Top Banner
Role of HGF/cMet Role of HGF/cMet Signaling Pathway in Signaling Pathway in NSCLC NSCLC M M . . G G ümüştekin ümüştekin 1 ,3,4 ,3,4 , B , B . . S S is is 2 , G , G . . B B ulut ulut 1 , , A A . . K K argı argı 2 2 , İ , İ . . Ö Ö ztop ztop 4 4 , N , N . . O O lgun lgun 4 4 , , N N . . A A tabey tabey 1 1 Dokuz Eylul University, School of Medicine, Dokuz Eylul University, School of Medicine, 1 Departments of Medical Biology and Genetics, Departments of Medical Biology and Genetics, 2 Pathology, Pathology, 3 3 Pharmacology, Pharmacology, 4 Institute of Institute of Oncology, Izmir Oncology, Izmir
28

Role of HGF/ cMet Signaling Pathway in NSCLC

Jan 08, 2016

Download

Documents

annona

Role of HGF/ cMet Signaling Pathway in NSCLC. M . G ümüştekin 1 ,3,4 , B . S is 2 , G . B ulut 1 , A . K argı 2 , İ . Ö ztop 4 , N . O lgun 4 , N . A tabey 1 - PowerPoint PPT Presentation
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Role of HGF/ cMet Signaling Pathway  in NSCLC

Role of HGF/cMet Role of HGF/cMet Signaling Pathway in Signaling Pathway in

NSCLCNSCLC

MM..GGümüştekinümüştekin11,3,4,3,4, B, B.. S Sisis22, G, G..BBulutulut11, , AA..KKargıargı22, İ, İ.. Ö Öztopztop44, N, N.. O Olgunlgun44, , NN..AAtabeytabey11

Dokuz Eylul University, School of Medicine, Dokuz Eylul University, School of Medicine, 11Departments of Medical Biology and Genetics, Departments of Medical Biology and Genetics,

22Pathology, Pathology, 3 3 Pharmacology, Pharmacology, 44 Institute of Oncology, Institute of Oncology, IzmirIzmir  

Page 2: Role of HGF/ cMet Signaling Pathway  in NSCLC

Receptor Tyrosine KinasesReceptor Tyrosine Kinases HGF-c-Met signaling pathwayHGF-c-Met signaling pathway Importance and role in Importance and role in

carcinogenesiscarcinogenesis Role in development of lung cancerRole in development of lung cancer Probable role in NSCLC ?Probable role in NSCLC ? IHC data of of c-Met, HGF ve some IHC data of of c-Met, HGF ve some

of target genesof target genes Mutation analysis of Exon 14Mutation analysis of Exon 14

Page 3: Role of HGF/ cMet Signaling Pathway  in NSCLC

Protein Tyrosine KinasesProtein Tyrosine Kinases Enzymes that catalyse transfer of a Enzymes that catalyse transfer of a --

phosphoryl group from ATP to serine, phosphoryl group from ATP to serine, treonine or tyrosine residues of other treonine or tyrosine residues of other proteins proteins

Normal cell and tissue developmentNormal cell and tissue development

Increased RTK activityIncreased RTK activity Proliferative diseasesProliferative diseases *Solid Tumors*Solid Tumors *Leukemia and Lymphomas*Leukemia and Lymphomas **PseurosiasisPseurosiasis, etc, etc

Page 4: Role of HGF/ cMet Signaling Pathway  in NSCLC

Protein Tyrosine KinasesProtein Tyrosine Kinases

20 subfamilies according to catalytic 20 subfamilies according to catalytic tyrosine kinase domain homology tyrosine kinase domain homology

Extracellular ligand binding regionExtracellular ligand binding region Single transmembranal regionSingle transmembranal region Intracellular tyrosine kinase regionIntracellular tyrosine kinase region Conserved Ig-like and EGF-like Conserved Ig-like and EGF-like

regions rich in sisteinregions rich in sistein

Page 5: Role of HGF/ cMet Signaling Pathway  in NSCLC

Intracellular RegionIntracellular Region

Extracellular DomainExtracellular Domain Upon ligand binding, receptor Upon ligand binding, receptor

dimerisation and changes in confirmation, dimerisation and changes in confirmation, leading to increase in kinase activity and leading to increase in kinase activity and autophosphorylationautophosphorylation

Catalytic Domain: Catalytic Domain: HighlyHighly conserved conserved ATP binding region that catalyses ATP binding region that catalyses

receptor autophosphorylation and receptor autophosphorylation and tyrosine phosphorylation of RTK tyrosine phosphorylation of RTK substratessubstrates

Page 6: Role of HGF/ cMet Signaling Pathway  in NSCLC

Activation of Receptor Activation of Receptor Tyrosine KinasesTyrosine Kinases

Autophosphorylation has dual effect:Autophosphorylation has dual effect:

1- Activation following Tyr 1- Activation following Tyr phosphorylation leads to phosphorylation leads to phosphorylation of Tyr away from phosphorylation of Tyr away from the active sitethe active site

