
conditioned media abolishes the Ptch1-HA-c-src association and is accompanied by an increase
in c-src activation, as determined by p-src-416 protein levels. Current understanding of Ptch1
trafficking suggests that membrane-bound Ptch1 is internalized into endosomal vesicles upon
ligand binding (Incardona et al., 2002; Rohatgi et al., 2007). Conversely, steady-state levels of
activated c-src are primarily associated with the plasma membrane (Donepudi and Resh, 2008),
and growth factor stimulation has been shown to promote the membrane-localization of activated
c-src (Sandilands et al., 2004, 2007). Taken together, this information establishes a hypothesis in
which the Ptch1-c-src association is disrupted due to differential trafficking, with Ptch1 being
internalized and activated c-src remaining at the plasma membrane. A remaining question is
whether Ptch1 associates preferentially with active or inactive c-src. This could be assayed in
vitro by comparing constitutively active c-src and catalytically dead c-src in their ability to
complex with Ptch1.
Whether or not, and in what manner the primary cilium factors into this interaction is still
unclear. To date, the only characterization of c-src function in relation to the primary cilium has
come from a study investigating the role of the actin regulatory protein Missing in Metastasis
(MIM) in Hh signal transduction. Bershteyn et al. demonstrated that through an as-of-yet
undefined mechanism MIM antagonizes SFK activity, which in turn leads to decreased activity
of the actin regulatory protein Cortactin and the promotion of primary cilium formation
(Bershteyn et al., 2010). Furthermore, overexpression of activated c-src inhibits cilia formation
and knockdown of MIM enables the visualization of activated c-src at the basal body of the
Page 69
59
cilium (Bershteyn et al., 2010). Thus, there is a possibility that the primary cilium is involved in
a Ptch1-c-src association.
The fact that activation of c-src in response to Shh was observed in MCF10A cells
indicates that this cascade is likely independent of Smo activity, since this human mammary
epithelial cell line lacks detectable Smo expression (Chang et al., 2010; Zhang et al., 2009). It is
interesting to note, however, that the ability of Shh ligand to activate SFKs has been
characterized for commissural neurons, and this process was shown to be Smo-dependent (Yam
et al., 2009). Together these data suggest the existence of two distinct Shh-induced cascades
capable of activating c-src, and that their presence may vary with cell type. Indeed, the distinct
effects of the mes mutation on development of different tissues supports the notion that distinct
but overlapping sets of signalling cascades may be regulated by the Hh-ligands at the level of
Ptch1.
As a tool to assess the requirement of the Ptch1 C-terminus in non-canonical activation of
c-src, we have employed the use of primary mouse mammary mesenchymal cells from littermate
wild type and mes/mes mice. Wild type mesenchymal cells responded to Shh peptide stimulation
with an increase in c-src activation, while cells from mes/mes animals displayed constitutively
elevated levels of activated c-src that did not increase in response to Shh peptide. This
observation indicates that the C-terminus of Ptch1 could be involved in regulating the levels of
activated c-src in the absence of Hh ligand, mediating the activation of c-src in response to Shh
ligand, or both of these functions. Importantly, both wild type and mes/mes mesenchymal cells
displayed activation of ERK1/2 in response to Shh peptide, suggesting that this cascade is
distinct from that of c-src activation and is not dependent on the Ptch1 C-terminus. It should also
be noted that
The mes allele of Ptch1 is hypomorphic in mammary fibroblasts
Current understanding of the effect of the mes allele on canonical Hh signalling indicates
that Ptch1-dependent inhibition of Smo activity is de-repressed in some tissues, but not in others.
Specifically, while both a previous in vitro analysis of the mes allele via Gli-binding site
luciferase reporter assay and a qualitative RT-PCR of Hh targets in total skin of mes/mes animals
did not reveal any impairment in Smo inhibition (Nieuwenhuis et al., 2007), RT-PCR of
Page 70
60
transcriptional targets of Hh-signalling in epididymal white adipose tissue of mes/mes animals
did (Li et al., 2008b).
Curiously, none of these analyses have investigated the ability of the mes variant of Ptch1
to respond to stimulation by the Hh-ligands. Using serum-starved primary mouse mammary
mesenchymal cells treated with Shh or Shh with SANT-1, we performed qRT-PCR on cells from
littermate wild type and mes/mes animals to assay both the starved and stimulated levels of Ptch1
and Gli1. In the case of Ptch1, cells from mes/mes mice displayed elevated levels of transcript
compared to wild type, but the fold increase between the two was roughly similar. These data
indicate a partial loss of Smo inhibition, but similar ability of mes to respond to Shh stimulation.
Conversely, mes/mes mammary mesenchymal cells exhibited constitutive Gli1 expression that
increased less than two-fold in response to Shh ligand, while cells from wild type animals
showed a ~170-fold induction of Gli1. The muted increase in Gli1 expression in response to Shh
ligand in mes/mes mesenchymal cells suggests that unlike Ptch1, expression of Gli1 in these
cells is near maximal levels in the absence of ligand. Taken together, these results indicate that,
in addition to ectopic pathway activation due to a partial de-repression of Smo activity, a distinct
pathway involved in the transcriptional regulation of Gli1 may also be perturbed in mes/mes
mammary mesenchymal cells.
Multiple studies have identified alternate mechanisms of Gli1 transcriptional activation
that are independent of Shh stimulation. Specifically, expression of oncogenic RAS variants have
been shown to increase Hh-signalling reporter activity as well as GLI1 transcription in a MEK-
dependent manner in pancreatic ductal adenocarcinoma (PDAC) and gastric cancer cell lines (Ji
et al., 2007; Nolan-Stevaux et al., 2009; Seto et al., 2009). In the case of PDAC cells, it has been
demonstrated that this effect may be mediated through regulation of GLI1 protein stability, as
MEK-inhibitor treatment results in reduced GLI1 protein levels within two hours (Ji et al., 2007).
Additionally, the observation that in gastric cancer cell lines, overexpression of SUFU inhibits
induction of Gli-reporter activity via activated MEK or KRAS overexpression also supports
regulation of GLI1 at the protein level (Seto et al., 2009). It is important to note, however, that
contradictory results exist with respect to the effect of oncogenic RAS mutants on Hh pathway
output. A more recent study using both fibroblasts and pancreatic cancer cell lines has suggested
that activated RAS inhibits Hh pathway output by both altering Gli protein processing and
downregulating Gli2 and Gli3 mRNA levels, and that its inhibitory effects are dependent on Sufu
Page 71
61
expression (Lauth et al., 2010). TGF-β is another factor that has been implicated in Hh-
independent regulation of Gli activity. Treatment of fibroblast, breast carcinoma, lung cancer,
and PDAC cell lines with TGF-β has been shown to directly stimulate Gli2 transcription in a
Smad3-dependent manner, leading to subsequent increases in Gli1 transcription (Dennler et al.,
2007; Nolan-Stevaux et al., 2009). While activated RAS and TGF-β seem to activate Gli1
transcription in an indirect manner, both the Ewing sarcoma oncoprotein EWS-FLI1
(Beauchamp et al., 2009), as well as c-Myc (Yoon et al., 2013) have been shown to directly
regulate the Gli1 promoter and drive Gli1 expression independent of Shh stimulation.
In addition to the regulation of Gli1 by via crosstalk with other signalling pathways, one
study has presented evidence that PTCH1, at least when overexpressed, can inhibit GLI1 protein
activity in a non-canonical fashion (Rahnama et al., 2006). This group demonstrated that
overexpression of PTCH1 and GLI1 in HEK 293 or NIH-3T3 cells inhibits the overexpressed
GLI1-mediated activation of a PTCH2 or GLI binding site Hh reporter plasmid. Furthermore,
overexpressed PTCH1 also inhibited the overexpressed GLI1-mediated transcription of
endogenous Gli1 in NIH-3T3 cells. This inhibitory effect of Ptch1 was deemed to be
independent of Smo or Sufu activity based on experiments employing cyclopamine and Sufu-/-
MEFs, respectively. Thus, the exact mechanism of this inhibition remains undefined, as the
authors reported that they could not detect a direct interaction between PTCH1 and GLI1 via co-
immunoprecipitation. A more recent and controversial study has also proposed a non-canonical
inhibitory function of Ptch1. Using a novel antibody against the Ptch1 C-terminus, the authors
detected an endogenous 37kDa C-terminal Ptch1 fragment that preferentially localizes to the
nucleus in fibroblasts (Kagawa et al., 2011). Moreover, overexpression of this fragment inhibited
overexpressed Gli1-mediated Hh reporter activity in HeLa cells, indicating that it possesses
repressive function through an as-of-yet undefined mechanism. It is interesting to note, however,
that the inhibitory Ptch1 function described by Rahnama et al. is unlikely to be the same as that
of Kagawa et al., since expression of a C-terminally truncated PTCH1 variant showed the same
inhibitory capability as wild type PTCH1 in Rahnama et al.'s assay.
One caveat with any of the aforementioned factors or mechanisms being involved in the
constitutive Gli1 expression observed in mes/mes primary mammary mesenchymal cells is that,
with the exception of the work of Kagawa et al., they have all been shown to function
independently of Smo, whereas the constitutive activation conferred by the mes allele is fully
Page 72
62
sensitive to SANT-1 treatment. Thus, there is no obvious explanation for the SANT-1-sensitive
elevated levels of Gli1 observed in mes/mes mesenchymal cells outside of them being a result of
attenuated Smo inhibition. It would also be worthwhile, then, to assess the levels of other Hh
target genes in mes/mes mammary mesenchymal cells to see if they respond to Shh stimulation
in a manner more similar to Ptch1 or Gli1. If the former, then that would indicate that, despite
there not being a clear explanation in the literature, there is in fact a secondary mechanism of
Gli1 regulation that is disrupted due to truncation of the Ptch C-terminus.
Loss of the Ptch1 middle intracellular loop results in an inability to respond
to Shh stimulation
To date, the most comprehensive analysis of the function of individual Ptch1 domains in
canonical pathway activation has come from Taipale et al. This group reconstituted a soft agar-
cloned Ptch1-/-
MEF-derived line with Ptch1 point mutations identified from NBCCS patients
and performed transient luciferase reporter assays in order to measure both pathway repression
and response to stimulation (Taipale et al., 2002). Although this study identified that point
mutation of select SSD residues that are conserved with bacterial RND transporters attenuates
Ptch1 repressive function, a comparative deletion analysis of Ptch1 intracellular domains has not
yet been performed. Using deletions of the Ptch1 C-terminus, middle intracellular loop, as well
as the mes allele, we have performed this assay in Ptch1-/-
MEFs. All deletion mutants assayed
retained the ability to repress Smo activity; however, mutants possessing a deletion of the middle
intracellular loop were unable to respond to Shh ligand.
The mechanism preventing Hh-ligand-dependent pathway stimulation in the presence of
these mutanhts remains undefined, although it is not due to an inability to bind Shh, as shown by
an Shh:AP-binding alkaline phosphatase binding assay. An alternative hypothesis could be that
this domain is required for proper exit from the primary cilium or proper internalization of Ptch1
upon ligand binding. Indeed, recent work has demonstrated that the Bardet-Biedel syndrome
(BBS) protein complex, the BBSome, is involved in the proper exit of both Ptch1 and Smo from
the primary cilium (Zhang et al., 2012). Additionally, the BBSome subunit BBS1 was shown to
co-immunoprecipitate with the overexpressed, isolated C-terminus of PTCH1 in HEK 293 cells,
Page 73
63
and this interaction requires residues 1321-1447 of human PTCH1 (Zhang et al., 2012). While
this study showed binding of BBS1 to the isolated PTCH1 C-terminus, work from our lab has
identified that factors capable of interacting with the isolated Ptch1 C-terminus can occasionally
display differential domain requirements in the context of interaction with full-length Ptch1 (A.
Tamachi, unpublished observation). Hence, it would be worthwhile to determine if the large
intracellular loop of Ptch1 is also involved in mediating interaction between BBS1 and full-
length Ptch1. Another alternative hypothesis for the inability of Ptch1 large intracellular loop
deletions to respond to Shh ligand is that loss of this domain may disrupt interaction with Boc,
Cdo, or Gas-1. Presumably, disruption of these interactions would still allow pathway repression,
but attenuate the ability to receive and sequester ligand. The in vitro structural requirements for
these interactions could be determined via co-immunoprecipitation assays. It is also worth noting
that Ming et al. identified the human PTCH1 T728M mutation in two separate HPE cases, hence
mutation of this residue may be of importance in conferring a presumed gain-of-function effect
with respect to pathway inhibition, potentially through disruption of one of the aforementioned
mechanisms (Ming et al., 2002).
To further characterize the canonical Hh pathway function of the Ptch1 intracellular
domain deletions, their ability to traffic to the primary cilium was assessed. There are, however,
two intertwined drawbacks that limit the conclusions that can be drawn from these experiments.
First, transfection of the Ptch1 mutants produces variably overexpressed protein levels that are
unlikely to mimic endogenous functionality. Second, this problem is further compounded by the
limited immuno-reagents currently available for Ptch1 detection. To date, all published
antibodies capable of reliable detection of endogenous Ptch1 have been independently produced
and raised against the C-terminus – residues 1238-1413 of mouse Ptch1 (Ocbina et al., 2011;
Rohatgi et al., 2007), residues 1321-1427 of mouse Ptch1 (Bidet et al., 2011), and residues 1420-
1434 of human PTCH1 (Kagawa et al., 2011). Of these, antisera raised against the mouse Ptch1
1238-1413 immunogen has been used commonly for detection of Ptch1 by immunofluorescence
in high impact studies. Because our focus is on the functionality of the middle intracellular loop
and C-terminal domains, we have employed a commercially available antibody against the Ptch1
N-terminus. Unfortunately, this reagent is not capable of detecting Ptch1 expressed at
endogenous levels. This creates a dilemma whereby overexpression is required for detection, but
limits the ability to perform functional assays. Thus, the only conclusion we can draw from this
Page 74
64
set of localization experiments is that all of the Ptch1 deletion mutants tested retain the capability
to localize to the primary cilium. Testing the trafficking of these mutants in response to Shh
ligand would require either an antibody that is capable of detecting physiological levels of Ptch1,
or the use of viral or stably-transfected expression of tagged Ptch1 mutants.
