-
RESEARCH Open Access
RNA interference targeting virion core proteinORF095 inhibits
Goatpox virus replication in VerocellsZhixun Zhao1, Guohua Wu1†,
Xueliang Zhu1, Xinmin Yan1, Yongxi Dou2, Jian Li1, Haixia Zhu1,
Qiang Zhang1,2* andXuepeng Cai1,2*
Abstract
Background: Goatpox is an economically important disease in goat
and sheep-producing areas of the world.Many vaccine strategies
developed to control the disease are not yet completely successful.
Hairpin expressionvectors have been used to induce gene silencing
in a large number of studies on viruses. However, none of
thesestudies has been attempted to study GTPV. In the interest of
exploiting improved methods to control goat pox, itis participated
that RNAi may provide effective protection against GTPV. In this
study we show the suppression ofGoatpox virus (GTPV) replication
via knockdown of virion core protein using RNA interference.
Results: Four short interfering RNA (siRNA) sequences (siRNA-61,
siRNA-70, siRNA-165 and siRNA-296) against aregion of GTPV ORF095
were selected. Sense and antisense siRNA-encoding sequences
separated by a hairpin loopsequence were designed as short hairpin
RNA (shRNA) expression cassettes under the control of a human
U6promoter. ORF095 amplicon was generated using PCR, and then
cloned into pEGFP-N1 vector, named as p095/EGFP. p095/EGFP and each
of the siRNA expression cassettes (p61, p70, p165 and p296) were
co-transfected intoBHK-21 cells. Fluorescence detection, flow
cytometric analysis, retro transcription PCR (RT-PCR) and real time
PCRwere used to check the efficiency of RNAi. The results showed
that the ORF095-specific siRNA-70 effectively down-regulated the
expression of ORF095. When Vero cells were transfected with shRNA
expression vectors (p61/GFP,p70/GFP, p165/GFP and p296/GFP) and
then infected with GTPV, GTPV-ORF095-70 was found to be the
mosteffective inhibition site in decreasing cytopathic effect (CPE)
induced by GTPV. The results presented here indicatedthat DNA-based
siRNA could effectively inhibit the replication of GTPV
(approximately 463. 5-fold reduction of viraltiters) on Vero
cells.
Conclusions: This study demonstrates that vector-based shRNA
methodology can effectively inhibit GTPVreplication on Vero cells.
Simultaneously, this work represents a strategy for controlling
goatpox, potentiallyfacilitating new experimental approaches in the
analysis of both viral and cellular gene functions during of
GTPVinfection.
Keywords: RNAi, shRNA, ORF095, Goatpox virus
* Correspondence: [email protected]; [email protected]†
Contributed equally1Key Laboratory of Animal virology of the
Ministry of Agriculture, State KeyLaboratory of Veterinary
Etiological Biology, Lanzhou Veterinary ResearchInstitute, Chinese
Academy of Agriculture Sciences, No. 1 Xujiaping, Lanzhou,Gansu
730046, PR ChinaFull list of author information is available at the
end of the article
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
© 2012 Zhao et al; licensee BioMed Central Ltd. This is an Open
Access article distributed under the terms of the Creative
CommonsAttribution License
(http://creativecommons.org/licenses/by/2.0), which permits
unrestricted use, distribution, and reproduction inany medium,
provided the original work is properly cited.