2- These phosphorylated residues 2- These phosphorylated residues creates binding regions for the creates binding regions for the effector molecules (effector molecules (those those containing SH2 ve PTB domainscontaining SH2 ve PTB domains))

Page 7: Role of HGF/ cMet Signaling Pathway  in NSCLC

Effectors of Receptor Effectors of Receptor Tyrosine KinasesTyrosine Kinases

PI3K p85 subunitPI3K p85 subunit Non-receptor PLCgamaNon-receptor PLCgama Src family tyrosine kinasesSrc family tyrosine kinases p120GAP p120GAP (a GTPase activating enzyme in Ras (a GTPase activating enzyme in Ras

signalingsignaling Grb2 Adaptor proteinGrb2 Adaptor protein SH-PTP2 (Shp2) Tyr specific protein SH-PTP2 (Shp2) Tyr specific protein

phosphotasephosphotase

Page 8: Role of HGF/ cMet Signaling Pathway  in NSCLC

Plazma Zarı

c-Met c-Met Reseptor Reseptor Tyrosine Tyrosine KinaseKinase

S: “Sema” domain C: sistein-rich domainIg: immunoglobulin domains K: kinase domain

HOS, 7q21-q31, 12 kb, 150 kDa

Page 9: Role of HGF/ cMet Signaling Pathway  in NSCLC

Substrate binding regions of c-Met and Substrate binding regions of c-Met and Tpr-MetTpr-Met

Ekstraselüler Domain

Transmembran DomainJuxtamembran Domain

KinazDomaini

Karboksi terminal “docking” bölgesi

c-Met

Tpr-Met

Page 10: Role of HGF/ cMet Signaling Pathway  in NSCLC

Hepatocyte Growth Factor / Hepatocyte Growth Factor / Scatter Factor (HGF/SF)Scatter Factor (HGF/SF)

MitogenMitogen MMororphogenphogen MMotootoggenen

HepatoHepatocytescytes EEpithelialpithelial cells cells EEndotndothhelial elial cellscells NeuronsNeurons MelanoMelanocytescytes LLymphocytesymphocytes Bone marrow derived Bone marrow derived

cellscells

Page 11: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF/SFHGF/SF

NoNormal developmentrmal development

and adult homeostasisand adult homeostasis Development og kidney, Development og kidney,

liver, spleen and placentaliver, spleen and placenta NeuronalNeuronal developmen developmentt BBranching morphogenesis ranching morphogenesis Kidney and lung Kidney and lung

regenerationregeneration Normal functions of liverNormal functions of liver Wound healingWound healing

CarsinogenesisCarsinogenesis Carcinomas (kCarcinomas (kolon, olon,

mammary, head-neck, mammary, head-neck, gastric, lunggastric, lung, thyroid and , thyroid and renal carcinomas)renal carcinomas)

MMelanomelanomasas SSararcomascomas

Lung??Lung??

Page 12: Role of HGF/ cMet Signaling Pathway  in NSCLC

N: N terminal Domain, K1-K4 Kringle Domains, SPH:Serin Proteinase Homology Domain

Hepatocyte Growth Hepatocyte Growth Factor / Scatter Factor Factor / Scatter Factor

(HGF/SF)(HGF/SF)

Page 13: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF (Aktive) 69kDa+32 kDA

Target Cells

c-Met (HGF receptor)HGFA (latent)

Nonparanchimal cells

Pro-HGF (latent) 92 kDa

HGFA (active)Trombin

HAI

Hepatocyte Growth Hepatocyte Growth Factor / Scatter Factor Factor / Scatter Factor

(HGF/SF)(HGF/SF)

Page 14: Role of HGF/ cMet Signaling Pathway  in NSCLC

Effect of HGF Effect of HGF stimulationstimulation

Plasma Membrane

Unstimulated

Substrates

Stimulated

Page 15: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF-HGF-c-Met c-Met

SignaliSignaling ng

PathwPathwayay

*Cell polarity*Actin cytoskeleton*Motility

*Proliferation*Cell Cycle regulation

*C/C contacts

*Migration*Invasion

*Survival

Branching morphogenesis

Plasma Membrane

Page 16: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF/c-MetHGF/c-MetInvasion MetastsisInvasion Metastsis

*HGF is the unique extracellular signaling molecule that can trigger increase in extracellular matrix proteolysis, cell dissociation, cellular motility

*Inhibitors that block this pathway blocks cell motility, invasion and angiogenesis as well.•Atabey N, et al. J of Biol Chem 276 (17) : 14308-14, 2001,

•Maulik G et al, Cytokine Growth Factor Rev 13(1): 41-59, 2002,

•Soriano JS, et al Mol Cancer Ther, 2004

Page 17: Role of HGF/ cMet Signaling Pathway  in NSCLC

Relationship between c-Met-HGF Relationship between c-Met-HGF Signaling and Solid Tumor Signaling and Solid Tumor