While in the process of localizing the Ptch1 deletion mutants, it was observed that the
Ptch1Δ L mutant appeared to produce an increase in ciliary length Upon quantification this
increase was determined to be significant. The cause of this phenomenon is not currently known,
although one possibility is that the ability of the Ptch1Δ L mutant to transiently exit the primary
cilium is perturbed, while its ability to localize to the cilium is not. Therefore when
overexpressed, this mutant may accumulate in the primary cilium to such an extent that the
function of the retrograde IFT machinery required for cilia disassembly is impaired. Certainly, a
defect in its ability to either traffic transiently out of the cilium or be internalized in response to
ligand would match with the luciferase reporter data. It would also be interesting to determine if
this increase in ciliary length is observed when Ptch1Δ L is expressed at near physiological
levels. Such a finding would indicate that the increase in ciliary length is not a by-product of
overexpression, but rather the result of a direct influence on cilia assembly/disassembly by
mutant Ptch1.
Conclusions
In summary, this work offers a further characterization of the role of Ptch1 intracellular
domains in both canonical and non-canonical Hh signalling pathways. We have further
characterized the interaction between Ptch1 and c-src, demonstrating that the C-terminus of
Ptch1 is required for this interaction and that Ptch1 is a target for tyrosine phosphorylation by
activated c-src. Additionally, the nature of this association in response to Shh stimulation was
also assayed, showing that the Ptch1-c-src association is disrupted in response to Shh ligand and
that the Ptch1 C-terminus is involved in the regulation of Shh-mediated c-src activation, but not
Shh-mediated ERK1/2 activation. Taken together, this suggests that the previously identified
non-canonical genetic interaction between Ptch1 and c-src may also involve a dynamic physical
association.
Page 75
65
In addition to the characterization of non-canonical Ptch1 function, this work has also
assessed the contribution of the large intracellular domains of Ptch1 to canonical Hh pathway
activity. Specifically, in vitro luciferase reporter assays identified that the middle intracellular
loop is essential for response to Shh stimulation, while the C-terminus is not. Interestingly,
although as measured by luciferase reporter assay, the mes allele does not result in any noticeable
attenuation of Smo-inhibition, analysis in primary mammary mesenchymal cells suggests
otherwise. Direct measurement of Ptch1 and Gli1 transcriptional output revealed the presence of
Smo-dependent constitutive elevation of Hh target genes, indicating that the Ptch1 C-terminus
does in fact contribute to Smo-repression. These experiments also highlight the importance of,
whenever possible, employing systems comprised entirely of endogenous components.
Page 76
66
References
Adolphe, C., Hetherington, R., Ellis, T., and Wainwright, B. (2006). Patched1 functions as a
gatekeeper by promoting cell cycle progression. Cancer Res. 66, 2081–2088.
Agren, M., Kogerman, P., Kleman, M.I., Wessling, M., and Toftgard, R. (2004). Expression of
the PTCH1 tumor suppressor gene is regulated by alternative promoters and a single functional
Gli-binding site. Gene 330, 101–114.
Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M., and Hooper, J.E. (1996). The Drosophila
smoothened gene encodes a seven-pass membrane protein, a putative receptor for the hedgehog
signal. Cell 86, 221–232.
Allen, B.L., Tenzen, T., and McMahon, A.P. (2007). The Hedgehog-binding proteins Gas1 and
Cdo cooperate to positively regulate Shh signaling during mouse development. Genes Dev 21,
1244–1257.
Allen, B.L., Song, J.Y., Izzi, L., Althaus, I.W., Kang, J.-S., Charron, F., Krauss, R.S., and
McMahon, A.P. (2011). Overlapping roles and collective requirement for the coreceptors GAS1,
CDO, and BOC in SHH pathway function. Dev. Cell 20, 775–787.
Amanai, K., and Jiang, J. (2001). Distinct roles of Central missing and Dispatched in sending the
Hedgehog signal. Development 128, 5119–5127.
Ansarin, H., Daliri, M., and Soltani-Arabshahi, R. (2006). Expression of p53 in aggressive and
non-aggressive histologic variants of basal cell carcinoma. Eur. J. Dermatol. EJD 16, 543–547.
Apionishev, S., Katanayeva, N.M., Marks, S.A., Kalderon, D., and Tomlinson, A. (2005).
Drosophila Smoothened phosphorylation sites essential for Hedgehog signal transduction. Nat
Cell Biol 7, 86–92.
Aszterbaum, M., Rothman, A., Johnson, R.L., Fisher, M., Xie, J., Bonifas, J.M., Zhang, X.,
Scott, M.P., and Epstein, E.H. (1998). Identification of Mutations in the Human PATCHED
Gene in Sporadic Basal Cell Carcinomas and in Patients with the Basal Cell Nevus Syndrome. J.
Invest. Dermatol. 110, 885–888.
Aszterbaum, M., Epstein, J., Oro, A., Douglas, V., LeBoit, P.E., Scott, M.P., and Epstein, E.H.
(1999). Ultraviolet and ionizing radiation enhance the growth of BCCs and trichoblastomas in
patched heterozygous knockout mice. Nat Med 5, 1285–1291.
Auepemkiate, S., Boonyaphiphat, P., and Thongsuksai, P. (2002). p53 expression related to the
aggressive infiltrative histopathological feature of basal cell carcinoma. Histopathology 40, 568–
573.
Ayrault, O., Zindy, F., Rehg, J., Sherr, C.J., and Roussel, M.F. (2009). Two tumor suppressors,
p27Kip1 and patched-1, collaborate to prevent medulloblastoma. Mol. Cancer Res. MCR 7, 33–
40.
Page 77
67
Bae, G.-U., Domene, S., Roessler, E., Schachter, K., Kang, J.-S., Muenke, M., and Krauss, R.S.
(2011). Mutations in CDON, Encoding a Hedgehog Receptor, Result in Holoprosencephaly and
Defective Interactions with Other Hedgehog Receptors. Am. J. Hum. Genet. 89, 231–240.
Bai, C.B., Auerbach, W., Lee, J.S., Stephen, D., and Joyner, A.L. (2002). Gli2, but not Gli1, is
required for initial Shh signaling and ectopic activation of the Shh pathway. Development 129,
4753–4761.
Bai, C.B., Stephen, D., and Joyner, A.L. (2004). All mouse ventral spinal cord patterning by
hedgehog is Gli dependent and involves an activator function of Gli3. Dev Cell 6, 103–115.
Bailey, E.C., Milenkovic, L., Scott, M.P., Collawn, J.F., and Johnson, R.L. (2002). Several
PATCHED1 missense mutations display activity in patched1-deficient fibroblasts. J. Biol. Chem.
277, 33632–33640.
Barakat, M.T., Humke, E.W., and Scott, M.P. (2010). Learning from Jekyll to control Hyde:
Hedgehog signaling in development and cancer. Trends Mol. Med. 16, 337–348.
Barnes, E.A., Kong, M., Ollendorff, V., and Donoghue, D.J. (2001). Patched1 interacts with
cyclin B1 to regulate cell cycle progression. EMBO J. 20, 2214–2223.
Barnes, E.A., Heidtman, K.J., and Donoghue, D.J. (2005). Constitutive activation of the shh-ptc1
pathway by a patched1 mutation identified in BCC. Oncogene 24, 902–915.
Barzi, M., Berenguer, J., Menendez, A., Alvarez-Rodriguez, R., and Pons, S. (2010). Sonic-
hedgehog-mediated proliferation requires the localization of PKA to the cilium base. J. Cell Sci.
123, 62–69.
Beauchamp, E., Bulut, G., Abaan, O., Chen, K., Merchant, A., Matsui, W., Endo, Y., Rubin, J.S.,
Toretsky, J., and Uren, A. (2009). GLI1 Is a Direct Transcriptional Target of EWS-FLI1
Oncoprotein. J. Biol. Chem. 284, 9074–9082.
Berman, D.M., Karhadkar, S.S., Hallahan, A.R., Pritchard, J.I., Eberhart, C.G., Watkins, D.N.,
Chen, J.K., Cooper, M.K., Taipale, J., Olson, J.M., et al. (2002). Medulloblastoma growth
inhibition by hedgehog pathway blockade. Science 297, 1559–1561.
Bershteyn, M., Atwood, S.X., Woo, W.-M., Li, M., and Oro, A.E. (2010). MIM and cortactin
antagonism regulates ciliogenesis and hedgehog signaling. Dev. Cell 19, 270–283.
Bertolacini, C.D.P., Ribeiro-Bicudo, L.A., Petrin, A., Richieri-Costa, A., and Murray, J.C.
(2012). Clinical findings in patients with GLI2 mutations--phenotypic variability. Clin. Genet.
81, 70–75.
Bhatia, N., Thiyagarajan, S., Elcheva, I., Saleem, M., Dlugosz, A., Mukhtar, H., and Spiegelman,
V.S. (2006). Gli2 is targeted for ubiquitination and degradation by beta-TrCP ubiquitin ligase. J
Biol Chem 281, 19320–19326.
Page 78
68
Bidet, M., Joubert, O., Lacombe, B., Ciantar, M., Nehmé, R., Mollat, P., Brétillon, L., Faure, H.,
Bittman, R., Ruat, M., et al. (2011). The hedgehog receptor patched is involved in cholesterol
transport. PloS One 6, e23834.
Bijlsma, M.F., Spek, C.A., Zivkovic, D., van de Water, S., Rezaee, F., and Peppelenbosch, M.P.
(2006). Repression of smoothened by patched-dependent (pro-)vitamin D3 secretion. PLoS Biol.
4, e232.
Blair, H.J., Tompson, S., Liu, Y.-N., Campbell, J., MacArthur, K., Ponting, C.P., Ruiz-Perez,
V.L., and Goodship, J.A. (2011). Evc2 is a positive modulator of Hedgehog signalling that
interacts with Evc at the cilia membrane and is also found in the nucleus. BMC Biol. 9, 14.
Bolshakov, S., Walker, C.M., Strom, S.S., Selvan, M.S., Clayman, G.L., El-Naggar, A.,
Lippman, S.M., Kripke, M.L., and Ananthaswamy, H.N. (2003). p53 Mutations in Human
Aggressive and Nonaggressive Basal and Squamous Cell Carcinomas. Clin. Cancer Res. 9, 228–
234.
Brash, D.E. (1997). Sunlight and the onset of skin cancer. Trends Genet. 13, 410–414.
Briggs, K.J., Corcoran-Schwartz, I.M., Zhang, W., Harcke, T., Devereux, W.L., Baylin, S.B.,
Eberhart, C.G., and Watkins, D.N. (2008). Cooperation between the Hic1 and Ptch1 tumor
suppressors in medulloblastoma. Genes Dev. 22, 770–785.
Briscoe, J., Chen, Y., Jessell, T.M., and Struhl, G. (2001). A Hedgehog-Insensitive Form of
Patched Provides Evidence for Direct Long-Range Morphogen Activity of Sonic Hedgehog in
the Neural Tube. Mol. Cell 7, 1279–1291.
Brugières, L., Pierron, G., Chompret, A., Paillerets, B.B., Di Rocco, F., Varlet, P., Pierre-Kahn,
A., Caron, O., Grill, J., and Delattre, O. (2010). Incomplete penetrance of the predisposition to
medulloblastoma associated with germ-line SUFU mutations. J. Med. Genet. 47, 142–144.
Brugières, L., Remenieras, A., Pierron, G., Varlet, P., Forget, S., Byrde, V., Bombled, J., Puget,
S., Caron, O., Dufour, C., et al. (2012). High frequency of germline SUFU mutations in children
with desmoplastic/nodular medulloblastoma younger than 3 years of age. J. Clin. Oncol. Off. J.
Am. Soc. Clin. Oncol. 30, 2087–2093.
Buglino, J.A., and Resh, M.D. (2008). Hhat is a palmitoylacyltransferase with specificity for N-
palmitoylation of Sonic Hedgehog. J. Biol. Chem. 283, 22076–22088.
Burke, R., Nellen, D., Bellotto, M., Hafen, E., Senti, K.A., Dickson, B.J., and Basler, K. (1999).
Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-
modified hedgehog from signaling cells. Cell 99, 803–815.
Buttitta, L., Mo, R., Hui, C.C., and Fan, C.M. (2003). Interplays of Gli2 and Gli3 and their
requirement in mediating Shh-dependent sclerotome induction. Development 130, 6233–6243.
Caparrós-Martín, J.A., Valencia, M., Reytor, E., Pacheco, M., Fernandez, M., Perez-Aytes, A.,
Gean, E., Lapunzina, P., Peters, H., Goodship, J.A., et al. (2013). The ciliary Evc/Evc2 complex
Page 79
69
interacts with Smo and controls Hedgehog pathway activity in chondrocytes by regulating
Sufu/Gli3 dissociation and Gli3 trafficking in primary cilia. Hum. Mol. Genet. 22, 124–139.
Carpenter, D., Stone, D.M., Brush, J., Ryan, A., Armanini, M., Frantz, G., Rosenthal, A., and de
Sauvage, F.J. (1998). Characterization of two patched receptors for the vertebrate hedgehog
protein family. Proc Natl Acad Sci U S 95, 13630–13634.
Caspary, T., Garcia-Garcia, M.J., Huangfu, D., Eggenschwiler, J.T., Wyler, M.R., Rakeman,
A.S., Alcorn, H.L., and Anderson, K.V. (2002). Mouse Dispatched homolog1 is required for
long-range, but not juxtacrine, Hh signaling. Curr Biol 12, 1628–1632.
Chamoun, Z., Mann, R.K., Nellen, D., von Kessler, D.P., Bellotto, M., Beachy, P.A., and Basler,
K. (2001). Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the
hedgehog signal. Science 293, 2080–2084.
Chang, D.T., Lopez, A., von Kessler, D.P., Chiang, C., Simandl, B.K., Zhao, R., Seldin, M.F.,
Fallon, J.F., and Beachy, P.A. (1994). Products, genetic linkage and limb patterning activity of a
murine hedgehog gene. Development 120, 3339–3353.
Chang, H., Li, Q., Moraes, R.C., Lewis, M.T., and Hamel, P.A. (2010). Activation of Erk by
sonic hedgehog independent of canonical hedgehog signalling. Int. J. Biochem. Cell Biol. 42,
1462–1471.
Chang, H., Balenci, L., Okolowsky, N., Muller, W.J., and Hamel, P.A. (2012). Mammary
epithelial-restricted expression of activated c-src rescues the block to mammary gland
morphogenesis due to the deletion of the C-terminus of Patched-1. Dev. Biol. 370, 187–197.
Chang, S.-C., Mulloy, B., Magee, A.I., and Couchman, J.R. (2011). Two distinct sites in sonic
Hedgehog combine for heparan sulfate interactions and cell signaling functions. J. Biol. Chem.
