Role of Leukotriene B Receptors in the Development of ...atvb.ahajournals.org/content/atvbaha/24/2/369.full.pdfRole of Leukotriene B4 Receptors in the Development of Atherosclerosis:

Role of Leukotriene B4 Receptors in the Development ofAtherosclerosis: Potential Mechanisms

Krishnaprasad Subbarao, Venkatakrishna R. Jala, Steven Mathis, Jill Suttles, Wolfgang Zacharias,Jasimuddin Ahamed, Hydar Ali, Michael T. Tseng, Bodduluri Haribabu

Objective—Leukotriene B4 (LTB4), a potent leukocyte chemoattractant, is known to promote several inflammatorydiseases, including atherosclerosis. We sought to determine mechanisms through which LTB4 modulates atherosclerosisin cell lines expressing LTB4 receptors, BLT-1, and in mice deficient in BLT-1 as well as macrophage cell lines derivedfrom BLT-1�/� and BLT-1�/� mice.

Methods and Results—Analysis of global changes in gene expression induced by LTB4 in rat basophilic leukemia cells(RBL-2H3) expressing the human BLT-1 showed highest-fold increase in expression of fatty acid translocase/CD36 andthe chemokine MCP1/JE/CCL2 , which are critical in atherogenesis. To determine the importance of BLT-1 inatherogenesis, we crossed BLT-1-null mice with apolipoprotein (apo)-E-deficient mice, which develop severeatherosclerosis. Deletion of BLT-1 significantly reduced the lesion formation in apo-E�/� mice only during initiatingstages (4 and 8 weeks) but had no effect on the lesion size in mice fed atherogenic diet for 19 weeks. Macrophage celllines from BLT-1-deficient mice expressed the low-affinity LTB4 receptor, BLT-2, and exhibited chemotaxis to LTB4.

Conclusions—The effects of LTB4 in atherosclerosis are likely mediated through the high-affinity BLT-1 and thelow-affinity BLT-2 receptors. LTB4 promotes atherosclerosis by chemo-attracting monocytes, by providing anamplification loop of monocyte chemotaxis via CCL2 production, and by converting monocytes to foam cells byenhanced expression of CD36 and fatty acid accumulation. (Arterioscler Thromb Vasc Biol. 2004;24:369-375.)

Key Words: atherosclerosis � monocyte/macrophages � leukotriene B4 receptors

Accumulation of monocytes in vascular subendothelialspaces and their conversion into lipid-laden “foam cells”

is an early and important event in atherogenesis.1 Themolecular mechanisms that regulate the recruitment of mono-cyte/macrophages to the vessel wall and the signaling path-ways underlying their conversion to foam cells are poorlyunderstood. Several recent studies suggest that chemokinesCCL2/MCP1/JE, interleukin-8 (IL-8), and fractalkine andtheir receptors CCR2, CXCR2, and CX3CR1 are criticalmediators of atherosclerosis.2–7 Mice lacking macrophagecolony-stimulating factor have severely reduced atheroscle-rosis in experimental models.8 Thus, macrophages play acentral role in the development of atherosclerotic vasculardisease, which is now considered a chronic inflammatorydisease.9

LTB4, a potent leukocyte chemoattractant, is known topromote a number of chronic inflammatory diseases.10

G-protein coupled receptors BLT-1 and BLT-2 and theperoxisome proliferator activator receptor � (PPAR�) are thecurrently known LTB4 receptors.11–13 While BLT-1 and

BLT-2 likely mediate the proinflammatory responses ofLTB4, PPAR�, a transcription factor, might serve as amediator of the anti-inflammatory effects of LTB4. Studies onmouse models and antagonists of LTB4 suggested a role forBLT-1 in rheumatoid arthritis, acute septic peritonitis, andatherosclerosis.14–16 To determine the role of BLT-1 inchronic inflammatory diseases, we analyzed LTB4-inducedchanges in global gene expression in cells expressing BLT-1and atherosclerotic lesion development in BLT-1 andapolipoprotein-E (apo-E) double-deficient mice. We ob-served that several genes with known functions in thedevelopment of atherosclerosis are upregulated by LTB4, anddeletion of BLT-1 gene offered early protection againstdevelopment of atherosclerotic lesions in mice. Macrophagecell lines derived from BLT-1-deficient mice expressed asecond LTB4 receptor, BLT-2. These cells also showedchemotaxis to higher LTB4 concentrations that are likely tooccur in established atherosclerotic plaques. These resultssuggest that LTB4 is an important mediator and its receptors,BLT-1 and BLT-2, play critical and sequential roles duringatherogenesis.

Received October 14, 2003; revision accepted November 19, 2003.From the James Graham Brown Cancer Center (K.S., V.R.J., B.H.) and the Departments of Microbiology and Immunology (S.M., J.S., B.H.), Medicine

and Pharmacology & Toxicology (W.Z.), Anatomical Sciences & Neurobiology (M.T.T.), University of Louisville Health Sciences, Louisville, KY; andDepartment of Pathology (J.A., H.A.), University of Pennsylvania, School of Dental Medicine, Philadelphia, PA.

K.S. and V.R.J. contributed equally to this manuscript.Correspondence to Dr Bodduluri Haribabu, Delia Baxter Bldg, University of Louisville, 580 South Preston Street, #119B, Louisville, KY 40202. E-mail

[email protected]© 2004 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org DOI: 10.1161/01.ATV.0000110503.16605.15

369

by guest on May 25, 2018

http://atvb.ahajournals.org/D

ownloaded from

by guest on M

ay 25, 2018http://atvb.ahajournals.org/

Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

http://atvb.ahajournals.org/















MethodsAnalysis of LTB4-Induced Changes inGene ExpressionGlobal changes in LTB4-induced gene expression were determinedin a rat basophilic leukemia cell line (RBL-2H3) expressing thehuman BLT-1 (hBLT-1) using the standard Affymetrix protocols andrat genome chip U34A (Affymetrix) containing probe sets for 8740known rat genes. Changes in individual mRNAs were determined inreal-time PCR experiments and individual proteins by flow cytom-etry or ELISA as detailed in supplemental data (seewww.ahajournals.org).

Generation of BLT-1�/� and Apo-E�/� MiceBLT-1�/� mice17,18 were backcrossed onto C57BL/6 background tothe 8th generation. These mice were mated with apoE�/� mice also onthe C57BL/6 background (Jackson Labs). The resulting offspring(BLT-1�/� and apoE�/�) were crossed with apo-E�/� mice and all theoffspring were genotyped by standard PCR methods to selectapo-E�/� and BLT-1�/� animals. These animals were setup asbreeders and all 3 types of offspring, ie, BLT-1�/�, BLT-1�/�, andBLT-1�/� mice, in apo-E�/� background served as experimentalanimals. The double-knockout (apoE�/� BLT-1�/�) mice were bornat the expected Mendelian ratios, developed normally, and weredisease-free. Mice were weaned at 4 weeks, fed normal rodent chow(4.5% fat; Ralston Purina) for 3 more weeks, and switched to thewestern diet (21% fat, 0.15% cholesterol; Harlan Tekland no. 88137)at age 7 weeks.