MetastasisMetastasis

Normal Epithelial Cells

VEGF, bFGF HGF, uPA,MMPs

ECMOrgan spesific

Metastasis

BrainLiverBoneBone Marrow

Transformed cellsMotility

ScatteringMigrationInvasion

Metastasis

Page 18: Role of HGF/ cMet Signaling Pathway  in NSCLC

C-Met in NSCLCC-Met in NSCLC Increase in c-Met expression and autonomous Met Increase in c-Met expression and autonomous Met

kinase activitykinase activity In patients exhibiting recurrence, HGF level is high, In patients exhibiting recurrence, HGF level is high,

related with poor prognosis related with poor prognosis Siegfried JM et al, Cancer Res 57(3):433-9, 1997. Siegfried JM et al, Cancer Res 57(3):433-9, 1997.

Constitutive and paracrine activation of c-Met Constitutive and paracrine activation of c-Met activates signaling pathways that regulates cell activates signaling pathways that regulates cell survival and proliferation. This leads to tumor survival and proliferation. This leads to tumor progression. progression. Qiao H et al, J Cell Biochem 86(4): 665-77, 2002.Qiao H et al, J Cell Biochem 86(4): 665-77, 2002.

Adenokarsinomda %35, Büyük hücreli andiferansiye Adenokarsinomda %35, Büyük hücreli andiferansiye kanserinde %20, Skuamöz hücreli kanserde ise kanserinde %20, Skuamöz hücreli kanserde ise normal akciğer dokusundan normal akciğer dokusundan daha az veya yakındaha az veya yakın oranda, Adenokarsinomda c-met’in ekspresyon düzeyi oranda, Adenokarsinomda c-met’in ekspresyon düzeyi ile tümör diferansiasyonu arasında ile tümör diferansiasyonu arasında korelasyonkorelasyon var varTsao MS et al, Lung Cancer 20(1): 1-16,1998.Tsao MS et al, Lung Cancer 20(1): 1-16,1998.

Page 19: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF and c-met expression analysis HGF and c-met expression analysis in 63 NSCLC tissue samples in 63 NSCLC tissue samples obtained from Dokuz Eylul obtained from Dokuz Eylul University, School of Medicine, University, School of Medicine, Department of Pathology was Department of Pathology was established immunohistochemically. established immunohistochemically.

Page 20: Role of HGF/ cMet Signaling Pathway  in NSCLC

Due to IHC analysis, Due to IHC analysis, of these NSCLC of these NSCLC tissue samplestissue samples

c-Met expression c-Met expression was increased in was increased in 81%,81%,

HGF expression was HGF expression was increased in 48%. increased in 48%.

c-Met

HGF

Page 21: Role of HGF/ cMet Signaling Pathway  in NSCLC

In late stage cases, c-Met expression In late stage cases, c-Met expression was high in 72 %, HGF expression was high in 72 %, HGF expression was high in 58 % of the cases.was high in 58 % of the cases.

There was no corelation between There was no corelation between tumor size, lymphatic metastasis, tumor size, lymphatic metastasis, tumor stage and recurrency.tumor stage and recurrency.

In 3 cases with metastasis, c-met In 3 cases with metastasis, c-met expression was found to be high.expression was found to be high.

Page 22: Role of HGF/ cMet Signaling Pathway  in NSCLC
Page 23: Role of HGF/ cMet Signaling Pathway  in NSCLC

MethodMethodParaffin blocked tissue samples

DNA Isolation (Nucleospin)

Polymerase Chain Reaction (PCR)

Agarose Gel Electrophoresis

DNA sequence analysis (ABI Prism)

Blast analysis (Multalin)

Page 24: Role of HGF/ cMet Signaling Pathway  in NSCLC

with primers flanking exon 14 c-Met reseptörünün tirozin kinaz

bölgesini kodlayan 14.eksona özgü primerler

Forward primer: GCCCATGATAGCCGTCTTTA

Revers primer: CAACAATGTCACAACCCACTG

Page 25: Role of HGF/ cMet Signaling Pathway  in NSCLC
Page 26: Role of HGF/ cMet Signaling Pathway  in NSCLC

ResultsResults

256 bp

Exon 14 PCR AmplificationExon 14 PCR Amplification DNA Sequence AnalysisDNA Sequence Analysis

A deletion

Frameshift

Squamous cell Ca Ca T3N0M0

c-met overexpression

Page 27: Role of HGF/ cMet Signaling Pathway  in NSCLC

HGF/c-Met pathway may be HGF/c-Met pathway may be important in NSCLC development.important in NSCLC development.

Page 28: Role of HGF/ cMet Signaling Pathway  in NSCLC

1- Mutation analysis of exon 13 and 1- Mutation analysis of exon 13 and exons 15-20 exons 15-20 2- Increase sample group size2- Increase sample group size3- Identification of molecules in HGF/c-3- Identification of molecules in HGF/c-Met signaling that may participate in Met signaling that may participate in NSCLC developmentNSCLC development

Studies under progress