mailto:[email protected]:[email protected]://creativecommons.org/licenses/by/2.0
-
BackgroundGTPV is a member of the Genus Capripoxvirus of
thefamily Poxviridae [1], which also includes the Sheeppoxvirus
(SPPV) and the Lumpy Skin Disease Virus (LSDV)of cattle. Both
sheeppox and goatpox are endemic inAfrica, the Middle East and many
countries in Asia, andthe diseases caused by these viruses have a
significanteconomic impact on the livestock industry in Africa
andAsia [2]. GTPV genome is approximately 150 kbp dou-ble-stranded
DNA, which composes at least 147 putativegenes, including conserved
replicative and structuralgenes and genes likely involved in
virulence and hostrange [3]. ORF095 encodes the virion protein
whichconstitutes a great part of the total protein content ofthe
virion and is essential during the assembly and dis-assembly of
virion. It is similar to myxoma virus(MYXV) M093L (accession
no.AF170726) [4,5] and vac-cinia virus (VACV) A4L (accession
no.M35027) thatencodes a 39 kDa acidic protein, a part of the viral
core,and is synthesized at late stages after infection
[6,7].RNA-mediated interference (RNAi) is a conserved
gene-silencing mechanism, where by the double-stranded RNA
matching is used as a signal to triggerthe sequence-specific
degradation of homologousmRNA [8]. RNAi can be triggered by
chemically synthe-sised and enzymatically produced 21-25 nt long
RNAduplexes in mammalian cells [9,10]. Since the effect ofshort
interfering RNAs (siRNAs) is generally temporalin transfected
animal cells, small RNA expression vec-tors have been developed to
induce long-lasting RNAsilencing in mammalian cells [11-14]. RNAi
represents anew antiviral method and is being increasingly used
toinhibit the replication of viral pathogens [15] such
asfoot-and-mouth disease [16,17], porcine reproductiveand
respiratory syndrome virus [18], Newcastle diseasevirus [19],
classical swine fever virus [20] and Monkey-pox virus [21]. Hairpin
expression vectors have beenused to induce gene silencing in a
large number of stu-dies on viruses [11,22-26].This study provides
not only an experimental basis for
the development of a new anti-GTPV strategy, but alsofor a new
approach to the study of GTPV infection andreplication.
Materials and methodsViruses and cellsGoatpox virus strain
A/Goat/Qinghai/AV40/2006(a cell-adapted strain) was used in this
study and maintained inAfrican green monkey kidney cells (Vero).
Baby Ham-ster Kidney cells (BHK-21) and the GTPV permissivecell
line Vero (Lanzhou Veterinary Research Institute,Chin) were
cultured in Dulbecco’s modified Eagle’smedium (DMEM; Sigma)
supplemented with 10% heat-
inactivated fetal bovine serum (FBS; Hangzhou, China),100 U/ml
penicillin and 100 μg/ml streptomycin(Sigma). Cultures were
incubated at 37°C with 5% CO2.
Construction of plasmidsThe cDNA cassettes corresponding to the
conservedgene of the GTPV genome was cloned into the pEGFP-N1
vector (Figure 1A). Directed cloning PCR was usedto amplify the
ORF095 gene, using the following pri-mers (sense:
5’-GTCCTCGAGATGGACTTCAT-GAAAAAATATACTAA-3’ and antisense:
5’-GCGGATCCTTGCTGTTATTATCATCTAGTTTG-3’)used for amplification
contained the target sequencesfor XhoI (CTCGAG) and BamHI (GGATCC)
incorpo-rated at the 5’ of the viral complementary sequence.Forward
primer contained an ATG sequence, before thesequence that codified
for the protein, as a start initia-tion codon of protein
translation. The reverse primeruncontained a TTA sequence, which
was used in thecharacterization of ORF095 protein and EGFP
co-expression. PCR products were digested with XhoI andBamHI, and
cloned into the pEGFP-N1 expression vec-tor (Invitrogen, Inc.,
Shanghai, China). The final con-struct p095/EGFP (Figure 1A) was
analyzed byrestriction digestion and sequenced. Plasmids used
for
Figure 1 Schematic representations of target construct,
siRNA-expressing plasmids, and predicted siRNAs. (A)Position of
targetsiRNAs: GTPV-ORF095-61, GTPV-ORF095-70, GTPV-ORF095-165
andGTPV-ORF095-296. (B) siRNA expressing plasmids and
predictedsiRNAs. An inverted repeat is inserted at the 3’-end of
the humanU6 promoter. The forward sequence of the repeat is 21 or
63 ntlong, corresponding to the region of interest of the ORF095
gene.The forward and reverse motifs are separated by a 7-nt spacer,
5’-TCAAGAG-3’. The transcriptional termination signal of five Ts
isadded at the 3’-end of the inverted repeat. The synthesized RNA
ispredicted to fold back to form a hairpin dsRNA, which would
befinally processed into the putative siRNAs.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 2 of 9
-
transfection were purified with the Wizard PurefectionTM Plasmid
DNA Purification System (Promega, USA)and quantified by
Biophotometer (Eppendorf, Germany).