286, 44391–44402.
Chang, T.-Y., Chang, C.C.Y., Ohgami, N., and Yamauchi, Y. (2006). Cholesterol sensing,
trafficking, and esterification. Annu. Rev. Cell Dev. Biol. 22, 129–157.
Chen, J.K., Taipale, J., Young, K.E., Maiti, T., and Beachy, P.A. (2002). Small molecule
modulation of Smoothened activity. Proc Natl Acad Sci U S 99, 14071–14076.
Chen, M.H., Li, Y.J., Kawakami, T., Xu, S.M., and Chuang, P.T. (2004a). Palmitoylation is
required for the production of a soluble multimeric Hedgehog protein complex and long-range
signaling in vertebrates. Genes Dev 18, 641–659.
Chen, M.-H., Wilson, C.W., Li, Y.-J., Law, K.K.L., Lu, C.-S., Gacayan, R., Zhang, X., Hui, C.,
and Chuang, P.-T. (2009). Cilium-independent regulation of Gli protein function by Sufu in
Hedgehog signaling is evolutionarily conserved. Genes Dev. 23, 1910–1928.
Chen, W., Ren, X.R., Nelson, C.D., Barak, L.S., Chen, J.K., Beachy, P.A., De Sauvage, F., and
Lefkowitz, R.J. (2004b). Activity-dependent internalization of smoothened mediated by beta-
arrestin 2 and GRK2. Science 306, 2257–2260.
Page 80
70
Chen, X., Tukachinsky, H., Huang, C.-H., Jao, C., Chu, Y.-R., Tang, H.-Y., Mueller, B.,
Schulman, S., Rapoport, T.A., and Salic, A. (2011a). Processing and turnover of the Hedgehog
protein in the endoplasmic reticulum. J. Cell Biol. 192, 825–838.
Chen, Y., Sasai, N., Ma, G., Yue, T., Jia, J., Briscoe, J., and Jiang, J. (2011b). Sonic Hedgehog
dependent phosphorylation by CK1α and GRK2 is required for ciliary accumulation and
activation of smoothened. PLoS Biol. 9, e1001083.
Chen, Y., Yue, S., Xie, L., Pu, X., Jin, T., and Cheng, S.Y. (2011c). Dual Phosphorylation of
Suppressor of Fused (Sufu) by PKA and GSK3? Regulates Its Stability and Localization in the
Primary Cilium. J. Biol. Chem. 286, 13502–13511.
Cheung, H.O.-L., Zhang, X., Ribeiro, A., Mo, R., Makino, S., Puviindran, V., Law, K.K.L.,
Briscoe, J., and Hui, C.-C. (2009). The kinesin protein Kif7 is a critical regulator of Gli
transcription factors in mammalian hedgehog signaling. Sci. Signal. 2, ra29.
Chinchilla, P., Xiao, L., Kazanietz, M.G., and Riobo, N.A. (2010). Hedgehog proteins activate
pro-angiogenic responses in endothelial cells through non-canonical signaling pathways. Cell
Cycle Georget. Tex 9, 570–579.
Christ, A., Christa, A., Kur, E., Lioubinski, O., Bachmann, S., Willnow, T.E., and Hammes, A.
(2012). LRP2 Is an Auxiliary SHH Receptor Required to Condition the Forebrain Ventral
Midline for Inductive Signals. Dev. Cell 22, 268–278.
Chuang, P.T., and McMahon, A.P. (1999). Vertebrate Hedgehog signalling modulated by
induction of a Hedgehog-binding protein. Nature 397, 617–621.
Chuang, P.T., Kawcak, T., and McMahon, A.P. (2003). Feedback control of mammalian
Hedgehog signaling by the Hedgehog-binding protein, Hip1, modulates Fgf signaling during
branching morphogenesis of the lung. Genes Dev 17, 342–347.
Cobourne, M.T., Miletich, I., and Sharpe, P.T. (2004). Restriction of sonic hedgehog signalling
during early tooth development. Dev. Camb. Engl. 131, 2875–2885.
Cole, F., and Krauss, R.S. (2003). Microform holoprosencephaly in mice that lack the Ig
superfamily member Cdon. Curr. Biol. CB 13, 411–415.
Cole, D.G., Diener, D.R., Himelblau, A.L., Beech, P.L., Fuster, J.C., and Rosenbaum, J.L.
(1998). Chlamydomonas kinesin-II-dependent intraflagellar transport (IFT): IFT particles
contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. J. Cell
Biol. 141, 993–1008.
Cooper, A.F., Yu, K.P., Brueckner, M., Brailey, L.L., Johnson, L., McGrath, J.M., and Bale,
A.E. (2005). Cardiac and CNS defects in a mouse with targeted disruption of suppressor of
fused. Development 132, 4407–4417.
Cooper, M.K., Wassif, C.A., Krakowiak, P.A., Taipale, J., Gong, R., Kelley, R.I., Porter, F.D.,
and Beachy, P.A. (2003). A defective response to Hedgehog signaling in disorders of cholesterol
biosynthesis. Nat Genet 33, 508–513.
Page 81
71
Corbit, K.C., Aanstad, P., Singla, V., Norman, A.R., Stainier, D.Y.R., and Reiter, J.F. (2005).
Vertebrate Smoothened functions at the primary cilium. Nature 437, 1018–1021.
Corcoran, R.B., and Scott, M.P. (2006). Oxysterols stimulate Sonic hedgehog signal transduction
and proliferation of medulloblastoma cells. Proc Natl Acad Sci U S 103, 8408–8413.
Cowan, R., Hoban, P., Kelsey, A., Birch, J.M., Gattamaneni, R., and Evans, D.G. (1997). The
gene for the naevoid basal cell carcinoma syndrome acts as a tumour-suppressor gene in
medulloblastoma. Br. J. Cancer 76, 141–145.
Creanga, A., Glenn, T.D., Mann, R.K., Saunders, A.M., Talbot, W.S., and Beachy, P.A. (2012).
Scube/You activity mediates release of dually lipid-modified Hedgehog signal in soluble form.
Genes Dev. 26, 1312–1325.
Crowson, A.N. (2006). Basal cell carcinoma: biology, morphology and clinical implications.
Mod. Pathol. 19, S127–S147.
Dahmane, N., Lee, J., Robins, P., Heller, P., and Altaba, A.R. i (1997). Activation of the
transcription factor Gli1 and the Sonic hedgehog signalling pathway in skin tumours. Nature
389, 876–881.
Dai, P., Akimaru, H., Tanaka, Y., Maekawa, T., Nakafuku, M., and Ishii, S. (1999). Sonic
Hedgehog-induced activation of the Gli1 promoter is mediated by GLI3. J. Biol. Chem. 274,
8143–8152.
Danaee, H., Karagas, M.R., Kelsey, K.T., Perry, A.E., and Nelson, H.H. (2006). Allelic loss at
Drosophila patched gene is highly prevalent in Basal and squamous cell carcinomas of the skin.
J. Invest. Dermatol. 126, 1152–1158.
Daya-Grosjean, L., and Sarasin, A. (2000). UV-specific mutations of the human patched gene in
basal cell carcinomas from normal individuals and xeroderma pigmentosum patients. Mutat. Res.
Mol. Mech. Mutagen. 450, 193–199.
Dennler, S., André, J., Alexaki, I., Li, A., Magnaldo, T., Dijke, P. ten, Wang, X.-J., Verrecchia,
F., and Mauviel, A. (2007). Induction of Sonic Hedgehog Mediators by Transforming Growth
Factor-β: Smad3-Dependent Activation of Gli2 and Gli1 Expression In vitro and In vivo. Cancer
Res. 67, 6981–6986.
Dessaud, E., McMahon, A.P., and Briscoe, J. (2008). Pattern formation in the vertebrate neural
tube: a sonic hedgehog morphogen-regulated transcriptional network. Dev. Camb. Engl. 135,
2489–2503.
Dierker, T., Dreier, R., Petersen, A., Bordych, C., and Grobe, K. (2009). Heparan sulfate-
modulated, metalloprotease-mediated sonic hedgehog release from producing cells. J. Biol.
Chem. 284, 8013–8022.
Ding, Q., Motoyama, J., Gasca, S., Mo, R., Sasaki, H., Rossant, J., and Hui, C.C. (1998).
Diminished Sonic hedgehog signaling and lack of floor plate differentiation in Gli2 mutant mice.
Dev. Camb. Engl. 125, 2533–2543.
Page 82
72
Ding, Q., Fukami, S. i, Meng, X., Nishizaki, Y., Zhang, X., Sasaki, H., Dlugosz, A., Nakafuku,
M., and Hui, C. c (1999). Mouse suppressor of fused is a negative regulator of sonic hedgehog
signaling and alters the subcellular distribution of Gli1. Curr. Biol. CB 9, 1119–1122.
Donepudi, M., and Resh, M.D. (2008). c-Src trafficking and co-localization with the EGF
receptor promotes EGF ligand-independent EGF receptor activation and signaling. Cell. Signal.
20, 1359–1367.
Dong, J., Gailani, M.R., Pomeroy, S.L., Reardon, D., and Bale, A.E. (2000). Identification of
PATCHED mutations in medulloblastomas by direct sequencing. Hum. Mutat. 16, 89–90.
Dorn, K.V., Hughes, C.E., and Rohatgi, R. (2012). A Smoothened-Evc2 complex transduces the
Hedgehog signal at primary cilia. Dev. Cell 23, 823–835.
Dubourg, C., Lazaro, L., Pasquier, L., Bendavid, C., Blayau, M., Duff, F.L., Durou, M.-R.,
Odent, S., and David, V. (2004). Molecular screening of SHH, ZIC2, SIX3, and TGIF genes in
patients with features of holoprosencephaly spectrum: Mutation review and genotype–phenotype
correlations. Hum. Mutat. 24, 43–51.
Dubourg, C., Bendavid, C., Pasquier, L., Henry, C., Odent, S., and David, V. (2007).
Holoprosencephaly. Orphanet J. Rare Dis. 2, 8.
Dwyer, J.R., Sever, N., Carlson, M., Nelson, S.F., Beachy, P.A., and Parhami, F. (2007).
Oxysterols are novel activators of the hedgehog signaling pathway in pluripotent mesenchymal
cells. J. Biol. Chem. 282, 8959–8968.
Eaton, S. (2008). Multiple roles for lipids in the Hedgehog signalling pathway. Nat. Rev. Mol.
Cell Biol. 9, 437–445.
Echelard, Y., Epstein, D.J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J.A., and McMahon,
A.P. (1993). Sonic hedgehog, a member of a family of putative signaling molecules, is
implicated in the regulation of CNS polarity. Cell 75, 1417–1430.
Endoh-Yamagami, S., Evangelista, M., Wilson, D., Wen, X., Theunissen, J.-W., Phamluong, K.,
Davis, M., Scales, S.J., Solloway, M.J., de Sauvage, F.J., et al. (2009). The mammalian Cos2
homolog Kif7 plays an essential role in modulating Hh signal transduction during development.
Curr. Biol. CB 19, 1320–1326.
Epstein, D.J., Marti, E., Scott, M.P., and McMahon, A.P. (1996). Antagonizing cAMP-dependent
protein kinase A in the dorsal CNS activates a conserved Sonic hedgehog signaling pathway.
Dev. Camb. Engl. 122, 2885–2894.
Etheridge, L.A., Crawford, T.Q., Zhang, S., and Roelink, H. (2010). Evidence for a role of
vertebrate Disp1 in long-range Shh signaling. Dev. Camb. Engl. 137, 133–140.
Evangelista, M., Lim, T.Y., Lee, J., Parker, L., Ashique, A., Peterson, A.S., Ye, W., Davis, D.P.,
and de Sauvage, F.J. (2008). Kinome siRNA screen identifies regulators of ciliogenesis and
hedgehog signal transduction. Sci. Signal. 1, ra7.
Page 83
73
Evans, D.G., Ladusans, E.J., Rimmer, S., Burnell, L.D., Thakker, N., and Farndon, P.A. (1993).
Complications of the naevoid basal cell carcinoma syndrome: results of a population based
study. J. Med. Genet. 30, 460–464.
Evans, D.G., Howard, E., Giblin, C., Clancy, T., Spencer, H., Huson, S.M., and Lalloo, F.
(2010). Birth incidence and prevalence of tumor-prone syndromes: estimates from a UK family
genetic register service. Am. J. Med. Genet. A. 152A, 327–332.
Fan, Z., Li, J., Du, J., Zhang, H., Shen, Y., Wang, C.-Y., and Wang, S. (2008). A missense
mutation in PTCH2 underlies dominantly inherited NBCCS in a Chinese family. J. Med. Genet.
45, 303–308.
Farndon, P.A., Del Mastro, R.G., Kilpatrick, M.W., and Evans, D.R.G. (1992). Location of gene
for Gorlin syndrome. The Lancet 339, 581–582.
Feng, W., Choi, I., Clouthier, D., Niswander, L., and Williams, T. (2013). The Ptch1(DL)
mouse: A new model to study lambdoid craniosynosytsosis and basal cell nevus syndrome
associated skeletal defects. Genes. New York N 2000.
Fietz, M.J., Jacinto, A., Taylor, A.M., Alexandre, C., and Ingham, P.W. (1995). Secretion of the
amino-terminal fragment of the hedgehog protein is necessary and sufficient for hedgehog
signalling in Drosophila. Curr. Biol. CB 5, 643–650.
Flanagan, J.G., and Cheng, H.J. (2000). Alkaline phosphatase fusion proteins for molecular
characterization and cloning of receptors and their ligands. Methods Enzymol. 327, 198–210.
Follit, J.A., Xu, F., Keady, B.T., and Pazour, G.J. (2009). Characterization of mouse IFT
complex B. Cell Motil. Cytoskeleton 66, 457–468.
Fombonne, J., Bissey, P.-A., Guix, C., Sadoul, R., Thibert, C., and Mehlen, P. (2012). Patched
dependence receptor triggers apoptosis through ubiquitination of caspase-9. Proc. Natl. Acad.
Sci. 109, 10510–10515.
Fujii, K., Ohashi, H., Suzuki, M., Hatsuse, H., Shiohama, T., Uchikawa, H., and Miyashita, T.
(2013). Frameshift mutation in the PTCH2 gene can cause nevoid basal cell carcinoma
syndrome. Fam. Cancer.
Gailani, M.R., Bale, S.J., Leffell, D.J., DiGiovanna, J.J., Peck, G.L., Poliak, S., Drum, M.A.,
Pastakia, B., McBride, O.W., Kase, R., et al. (1992). Developmental defects in gorlin syndrome
related to a putative tumor suppressor gene on chromosome 9. Cell 69, 111–117.