Quantification of Atherosclerotic LesionsAtherosclerotic lesions were analyzed using standard protocols withminor modifications.19,20 After collecting 0.5 mL whole blood, theanesthetized mice were transcardially perfused with saline followedby 4% buffered formalin. Aorta tree beginning at the aortic valve tothe brachiocephalic artery, which is �2.5 mm, was removed andembedded in cryostat molds. Samples were snap-frozen by immer-sion in liquid nitrogen and stored at �20°C. The sectioning strategywas modified from that of Paigen et al20 as follows. The ascendingsegment from the appearance of aortic valve leaflets to the junctionof the brachiocephalic artery, which is �1.5 mm, was sectioned.Then, 10-�m cryosections were serially made such that 2 contiguoussections were placed on 2 different slides. The next 5 sections werediscarded. The cycle was repeated until the end of this segment. Thismethod gave us at least 10 and up to 25 sections on each slide. Oneof the 2 slide sets was stained with Oil Red O stain as described.21

Images were examined in bright field using Nikon fluorescencemicroscope TE 300 and captured with digital color camera. Mor-phometric image analysis of the foamy–cell-laden atheroscleroticplaque was performed with Metamorph software version 5.0. Foreach animal, the average lesion area of 10 to 20 sections wasdetermined and the data expressed as percent lesion area�SD.Representative sections from the other set were stained withMOMA-2 immunostain of the monocytes as described4, and thenumber of macrophages in lesions were counted (cells per high-power field). The remainder of the aorta was divided into the aorticarch, the thoracic aorta, and abdominal aorta for en face quantitativeanalysis of the atherosclerotic lesion by Sudan IV staining.16 Thelesion area was expressed as percent lesion area of total area ofpinned out arteries measured by digital morphometric analysis. Totalplasma cholesterol and triglyceride levels were measured usingcommercially available kits (Sigma). Mice were fasted overnightbefore the collection of blood samples for lipid analysis. Statisticalanalyses of the lesion size data were performed using the nonpara-metric Mann-Whitney U test.

Generation and Analysis of ImmortalizedMacrophage Cell LinesImmortalized wild-type and BLT-1-deficient murine macrophagecell lines were generated by J2 retroviral transformation as previ-ously described.22 Details of phenotype, mRNA expression analysis,

and methods for analysis of chemotaxis are provided in supplementaldata (see www.ahajournals.org).

ResultsLTB4-Induced Genes Involved in AtherosclerosisPrevious studies have shown that RBL cells expressing thehBLT-1 activate actin polymerization, pseudopod extension,chemotaxis, calcium mobilization, and degranulation in re-sponse to LTB4.23 To further assess the extent of cellularresponses to LTB4, we analyzed changes in mRNA expressionon Affymetrix rat U34A microarrays. Gene expression pro-files in vehicle-treated hBLT-1-RBL cells or parental RBLcells treated with LTB4 were compared with LTB4-treatedhBLT-1-RBL cells. The application of the double filter todata analysis resulted in a total of 17 upregulated genes, andthe most striking observation from this analysis is that geneswith well-established functions in the development of athero-sclerosis showed highest-fold increases (Table 1). Fatty acidtranslocase/CD36 is a transmembrane protein and a specificreceptor for oxidized LDL that transports LDL cholesterolinto monocytes, thereby converting them to foam cells.Deletion of the CD36 gene in mice was protective againstdevelopment of atherosclerotic lesions in otherwise suscepti-ble mice.24 Rat JE (MCP-1/CCL2) is a ligand for thechemokine receptor CCR2 and a major regulator of mono-cyte/macrophage functions. CCL2, presumably produced atthe site of vascular lesions, attracts monocytes to the area, anddeletion of either CCL2 gene or its receptor CCR2 geneprotected mice from developing atherosclerosis.2,4 Con-versely, overexpression of CCL2 resulted in enhanced ath-erosclerosis in mice.25

Among other genes specifically induced by LTB4 wereurokinase plasminogen activator (uPA), colony-stimulatingfactor (CSF-1), and osteopontin. Although known to reducevascular thrombosis, uPA was recently shown to significantlyenhance experimental atherogenesis.26 CSF-1, the gene mu-tated in osteopetrotic mice, is essential for the development ofatherosclerosis.27 A close examination of the microarray dataalso showed that osteopontin mRNA was upregulated �40-fold from parental RBL cells treated with LTB4 versushBLT-1 cells treated with LTB4. Together, CSF-1 and os-teopontin may be critical in promoting calcification anddevelopment of clinically significant aortic lesions.27,28 Inaddition, a number of other upregulated genes such as CD44,Src-like adapter protein (SLAP), and protein tyrosine phos-phatase SHP-1, may have important functions in leukocyterecruitment and signal transduction. These results suggestthat LTB4 is likely to have a major role in atherogenesis andprovide targets for further analysis.

LTB4-induced upregulation of individual mRNAs and thecorresponding proteins were tested in real-time PCR andprotein expression experiments. The data (Figure 1) demon-strate that LTB4 enhanced the expression of mRNA andprotein levels of CD36 (Figure 1A, 1C, and 1E) and CCL2(Figure 1B, 1D,and 1F). Incubation of parental RBL cellswith LTB4 did not result in any induction of either CD36 orCCL2. Moreover, the expression of both mRNAs and thecorresponding proteins were dependent on G�i-protein sig-naling, as evidenced by near-complete inhibition of induction

370 Arterioscler Thromb Vasc Biol. February 2004



ownloaded from


in cells treated with pertussis toxin. Pertussis toxin alsoinhibited the LTB4-induced upregulation of SLAP and uPAmRNAs (data not shown). A major difference between theexpression of CD36 and CCL2 genes was that CCL2 induc-tion appears to reach maximum levels both at lower doses ofLTB4 and at earlier time points. This raises the possibility thatsome of the products of the genes induced early mightpromote upregulation of CD36. CSF-1 was one of theLTB4-induced genes (Table 1) and was known to induce theexpression of CD36.29 However, addition of the mediumfrom LTB4-treated hBLT1 cells (6 hours with 1 �mol/L) toRBL cells did not result in any detectable CD36 expressionafter an additional 18 hours, suggesting that LTB4-inducedCD36 expression may be a direct effect of LTB4 on BLT-1(data not shown). Therefore, LTB4 presumably activatesdistinct signaling pathways for the coordinated regulation ofseveral genes involved in the development of atherosclerosis.