Target sequence selection and vector constructionAs the AAGN18UU
sequence (N, any nucleotide) hasbeen found to be preferred for
siRNA-mediated genesilencing under the control of the PolU6
promoter [27],we searched for this sequence in the ORF of
ORF095gene. Four fragments (ORF095-61, ORF095-70,ORF095-165 and
ORF095-296) in the coding region ofORF095 gene were selected
according to the web-basedcriteria (http://www.ambion.com). These
selectedsequences were then submitted to a BLAST searchingagainst
human genome sequence to check whether ornot these potential
targets have homologues in thehuman genome was not targeted. To
construct hairpinsiRNA expression cassette, the following DNA
oligonu-cleotides were synthesized: GTPV-ORF095-61, GTPV-ORF095-70,
GTPV-ORF095-165 and GTPV-ORF095-296 (Figure 1A). The 21 nt target
sequences served as abasis for the design of the two complementary
51-53mer siRNA template oligonucleotides that weresynthesized,
annealed, and inserted into BamHI andBbsI sites of the siRNA
expression vectors pGPU6/Neoand pGPU6/GFP/Neo (GenePharma Co., Ltd,
Shanghai,China), respectively. The recombinant plasmids
weredesignated as p61, p61/GFP, p70, p70/GFP, p165, p165/GFP, p296
and p296/GFP. The pC and pC/GFP negativecontrols (GenePharma Co.,
Ltd, Shanghai, China) werenegative control plasmid, which encode
hairpin siRNAthat does not have homologues in mice, human
andCarpripoxvirus genome databases.
Transfection of the siRNA expression cassettes into BHK-21
cellsBHK-21 cells were seeded in six-well plates and culturedat
37°C and 5% CO2 overnight. When the cells showed70-80% confluence,
2.5 μg of p61, p70, p165 or p296each were cotransfected with an
equal amount of p095/EGFP using FuGENE HD Transfection Reagent
(Roche,Germany) according to the Manufacturer’s recommen-dations,
respectively. Simultaneously, 2.5 μg of p095/EGFP were
cotransfected with 2.5 μg of pC. Non-trans-fected BHK-21 cells were
also used as a control.
Analysis of EGFP expression in BHK-21 cells and flowcytometry
assayAfter an additional 24 h of incubation, cells wereobserved for
the expression of green fluorescent proteinin the transfected cells
was monitoring fluorescentmicroscope (Olympus, Japan).Cells were
further subjected to fluorescence-activated
cell sorting (FACS). At 48 h posttransfection, the
transfected cells and the controls were washed gently
inphosphate-buffered saline (PBS), trypsinized and resus-pended in
PBS. EGFP positive cells and EGFP expres-sion signal were evaluated
by the FACS Calibur FlowCytometry System (Becton Dickinson,
USA).
Reverse transcription (RT)-PCRTo confirm the efficacy of RNAi,
RT-PCR was used toamplify the target gene in the transfected cells.
TotalRNA was extracted from BHK-21 culture with Trizolreagent
(TaKaRa, Dalian), and incubated for 1 h at 37°Cwith Dnase RQ1
(TaKaRa, Dalian). To detect ORF095mRNA expression in BHK-21 cells,
RT-PCR was con-ducted using 1.8 μg of RNA extracts with
Superscriptone-step RT-PCR system (Gibco, BRL). Retrotranscrip-tion
b-actin as a control was also amplified using thePrimers
5’-CACCCGCGAGTACAACCTTC-3’ (sense)and 5’-CCCATACCCACCATCACACC-3’
(antisense).PCR was run for 30 cycles with 95°C for 30 s, 56°C
for45 s and 72°C for 45 s. To verify primer specificity, amelting
curve was analyzed, and RT-PCR products werefurther cloned into
pMD18-T for sequencing.