Gailani, M.R., Ståhle-Bäckdahl, M., Leffell, D.J., Glyn, M., Zaphiropoulos, P.G., Undén, A.B.,
Dean, M., Brash, D.E., Bale, A.E., and Toftgård, R. (1996). The role of the human homologue of
Drosophila patched in sporadic basal cell carcinomas. Nat. Genet. 14, 78–81.
Galdzicka, M., Patnala, S., Hirshman, M.G., Cai, J.-F., Nitowsky, H., Egeland, J.A., and Ginns,
E.I. (2002). A new gene, EVC2, is mutated in Ellis-van Creveld syndrome. Mol. Genet. Metab.
77, 291–295.
Page 84
74
Garcia-Gonzalo, F.R., Corbit, K.C., Sirerol-Piquer, M.S., Ramaswami, G., Otto, E.A., Noriega,
T.R., Seol, A.D., Robinson, J.F., Bennett, C.L., Josifova, D.J., et al. (2011). A Transition Zone
Complex Regulates Mammalian Ciliogenesis and Ciliary Membrane Composition. Nat. Genet.
43, 776–784.
Goetz, S.C., and Anderson, K.V. (2010). The primary cilium: a signalling centre during
vertebrate development. Nat. Rev. Genet. 11, 331–344.
Goodrich, L.V., Johnson, R.L., Milenkovic, L., McMahon, J.A., and Scott, M.P. (1996).
Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a
mouse patched gene by Hedgehog. Genes Dev. 10, 301–312.
Goodrich L V ilenković L Higgins K and Scott P (1997) Altered neural cell fates
and medulloblastoma in mouse patched mutants. Science 277, 1109–1113.
Gorlin, R.J. (2004). Nevoid basal cell carcinoma (Gorlin) syndrome. Genet. Med. 6, 530–539.
Grachtchouk, M., Mo, R., Yu, S., Zhang, X., Sasaki, H., Hui, C.C., and Dlugosz, A.A. (2000).
Basal cell carcinomas in mice overexpressing Gli2 in skin. Nat. Genet. 24, 216–217.
Grover, V.K., Valadez, J.G., Bowman, A.B., and Cooper, M.K. (2011). Lipid modifications of
Sonic hedgehog ligand dictate cellular reception and signal response. PloS One 6, e21353.
Guy, C.T., Muthuswamy, S.K., Cardiff, R.D., Soriano, P., and Muller, W.J. (1994). Activation of
the c-Src tyrosine kinase is required for the induction of mammary tumors in transgenic mice.
Genes Dev. 8, 23–32.
Hahn, H., Wicking, C., Zaphiropoulos, P.G., Gailani, M.R., Shanley, S., Chidambaram, A.,
Vorechovsky, I., Holmberg, E., Unden, A.B., Gillies, S., et al. (1996). Mutations of the Human
Homolog of Drosophila patched in the Nevoid Basal Cell Carcinoma Syndrome. Cell 85, 841–
851.
Hahn, H., Wojnowski, L., Zimmer, A.M., Hall, J., Miller, G., and Zimmer, A. (1998).
Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nat.
Med. 4, 619–622.
Haycraft, C.J., Banizs, B., Aydin-Son, Y., Zhang, Q., Michaud, E.J., and Yoder, B.K. (2005).
Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for
processing and function. PLoS Genet. 1, e53.
Hehr, U., Gross, C., Diebold, U., Wahl, D., Beudt, U., Heidemann, P., Hehr, A., and Mueller, D.
(2004). Wide phenotypic variability in families with holoprosencephaly and a sonic hedgehog
mutation. Eur. J. Pediatr. 163, 347–352.
Heitzer, E., Lassacher, A., Quehenberger, F., Kerl, H., and Wolf, P. (2007). UV fingerprints
predominate in the PTCH mutation spectra of basal cell carcinomas independent of clinical
phenotype. J. Invest. Dermatol. 127, 2872–2881.
Page 85
75
Van den Heuvel, M., and Ingham, P.W. (1996). smoothened encodes a receptor-like serpentine
protein required for hedgehog signalling. Nature 382, 547–551.
Hime, G.R., Lada, H., Fietz, M.J., Gillies, S., Passmore, A., Wicking, C., and Wainwright, B.J.
(2004). Functional analysis in Drosophila indicates that the NBCCS/PTCH1 mutation G509V
results in activation of smoothened through a dominant-negative mechanism. Dev. Dyn. Off.
Publ. Am. Assoc. Anat. 229, 780–790.
Hollway, G.E., Maule, J., Gautier, P., Evans, T.M., Keenan, D.G., Lohs, C., Fischer, D.,
Wicking, C., and Currie, P.D. (2006). Scube2 mediates Hedgehog signalling in the zebrafish
embryo. Dev. Biol. 294, 104–118.
Holtz, A.M., Peterson, K.A., Nishi, Y., Morin, S., Song, J.Y., Charron, F., McMahon, A.P., and
Allen, B.L. (2013). Essential role for ligand-dependent feedback antagonism of vertebrate
hedgehog signaling by PTCH1, PTCH2 and HHIP1 during neural patterning. Dev. Camb. Engl.
140, 3423–3434.
Hsu, S.-H.C., Zhang, X., Yu, C., Li, Z.J., Wunder, J.S., Hui, C.-C., and Alman, B.A. (2011).
Kif7 promotes hedgehog signaling in growth plate chondrocytes by restricting the inhibitory
function of Sufu. Development 138, 3791–3801.
Hu, Q., Milenkovic, L., Jin, H., Scott, M.P., Nachury, M.V., Spiliotis, E.T., and Nelson, W.J.
(2010). A septin diffusion barrier at the base of the primary cilium maintains ciliary membrane
protein distribution. Science 329, 436–439.
Huang, Y., Roelink, H., and McKnight, G.S. (2002). Protein kinase A deficiency causes axially
localized neural tube defects in mice. J. Biol. Chem. 277, 19889–19896.
Huang, Y.S., Bu, D.F., Li, X.Y., Ma, Z.H., Yang, Y., Lin, Z.M., Lu, F.M., Tu, P., and Li, H.
(2013). Unique features of PTCH1 mutation spectrum in Chinese sporadic basal cell carcinoma.
J. Eur. Acad. Dermatol. Venereol. JEADV 27, 235–241.
Huangfu, D., and Anderson, K.V. (2005). Cilia and Hedgehog responsiveness in the mouse.
Proc. Natl. Acad. Sci. U. S. A. 102, 11325–11330.
Huangfu, D., Liu, A., Rakeman, A.S., Murcia, N.S., Niswander, L., and Anderson, K.V. (2003).
Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature 426, 83–87.
Humke, E.W., Dorn, K.V., Milenkovic, L., Scott, M.P., and Rohatgi, R. (2010). The output of
Hedgehog signaling is controlled by the dynamic association between Suppressor of Fused and
the Gli proteins. Genes Dev. 24, 670–682.
Incardona, J.P., Gruenberg, J., and Roelink, H. (2002). Sonic Hedgehog Induces the Segregation
of Patched and Smoothened in Endosomes. Curr. Biol. 12, 983–995.
Ingham, P.W., Nakano, Y., and Seger, C. (2011). Mechanisms and functions of Hedgehog
signalling across the metazoa. Nat. Rev. Genet. 12, 393–406.
Page 86
76
Izzi, L., Lévesque, M., Morin, S., Laniel, D., Wilkes, B.C., Mille, F., Krauss, R.S., McMahon,
A.P., Allen, B.L., and Charron, F. (2011). Boc and Gas1 each form distinct Shh receptor
complexes with Ptch1 and are required for Shh-mediated cell proliferation. Dev. Cell 20, 788–
801.
Jenkins, D., Winyard, P.J.D., and Woolf, A.S. (2007). Immunohistochemical analysis of Sonic
hedgehog signalling in normal human urinary tract development. J. Anat. 211, 620–629.
Jeong, J., and McMahon, A.P. (2005). Growth and pattern of the mammalian neural tube are
governed by partially overlapping feedback activities of the hedgehog antagonists patched 1 and
Hhip1. Development 132, 143–154.
Ji, Z., Mei, F.C., Xie, J., and Cheng, X. (2007). Oncogenic KRAS Activates Hedgehog Signaling
Pathway in Pancreatic Cancer Cells. J. Biol. Chem. 282, 14048–14055.
Jia, J., Tong, C., Wang, B., Luo, L., and Jiang, J. (2004). Hedgehog signalling activity of
Smoothened requires phosphorylation by protein kinase A and casein kinase I. Nature 432,
1045–1050.
Jia, J., Kolterud, A., Zeng, H., Hoover, A., Teglund, S., Toftgård, R., and Liu, A. (2009).
Suppressor of Fused inhibits mammalian Hedgehog signaling in the absence of cilia. Dev. Biol.
330, 452–460.
Johnson, J.-L.F.A., Hall, T.E., Dyson, J.M., Sonntag, C., Ayers, K., Berger, S., Gautier, P.,
Mitchell, C., Hollway, G.E., and Currie, P.D. (2012). Scube activity is necessary for Hedgehog
signal transduction in vivo. Dev. Biol. 368, 193–202.
Johnson, R.L., Rothman, A.L., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G.,
Myers, R.M., Cox, D.R., Epstein, E.H., et al. (1996). Human homolog of patched, a candidate
gene for the basal cell nevus syndrome. Science 272, 1668–1671.
Johnson, R.L., Milenkovic, L., and Scott, M.P. (2000). In vivo functions of the patched protein:
requirement of the C terminus for target gene inactivation but not Hedgehog sequestration. Mol.
Cell 6, 467–478.
Jones, D.T., Jager, N., Kool, M., Zichner, T., Hutter, B., Sultan, M., Cho, Y.-J., Pugh, T.J.,
Hovestadt, V., Stutz, A.M., et al. (2012). ICGC PedBrain: Dissecting the genomic complexity
underlying medulloblastoma. Nature 488, 100–105.
Jones, E.A., Sajid, M.I., Shenton, A., and Evans, D.G. (2011). Basal Cell Carcinomas in Gorlin
Syndrome: A Review of 202 Patients. J. Skin Cancer 2011.
Kagawa, H., Shino, Y., Kobayashi, D., Demizu, S., Shimada, M., Ariga, H., and Kawahara, H.
(2011). A novel signaling pathway mediated by the nuclear targeting of C-terminal fragments of
mammalian Patched 1. PLoS ONE 6, e18638.
Kang, H.C., Wakabayashi, Y., Jen, K.-Y., Mao, J.-H., Zoumpourlis, V., Del Rosario, R., and
Balmain, A. (2013). Ptch1 Overexpression Drives Skin Carcinogenesis and Developmental
Defects in K14PtchFVB Mice. J. Invest. Dermatol. 133, 1311–1320.
Page 87
77
Kang, J.S., Gao, M., Feinleib, J.L., Cotter, P.D., Guadagno, S.N., and Krauss, R.S. (1997). CDO:
an oncogene-, serum-, and anchorage-regulated member of the Ig/fibronectin type III repeat
family. J. Cell Biol. 138, 203–213.
Kang, J.-S., Mulieri, P.J., Hu, Y., Taliana, L., and Krauss, R.S. (2002). BOC, an Ig superfamily
member, associates with CDO to positively regulate myogenic differentiation. EMBO J. 21,
114–124.
Kawakami, A., Nojima, Y., Toyoda, A., Takahoko, M., Satoh, M., Tanaka, H., Wada, H., Masai,
I., Terasaki, H., Sakaki, Y., et al. (2005). The zebrafish-secreted matrix protein you/scube2 is
implicated in long-range regulation of hedgehog signaling. Curr. Biol. CB 15, 480–488.
Kawakami, T., Kawcak, T., Li, Y.-J., Zhang, W., Hu, Y., and Chuang, P.-T. (2002). Mouse
dispatched mutants fail to distribute hedgehog proteins and are defective in hedgehog signaling.
Dev. Camb. Engl. 129, 5753–5765.
Kawamura, S., Hervold, K., Ramirez-Weber, F.-A., and Kornberg, T.B. (2008). Two patched
protein subtypes and a conserved domain of group I proteins that regulates turnover. J. Biol.
Chem. 283, 30964–30969.
Keady, B.T., Samtani, R., Tobita, K., Tsuchya, M., San Agustin, J.T., Follit, J.A., Jonassen, J.A.,
Subramanian, R., Lo, C.W., and Pazour, G.J. (2012). IFT25 links the signal-dependent
movement of Hedgehog components to intraflagellar transport. Dev. Cell 22, 940–951.
Kenney, A.M., and Rowitch, D.H. (2000). Sonic hedgehog promotes G(1) cyclin expression and
sustained cell cycle progression in mammalian neuronal precursors. Mol. Cell. Biol. 20, 9055–
9067.
Kenney, A.M., Cole, M.D., and Rowitch, D.H. (2003). Nmyc upregulation by sonic hedgehog
signaling promotes proliferation in developing cerebellar granule neuron precursors. Dev. Camb.
Engl. 130, 15–28.
Kim, H., Laing, M., and Muller, W. (2005). c-Src-null mice exhibit defects in normal mammary
gland development and ERalpha signaling. Oncogene 24, 5629–5636.
Kim, J., Kato, M., and Beachy, P.A. (2009a). Gli2 trafficking links Hedgehog-dependent
activation of Smoothened in the primary cilium to transcriptional activation in the nucleus. Proc.
Natl. Acad. Sci. U. S. A. 106, 21666–21671.
Kim, L.C., Song, L., and Haura, E.B. (2009b). Src kinases as therapeutic targets for cancer. Nat.
Rev. Clin. Oncol. 6, 587–595.
Kimura, H., Stephen, D., Joyner, A., and Curran, T. (2005). Gli1 is important for
medulloblastoma formation in Ptc1+/- mice. Oncogene 24, 4026–4036.
Kise, Y., Morinaka, A., Teglund, S., and Miki, H. (2009). Sufu recruits GSK3beta for efficient
processing of Gli3. Biochem. Biophys. Res. Commun. 387, 569–574.
Page 88
78
Kogerman, P., Grimm, T., Kogerman, L., Krause, D., Undén, A.B., Sandstedt, B., Toftgård, R.,
and Zaphiropoulos, P.G. (1999). Mammalian suppressor-of-fused modulates nuclear-cytoplasmic
shuttling of Gli-1. Nat. Cell Biol. 1, 312–319.