BLT-1 Promotes Early Atherosclerotic Lesions inApo-E�/�-Deficient MiceGiven the dramatic induction of genes involved in atherogen-esis by LTB4, we examined the involvement of BLT-1 in thedevelopment of atherosclerotic lesions in BLT-1-deficientmice. Deletion of BLT-1 is known to reduce LTB4-inducedleukocyte adhesion under flow and inflammatory responsesto thioglycolate or zymosan.17,18 Apo-E�/� mice spontane-ously have lesions in the aortic valve and throughout arterialtree.4,30,31 Therefore, we bred BLT-1�/� mice with apo-E�/�

mice and generated BLT-1 and apo-E double-deficient mice.Quantitative analysis of atherosclerotic lesion development in

these mice fed a high fat western diet showed significantlyreduced lesions in BLT-1�/� mice compared with BLT-1�/�

mice (Figures 2 and 3). First, we examined the lesiondevelopment along the aorta in whole-mount en face prepa-rations stained with Sudan IV (Figure 1). In mice fed westerndiet for 4 weeks, the average lesions were 5.6�2.3% of thetotal area in BLT-1�/� and 3.5�1.7% of the total area inBLT-1�/� mice (P�0.019, Mann-Whitney test). Although a30% reduction in mean lesion area was also observed inBLT-1�/� mice at 8 weeks, the data are not statisticallysignificant (data not shown). Aortic lesions were also mea-sured by two other independent methods, a quantitative OilRed O staining21 of the fatty lesions in aortic cross sectionsand a qualitative immunohistochemical staining of macro-phages with MOMA-2 antibody in the same areas.4 Stainingwith Oil Red O confirmed the significant decrease in the totallesion area in BLT-1�/� mice after 4 weeks on the high-fatdiet (Figure 3A–C). BLT-1�/� showed intermediate lesionsboth in en face and aortic cross-section analyses, suggestinga gene dosage effect. Typical MOMA-2 staining shown inFigure 3D and 3E indicates reduced monocyte infiltration inthe lesions of the BLT-1�/� mice relative to BLT-1�/� mice.However, when the mice were continued on the high-fat dietfor 19 weeks, the lesion size was similar in BLT-1�/� andBLT-1�/� mice as determined both in en face and aorticcross-section analyses (Figure I, available at http://atvb.ahajournals.org). Cholesterol and triglyceride levels in plasmasamples of these mice were measured (Table I, available athttp://atvb.ahajournals.org). While some variation was ob-

Microarray Analysis of Changes in LTB4-induced Gene Expression

Probe Set Name Gene

Fold ChangehBLT-1 �LTB4 vs

hBLT-1 –LTB4 P-Value

Fold ChangehBLT-1 �LTB4 vs

RBL �LTB4 P-Value

AF072411_g_at Fatty acid translocase/CD36 11.2 0.000047 7.3 0.000043

X17053cds_s_at Monocyte chemoattractant protein-1 (MCP-1) /CCL2/JE 8.7 0 10.0 0

rc_AI639338_at Src Like Adapter Protein-1 (SLAP-1) 5.7 0 12.6 0.000001

X63434_at Urokinase-type plasminogen activator 4.1 0.000003 2.2 0.000005

M61875_s_at CD44 4.1 0.000005 3.7 0.000001

U63740_at Synaptotagmin binding zyginl mRNA 4.0 0.000011 4.0 0.000001

rc_AI235890_s_at Major histocompatibility complex protein class I 2.9 0.000001 4.1 0.000001

U77038_at Protein Tyrosine phosphatase (SHP-1) 2.8 0 4.0 0

X06916_at Protein p9Ka homologous to CaBP 2.5 0.000005 3.9 0.000955

D50436_at Adrenodoxin 2.5 0 3.1 0

M84361_at CSF-1 2.3 0.000079 2.5 0.00001

L09119_g_at Rattus norvegicus C kinase substratecalmodulin-binding protein (RC3) mRNA

2.3 0.000004 2.1 0

U10995_g_at Wistar orphan receptor COUP-TFI 2.2 0.000001 5.2 0.000001

rc_AA875043_at Rattus norvegicus testis specific protein kinase1 2.1 0 3.2 0.000002

AF009511_at Rattus norvegicus NKR-P2 (Nkrp2) mRNA 2.1 0.000004 3.2 0.00022

AF002251_at Rattus norvegicus Maxp1 mRNA 2.0 0.000001 2.0 0.000001

M14656_at* Rat Osteopontin mRNA 1.5 0 41.4 0

Affymetrix Rat U34A gene chips were hybridized with cRNA generated from control and sample RNAs and analyzed as described in Methods, andthe genes displaying more than two-fold upregulation with the double filter are shown in order.

*Rat osteopontin mRNA was included in this table based on its highest fold induction difference in comparison with RBL cells treated with LTB4

vs hBLT-1 cells treated with LTB4. The significance (P ) for each call of change in mRNA level as determined by the Affymetrix software is indicated.

Subbarao et al Role of Leukotriene B4 Receptors in Atherosclerosis 371



ownloaded from


served in these values, there is no clear pattern of changes inplasma lipid levels between BLT-1�/� and BLT-1�/� animals.

Macrophages From BLT-1�/� Mice Express aFunctional BLT-2 ReceptorTo analyze the expression of different leukotriene receptorsand their signal transduction pathways in macrophages, thepredominant leukocyte implicated in atherosclerosis, we gen-erated immortalized macrophage cell lines from both BLT-1�/� and BLT-1�/� cells.22 J2 retroviral transformation ofmurine bone marrow has been shown to result in the selectiveimmortalization of cell lines that display the phenotypic andfunctional characteristics of macrophages, including LPSresponsiveness and production of inflammatory cytokines,and nitric oxide production.32 Phenotypic analysis showedboth of these cell lines expressed the typical macrophagemarker CD11b and no T and B cell markers (Figure II,available at http://atvb.ahajournals.org). Real-time PCR anal-yses showed that both BLT-1 and BLT-2 are expressed inmacrophages derived from BLT-1�/� mice. More impor-tantly, macrophages from BLT-1�/� mice showed the absenceof BLT-1 transcripts but normal BLT-2 expression (Figure4A). BLT-1�/� macrophages showed robust chemotactic re-sponse with a maximum response at 1.0 nM LTB4. TheBLT-1�/� cell line also showed chemotaxis but required a100-fold higher LTB4 concentration for maximal response(Figure 4B and 4C). Both cell lines showed identical chemo-

tactic responses to platelet activating factor (Figure III,available at http://atvb.ahajournals.org).

DiscussionThe results presented here point to a complex role for LTB4

and the two G-protein coupled receptors, BLT-1 and BLT-2,in atherosclerosis. Several recent reports support the view thatLTB4 may play a critical role in atherosclerosis. High levelsof all components involved in LTB4 biosynthesis, ie, 5-lipox-ygenase, 5-lipoxygenase activating protein, and LTA4 hydro-lase, were detected in human atherosclerotic lesions.33 An-tagonists of LTB4 blocked the development of atherosclerosisin apo-E-deficient and LDLR-deficient mice,16 and micedeficient in 5-lipoxygenase showed greatly reduced lesions inLDLR�/� background, suggesting leukotrienes may play adominant role in atherogenesis.34 However, the mechanismsthrough which LTB4 could bring about such dramatic differ-ences are unclear. The data presented here suggest severalmechanisms through which LTB4 might regulate atherogen-esis (Figure IV, available at http://atvb.ahajournals.org). First,as a chemoattractant of monocytes, LTB4 could attract mono-cytes to the lipid-rich subendothelial spaces where it might beproduced through the activation of 5-lipoxygenase. Alterna-tively, non-enzymatic lipid peroxidation produces isoleuko-trienes that modulate biological processes through the acti-vation of leukotriene receptors.35 Second, after therecruitment of monocytes to the developing atheroscleroticlesion, LTB4 can upregulate CCL2, CD36, uPA, CSF-1, and