Real-time PCR analysisIn order to use full-length ORF095 gene as
a quantita-tive RT-PCR standard, Selected primer sequenceswere
CTGTCTACATGATTAACCCACTCGTTCTTC(ORF095 FP primer), and
GAAGTCGACTACCCCTCTCCCTATCAGGGTCATC (ORF095 RP pri-mer). One
additional primer was synthesized for quanti-fication of the ORF095
in real-time PCR: 5-FAM-CCTTGCTCGCGAATTTCTCACCGATAMRA- 3(TaqMan
probe). The target region of real time RT-PCRwas 263-389 bp of
ORF095.For quantitative analysis of the ORF095 gene, 100 ng
total RNA from p095/EGFP-transfected cells was mixedwith 1 μL
ORF095 primer, heated to 65°C for 5 minand chilled on ice for 2
min. To this primer templatemix was added 5× buffer (4 μL), 10
mmol/μL dNTP (1μL), RNasin (1 μL), AMV reverse transcriptase (1
μL,Promega, USA) and ddH2O to a total volume of 20 μL.The reaction
mixture was incubated at 42°C for 45 min,followed by inactivation
of reverse transcriptase at 75°Cfor 15 min. Real-time PCR was
performed with the ABIPRISM 7000 Sequence Detection System using 2
μLtranscriptase products as template under the conditionsof 95°C
for 15 min, followed by 50 cycles of denatura-tion at 95°C for 30
s, annealing, and extension at 60°Cfor 30 s. The quantitative
standard curve for determina-tion of ORF095 copy number was created
by real-timePCR of standard plasmid p095/EGFP serial 10-fold
dilu-tions of a stock containing 108 copies/μL. The specificityof
the real-time PCR was confirmed by sequencing ofthe product.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 3 of 9
http://www.ambion.com
-
Transfection and GTPV infection Vero cellsFour siRNAs targeting
ORF095 were designed to inhibitGTPV ORF095 gene expression in
BHK-21 cells. Weused a modified CMV promoter, a typical RNA
polIIIpromoter, to drive the transcription of the siRNAs. Tomonitor
the effects of the siRNAs, eukaryotic expressionplasmid p095/EGFP
was constructed, in which theORF095 gene were fused to the 5’-end
of the EGFP cod-ing sequence, and cotransfected with their
specificsiRNA expression plasmids. So the inhibitory effects ofthe
ORF095-specific siRNAs on the ORF095 expressioncould be indirectly
evaluated by the expression of EGFPin the transfected cells.To test
whether the expressed siRNAs inhibited GTPV
production, we first assessed the growing capacity ofGTPV in
Vero cells expressing siRNAs. Vero cells wereseeded in six-well
plates and cultured at 37°C and 5%CO2 overnight. When the cell
reached 70-80% conflu-ence, 2.5 μg of p61/GFP, p70/GFP, p165/GFP or
p296/GFP each were cotransfected with an equal amount ofpC/GFP as
described above, respectively. The nonspeci-fic vector pC/GFP and
non-transfected Vero cells werealso used as a control. 24 h
posttransfection, the cellswere infected with GTPV at a
multiplicity of infection(moi) of about 0.01. Briefly, after
removing the culturemedium, GTPV (200 μl) in infection medium (2.5
μg/mltrypsin), respectively, were added to each well. The cul-tures
were then incubated at 37°C, 5% CO2 for 4 h, atwhich point the
culture medium was replaced with freshDMEM containing 2% fetal
bovine serum.
Virus titrationTo determine transfection efficiency, we
monitored GFPfluorescence intensity of transfected cells using
fluores-cent microscope analysis. Culture supernatants were
col-lected for virus titration. Six days post
infection,supernatants was harvested from the infected culturesand
virus titer (TCID50) was determined three times onVero cells.Virus
infectivity was determined by serial dilutions of
the samples in 96-well plates and the virus titer was
cal-culated as a TCID50 by the Reed-Muench method [28].A viral
suspension titrated at 10-1 to 10-8 TCID50 per0.1 ml was used for
viral challenge. Vero cells (about80% confluent) grown in 96-well
plates were transientlytransfected with 0.1 μg p61/GFP, p70/GFP,
p165/GFPand p296/GFP, respectively, per well. After 6 h of
trans-fected, the transfection medium was removed and thecells were
washed twice with DMEM medium. Thetransfected cells were then
infected with 100 TCID50 ofvirus per 0.1 ml per well. After
additional 1 h incuba-tion, the inoculum was removed and the cells
werewashed twice with DMEM medium. The cells were thenmaintained in
DMEM medium supplemented with 10%
fetal bovine serum for 6 days. For detecting the thera-peutic
potential of siRNA, in another parallel experi-ment, transfection
was performed 1 h post-infectionwith the virus. GTPV replication in
Vero cells was eval-uated by virus titer (TCID50).