Kogerman, P., Krause, D., Rahnama, F., Kogerman, L., Undén, A.B., Zaphiropoulos, P.G., and
Toftgård, R. (2002). Alternative first exons of PTCH1 are differentially regulated in vivo and
may confer different functions to the PTCH1 protein. Oncogene 21, 6007–6016.
Kolpakova-Hart, E., Jinnin, M., Hou, B., Fukai, N., and Olsen, B.R. (2007). Kinesin-2 controls
development and patterning of the vertebrate skeleton by Hedgehog- and Gli3-dependent
mechanisms. Dev. Biol. 309, 273–284.
Kool, M., Koster, J., Bunt, J., Hasselt, N.E., Lakeman, A., van Sluis, P., Troost, D., Meeteren,
N.S., Caron, H.N., Cloos, J., et al. (2008). Integrated genomics identifies five medulloblastoma
subtypes with distinct genetic profiles, pathway signatures and clinicopathological features. PloS
One 3, e3088.
Kool, M., Korshunov, A., Remke, M., Jones, D.T.W., Schlanstein, M., Northcott, P.A., Cho, Y.-
J., Koster, J., Schouten-van Meeteren, A., van Vuurden, D., et al. (2012). Molecular subgroups
of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and
clinical data of WNT, SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol. (Berl.)
123, 473–484.
Kovacs, J.J., Whalen, E.J., Liu, R., Xiao, K., Kim, J., Chen, M., Wang, J., Chen, W., and
Lefkowitz, R.J. (2008). Beta-arrestin-mediated localization of smoothened to the primary cilium.
Science 320, 1777–1781.
Larkins, C.E., Aviles, G.D.G., East, M.P., Kahn, R.A., and Caspary, T. (2011). Arl13b regulates
ciliogenesis and the dynamic localization of Shh signaling proteins. Mol. Biol. Cell 22, 4694–
4703.
Lauth, M., Bergström, Å., Shimokawa, T., Tostar, U., Jin, Q., Fendrich, V., Guerra, C., Barbacid,
M., and Toftgård, R. (2010). DYRK1B-dependent autocrine-to-paracrine shift of Hedgehog
signaling by mutant RAS. Nat. Struct. Mol. Biol. 17, 718–725.
Law, K.K.L., Makino, S., Mo, R., Zhang, X., Puviindran, V., and Hui, C. (2012). Antagonistic
and Cooperative Actions of Kif7 and Sufu Define Graded Intracellular Gli Activities in
Hedgehog Signaling. PLoS ONE 7, e50193.
Lee, J.D., and Treisman, J.E. (2001). Sightless has homology to transmembrane acyltransferases
and is required to generate active Hedgehog protein. Curr. Biol. CB 11, 1147–1152.
Lee, C.S., Buttitta, L., and Fan, C.M. (2001). Evidence that the WNT-inducible growth arrest-
specific gene 1 encodes an antagonist of sonic hedgehog signaling in the somite. Proc. Natl.
Acad. Sci. U. S. A. 98, 11347–11352.
Lee, J.J., Ekker, S.C., von Kessler, D.P., Porter, J.A., Sun, B.I., and Beachy, P.A. (1994).
Autoproteolysis in hedgehog protein biogenesis. Science 266, 1528–1537.
Page 89
79
Lee, Y., Miller, H.L., Russell, H.R., Boyd, K., Curran, T., and McKinnon, P.J. (2006). Patched2
modulates tumorigenesis in patched1 heterozygous mice. Cancer Res. 66, 6964–6971.
Lewis, P.M., Dunn, M.P., McMahon, J.A., Logan, M., Martin, J.F., St-Jacques, B., and
McMahon, A.P. (2001). Cholesterol modification of sonic hedgehog is required for long-range
signaling activity and effective modulation of signaling by Ptc1. Cell 105, 599–612.
Li, S.S.-C. (2005). Specificity and versatility of SH3 and other proline-recognition domains:
structural basis and implications for cellular signal transduction. Biochem. J. 390, 641–653.
Li, Y., Zhang, H., Litingtung, Y., and Chiang, C. (2006). Cholesterol modification restricts the
spread of Shh gradient in the limb bud. Proc. Natl. Acad. Sci. U. S. A. 103, 6548–6553.
Li, Z., Zhang, H., Denhard, L.A., Liu, L.-H., Zhou, H., and Lan, Z.-J. (2008a). Reduced white fat
mass in adult mice bearing a truncated Patched 1. Int. J. Biol. Sci. 4, 29–36.
Li, Z., Zhang, H., Denhard, L.A., Liu, L.-H., Zhou, H., and Lan, Z.-J. (2008b). Reduced white fat
mass in adult mice bearing a truncated Patched 1. Int. J. Biol. Sci. 4, 29–36.
Li, Z.J., Nieuwenhuis, E., Nien, W., Zhang, X., Zhang, J., Puviindran, V., Wainwright, B.J.,
Kim, P.C.W., and Hui, C. -c. (2012). Kif7 regulates Gli2 through Sufu-dependent and -
independent functions during skin development and tumorigenesis. Development 139, 4152–
4161.
Liem, K.F., Jr, He, M., Ocbina, P.J.R., and Anderson, K.V. (2009). Mouse Kif7/Costal2 is a
cilia-associated protein that regulates Sonic hedgehog signaling. Proc. Natl. Acad. Sci. U. S. A.
106, 13377–13382.
Liem, K.F., Jr, Ashe, A., He, M., Satir, P., Moran, J., Beier, D., Wicking, C., and Anderson, K.V.
(2012). The IFT-A complex regulates Shh signaling through cilia structure and membrane
protein trafficking. J. Cell Biol. 197, 789–800.
Lim, W.A., Richards, F.M., and Fox, R.O. (1994). Structural determinants of peptide-binding
orientation and of sequence specificity in SH3 domains. Nature 372, 375–379.
Lindström, E., Shimokawa, T., Toftgård, R., and Zaphiropoulos, P.G. (2006). PTCH mutations:
distribution and analyses. Hum. Mutat. 27, 215–219.
Lipinski, R.J., Gipp, J.J., Zhang, J., Doles, J.D., and Bushman, W. (2006). Unique and
complimentary activities of the Gli transcription factors in Hedgehog signaling. Exp. Cell Res.
312, 1925–1938.
Litingtung, Y., Dahn, R.D., Li, Y., Fallon, J.F., and Chiang, C. (2002). Shh and Gli3 are
dispensable for limb skeleton formation but regulate digit number and identity. Nature 418, 979–
983.
Liu, A., Wang, B., and Niswander, L.A. (2005). Mouse intraflagellar transport proteins regulate
both the activator and repressor functions of Gli transcription factors. Development 132, 3103–
3111.
Page 90
80
Liu, B.A., Engelmann, B.W., and Nash, P.D. (2012). The language of SH2 domain interactions
defines phosphotyrosine-mediated signal transduction. FEBS Lett. 586, 2597–2605.
Lo, J.S., Snow, S.N., Reizner, G.T., Mohs, F.E., Larson, P.O., and Hruza, G.J. (1991). Metastatic
basal cell carcinoma: report of twelve cases with a review of the literature. J. Am. Acad.
Dermatol. 24, 715–719.
López-Martínez, A., Chang, D.T., Chiang, C., Porter, J.A., Ros, M.A., Simandl, B.K., Beachy,
P.A., and Fallon, J.F. (1995). Limb-patterning activity and restricted posterior localization of the
amino-terminal product of Sonic hedgehog cleavage. Curr. Biol. CB 5, 791–796.
Lu, X., Liu, S., and Kornberg, T.B. (2006). The C-terminal tail of the Hedgehog receptor
Patched regulates both localization and turnover. Genes Dev. 20, 2539–2551.
Lü, Y., Zhu, H., Ye, W., Zhang, M., He, D., and Chen, W. (2008). A new mutation of PTCH
gene in a Chinese family with nevoid basal cell carcinoma syndrome. Chin. Med. J. (Engl.) 121,
118–121.
Ma, Y., Erkner, A., Gong, R., Yao, S., Taipale, J., Basler, K., and Beachy, P.A. (2002).
Hedgehog-mediated patterning of the mammalian embryo requires transporter-like function of
dispatched. Cell 111, 63–75.
Maity, T., Fuse, N., and Beachy, P.A. (2005). Molecular mechanisms of Sonic hedgehog mutant
effects in holoprosencephaly. Proc. Natl. Acad. Sci. U. S. A. 102, 17026–17031.
Makino, S., Masuya, H., Ishijima, J., Yada, Y., and Shiroishi, T. (2001). A spontaneous mouse
mutation, mesenchymal dysplasia (mes), is caused by a deletion of the most C-terminal
cytoplasmic domain of patched (ptc). Dev. Biol. 239, 95–106.
Mancuso, M., Pazzaglia, S., Tanori, M., Hahn, H., Merola, P., Rebessi, S., Atkinson, M.J., Di
Majo, V., Covelli, V., and Saran, A. (2004). Basal cell carcinoma and its development: insights
from radiation-induced tumors in Ptch1-deficient mice. Cancer Res. 64, 934–941.
Mancuso, M., Leonardi, S., Tanori, M., Pasquali, E., Pierdomenico, M., Rebessi, S., Di Majo, V.,
Covelli, V., Pazzaglia, S., and Saran, A. (2006). Hair cycle-dependent basal cell carcinoma
tumorigenesis in Ptc1neo67/+ mice exposed to radiation. Cancer Res. 66, 6606–6614.
Mannock, D.A., McIntosh, T.J., Jiang, X., Covey, D.F., and McElhaney, R.N. (2003). Effects of
natural and enantiomeric cholesterol on the thermotropic phase behavior and structure of egg
sphingomyelin bilayer membranes. Biophys. J. 84, 1038–1046.
Marcotte, R., Smith, H.W., Sanguin-Gendreau, V., McDonough, R.V., and Muller, W.J. (2012).
Mammary epithelial-specific disruption of c-Src impairs cell cycle progression and
tumorigenesis. Proc. Natl. Acad. Sci. U. S. A. 109, 2808–2813.
Marigo, V., Davey, R.A., Zuo, Y., Cunningham, J.M., and Tabin, C.J. (1996). Biochemical
evidence that patched is the Hedgehog receptor. Nature 384, 176–179.
Page 91
81
Marsh, A., Wicking, C., Wainwright, B., and Chenevix-Trench, G. (2005). DHPLC Analysis of
patients with Nevoid Basal Cell Carcinoma Syndrome reveals novel PTCH missense mutations
in the sterol-sensing domain. Hum. Mutat. 26, 283–283.
Martí, E., Bumcrot, D.A., Takada, R., and McMahon, A.P. (1995). Requirement of 19K form of
Sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375, 322–
325.
art n V Carrillo G Torroja C and Guerrero I (2 1) The sterol-sensing domain of
Patched protein seems to control Smoothened activity through Patched vesicular trafficking.
Curr. Biol. 11, 601–607.
Martinelli, D.C., and Fan, C.-M. (2007). Gas1 extends the range of Hedgehog action by
facilitating its signaling. Genes Dev. 21, 1231–1243.
Martinelli, D.C., and Fan, C.-M. (2009). A sonic hedgehog missense mutation associated with
holoprosencephaly causes defective binding to GAS1. J. Biol. Chem. 284, 19169–19172.
Matsuzawa, N., Nagao, T., Shimozato, K., Niikawa, N., and Yoshiura, K. (2006). Patched
homologue 1 mutations in four Japanese families with basal cell nevus syndrome. J. Clin. Pathol.
59, 1084–1086.
McCarthy, R.A., Barth, J.L., Chintalapudi, M.R., Knaak, C., and Argraves, W.S. (2002).
Megalin functions as an endocytic sonic hedgehog receptor. J. Biol. Chem. 277, 25660–25667.
McDermott, A., Gustafsson, M., Elsam, T., Hui, C.-C., Emerson, C.P., Jr, and Borycki, A.-G.
(2005). Gli2 and Gli3 have redundant and context-dependent function in skeletal muscle
formation. Dev. Camb. Engl. 132, 345–357.
Mehlen, P., and Bredesen, D.E. (2004). The dependence receptor hypothesis. Apoptosis Int. J.
Program. Cell Death 9, 37–49.
Meloni, A.R., Fralish, G.B., Kelly, P., Salahpour, A., Chen, J.K., Wechsler-Reya, R.J.,
Lefkowitz, R.J., and Caron, M.G. (2006). Smoothened signal transduction is promoted by G
protein-coupled receptor kinase 2. Mol. Cell. Biol. 26, 7550–7560.
Micchelli, C.A., The, I., Selva, E., Mogila, V., and Perrimon, N. (2002). Rasp, a putative
transmembrane acyltransferase, is required for Hedgehog signaling. Dev. Camb. Engl. 129, 843–
851.
Milenkovic, L., Goodrich, L.V., Higgins, K.M., and Scott, M.P. (1999). Mouse patched1
controls body size determination and limb patterning. Dev. Camb. Engl. 126, 4431–4440.
Milenkovic, L., Scott, M.P., and Rohatgi, R. (2009). Lateral transport of Smoothened from the
plasma membrane to the membrane of the cilium. J. Cell Biol. 187, 365–374.
Millard, E.E., Gale, S.E., Dudley, N., Zhang, J., Schaffer, J.E., and Ory, D.S. (2005). The sterol-
sensing domain of the Niemann-Pick C1 (NPC1) protein regulates trafficking of low density
lipoprotein cholesterol. J. Biol. Chem. 280, 28581–28590.
Page 92
82
Mille, F., Thibert, C., Fombonne, J., Rama, N., Guix, C., Hayashi, H., Corset, V., Reed, J.C., and
Mehlen, P. (2009). The Patched dependence receptor triggers apoptosis through a DRAL-
caspase-9 complex. Nat. Cell Biol. 11, 739–746.
Miller, D.L., and Weinstock, M.A. (1994). Nonmelanoma skin cancer in the United States:
incidence. J. Am. Acad. Dermatol. 30, 774–778.
Ming, J.E., Kaupas, M.E., Roessler, E., Brunner, H.G., Golabi, M., Tekin, M., Stratton, R.F.,
Sujansky, E., Bale, S.J., and Muenke, M. (2002). Mutations in PATCHED-1, the receptor for
SONIC HEDGEHOG, are associated with holoprosencephaly. Hum. Genet. 110, 297–301.
Mo, R., Freer, A.M., Zinyk, D.L., Crackower, M.A., Michaud, J., Heng, H.H., Chik, K.W., Shi,
X.M., Tsui, L.C., Cheng, S.H., et al. (1997). Specific and redundant functions of Gli2 and Gli3
zinc finger genes in skeletal patterning and development. Dev. Camb. Engl. 124, 113–123.