Figure 1. Analysis of LTB4-induced gene expression. Parental RBL cells or cells expressing human BLT-1 (hBLT-1) were treated asindicated and total RNA was isolated. Real-time PCR analysis was performed as described in Methods, and the data were expressedas fold induction over the levels in vehicle-treated versus LTB4-treated (1 �mol/L) cells for CD36 (A) and CCL2 (B) mRNAs. Cells wereincubated with Pertussis toxin at 100 ng/mL overnight as indicated before the addition of LTB4. Time–course and dose–response ofgene induction by LTB4 were determined in RBL or hBLT-1 cells. The indicated cell lines were treated with LTB4 (1.0 �mol/L) for differ-ent times (C and D) or different concentrations of LTB4 for 16 hours (E) or 6 hours (F), and the protein expression of CD36 (C and E) orCCL2 (D and F) were determined as described in Methods. The data in A–F are representative of at least 3 independent experiments,each with triplicate measurements.




ownloaded from


osteopontin, all of which have well-established roles atvarious stages during the development of atherosclero-sis.2,4,24,26–28 In particular, the induction of CCL2 by LTB4

provides a positive feedback loop to recruit macrophages andfurther generation of LTB4 by CCL2-mediated activation ofarachidonic acid metabolism.15 Likewise, the induction ofCD36 by LTB4 provides yet another positive feedback loopvia OxLDL uptake, conversion of macrophages to foam cells,and to the production of additional chemokines by OxLDL.Although multiple regulatory mechanisms for the expressionof these individual genes are known, the coordinated regula-tion of all of these molecules through the activation of BLT-1by LTB4 offers a clear initiating step in atherogenesis. Wehave not detected changes in CD36 and/or CCL2 mRNAlevels in response to LTB4 in primary macrophages ormacrophage lines. This could be because of the activationstate and expression levels of BLT-1 in these cells. Restingmacrophages express low levels of BLT-1, and activation wasshown to increase BLT-1 mRNA levels.36 In addition, het-erogeneous nature of monocyte/macrophages with subsets ofcells expressing distinct markers was also reported.37 Themacrophages in the atherosclerotic plaque are likely to be

different from those in circulation or elicited by inflammatorymediators in peritoneal exudates.

The partial protection against lesion development in BLT-1-deficient mice at early times and no reduction in lesions inmice on prolonged high-fat diet is in contrast to the signifi-cant protection observed in mice treated with BLT-1 antag-onist.16 This suggests that compensatory mechanisms for theloss of BLT-1 might have occurred in BLT-1-deficient mice.These may include upregulation of other chemokines, likeMIP-2, KC, CX3CL1, and possibly CCL-2, acting throughCXCR2, CX3CR1, and CCR2 receptors (all demonstrated tobe involved in macrophage influx during atherogenesis).2–4 Inaddition, the nearly complete protection against atherogenesisoffered by reduced 5-lipoxygenase activity34 suggests thatother leukotrienes (LTC4 and LTD4) and leukotriene receptors(Cys LTs and BLT-2) are likely to be critical mediators oflesion development. Indeed, the results presented hereshowed that macrophages from BLT-1-deficient mice ex-pressed the low-affinity LTB4 receptor BLT-2 and chemotac-tic response to LTB4. Cys LT and BLT-2 were also shown tobe expressed on macrophages as well as in endothelial cells.38

The studies with LTB4 antagonists are also in agreement witha late role for BLT-2, because there was a greater protectionat early times (� 70%) but reduced effectiveness at later

Figure 2. Total lesion coverage in aortas of mice. A, The wholeaorta divided into the aortic arch, the thoracic aorta, andabdominal aortas from mice fed high-fat diet for 4 or 8 weekswere mounted en face and stained for lipid with Sudan IV. Totallesion area in each of these segments was measured by digitalmorphometry. Each symbol represents a single animal and thebar represents means. The percentage of the lesion areas inBLT-1�/� mice (n�8) at 4 weeks is significantly higher than inBLT-1�/� (n�8) mice (P�0.019, Mann–Whitney test; P�0.005,ANOVA). B, Representative sections of en face preparationsstained with Sudan IV from BLT-1�/� and BLT-1�/� mice.

Figure 3. Effect of BLT-1 deletion on lesions. A, Aortic crosssections (10 �m) were stained for lipid with Oil Red O andquantitated by digital morphometry. Each symbol represents ananimal and the bars represent means for comparisons of BLT-1�/� and BLT-1�/� mice at 4 weeks (P�0.036) and at 8 weeks(P�0.085, Mann–Whitney test). The difference in lesionsbetween BLT-1�/� and BLT-1�/� mice at 8 weeks is significant(P�0.041 Mann–Whitney test). Representative Oil Red O-stainedsections of BLT-1�/� (B) and BLT-1�/� (C), original magnification�200. Sections of aortic sinus stained for macrophages withMOMA-2 antibody (brown) and counter stained with hematoxylinfrom BLT-1�/� (D) and BLT-1�/� (E) mice.




ownloaded from


times (�25%).16 Because established atherosclerotic plaqueshave very high levels of 5-lipoxygenase pathway compo-nents,33 it is likely that high local LTB4 concentrations thatare inhibitory for chemotaxis through BLT-1 will be gener-ated at these sites. Presence of a low-affinity BLT-2 onmonocytes will allow these cells to migrate to the lesions athigh LTB4 concentrations. Such tandem of high- and low-affinity chemoattractant receptors have been shown to medi-ate chemotaxis at different concentrations of the ligand.39

Demonstration of a more direct role for BLT-2 in atheroscle-rosis requires the development of BLT-2-specific antagonistsand generation of BLT-2�/� mice.

The results presented herein suggest that LTB4 and itsreceptors BLT-1 and BLT-2 might play distinct roles in theinitiation and progression of atherosclerotic disease. Selectiveinterference with either LTB4 synthesis or function of BLT-1and BLT-2 offers attractive targets for the development of

pharmacological agents to block the progression of athero-sclerotic vascular disease.

AcknowledgmentsWe thank J. Eaton for critical readings of the manuscript. Technicalassistance was provided by Sabine J. Weigel in microarray analysisand Barbara Kalinowska in cryosectioning and histology. We alsothank Bharati Matta for generating macrophage cell lines from mice.This research was supported by NIH grants AI-43184 and AI-52381to B.H.

References1. Lusis AJ. Atherosclerosis. Nature. 2000;407:233–241.2. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ.

Absence of monocyte chemoattractant protein-1 reduces atherosclerosisin low-density lipoprotein receptor-deficient mice. Mol Cell. 1998;2:275–281.

3. Gerszten RE, Garcia-Zepeda EA, Lim YC, Yoshida M, Ding HA,Gimbrone MA Jr, Luster AD, Luscinskas FW, Rosenzweig A. MCP-1and IL-8 trigger firm adhesion of monocytes to vascular endotheliumunder flow conditions. Nature. 1999;398:718–723.