ResultsTransient cellular transfection and analysis of
thetargeted gene and EGFP expression in BHK-21 cellsDifferent
siRNAs suppressed the expression of fusiongreen fluorescent protein
in BHK-21 cells is different.The siRNAs targeting to the conserved
region of GTPVgenome were generated in vitro by human
recombinantDicer enzyme, as described in Figure 1B. To identify
aneffective inhibitory effect of siRNAs, the cDNA cassettesof these
regions were inserted into the 5’ end ofenhanced green fluorescent
protein (EGFP) gene to con-struct reporter plasmids (Figure 2). The
reporter plas-mids were used to cotransfect BHK-21 cells with
eitherthe homologous siRNAs or the heterologous siRNAs.The results
showed that the number of EGFP-expressingcell was markedly reduced
in the sample transfectedwith homologous siRNAs than sample
transfected withheterologous siRNAs or non-transfected (Figure
3A).FACS demonstrated that the levels of inhibitionmediated by the
siRNAs were similar among the differ-ent experiment groups and
significantly higher than thecontrol group (cotransfection with
heterologous siRNAsor without siRNAs).The inhibitory effects of the
siRNAs on expression of
EGFP were quantitatively validated by flow cytometry 48h
posttransfection. The extent of EGFP down regulationwas assessed by
the mean fluorescence of the positivecells (LR-values) and the rate
of EGFP positive cells
Figure 2 Amplification of ORF095 gene from the GTPVgenome by PCR
and identification of recombinant plasmidp095/EGFP by restriction
and PCR. M1 DNA marker DL 2000; 1&2PCR products; M2 DNA marker
500-12000; 3 map of restriction byBamHI and XhoI; 4 PCR product; N
negative control.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 4 of 9
-
(Figure 3B). Compared with the pC, the LR-values of theEGFP
positive cells were reduced in the cells transfectedwith ORF095
siRNA-specific expression plasmids p61,p70, p165 and p296, and were
reduced by 90.9%, 96.7%,66.0%and 69.32%, respectively.To further
demonstrate the levels of inhibition, cells
were collected 48 h post-transfection and RT-PCR ana-lysis was
performed. The level of target RNA, as deter-mined by RT-PCR, was
also significantly reduced incells transfected with homologous
siRNAs (Figure 4A).To measure the level of gene suppression
accurately,QPCR primers and Taqman probes directing to ORF095were
designed. We also designed probes and primers
directed tob-actin sequence (serve as internal reference).When
normalized for loading differences using the b-actin mRNA, the
ORF095 message in the cells trans-fected with p61, p70, p165 and
p296 were reduced by69%, 97%, 22%and 57% (ORF095 message copies
ratiosof cells transfected with shRNA expression
vectors/cellstransfected with empty vector)(Figure 4B). There was
nosignificant inhibition in cells transfected with the emptyvector
pEGFP-N1 and nonspecific shRNA expressionvector pC. mRNA levels of
ORF095 (average ORF095mRNA levels in cells treated with p61, p70,
p165, p296,pC and empty vector were 0.416, 0.036, 1.046,
0.580,1.345, respectively) or b-actin suggested that the
Figure 3 Transient expression of siRNAs conferred the
sequence-specific inhibition of expression of GTPV ORF95 in BKH-21
cells. (A)Fluorescence detection of cotransfection of p095/EGFP
with their corresponding siRNA expression plasmids 24 h
posttransfection. (B) Flowcytometric analysis of cotransfection of
p095/EGFP with their corresponding siRNA expression plasmids 48 h
posttransfection. EGFP expressionlevel in cells cotransfected with
(a) pEGFP-N1 vector; (b) p095/EGFP; (c) p095/EGFP and p61; (d)
p095/EGFP and p70; (e) p095/EGFP and p165; (f)p095/EGFP and p296;
(g) p095/EGFP and pControl; (h) BHK-21 cell control. LR-Value means
the rate of EGFP positive cells.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 5 of 9
-
reductions in ORF095 message did not result from
poortransfection, nonspecific inhibition or toxicity, becausethe
average mRNA levels of b-actin for experimentalcells were not
significantly reduced compared to thecontrol cells. In addition,
the suppressive effect wasfound to be gene-specific, because the
inhibitory effectof empty vector and nonspecific shRNA expression
vec-tor pC were negligible. These results suggest that thesiRNA
generated by in vitro transcription effectively andspecifically
inhibit the expression of GTPV ORF095 con-served regions in BHK-21
cells.