Moraes, R.C., Chang, H., Harrington, N., Landua, J.D., Prigge, J.T., Lane, T.F., Wainwright,
B.J., Hamel, P.A., and Lewis, M.T. (2009). Ptch1 is required locally for mammary gland
morphogenesis and systemically for ductal elongation. Dev. Camb. Engl. 136, 1423–1432.
Motoyama, J., Liu, J., Mo, R., Ding, Q., Post, M., and Hui, C.C. (1998a). Essential function of
Gli2 and Gli3 in the formation of lung, trachea and oesophagus. Nat. Genet. 20, 54–57.
Motoyama, J., Takabatake, T., Takeshima, K., and Hui, C. (1998b). Ptch2, a second mouse
Patched gene is co-expressed with Sonic hedgehog. Nat. Genet. 18, 104–106.
Motoyama, J., Milenkovic, L., Iwama, M., Shikata, Y., Scott, M.P., and Hui, C. (2003).
Differential requirement for Gli2 and Gli3 in ventral neural cell fate specification. Dev. Biol.
259, 150–161.
Mukhopadhyay, S., Wen, X., Ratti, N., Loktev, A., Rangell, L., Scales, S.J., and Jackson, P.K.
(2013). The ciliary G-protein-coupled receptor Gpr161 negatively regulates the Sonic hedgehog
pathway via cAMP signaling. Cell 152, 210–223.
Murone, M., Rosenthal, A., and de Sauvage, F.J. (1999). Sonic hedgehog signaling by the
patched-smoothened receptor complex. Curr. Biol. CB 9, 76–84.
Muthuswamy, S.K., Siegel, P.M., Dankort, D.L., Webster, M.A., and Muller, W.J. (1994).
Mammary tumors expressing the neu proto-oncogene possess elevated c-Src tyrosine kinase
activity. Mol. Cell. Biol. 14, 735–743.
Nachtergaele, S., Mydock, L.K., Krishnan, K., Rammohan, J., Schlesinger, P.H., Covey, D.F.,
and Rohatgi, R. (2012). Oxysterols are allosteric activators of the oncoprotein Smoothened. Nat.
Chem. Biol. 8, 211–220.
Nagano, T., Bito, T., Kallassy, M., Nakazawa, H., Ichihashi, M., and Ueda, M. (1999).
Overexpression of the human homologue of Drosophila patched (PTCH) in skin tumours:
specificity for basal cell carcinoma. Br. J. Dermatol. 140, 287–290.
Page 93
83
Nagao, K., Toyoda, M., Takeuchi-Inoue, K., Fujii, K., Yamada, M., and Miyashita, T. (2005a).
Identification and characterization of multiple isoforms of a murine and human tumor
suppressor, patched, having distinct first exons. Genomics 85, 462–471.
Nagao, K., Togawa, N., Fujii, K., Uchikawa, H., Kohno, Y., Yamada, M., and Miyashita, T.
(2005b). Detecting tissue-specific alternative splicing and disease-associated aberrant splicing of
the PTCH gene with exon junction microarrays. Hum. Mol. Genet. 14, 3379–3388.
Nakamura, M., and Tokura, Y. (2009). A novel missense mutation in the PTCH1 gene in a
premature case of nevoid basal cell carcinoma syndrome. Eur. J. Dermatol. EJD 19, 262–263.
Nedelcu, D., Liu, J., Xu, Y., Jao, C., and Salic, A. (2013). Oxysterol binding to the extracellular
domain of Smoothened in Hedgehog signaling. Nat. Chem. Biol.
Nieuwenhuis, E., Motoyama, J., Barnfield, P.C., Yoshikawa, Y., Zhang, X., Mo, R., Crackower,
M.A., and Hui, C. (2006). Mice with a Targeted Mutation of Patched2 Are Viable but Develop
Alopecia and Epidermal Hyperplasia. Mol Cell Biol 26, 6609–6622.
Nieuwenhuis, E., Barnfield, P.C., Makino, S., and Hui, C.-C. (2007). Epidermal hyperplasia and
expansion of the interfollicular stem cell compartment in mutant mice with a C-terminal
truncation of Patched1. Dev. Biol. 308, 547–560.
Niewiadomski, P., Zhujiang, A., Youssef, M., and Waschek, J.A. (2013). Interaction of PACAP
with Sonic hedgehog reveals complex regulation of the Hedgehog pathway by PKA. Cell.
Signal.
Nilsson, M., Undèn, A.B., Krause, D., Malmqwist, U., Raza, K., Zaphiropoulos, P.G., and
Toftgård, R. (2000). Induction of basal cell carcinomas and trichoepitheliomas in mice
overexpressing GLI-1. Proc. Natl. Acad. Sci. U. S. A. 97, 3438–3443.
Nolan-Stevaux, O., Lau, J., Truitt, M.L., Chu, G.C., Hebrok, M., Fernández-Zapico, M.E., and
Hanahan, D. (2009). GLI1 is regulated through Smoothened-independent mechanisms in
neoplastic pancreatic ducts and mediates PDAC cell survival and transformation. Genes Dev. 23,
24–36.
Northcott, P.A., Hielscher, T., Dubuc, A., Mack, S., Shih, D., Remke, M., Al-Halabi, H.,
Albrecht, S., Jabado, N., Eberhart, C.G., et al. (2011). Pediatric and adult sonic hedgehog
medulloblastomas are clinically and molecularly distinct. Acta Neuropathol. (Berl.) 122, 231–
240.
Ocbina, P.J.R., and Anderson, K.V. (2008). Intraflagellar transport, cilia, and mammalian
Hedgehog signaling: analysis in mouse embryonic fibroblasts. Dev. Dyn. Off. Publ. Am. Assoc.
Anat. 237, 2030–2038.
Ocbina, P.J.R., Eggenschwiler, J.T., Moskowitz, I., and Anderson, K.V. (2011). Complex
interactions between genes controlling trafficking in primary cilia. Nat. Genet. 43, 547–553.
Page 94
84
Ohlig, S., Farshi, P., Pickhinke, U., van den Boom, J., Höing, S., Jakuschev, S., Hoffmann, D.,
Dreier, R., Schöler, H.R., Dierker, T., et al. (2011). Sonic hedgehog shedding results in
functional activation of the solubilized protein. Dev. Cell 20, 764–774.
Ohlig, S., Pickhinke, U., Sirko, S., Bandari, S., Hoffmann, D., Dreier, R., Farshi, P., Goetz, M.,
and Grobe, K. (2012). An emerging role of Sonic hedgehog shedding as a modulator of heparan
sulfate interactions. J. Biol. Chem.
Okada, A., Charron, F., Morin, S., Shin, D.S., Wong, K., Fabre, P.J., Tessier-Lavigne, M., and
McConnell, S.K. (2006). Boc is a receptor for sonic hedgehog in the guidance of commissural
axons. Nature 444, 369–373.
Oliver, T.G., Read, T.A., Kessler, J.D., Mehmeti, A., Wells, J.F., Huynh, T.T.T., Lin, S.M., and
Wechsler-Reya, R.J. (2005). Loss of patched and disruption of granule cell development in a pre-
neoplastic stage of medulloblastoma. Development 132, 2425–2439.
Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein, E.H., Jr, and Scott, M.P. (1997). Basal
cell carcinomas in mice overexpressing sonic hedgehog. Science 276, 817–821.
Pan, Y., and Wang, B. (2007). A novel protein-processing domain in Gli2 and Gli3 differentially
blocks complete protein degradation by the proteasome. J. Biol. Chem. 282, 10846–10852.
Pan, Y., Bai, C.B., Joyner, A.L., and Wang, B. (2006). Sonic hedgehog Signaling Regulates Gli2
Transcriptional Activity by Suppressing Its Processing and Degradation. Mol. Cell. Biol. 26,
3365–3377.
Park, H.L., Bai, C., Platt, K.A., Matise, M.P., Beeghly, A., Hui, C.C., Nakashima, M., and
Joyner, A.L. (2000). Mouse Gli1 mutants are viable but have defects in SHH signaling in
combination with a Gli2 mutation. Dev. Camb. Engl. 127, 1593–1605.
Pazzaglia, S., Mancuso, M., Atkinson, M.J., Tanori, M., Rebessi, S., Majo, V.D., Covelli, V.,
Hahn, H., and Saran, A. (2002). High incidence of medulloblastoma following X-ray-irradiation
of newborn Ptc1 heterozygous mice. Oncogene 21, 7580–7584.
Pazzaglia, S., Tanori, M., Mancuso, M., Gessi, M., Pasquali, E., Leonardi, S., Oliva, M.A.,
Rebessi, S., Di Majo, V., Covelli, V., et al. (2006). Two-hit model for progression of
medulloblastoma preneoplasia in Patched heterozygous mice. Oncogene 25, 5575–5580.
Pepinsky, R.B., Zeng, C., Wen, D., Rayhorn, P., Baker, D.P., Williams, K.P., Bixler, S.A.,
Ambrose, C.M., Garber, E.A., Miatkowski, K., et al. (1998). Identification of a palmitic acid-
modified form of human Sonic hedgehog. J. Biol. Chem. 273, 14037–14045.
Pernot, F., Dorandeu, F., Beaup, C., and Peinnequin, A. (2010). Selection of reference genes for
real-time quantitative reverse transcription-polymerase chain reaction in hippocampal structure
in a murine model of temporal lobe epilepsy with focal seizures. J. Neurosci. Res. 88, 1000–
1008.
Page 95
85
Philipp, M., Fralish, G.B., Meloni, A.R., Chen, W., MacInnes, A.W., Barak, L.S., and Caron,
M.G. (2008). Smoothened signaling in vertebrates is facilitated by a G protein-coupled receptor
kinase. Mol. Biol. Cell 19, 5478–5489.
Pietsch, T., Waha, A., Koch, A., Kraus, J., Albrecht, S., Tonn, J., Sörensen, N., Berthold, F.,
Henk, B., Schmandt, N., et al. (1997). Medulloblastomas of the desmoplastic variant carry
mutations of the human homologue of Drosophila patched. Cancer Res. 57, 2085–2088.
Pineda-Alvarez, D.E., Roessler, E., Hu, P., Srivastava, K., Solomon, B.D., Siple, C.E., Fan, C.-
M., and Muenke, M. (2012). Missense substitutions in the GAS1 protein present in
holoprosencephaly patients reduce the affinity for its ligand, SHH. Hum. Genet. 131, 301–310.
Pogoriler, J., Millen, K., Utset, M., and Du, W. (2006). Loss of cyclin D1 impairs cerebellar
development and suppresses medulloblastoma formation. Dev. Camb. Engl. 133, 3929–3937.
Polizio, A.H., Chinchilla, P., Chen, X., Manning, D.R., and Riobo, N.A. (2011). Sonic Hedgehog
activates the GTPases Rac1 and RhoA in a Gli-independent manner through coupling of
smoothened to Gi proteins. Sci. Signal. 4, pt7.
Porter, J.A., von Kessler, D.P., Ekker, S.C., Young, K.E., Lee, J.J., Moses, K., and Beachy, P.A.
(1995). The product of hedgehog autoproteolytic cleavage active in local and long-range
signalling. Nature 374, 363–366.
Porter, J.A., Ekker, S.C., Park, W.J., von Kessler, D.P., Young, K.E., Chen, C.H., Ma, Y.,
Woods, A.S., Cotter, R.J., Koonin, E.V., et al. (1996a). Hedgehog patterning activity: role of a
lipophilic modification mediated by the carboxy-terminal autoprocessing domain. Cell 86, 21–
34.
Porter, J.A., Young, K.E., and Beachy, P.A. (1996b). Cholesterol modification of hedgehog
signaling proteins in animal development. Science 274, 255–259.
Pugh, T.J., Weeraratne, S.D., Archer, T.C., Pomeranz Krummel, D.A., Auclair, D., Bochicchio,
J., Carneiro, M.O., Carter, S.L., Cibulskis, K., Erlich, R.L., et al. (2012). Medulloblastoma
exome sequencing uncovers subtype-specific somatic mutations. Nature 488, 106–110.
Qin, J., Lin, Y., Norman, R.X., Ko, H.W., and Eggenschwiler, J.T. (2011). Intraflagellar
transport protein 122 antagonizes Sonic Hedgehog signaling and controls ciliary localization of
pathway components. Proc. Natl. Acad. Sci. 108, 1456–1461.
Raffel, C., Jenkins, R.B., Frederick, L., Hebrink, D., Alderete, B., Fults, D.W., and James, C.D.
(1997). Sporadic medulloblastomas contain PTCH mutations. Cancer Res. 57, 842–845.
Rahimov, F., Ribeiro, L.A., de Miranda, E., Richieri-Costa, A., and Murray, J.C. (2006). GLI2
mutations in four Brazilian patients: How wide is the phenotypic spectrum? Am. J. Med. Genet.
A. 140A, 2571–2576.
Rahnama, F., Toftgard, R., and Zaphiropoulos, P.G. (2004). Distinct roles of PTCH2 splice
variants in Hedgehog signalling. Biochem. J. 378, 325–334.
Page 96
86
Rahnama, F., Shimokawa, T., Lauth, M., Finta, C., Kogerman, P., Teglund, S., Toftgård, R., and
Zaphiropoulos, P.G. (2006). Inhibition of GLI1 gene activation by Patched1. Biochem. J. 394,
19–26.
Regl, G., Kasper, M., Schnidar, H., Eichberger, T., Neill, G.W., Philpott, M.P., Esterbauer, H.,
Hauser-Kronberger, C., Frischauf, A.-M., and Aberger, F. (2004). Activation of the BCL2
promoter in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2.
Cancer Res. 64, 7724–7731.
Reifenberger, J., Wolter, M., Weber, R.G., Megahed, M., Ruzicka, T., Lichter, P., and
Reifenberger, G. (1998). Missense mutations in SMOH in sporadic basal cell carcinomas of the
skin and primitive neuroectodermal tumors of the central nervous system. Cancer Res. 58, 1798–
1803.
Reifenberger, J., Wolter, M., Knobbe, C.B., Köhler, B., Schönicke, A., Scharwächter, C., Kumar,
K., Blaschke, B., Ruzicka, T., and Reifenberger, G. (2005). Somatic mutations in the PTCH,
SMOH, SUFUH and TP53 genes in sporadic basal cell carcinomas. Br. J. Dermatol. 152, 43–51.