4. Boring L, Gosling J, Cleary M, Charo IF. Decreased Lesion Formation inCcr2(�/�) Mice Reveals a Role For Chemokines in the Initiation ofAtherosclerosis. Nature. 1998;394:894–897.

5. Boisvert WA, Santiago R, Curtiss LK, Terkeltaub RA. A leukocytehomologue of the IL-8 receptor CXCR-2 mediates the accumulation ofmacrophages in atherosclerotic lesions of LDL receptor-deficient mice.J Clin Invest. 1998;101:353–363.

6. Combadiere C, Potteaux S, Gao JL, Esposito B, Casanova S, Lee EJ,Debre P, Tedgui A, Murphy PM, Mallat Z. Decreased atheroscleroticlesion formation in CX3CR1/apolipoprotein E double knockout mice.Circulation. 2003;107:1009–1016.

7. Lesnik P, Haskell CA, Charo IF. Decreased atherosclerosis inCX3CR1�/� mice reveals a role for fractalkine in atherogenesis. J ClinInvest. 2003;111:333–340.

8. Qiao JH, Tripathi J, Mishra NK, Cai Y, Tripathi S, Wang XP, Imes S,Fishbein MC, Clinton SK, Libby P, Lusis AJ, Rajavashisth TB. Role ofmacrophage colony-stimulating factor in atherosclerosis: studies of osteo-petrotic mice. Am J Pathol. 1997;150:1687–1699.

9. Ross R. Atherosclerosis is an inflammatory disease. Am Heart J. 1999;138:S419–S420.

10. Samuelsson B, Dahlen SE, Lindgren JA, Rouzer CA, Serhan CN. Leu-kotrienes and lipoxins: structures, biosynthesis, and biological effects.Science. 1987;237:1171–1176.

11. Yokomizo T, Izumi T, Chang K, Takuwa Y, Shimizu T. A G-Protein-Coupled Receptor For Leukotriene B-4 That Mediates Chemotaxis.Nature. 1997;387:620–624.

12. Yokomizo T, Kato K, Terawaki K, Izumi T, Shimizu T. A secondleukotriene B-4 receptor, BLT2: A new therapeutic target in inflammationand immunological disorders. J Exp Med. 2000;192:421–431.

13. Devchand PR, Keller H, Peters JM, Vazquez M, Gonzalez FJ, Wahli W.The PPAR�-leukotriene B4 pathway to inflammation control. Nature.1996;384:39–43.

14. Griffiths RJ, Pettipher ER, Koch K, Farrell CA, Breslow R, Conklyn MJ,Smith MA, Hackman BC, Wimberly DJ, Milici AJ, Scampoli DN, ChengJB, Pillar JS, Pazoles, CJ Doherty NS, Melvin LS, Reiter LA, BiggarsMS, Falkner FC, Mitchell DY, Liston TE, Showell HJ. Leukotriene B4plays a critical role in the progression of collagen-induced arthritis. ProcNatl Acad Sci U S A. 1995;92:517–521.

15. Matsukawa A, Hogaboam CM, Lukacs NW, Lincoln PM, Strieter RM,Kunkel SL. Endogenous monocyte chemoattractant protein-1 (MCP-1)protects mice in a model of acute septic peritonitis: Cross-talk betweenMCP-1 and leukotriene B-4. J Immunol. 1999;163:6148–6154.

16. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Freeman A, ShowellHJ. Leukotriene B4 receptor antagonism reduces monocytic foam cells inmice. Arterioscler Thromb Vasc Biol. 2002;22:443–449.

17. Tager AM, Dufour JH, Goodarzi K, Bercury SD, von Andrian UH, LusterAD. BLTR mediates leukotriene B-4-induced chemotaxis and adhesionand plays a dominant role in eosinophil accumulation in a murine modelof peritonitis. J Exp Med. 2000;192:439–446.

18. Haribabu B, Verghese MW, Steeber DA, Sellars DD, Bock CB,Snyderman R. Targeted disruption of the leukotriene B-4 receptor in mice

Figure 4. Expression and function of BLT-1 and BLT-2 inmurine macrophages: A, Levels of BLT-1 and BLT-2 mRNAs inmurine macrophage cell lines from BLT-1�/� and BLT-1-/- micewere measured as described in Methods. The chemotaxis ofBLT-1�/� (B) and BLT-1�/� (C) macrophages to LTB4 is deter-mined in transmembrane chemotaxis assays. The data shownare representative of three independent experiments.




ownloaded from


reveals its role in inflammation and platelet-activating factor-inducedanaphylaxis. J Exp Med. 2000;192:433–438.

19. Purcell-Huynh DA, Farese RV, Jr., Johnson DF, Flynn LM, Pierotti V,Newland DL, Linton MF, Sanan DA, Young SG. Transgenic miceexpressing high levels of human apolipoprotein B develop severe athero-sclerotic lesions in response to a high-fat diet. J Clin Invest. 1995;95:2246–2257.

20. Paigen B, Morrow A, Holmes PA, Mitchell D, Williams RA. Quantitativeassessment of atherosclerotic lesions in mice. Atherosclerosis. 1987;68:231–240.

21. Fazio S, Babaev VR, Murray AB, Hasty AH, Carter KJ, Gleaves LA,Atkinson JB, Linton MF. Increased atherosclerosis in mice reconstitutedwith apolipoprotein E null macrophages. Proc Natl Acad Sci U S A.1997;94:4647–4652.

22. Clemons-Miller AR, Cox GW, Suttles J, Stout RD. LPS stimulation ofTNF-receptor deficient macrophages: a differential role for TNF-alphaautocrine signaling in the induction of cytokine and nitric oxide produc-tion. Immunobiology. 2000;202:477–492.

23. Haribabu B, Zhelev DV, Pridgen BC, Richardson RM, Ali H, SnydermanR. Chemoattractant receptors activate distinct pathways for chemotaxisand secretion - Role of G-protein usage. J Biol Chem. 1999;274:37087–37092.

24. Febbraio M, Podrez EA, Smith JD, Hajjar DP, Hazen SL, Hoff HF,Sharma K, Silverstein RL. Targeted disruption of the class B scavengerreceptor CD36 protects against atherosclerotic lesion development inmice. J Clin Invest. 2000;105:1049–1056.

25. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E, Rollins BJ, MilosPM. Monocyte chemoattractant protein-1 accelerates atherosclerosis inapolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol. 1999;19:1518–1525.

26. Falkenberg M, Tom C, DeYoung MB, Wen S, Linnemann R, Dichek DA.Increased expression of urokinase during atherosclerotic lesion devel-opment causes arterial constriction and lumen loss, and accelerates lesiongrowth. Proc Natl Acad Sci U S A. 2002;99:10665–10670.

27. Doherty TM, Uzui H, Fitzpatrick LA, Tripathi PV, Dunstan CR, AsotraK, Rajavashisth TB. Rationale for the role of osteoclast-like cells inarterial calcification. FASEB J. 2002;16:577–582.