Interference of GTPV replication by shRNA expressionvectorTo
investigate whether or not knockout of ORF095relieves cytopathic
effect (CPE) induced by GTPV,Vero cells were transfected by
plasmids expressing
ORF095 protein-targeted shRNAs (p61/GFP, p70/GFP,p165/GFP and
p296/GFP), respectively. NonspecificshRNA expression vector pC/GFP
was transfected inparallel. 4 h post-transfection, the cultures
wereinfected with GTPV and checked daily. Six days later,we found
that cells pre-transfected with p70/GFPexhibited less CPE, whereas
other shRNA-treated cellsand the empty vector control demonstrated
the sametypical GTPV-induced CPE as cells infected only withvirus,
as shown in Figure 5.The TCID50 assay was performed to examine
the
effect of siRNA on production of viable virus, and theresults
(Figure 6) showed that in control cells the titersreached 10-5.12
TCID50/0.1 mL at 6 days post-infection.In contrast, the titers in
the cells transfected with p61/GFP, p70/GFP, p165/GFP or p296/GFP,
were 10-3.75,10-2.48, 10-4.73 and 10-4.66/0.1 mL 6 days
post-infection
Figure 4 Analysis effect of RNAi on ORF095 by RT-PCR. (A) Cells
were harvested, and transcripts were analyzed by RT-PCR
amplification. The28S, 18S, and 5.8S rRNAs were visualized under UV
light for equal loading control. (B) Specific siRNA inhibits the
accumulation of ORF095message. BHK-21 cells were transfected with
pEGFP-N1 and then transfected with variant shRNA-expressing
vectors. Forty hours post-transfection, total RNA was extracted and
subjected to fluorescence quantitative PCR analysis. pC transfected
cells and mock-transfected cellswere used as controls. The mRNA of
beta actin served as an internal reference.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 6 of 9
-
respectively, corresponding to 23.4-, 463.5-, 1.4- and2.9- fold
reductions in viable virus production.
Dose-dependent inhibitory effect of shRNA expressionvector
p70/GFPTo characterize the antiviral properties of most potentsiRNA
construct, namely p70/GFP, Vero cells weretransfected with dilution
of each construct to cover arange of 0.1-5.0 μg in six
concentrations. Overnighttransfected cells were infected with GTPV
at an MOI of0.01 and viral replication was examined at 48 h PI
(Figure 7). p70/GFP showed average viral replicationinhibition
of 5.3% at the lowest tested concentration of0.1 μg, and complete
inhibition at concentrations of 2.5μg and higher.
DiscussionRNAi is a process of sequence-specific,
post-transcrip-tional gene silencing that is initiated by double
strandedRNA. Introduction of siRNA results in degradation ofsiRNA
specific transcripts thus reducing the expressionof their protein
product. In plants, it is a natural anti-viral defense mechanism
[29]. In mammalian cells, how-ever, dsRNAs longer than 30 nt
activate an antiviraldefense leading to the nonspecific degradation
of RNAtranscripts and a general shutdown of host-cell
proteintranslation [30]. The successful use of siRNA in animalcells
encouraged the development of siRNA expressionvector [31] and
numerous studies have demonstratedthat DNA-based siRNA is a
promising approach forantiviral therapy in mammals. RNAi represents
a newantiviral method and is being increasingly used to inhi-bit
the replication of viral pathogens [15], such as HIV-1 [32],
hepatitis C [33], influenza [34], severe acuterespiratory syndrome
[35]and hepatitis E viruses [36].This study has demonstrated the
use of pGPU6/Neo orpGPU6/GFP/Neo vector-based RNAi against GTPV,
amajor pathogen of goats and sheep. Four differentsiRNA targeting
viral gene ORF095, one key geneinvolved in GTPV replication,
successfully reduced viralreplication.The results showed that the
ORF095-specific siRNAs
p70 could effectively down-regulate the expression of
Figure 5 Cytopathic effect (CPE) analysis of GTPV on Vero
cellstransfected with shRNA-expressing vectors (2.5 μg each).
(A):Cells just were infected GTPV; (B)-(G):p61/GFP, p70/GFP,
p165/GFP,p296/GFP, pC/GFP and untreated cells, respectively.
Except(G), allcells were infected with
GTPV(A/Goat/Qinghai/SV40/2006) isolate ata multiplicity of
infection (MOI) of 0.01. Pictures were taken at 6days
post-infection with an Olympus digital camera (Olympus,Japan) at a
magnification of × 40 with an exposure time of 1/8 s.