Ribeiro, L.A., Murray, J.C., and Richieri-Costa, A. (2006). PTCH mutations in four Brazilian
patients with holoprosencephaly and in one with holoprosencephaly-like features and normal
MRI. Am. J. Med. Genet. A. 140A, 2584–2586.
De Rivoyre, M., Ruel, L., Varjosalo, M., Loubat, A., Bidet, M., Thérond, P., and Mus-Veteau, I.
(2006). Human receptors patched and smoothened partially transduce hedgehog signal when
expressed in Drosophila cells. J. Biol. Chem. 281, 28584–28595.
Robinson, G., Parker, M., Kranenburg, T.A., Lu, C., Chen, X., Ding, L., Phoenix, T.N., Hedlund,
E., Wei, L., Zhu, X., et al. (2012). Novel mutations target distinct subgroups of
medulloblastoma. Nature 488, 43–48.
Roessler, E., and Muenke, M. (2010). The molecular genetics of holoprosencephaly. Am. J.
Med. Genet. C Semin. Med. Genet. 154C, 52–61.
Roessler, E., Du, Y.-Z., Mullor, J.L., Casas, E., Allen, W.P., Gillessen-Kaesbach, G., Roeder,
E.R., Ming, J.E., Ruiz i Altaba, A., and Muenke, M. (2003). Loss-of-function mutations in the
human GLI2 gene are associated with pituitary anomalies and holoprosencephaly-like features.
Proc. Natl. Acad. Sci. U. S. A. 100, 13424–13429.
Roessler, E., El-Jaick, K.B., Dubourg, C., Vélez, J.I., Solomon, B.D., Pineda-Álvarez, D.E.,
Lacbawan, F., Zhou, N., Ouspenskaia, M., Paulussen, A., et al. (2009a). The mutational
spectrum of holoprosencephaly-associated changes within the SHH gene in humans predicts
loss-of-function through either key structural alterations of the ligand or its altered synthesis.
Hum. Mutat.
Roessler, E., Ma, Y., Ouspenskaia, M.V., Lacbawan, F., Bendavid, C., Dubourg, C., Beachy,
P.A., and Muenke, M. (2009b). Truncating loss-of-function mutations of DISP1 contribute to
holoprosencephaly-like microform features in humans. Hum. Genet. 125, 393–400.
Page 97
87
Rohatgi, R., Milenkovic, L., and Scott, M.P. (2007). Patched1 Regulates Hedgehog Signaling at
the Primary Cilium. Science 317, 372–376.
Rohatgi, R., Milenkovic, L., Corcoran, R.B., and Scott, M.P. (2009). Hedgehog signal
transduction by Smoothened: pharmacologic evidence for a 2-step activation process. Proc. Natl.
Acad. Sci. U. S. A. 106, 3196–3201.
Romer, J.T., Kimura, H., Magdaleno, S., Sasai, K., Fuller, C., Baines, H., Connelly, M., Stewart,
C.F., Gould, S., Rubin, L.L., et al. (2004). Suppression of the Shh pathway using a small
molecule inhibitor eliminates medulloblastoma in Ptc1+/−p53−/− mice Cancer Cell 6, 229–240.
Ruiz-Perez, V.L., Ide, S.E., Strom, T.M., Lorenz, B., Wilson, D., Woods, K., King, L.,
Francomano, C., Freisinger, P., Spranger, S., et al. (2000). Mutations in a new gene in Ellis-van
Creveld syndrome and Weyers acrodental dysostosis. Nat. Genet. 24, 283–286.
Ruiz-Perez, V.L., Blair, H.J., Rodriguez-Andres, M.E., Blanco, M.J., Wilson, A., Liu, Y.-N.,
Miles, C., Peters, H., and Goodship, J.A. (2007). Evc is a positive mediator of Ihh-regulated
bone growth that localises at the base of chondrocyte cilia. Development 134, 2903–2912.
Ruppert, J.M., Kinzler, K.W., Wong, A.J., Bigner, S.H., Kao, F.T., Law, M.L., Seuanez, H.N.,
O’Brien S J and Vogelstein B (1988) The GLI-Kruppel family of human genes. Mol. Cell.
Biol. 8, 3104–3113.
Rutkowski, S., von Hoff, K., Emser, A., Zwiener, I., Pietsch, T., Figarella-Branger, D.,
Giangaspero, F., Ellison, D.W., Garre, M.-L., Biassoni, V., et al. (2010). Survival and prognostic
factors of early childhood medulloblastoma: an international meta-analysis. J. Clin. Oncol. Off.
J. Am. Soc. Clin. Oncol. 28, 4961–4968.
Saksela K and Permi P (2 12) SH3 domain ligand binding: What’s the consensus and
where’s the specificity? FEBS Lett 586, 2609–2614.
Sandilands, E., Cans, C., Fincham, V.J., Brunton, V.G., Mellor, H., Prendergast, G.C., Norman,
J.C., Superti-Furga, G., and Frame, M.C. (2004). RhoB and Actin Polymerization Coordinate Src
Activation with Endosome-Mediated Delivery to the Membrane. Dev. Cell 7, 855–869.
Sandilands, E., Akbarzadeh, S., Vecchione, A., McEwan, D.G., Frame, M.C., and Heath, J.K.
(2007). Src kinase modulates the activation, transport and signalling dynamics of fibroblast
growth factor receptors. EMBO Rep. 8, 1162–1169.
Sasaki, H., Hui, C., Nakafuku, M., and Kondoh, H. (1997). A binding site for Gli proteins is
essential for HNF-3beta floor plate enhancer activity in transgenics and can respond to Shh in
vitro. Dev. Camb. Engl. 124, 1313–1322.
Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M., and Kondoh, H. (1999). Regulation of Gli2 and
Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary
mediators of Shh signaling. Dev. Camb. Engl. 126, 3915–3924.
Page 98
88
Seppala, M., Depew, M.J., Martinelli, D.C., Fan, C.-M., Sharpe, P.T., and Cobourne, M.T.
(2007). Gas1 is a modifier for holoprosencephaly and genetically interacts with sonic hedgehog.
J. Clin. Invest. 117, 1575–1584.
Seto, M., Ohta, M., Asaoka, Y., Ikenoue, T., Tada, M., Miyabayashi, K., Mohri, D., Tanaka, Y.,
Ijichi, H., Tateishi, K., et al. (2009). Regulation of the hedgehog signaling by the mitogen-
activated protein kinase cascade in gastric cancer. Mol. Carcinog. 48, 703–712.
Shimokawa, T., Rahnama, F., and Zaphiropoulos, P.G. (2004). A novel first exon of the
Patched1 gene is upregulated by Hedgehog signaling resulting in a protein with pathway
inhibitory functions. FEBS Lett. 578, 157–162.
Shimokawa, T., Svärd, J., Heby-Henricson, K., Teglund, S., Toftgård, R., and Zaphiropoulos,
P.G. (2007). Distinct roles of first exon variants of the tumor-suppressor Patched1 in Hedgehog
signaling. Oncogene 26, 4889–4896.
Silva, C.M. (2004). Role of STATs as downstream signal transducers in Src family kinase-
mediated tumorigenesis. Oncogene 23, 8017–8023.
Smyth, I., Narang, M.A., Evans, T., Heimann, C., Nakamura, Y., Chenevix-Trench, G., Pietsch,
T., Wicking, C., and Wainwright, B.J. (1999). Isolation and characterization of human patched 2
(PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on
chromosome 1p32. Hum. Mol. Genet. 8, 291–297.
Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F.,
Roberts, T., Ratnofsky, S., and Lechleider, R.J. (1993). SH2 domains recognize specific
phosphopeptide sequences. Cell 72, 767–778.
Songyang, Z., Carraway, K.L., 3rd, Eck, M.J., Harrison, S.C., Feldman, R.A., Mohammadi, M.,
Schlessinger, J., Hubbard, S.R., Smith, D.P., and Eng, C. (1995). Catalytic specificity of protein-
tyrosine kinases is critical for selective signalling. Nature 373, 536–539.
Spoelgen, R., Hammes, A., Anzenberger, U., Zechner, D., Andersen, O.M., Jerchow, B., and
Willnow, T.E. (2005). LRP2/megalin is required for patterning of the ventral telencephalon.
Development 132, 405–414.
Stehelin, D., Varmus, H.E., Bishop, J.M., and Vogt, P.K. (1976). DNA related to the
transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260, 170–
173.
Stone, D.M., Hynes, M., Armanini, M., Swanson, T.A., Gu, Q., Johnson, R.L., Scott, M.P.,
Pennica, D., Goddard, A., Phillips, H., et al. (1996). The tumour-suppressor gene patched
encodes a candidate receptor for Sonic hedgehog. Nature 384, 129–134.
Strutt, H., Thomas, C., Nakano, Y., Stark, D., Neave, B., Taylor, A.M., and Ingham, P.W.
(2001). Mutations in the sterol-sensing domain of Patched suggest a role for vesicular trafficking
in Smoothened regulation. Curr. Biol. 11, 608–613.
Page 99
89
Suzuki, T. (2013). How is digit identity determined during limb development? Dev. Growth
Differ. 55, 130–138.
Svard, J., Rozell, B., Toftgard, R., and Teglund, S. (2009). Tumor suppressor gene co-operativity
in compound Patched1 and Suppressor of fused heterozygous mutant mice. Mol. Carcinog. 48,
408–419.
Svärd, J., Heby-Henricson, K., Henricson, K.H., Persson-Lek, M., Rozell, B., Lauth, M.,
Bergström, A., Ericson, J., Toftgård, R., and Teglund, S. (2006). Genetic elimination of
Suppressor of fused reveals an essential repressor function in the mammalian Hedgehog
signaling pathway. Dev. Cell 10, 187–197.
Sweet, H.O., Bronson, R.T., Donahue, L.R., and Davisson, M.T. (1996). Mesenchymal
dysplasia: a recessive mutation on chromosome 13 of the mouse. J. Hered. 87, 87–95.
Taipale, J., Chen, J.K., Cooper, M.K., Wang, B., Mann, R.K., Milenkovic, L., Scott, M.P., and
Beachy, P.A. (2000). Effects of oncogenic mutations in Smoothened and Patched can be
reversed by cyclopamine. Nature 406, 1005–1009.
Taipale, J., Cooper, M.K., Maiti, T., and Beachy, P.A. (2002). Patched acts catalytically to
suppress the activity of Smoothened. Nature 418, 892–896.
Takeya, T., and Hanafusa, H. (1982). DNA sequence of the viral and cellular src gene of
chickens. II. Comparison of the src genes of two strains of avian sarcoma virus and of the
cellular homolog. J. Virol. 44, 12–18.
Tang, J.Y., Xiao, T.Z., Oda, Y., Chang, K.S., Shpall, E., Wu, A., So, P.-L., Hebert, J., Bikle, D.,
and Epstein, E.H. (2011). Vitamin D3 Inhibits Hedgehog Signaling and Proliferation in Murine
Basal Cell Carcinomas. Cancer Prev. Res. Phila. Pa 4, 744–751.
Taschner, M., Bhogaraju, S., and Lorentzen, E. (2012). Architecture and function of IFT
complex proteins in ciliogenesis. Differentiation 83, S12–S22.
Taylor, F.R., Wen, D., Garber, E.A., Carmillo, A.N., Baker, D.P., Arduini, R.M., Williams, K.P.,
Weinreb, P.H., Rayhorn, P., Hronowski, X., et al. (2001). Enhanced Potency of Human Sonic
Hedgehog by Hydrophobic Modification. Biochemistry (Mosc.) 40, 4359–4371.
Taylor, M.D., Liu, L., Raffel, C., Hui, C., Mainprize, T.G., Zhang, X., Agatep, R., Chiappa, S.,
Gao, L., Lowrance, A., et al. (2002). Mutations in SUFU predispose to medulloblastoma. Nat.
Genet. 31, 306–310.
Teh, M.-T., Wong, S.-T., Neill, G.W., Ghali, L.R., Philpott, M.P., and Quinn, A.G. (2002).
FOXM1 Is a Downstream Target of Gli1 in Basal Cell Carcinomas. Cancer Res. 62, 4773–4780.
Tempe, D., Casas, M., Karaz, S., Blanchet-Tournier, M.-F., and Concordet, J.-P. (2006).
Multisite Protein Kinase A and Glycogen Synthase Kinase 3? Phosphorylation Leads to Gli3
Ubiquitination by SCFβTrCP ol Cell Biol 26, 4316–4326.
Page 100
90
Tenzen, T., Allen, B.L., Cole, F., Kang, J.-S., Krauss, R.S., and McMahon, A.P. (2006). The cell
surface membrane proteins Cdo and Boc are components and targets of the Hedgehog signaling
pathway and feedback network in mice. Dev. Cell 10, 647–656.
Thibert, C., Teillet, M.-A., Lapointe, F., Mazelin, L., Douarin, N.M.L., and Mehlen, P. (2003).
Inhibition of Neuroepithelial Patched-Induced Apoptosis by Sonic Hedgehog. Science 301, 843–
846.
Traiffort, E., Dubourg, C., Faure, H., Rognan, D., Odent, S., Durou, M.-R., David, V., and Ruat,
M. (2004). Functional characterization of sonic hedgehog mutations associated with
holoprosencephaly. J. Biol. Chem. 279, 42889–42897.
Tsai, M.-T., Cheng, C.-J., Lin, Y.-C., Chen, C.-C., Wu, A.-R., Wu, M.-T., Hsu, C.-C., and Yang,
R.-B. (2009). Isolation and characterization of a secreted, cell-surface glycoprotein SCUBE2
from humans. Biochem. J. 422, 119–128.
Tseng, T.T., Gratwick, K.S., Kollman, J., Park, D., Nies, D.H., Goffeau, A., and Saier, M.H., Jr
(1999). The RND permease superfamily: an ancient, ubiquitous and diverse family that includes
human disease and development proteins. J. Mol. Microbiol. Biotechnol. 1, 107–125.
Tukachinsky, H., Lopez, L.V., and Salic, A. (2010). A mechanism for vertebrate Hedgehog
signaling: recruitment to cilia and dissociation of SuFu-Gli protein complexes. J. Cell Biol. 191,
415–428.
Tukachinsky, H., Kuzmickas, R.P., Jao, C.Y., Liu, J., and Salic, A. (2012). Dispatched and scube
mediate the efficient secretion of the cholesterol-modified hedgehog ligand. Cell Reports 2, 308–
320.
Tuson, M., He, M., and Anderson, K.V. (2011). Protein kinase A acts at the basal body of the
primary cilium to prevent Gli2 activation and ventralization of the mouse neural tube.