28. Canfield AE, Farrington C, Dziobon MD, Boot-Handford RP, HeagertyAM, Kumar SN, Roberts IS. The involvement of matrix glycoproteins invascular calcification and fibrosis: an immunohistochemical study.J Pathol. 2002;196:228–234.

29. de Villiers WJ, Fraser IP, Hughes DA, Doyle AG, Gordon S. Macro-phage-colony-stimulating factor selectively enhances macrophage

scavenger receptor expression and function. J Exp Med. 1994;180:705–709.

30. Plump AS, Smith JD, Hayek T, Aalto-Setala K, Walsh A, Verstuyft JG,Rubin EM, Breslow JL. Severe hypercholesterolemia and atherosclerosisin apolipoprotein E-deficient mice created by homologous recombinationin ES cells. Cell. 1992;71:343–353.

31. Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hyper-cholesterolemia and arterial lesions in mice lacking apolipoprotein E.Science. 1992;258:468–471.

32. Makowski L, Boord JB, Maeda K, Babaev VR, Uysal KT, Morgan MA,Parker RA, Suttles J, Fazio S, Hotamisligil GS, Linton MF. Lack ofmacrophage fatty-acid-binding protein aP2 protects mice deficient inapolipoprotein E against atherosclerosis. Nat Med. 2001;7:699–705.

33. Spanbroek R, Grabner R, Lotzer K, Hildner M, Urbach A, Ruhling K,Moos MP, Kaiser B, Cohnert TU, Wahlers T, Zieske A, Plenz G,Robenek H, Salbach P, Kuhn H, Radmark O, Samuelsson B, HabenichtAJ. Expanding expression of the 5-lipoxygenase pathway within thearterial wall during human atherogenesis. Proc Natl Acad Sci U S A.2003;100:1238–1243.

34. Mehrabian M, Allayee H, Wong J, Shih W, Wang XP, Shaposhnik Z,Funk CD, Lusis AJ. Identification of 5-lipoxygenase as a major genecontributing to atherosclerosis susceptibility in mice. Circ Res. 2002;91:120–126.

35. Harrison KA, Murphy RC. Isoleukotrienes are biologically active freeradical products of lipid peroxidation. J Biol Chem. 1995;270:17273–17278.

36. Toda A, Yokomizo T, Masuda K, Nakao A, Izumi T, Shimizu T. Cloningand characterization of rat leukotriene B-4 receptor. Biochem Biophys ResCommun. 1999;262:806–812.

37. Geissmann F, Jung S, Littman DR. Blood monocytes consist of twoprincipal subsets with distinct migratory properties. Immunity. 2003;19:71–82.

38. Lotzer K, Spanbroek R, Hildner M, Urbach A, Heller R, Bretschneider E,Galczenski H, Evans JF, Habenicht AJ. Differential leukotriene receptorexpression and calcium responses in endothelial cells and macrophagesindicate 5-lipoxygenase-dependent circuits of inflammation and athero-genesis. Arterioscler Thromb Vasc Biol. 2003;23:E32–E36.

39. Hartt JK, Barish G, Murphy PM, Gao JL. N-formylpeptides induce twodistinct concentration optima for mouse neutrophil chemotaxis by differ-ential interaction with two N-formylpeptide receptor (FPR) subtypes.Molecular characterization of FPR2, a second mouse neutrophil FPR. JExp Med. 1999;190:741–747.




ownloaded from


Zacharias, Jasimuddin Ahamed, Hydar Ali, Michael T. Tseng and Bodduluri HaribabuKrishnaprasad Subbarao, Venkatakrishna R. Jala, Steven Mathis, Jill Suttles, Wolfgang

Mechanisms Receptors in the Development of Atherosclerosis: Potential4Role of Leukotriene B

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2003 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/01.ATV.0000110503.16605.152003;

2004;24:369-375; originally published online December 1,Arterioscler Thromb Vasc Biol.

http://atvb.ahajournals.org/content/24/2/369World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2004/01/27/24.2.369.DC1Data Supplement (unedited) at:

http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

http://www.lww.com/reprints

Information about reprints can be found online at: Reprints:

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:



ownloaded from

http://atvb.ahajournals.org/content/24/2/369

http://atvb.ahajournals.org/content/suppl/2004/01/27/24.2.369.DC1

http://www.ahajournals.org/site/rights/

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://atvb.ahajournals.org//subscriptions/


1

Supplemental data ATVB/2003/ 007690: Subbarao et al “ROLE OF LEUKOTRIENE B4 RECEPTORS IN

THE DEVELOPMENT OF ATHEROSCLEROSIS: POTENTIAL MECHANISMS” Methods:

Analysis of LTB4 induced changes in gene expression. RBL-2H3 is a basophilic

leukemia cell line isolated and cloned from Wistar rat basophilic cells that were

maintained as tumors and were purchased from ATCC, Manassas, VA (cat # CRL_2256).

These cells express high affinity IgE receptors and have been extensively used as a model

for studies on leukocyte chemoattractant receptor function and regulation1. Clonal lines

of RBL-2H3 cells expressing a HA-tagged human BLT-1 (hBLT-1) were generated as

previously described 2. RBL-2H3 and hBLT1 cells were incubated in the presence and

absence of LTB4 (1 µM) for 6 hrs at 37 °C. The total RNA was isolated using TRIzol

(Life Technologies, Gaithersburg, MD) and mRNA was purified using Oligotex

(QIAGEN) mRNA isolation kit. The cDNA was synthesized from this mRNA using the

Superscript II Microarray kit (Invitrogen/Life Technologies) and oligo-dT-T7-promoter

as primer. The cDNA pool was used as template to produce representative biotin-labeled

cRNA with an RNA labeling kit (Enzo). The cRNA was purified and fragmented

according to the standard Affymetrix protocols, and hybridized to rat genome chip U34A

(Affymetrix) containing probe sets for 8,740 known rat genes. Chips were scanned and

analyzed using Affymetrix Mircoarray Suite 5.0 software. Experimental and sample

preparation variations were standardized by applying the global scaling procedure to all

absolute analysis data, using a global target intensity of 150. Comparative analyses of the

2

data sets were done and further evaluated using the Affymetrix DMT 3.0 program. For

the two comparisons, the hBLT-1 cells treated with vehicle (ethanol for 6hrs) or parental

RBL-2H3 cells treated with LTB4 (1 µM) for 6 hrs samples were taken as baseline, and

the hBLT-1 cells treated with LTB4 (1 µM) for 6 hrs sample as experiment. To identify

differentially expressed genes, all candidates that were scored absent in both absolute

analyses were excluded; thresholds were set for fold changes (2-fold and greater) and

absolute signal intensity (average difference of 25 or higher).

For quantitative real-time PCR, 200 ng of total RNA was reverse transcribed

using TaqMan reverse transcription reagents (Applied Biosystems) using random

hexamer primers. Primers were designed using Primer Express software (Applied

Biosystems) for GAPDH, CD36 and CCL2. GAPDH (housekeeping gene) FP: 5’

CGGATTTGGCCGTATTGG 3’ RP: 5’ CAATGTCCACTTTGTCACAAGAGAA 3’

Fatty acid Translocase/CD36 FP: 5’ CATCGGCGATGAGAAAGCA 3’ RP: 5’

ACCAGGCCCAGGAGCTTTA 3’. Chemokine CCL2/MCP-1 FP: 5’

TGCAGTTAATGCCCCACTCA 3’ RP: 5’ TCTCCAGCCGACTCATTGG. The SYBR-

green master mix was used to detect the accumulation of PCR product during cycling on

the ABI-Prism 7000 sequence detecting system. Expression of the target genes was

normalized to GAPDH and displayed as fold change relative to the untreated samples.

The cell surface expression of CD36 was assayed by indirect immunofluorescence

using a mouse anti-mouse CD36 that was known to cross-react with the rat CD36

(Chemicon International, MAB 1258). The data is expressed as relative fluorescence over

the negative control in which the primary antibody was omitted or an isotype matched

3

(IgA subtype) control non-specific antibody was used. CCL2 production was quantified

using sandwich ELISA kit from Biosource International Inc, as previously described 3.

Generation and analysis of immortalized macrophage cell lines. Immortalized wild-

type and BLT-1-deficient murine macrophage cell lines were generated by J2 retroviral

transformation as previously described 4. Density gradient purified bone marrow cells

were suspended in supernatants of the J2 virus-producing ΡCRE/J2 cell line containing

polybrene and GM-CSF (R&D Systems, Minneapolis, MN). After 7 days in culture, the

medium was replaced with RPMI and GM-CSF. The cells were weaned of GM-CSF

whereupon transformants emerged as GM-CSF-independent cell lines. The levels of

BLT1, BLT2 and GAPDH transcripts in these macrophage cell lines were determined by

TaqMan probes (Applied Biosystems). Briefly, 200 ng of total RNA was reverse

transcribed using Taqman reverse transcription reagents and random hexamers. The

Taqman primers and probes were designed using primer express software and are as

follows- mBLT1-taq-FP: GGC ATC TGG GTG GTG TCT TT, mBLT1-taq-RP: TGT

TGT TCC ATT TTA CTG TAC GGT ACA, mBLT1 probe: 6FAM-CTG CTG GCC

ATA CCG GTC CT-MGBNFQ; mBLT2-taq- FP: CAC CGG CAC TGC TTT TCT ACT,

mBLT2-taq- RP: AGC TCC ATA CTA CGA AGC CAT TG, mBLT2 probe: 6FAM-

CTG GCG GCG TTG CTG GGA CT-MGBNFQ; mGAPDH-taq-FP: GGT GGA GCC

AAA AGG GTC AT, mGAPDH-taq-RP: GGT TCA CAC CCA TCA CAA ACA T,

mGAPDH probe: 6FAMA-TC TCC GCC CCT TCT GCC GAT G-MGBNFQ. The

TaqMan Universal PCR master mix was used to detect the accumulation of PCR product.

BLT1 and BLT2 levels in the PCR reaction were measured from the standard curve using

4

known concentrations of plasmid (pRK5) containing BLT1 and BLT2 simultaneously in

the same PCR reaction and the amount expressed as pg/µg of total RNA.

Transmembrane chemotaxis. Macrophage cell lines were grown in RPMI medium

containing 5% FBS, 1% HEPES (1 M) and 0.2% Gentamicin. Before the experiment the

cells were lifted, washed and re-suspended in RPMI containing 0.5% BSA at a density

of 0.5 X 106/ml. The directional movement of cells toward the gradient of LTB4

concentration across an 8-µm pore polycarbonate membrane was evaluated. The

membrane was covered with 100 µL gelatin (0.5%) for 10 min at 37°C and 5 min at room

temperature. The solution was discarded before assay. Cells (105 in 100 µL) were seeded

into the upper chamber of a Transwell insert (Costar Transwell; Costar-Corning). The

lower chamber was filled with 650 µl of RPMI medium containing 0.5% BSA and

different concentrations of LTB4 and RPMI medium containing 0.5% BSA was used as a

negative control. After 20 hours, the insert was removed from the transwell and stained

with HEMA-3 stain. Cells remaining in the upper chamber were scraped off with cotton

wool, and the cells that had transmigrated were counted on the lower side of the

membrane. Chemotactic index was defined as the ratio of number of cells migrating

towards ligand and number of cells migrating towards buffer.

5

Genotype

Weeks on diet

Number of mice

TPC (mg/dL)

TG (mg/dL)

BLT1 +/+

4

8

695 (± 151) 92 (±21)

BLT1 +/-

4 8 969 (± 144) 124 (± 20)

BLT1 -/-

4 8 1017 (± 157) 145 (± 37)

BLT1 +/+

8

8 894 (±212) ND

BLT1 +/-

8 9 920 (± 128) ND

BLT1 -/-

8 5 803 (± 137) ND

BLT1 +/+

19

10 831 (± 201) 116 (± 15)

BLT1 -/-

19 7 1080 (± 97) 118 (± 16)

TPC: Total plasma cholesterol, TG: Triglycerides, ND: Not determined Table-I. Plasma cholesterol and triglyceride levels in ApoE-/- mice with indicated BLT1

genotype fed on high fat diet were determined using plasma cholesterol and triglyceride

kits from Sigma chemical co. following manufacturer’s instructions.

6

Supplemental data Subbarao et al Figure I

A B

C DBLT1+/+ BLT1-/-

BLT1 genotype

19 weeksen face

19 weekscross section

+/+ -/-0

10

20

30

40

Perc

ent l

esio

n ar

ea

+/+ -/-0

10

20

30

40

50

60

A B

C DBLT1+/+ BLT1-/-C DBLT1+/+ BLT1-/-

BLT1 genotype

19 weeksen face

19 weekscross section

+/+ -/-0

10

20

30

40

Perc

ent l

esio

n ar

ea

+/+ -/-0

10

20

30

40

50

60

7

Supplemental data Subbarao et al Figure II

8

Supplemental data Subbarao et al Figure III

0

1

2

0 0.01 0.1 1 10 100

PAF (nM)

Che

mot

axis

Ind

ex

B

0

1

2

0 0.01 0.1 1 10 100

PAF (nM)

Che

mot

axis

Ind

ex

ABLT1+/+

BLT1-/-

Macrophages Plaque formation

Oxidized LDL

LDL

LDL and Monocyte recruitment Amplification loop by chemokines Foam cells and Plaque formation

Monocytes

T-cells

Smooth muscle cells

Foam cells

Epithelial cells

Cytokines (IFN-γ)Growth factors

LTC4/D4

LTB4 MCP1

LTB4 MCP1

LTB4

MCP1

CSF1

Osteopontin5-LO

5-LO

5-LO

BLT1 BLT2 CD36 Cys-LT1-R Cys-LT2-RCCR2

10

Supplemental data:

Figure Legends

Figure I: Effect of BLT-1 deletion on lesions. Aortic cross sections (A) and enface

preparations (B) of BLT-1+/+ and BLT-1-/- mice in apo-E-/- background mice fed high

fat diet for 19 weeks were analyzed for lesions as described in methods. Each symbol

represents an animal and the bars represent means. The lesions were essentially

similar in both BLT-1+/+ and BLT-1-/- mice, respectively (C and D).