Development 138, 4921–4930.
Uchikawa, H., Toyoda, M., Nagao, K., Miyauchi, H., Nishikawa, R., Fujii, K., Kohno, Y.,
Yamada, M., and Miyashita, T. (2006). Brain- and heart-specific Patched-1 containing exon 12b
is a dominant negative isoform and is expressed in medulloblastomas. Biochem. Biophys. Res.
Commun. 349, 277–283.
Uhmann, A., Niemann, H., Lammering, B., Henkel, C., Heß, I., Nitzki, F., Fritsch, A., Prüfer, N.,
Rosenberger, A., Dullin, C., et al. (2011). Antitumoral Effects of Calcitriol in Basal Cell
Carcinomas Involve Inhibition of Hedgehog Signaling and Induction of Vitamin D Receptor
Signaling and Differentiation. Mol. Cancer Ther. 10, 2179–2188.
Unden, A.B., Holmberg, E., Lundh-Rozell, B., Stähle-Bäckdahl, M., Zaphiropoulos, P.G.,
Toftgård, R., and Vorechovsky, I. (1996). Mutations in the human homologue of Drosophila
patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms
of PTCH inactivation. Cancer Res. 56, 4562–4565.
Page 101
91
Undén, A.B., Zaphiropoulos, P.G., Bruce, K., Toftgård, R., and Ståhle-Bäckdahl, M. (1997).
Human patched (PTCH) mRNA is overexpressed consistently in tumor cells of both familial and
sporadic basal cell carcinoma. Cancer Res. 57, 2336–2340.
Vaillant, C., and Monard, D. (2009). SHH pathway and cerebellar development. Cerebellum
Lond. Engl. 8, 291–301.
Varjosalo, M., Li, S.-P., and Taipale, J. (2006). Divergence of hedgehog signal transduction
mechanism between Drosophila and mammals. Dev. Cell 10, 177–186.
Villani, R.M., Adolphe, C., Palmer, J., Waters, M.J., and Wainwright, B.J. (2010). Patched1
inhibits epidermal progenitor cell expansion and basal cell carcinoma formation by limiting
Igfbp2 activity. Cancer Prev. Res. Phila. Pa 3, 1222–1234.
Wakabayashi, Y., Mao, J.-H., Brown, K., Girardi, M., and Balmain, A. (2007). Promotion of
Hras-induced squamous carcinomas by a polymorphic variant of the Patched gene in FVB mice.
Nature 445, 761–765.
Waksman, G., Kominos, D., Robertson, S.C., Pant, N., Baltimore, D., Birge, R.B., Cowburn, D.,
Hanafusa, H., Mayer, B.J., Overduin, M., et al. (1992). Crystal structure of the phosphotyrosine
recognition domain SH2 of v-src complexed with tyrosine-phosphorylated peptides. Nature 358,
646–653.
Walling, H.W., Fosko, S.W., Geraminejad, P.A., Whitaker, D.C., and Arpey, C.J. (2004).
Aggressive basal cell carcinoma: presentation, pathogenesis, and management. Cancer
Metastasis Rev. 23, 389–402.
Wang, B., and Li, Y. (2006). Evidence for the direct involvement of βTrCP in Gli3 protein
processing. Proc. Natl. Acad. Sci. U. S. A. 103, 33–38.
Wang, B., Fallon, J.F., and Beachy, P.A. (2000). Hedgehog-Regulated Processing of Gli3
Produces an Anterior/Posterior Repressor Gradient in the Developing Vertebrate Limb. Cell 100,
423–434.
Wang, C., Pan, Y., and Wang, B. (2010). Suppressor of fused and Spop regulate the stability,
processing and function of Gli2 and Gli3 full-length activators but not their repressors. Dev.
Camb. Engl. 137, 2001–2009.
Wang, G.Y., Wang, J., Mancianti, M.-L., and Epstein Jr., E.H. (2011). Basal Cell Carcinomas
Arise from Hair Follicle Stem Cells in Ptch1+/− ice Cancer Cell 19, 114–124.
Wang, Y., Zhou, Z., Walsh, C.T., and McMahon, A.P. (2009). Selective translocation of
intracellular Smoothened to the primary cilium in response to Hedgehog pathway modulation.
Proc. Natl. Acad. Sci. U. S. A. 106, 2623–2628.
Wassif, C.A., Maslen, C., Kachilele-Linjewile, S., Lin, D., Linck, L.M., Connor, W.E., Steiner,
R.D., and Porter, F.D. (1998). Mutations in the human sterol delta7-reductase gene at 11q12-13
cause Smith-Lemli-Opitz syndrome. Am. J. Hum. Genet. 63, 55–62.
Page 102
92
Waterham, H.R., Koster, J., Romeijn, G.J., Hennekam, R.C., Vreken, P., Andersson, H.C.,
FitzPatrick, D.R., Kelley, R.I., and Wanders, R.J. (2001). Mutations in the 3beta-hydroxysterol
Delta24-reductase gene cause desmosterolosis, an autosomal recessive disorder of cholesterol
biosynthesis. Am. J. Hum. Genet. 69, 685–694.
Watkin, H., Richert, M.M., Lewis, A., Terrell, K., McManaman, J.P., and Anderson, S.M.
(2008). Lactation failure in Src knockout mice is due to impaired secretory activation. BMC
Dev. Biol. 8, 6.
Webster, M.A., Cardiff, R.D., and Muller, W.J. (1995). Induction of mammary epithelial
hyperplasias and mammary tumors in transgenic mice expressing a murine mammary tumor
virus/activated c-src fusion gene. Proc. Natl. Acad. Sci. U. S. A. 92, 7849–7853.
Te Welscher, P., Zuniga, A., Kuijper, S., Drenth, T., Goedemans, H.J., Meijlink, F., and Zeller,
R. (2002). Progression of vertebrate limb development through SHH-mediated counteraction of
GLI3. Science 298, 827–830.
Wen, X., Lai, C.K., Evangelista, M., Hongo, J.-A., de Sauvage, F.J., and Scales, S.J. (2010).
Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent
degradation. Mol. Cell. Biol. 30, 1910–1922.
Westover, E.J., Covey, D.F., Brockman, H.L., Brown, R.E., and Pike, L.J. (2003). Cholesterol
depletion results in site-specific increases in epidermal growth factor receptor phosphorylation
due to membrane level effects. Studies with cholesterol enantiomers. J. Biol. Chem. 278, 51125–
51133.
Wetmore, C., Eberhart, D.E., and Curran, T. (2000). The normal patched allele is expressed in
medulloblastomas from mice with heterozygous germ-line mutation of patched. Cancer Res. 60,
2239–2246.
Wetmore, C., Eberhart, D.E., and Curran, T. (2001). Loss of p53 but not ARF Accelerates
Medulloblastoma in Mice Heterozygous for patched. Cancer Res. 61, 513–516.
Wheeler, D.L., Iida, M., and Dunn, E.F. (2009). The Role of Src in Solid Tumors. Oncologist 14,
667–678.
Wicking, C., Shanley, S., Smyth, I., Gillies, S., Negus, K., Graham, S., Suthers, G., Haites, N.,
Edwards, M., Wainwright, B., et al. (1997). Most germ-line mutations in the nevoid basal cell
carcinoma syndrome lead to a premature termination of the PATCHED protein, and no
genotype-phenotype correlations are evident. Am. J. Hum. Genet. 60, 21–26.
Wijgerde, M., McMahon, J.A., Rule, M., and McMahon, A.P. (2002). A direct requirement for
Hedgehog signaling for normal specification of all ventral progenitor domains in the presumptive
mammalian spinal cord. Genes Dev. 16, 2849–2864.
Willnow, T.E., Hilpert, J., Armstrong, S.A., Rohlmann, A., Hammer, R.E., Burns, D.K., and
Herz, J. (1996). Defective forebrain development in mice lacking gp330/megalin. Proc. Natl.
Acad. Sci. 93, 8460–8464.
Page 103
93
Wilson, C.W., Chen, M.-H., and Chuang, P.-T. (2009). Smoothened adopts multiple active and
inactive conformations capable of trafficking to the primary cilium. PloS One 4, e5182.
Wolter, M., Reifenberger, J., Sommer, C., Ruzicka, T., and Reifenberger, G. (1997). Mutations
in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic
basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous
system. Cancer Res. 57, 2581–2585.
Wong, S.Y., and Reiter, J.F. (2011). Wounding mobilizes hair follicle stem cells to form tumors.
Proc. Natl. Acad. Sci. U. S. A.
Wong, C.S.M., Strange, R.C., and Lear, J.T. (2003). Basal cell carcinoma. BMJ 327, 794–798.
Woods, I.G., and Talbot, W.S. (2005). The you gene encodes an EGF-CUB protein essential for
Hedgehog signaling in zebrafish. PLoS Biol. 3, e66.
Wu, V.M., Chen, S.C., Arkin, M.R., and Reiter, J.F. (2012). Small molecule inhibitors of
Smoothened ciliary localization and ciliogenesis. Proc. Natl. Acad. Sci. U. S. A. 109, 13644–
13649.
Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes,
M., Goddard, A., et al. (1998). Activating Smoothened mutations in sporadic basal-cell
carcinoma. Nature 391, 90–92.
Xue, Y., Liu, Z., Cao, J., Ma, Q., Gao, X., Wang, Q., Jin, C., Zhou, Y., Wen, L., and Ren, J.
(2011). GPS 2.1: enhanced prediction of kinase-specific phosphorylation sites with an algorithm
of motif length selection. Protein Eng. Des. Sel. PEDS 24, 255–260.
Yam, P.T., Langlois, S.D., Morin, S., and Charron, F. (2009). Sonic hedgehog guides axons
through a noncanonical, Src-family-kinase-dependent signaling pathway. Neuron 62, 349–362.
Yang, C., Chen, W., Chen, Y., and Jiang, J. (2012). Smoothened transduces Hedgehog signal by
forming a complex with Evc/Evc2. Cell Res. 22, 1593–1604.
Yang, Z.-J., Ellis, T., Markant, S.L., Read, T.-A., Kessler, J.D., Bourboulas, M., Schüller, U.,
Machold, R., Fishell, G., Rowitch, D.H., et al. (2008). Medulloblastoma can be initiated by
deletion of Patched in lineage-restricted progenitors or stem cells. Cancer Cell 14, 135–145.
Yoon, J.W., Kita, Y., Frank, D.J., Majewski, R.R., Konicek, B.A., Nobrega, M.A., Jacob, H.,
Walterhouse, D., and Iannaccone, P. (2002). Gene expression profiling leads to identification of
GLI1-binding elements in target genes and a role for multiple downstream pathways in GLI1-
induced cell transformation. J. Biol. Chem. 277, 5548–5555.
Yoon, J.W., Gallant, M., Lamm, M.L., Iannaccone, S., Vieux, K.-F., Proytcheva, M., Hyjek, E.,
Iannaccone, P., and Walterhouse, D. (2013). Noncanonical Regulation of the Hedgehog
Mediator GLI1 by c-MYC in Burkitt Lymphoma. Mol. Cancer Res. 11, 604–615.
Page 104
94
Youssef, K.K., Van Keymeulen, A., Lapouge, G., Beck, B., Michaux, C., Achouri, Y.,
Sotiropoulou, P.A., and Blanpain, C. (2010). Identification of the cell lineage at the origin of
basal cell carcinoma. Nat. Cell Biol. 12, 299–305.
Yu, H., Chen, J.K., Feng, S., Dalgarno, D.C., Brauer, A.W., and Schreiber, S.L. (1994).
Structural basis for the binding of proline-rich peptides to SH3 domains. Cell 76, 933–945.
Zeng, H., Jia, J., and Liu, A. (2010). Coordinated translocation of mammalian Gli proteins and
suppressor of fused to the primary cilium. PLoS ONE 5, e15900.
Zhang, Q., Seo, S., Bugge, K., Stone, E.M., and Sheffield, V.C. (2012). BBS proteins interact
genetically with the IFT pathway to influence SHH-related phenotypes. Hum. Mol. Genet. 21,
1945–1953.
Zhang, W., Kang, J.-S., Cole, F., Yi, M.-J., and Krauss, R.S. (2006). Cdo functions at multiple
points in the Sonic Hedgehog pathway, and Cdo-deficient mice accurately model human
holoprosencephaly. Dev. Cell 10, 657–665.
Zhang, W., Hong, M., Bae, G., Kang, J.-S., and Krauss, R.S. (2011). Boc modifies the
holoprosencephaly spectrum of Cdo mutant mice. Dis. Model. Mech. 4, 368–380.
Zhang, X., Harrington, N., Moraes, R.C., Wu, M.-F., Hilsenbeck, S.G., and Lewis, M.T. (2009).
Cyclopamine inhibition of human breast cancer cell growth independent of Smoothened (Smo).
Breast Cancer Res. Treat. 115, 505–521.
Zhang, X.M., Ramalho-Santos, M., and McMahon, A.P. (2001). Smoothened mutants reveal
redundant roles for Shh and Ihh signaling including regulation of L/R symmetry by the mouse
node. Cell 106, 781–792.
Zhao, Y., Tong, C., and Jiang, J. (2007). Hedgehog regulates smoothened activity by inducing a
conformational switch. Nature 450, 252–258.
Zhou, X., Liu, Z., Jang, F., Xiang, C., Li, Y., and He, Y. (2012). Autocrine Sonic Hedgehog
Attenuates Inflammation in Cerulein-Induced Acute Pancreatitis in Mice via Upregulation of IL-
10. PLoS ONE 7, e44121.
Zibat, A., Uhmann, A., Nitzki, F., Wijgerde, M., Frommhold, A., Heller, T., Armstrong, V.,
Wojnowski, L., Quintanilla-Martinez, L., Reifenberger, J., et al. (2009). Time-point and dosage
of gene inactivation determine the tumor spectrum in conditional Ptch knockouts. Carcinogenesis
30, 918–926.
Zurawel, R.H., Allen, C., Chiappa, S., Cato, W., Biegel, J., Cogen, P., de Sauvage, F., and
Raffel, C. (2000a). Analysis of PTCH/SMO/SHH pathway genes in medulloblastoma. Genes.
Chromosomes Cancer 27, 44–51.
Zurawel, R.H., Allen, C., Wechsler-Reya, R., Scott, M.P., and Raffel, C. (2000b). Evidence that
haploinsufficiency of Ptch leads to medulloblastoma in mice. Genes. Chromosomes Cancer 28,
77–81.