Figure II: Phenotypic analysis of macrophage cell lines generated from BLT1+/+ type

and BLT1-/-mice. 5 x 105 cells were labeled with FITC (CD4) or PE (Mac-1, CD19,

CD8) conjugated antibodies on ice in the presence of 0.1% sodium azide and anti-

FcRgII,III antibody (for blockade of background Fc binding). The light lines represent

fluorescence profiles of unlabeled controls and the dark lines represent fluorescence

profiles of antibody labeled cells.

Figure III: Chemotaxis of BLT-1+/+ (A) and BLT-1-/- (B) macrophages to platelet

activating factor (PAF) is determined in transmembrane chemotaxis assays as described

in methods.

Figure IV: A model for the role of leukotrienes in atherosclerosis: LTB4 is a potent

chemoattractant for monocytes. LTB4 receptors, BLT-1 and BLT-2 are expressed in

monocyte/macrophages and T-lymphocytes. CysLT-1 and CysLT-2 are also expressed in

macrophages as well as in smooth muscle and endothelial cells5, 6. Vascular injury or

11

accumulation of oxidized lipids could recruit monocytes to the intima through

chemotaxis via BLT-1 and BLT-2 as well as other chemokine receptors CCR2, CX3CR1

and CXCR2 7, 8. Activation of BLT-1 results in arrest of leukocytes on endothelium and

transmigration across endothelial wall9. Components of 5-LO pathway are up regulated in

the atherosclerotic lesions leading to an amplification of the monocyte recruitment

cascade10. Genetic evidence in mice suggests a role for 5-LO in atherogenesis with

mutations leading to reduced activity of 5-LO having a protective role in atherogenesis11-

13. LTB4 can cause the induction of CCL2 and CCL2 was shown to enhance the

production of LTB414. Chemokine and leukotriene mediated amplification loops enhance

further recruitment of monocytes. LTB4 and other chemokines can also up regulate

scavenger receptor, CD36 expression in macrophages allowing their conversion to foam

cells15. LTB4 also upregulates CSF-1 and osteopontin that are critical in atherogenesis.

LTB4 and BLT1 are shown to control cytotoxic effector T-lymphocyte recruitment to

inflamed tissues16. These T-cells might further participate in the activation of smooth

muscle cell proliferation and atherosclerotic plaque development.

Supplemental data References:

1. Ali H, Richardson RM, Haribabu B, Snyderman R. Chemoattractant receptor

cross-desensitization [Review]. Journal of Biological Chemistry. 1999;274:6027-6030.

2. Haribabu B, Zhelev DV, Pridgen BC, Richardson RM, Ali H, Snyderman R. Chemoattractant receptors activate distinct pathways for chemotaxis and secretion - Role of G-protein usage. Journal of Biological Chemistry. 1999;274:37087-37092.

12

3. Ahamed J, Haribabu B, Ali H. Cutting edge: differential regulation of chemoattractant receptor-induced degranulation and chemokine production by receptor phosphorylation. J Immunol. 2001;167:3559-3563.

4. Clemons-Miller AR, Cox GW, Suttles J, Stout RD. LPS stimulation of TNF-receptor deficient macrophages: a differential role for TNF-alpha autocrine signaling in the induction of cytokine and nitric oxide production. Immunobiology. 2000;202:477-492.

5. Lotzer K, Spanbroek R, Hildner M, Urbach A, Heller R, Bretschneider E, Galczenski H, Evans JF, Habenicht AJ. Differential leukotriene receptor expression and calcium responses in endothelial cells and macrophages indicate 5-lipoxygenase-dependent circuits of inflammation and atherogenesis. Arterioscler Thromb Vasc Biol. 2003;23:E32-36.

6. Sjostrom M, Johansson AS, Schroder O, Qiu H, Palmblad J, Haeggstrom JZ. Dominant Expression of the CysLT2 Receptor Accounts for Calcium Signaling by Cysteinyl Leukotrienes in Human Umbilical Vein Endothelial Cells. Arterioscler Thromb Vasc Biol. 2003;23:E37-41.

7. Lusis AJ. Atherosclerosis. Nature. 2000;407:233-241. 8. Umehara H, Bloom ET, Okazaki T, Nagano Y, Yoshie O, Imai T. Fractalkine in

Vascular Biology. From Basic Research to Clinical Disease. Arterioscler Thromb Vasc Biol. 2003.

9. Friedrich EB, Tager AM, Liu E, Pettersson A, Owman C, Munn L, Luster AD, Gerszten RE. Mechanisms of Leukotriene B4-Triggered Monocyte Adhesion. Arterioscler Thromb Vasc Biol. 2003.

10. Spanbroek R, Grabner R, Lotzer K, Hildner M, Urbach A, Ruhling K, Moos MP, Kaiser B, Cohnert TU, Wahlers T, Zieske A, Plenz G, Robenek H, Salbach P, Kuhn H, Radmark O, Samuelsson B, Habenicht AJ. Expanding expression of the 5-lipoxygenase pathway within the arterial wall during human atherogenesis. Proc Natl Acad Sci U S A. 2003;100:1238-1243.

11. Kuhn H, Anton M, Gerth C, Habenicht A. Amino Acid Differences in the Deduced 5-Lipoxygenase Sequence of CAST Atherosclerosis-Resistance Mice Confer Impaired Activity When Introduced Into the Human Ortholog. Arterioscler Thromb Vasc Biol. 2003;23:1072-1076.

12. Mehrabian M, Allayee H. 5-Lipoxygenase and atherosclerosis. Curr Opin Lipidol. 2003;14:447-457.

13. Mehrabian M, Allayee H, Wong J, Shih W, Wang XP, Shaposhnik Z, Funk CD, Lusis AJ. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ Res. 2002;91:120-126.

14. Matsukawa A, Hogaboam CM, Lukacs NW, Lincoln PM, Strieter RM, Kunkel SL. Endogenous monocyte chemoattractant protein-1 (MCP-1) protects mice in a model of acute septic peritonitis: Cross-talk between MCP-1 and leukotriene B-4. Journal of Immunology. 1999;163:6148-6154.

15. Locati M, Deuschle U, Massardi ML, Martinez FO, Sironi M, Sozzani S, Bartfai T, Mantovani A. Analysis of the gene expression profile activated by the CC chemokine ligand 5/RANTES and by lipopolysaccharide in human monocytes. J Immunol. 2002;168:3557-3562.

13

16. Goodarzi K, Goodarzi M, Tager AM, Luster AD, von Andrian UH. Leukotriene B4 and BLT1 control cytotoxic effector T cell recruitment to inflamed tissues. Nat Immunol. 2003;4:965-973.

Role of Leukotriene B Receptors in the Development of ...atvb.ahajournals.org/content/atvbaha/24/2/369.full.pdfRole of Leukotriene B4 Receptors in the Development of Atherosclerosis:

Documents