Figure 6 GTPV-ORF095 gene RNA-specific siRNAs can inhibitthe
production of progeny virus. Vero cells transiently transfectedwith
empty vector or plasmid carry siRNA-61, 70, 165 or 296 wereinfected
with GTPV at an MOI of 0.01. Viruses were harvested andtiters were
determined as described above. Mock-infected cells wereused as a
control. The values given are average of threeindependent
experiments. Error bars indicate standard deviations.
Figure 7 Dose-dependent inhibitory effect of shRNAexpression
vector p70/GFP. Vero cells were transfected withvariant p70/GFP and
then infected with GTPV at an MOI of 0.01. 48h post-infection,
total RNA was extracted and subjected toquantitative PCR analysis.
Mock-transfected cells were used ascontrols. The mRNA of beta actin
served as an internal reference.Black bars indicate normalized
shRNA+ (cells transfected with p70/GFP at six different
concentrations ranging from 0.1 to 5.0 μg) GTPVmessage copies
ratios. The data shown represent average fromthree experiments with
the standard deviations indicated by errorbars.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 7 of 9
-
ORF095, while p61, p165 and p296 displayed weakactivity.
Additionally, expression of the housekeepinggene b-actin was also
analyzed by RT-PCR and quanti-tative real-time PCR, and no
significant difference in theexpression of b-actin was observed
between the siRNAstreatment groups and pC treatment
groups.Different siRNA sequences display widely different effi-
cacies with regard to suppression of gene expression,requiring
screening of multiple sequences [37]. In thisresearch, we have
selected four target sequences for RNAinterference by the software
applications, “siRNA TargetFinder and Design Tool” available at
http://www.ambion.com/. As the ORF095 gene is well conserved in
GTPVand ORF095 protein is a virion core protein and assemblyprotein
in GTPV, we selected ORF095 as a target gene. Inorder to generate
shRNA expression cassettes quickly andaccurately, we employed a
PCR-based strategy to clonesiRNA sequences. In this strategy, siRNA
sequences weredesigned as a single primer sequence of which 19 bp
com-plementary to the human U6 promoter were added. Theresulting
PCR products are shRNA expression cassettesincluding the human U6
promoter. shRNAs that havebeen generated from this expression
system are efficientlyprocessed by dicer into siRNAs. In addition,
in this study,we selected pEGFP-N1 vector that contains an EGFP
geneas report gene and can be transfected into mammaliancells using
any standard transfection method.Vero cells transfected with
p61/GFP, p70/GFP, p165/
GFP, p296/GFP and pC/GFP were examined for CPE byvirus
titration. All results demonstrated that siRNA-70is the most
effective one, and result showed that mini-mum concentration of the
construct p70/GFP is 2.5 μgrequired to induce maximum
inhibition.Blasting ORF095 sequence in GenBank revealed that
there were 8 Capripoxvirus isolates containing identicalsequence
corresponding to ORF095. In view of thesequences of the ORF095
genes of GTPV strains fromthe same genotype, they all share high
homology (95-100%). Therefore, ORF095 gene is a good target to
sup-press GTPV replication by RNAi.
ConclusionIn conclusion, this study demonstrates that
vector-basedshRNA methodology can effectively inhibit GTPV
replica-tion on Vero cells. Further study will be required to
deter-mine whether such treatment protect against GTPVinfection in
vivo. Still, this work represents a strategy forcontrolling
goatpox, potentially facilitating new experi-mental approaches in
the analysis of both viral and cellulargene functions during of
GTPV infection.
AbbreviationsGTPV: Goatpox virus; RNAi: RNA-mediated
interference; siRNA: Shortinterference RNA; shRNA: Short hairpin
RNA; GFP: Green fluorescent protein;
EGFP: Enhanced green fluorescent protein; p095/EGFP: pEGFP-N1
expressionORF095 gene cassette; p61 p70, p165, p296 and pC were
siRNA-61, 70, 165,196 and control expression cassettes pGU6/Neo
plasmids; p61/GFP p70/GFP:p165/GFP, p296/GFP and pC/GFP were
siRNA-61, 70, 165, 196 and controlexpression cassettes pGU6/GFP/Neo
plasmids; CPE: Cytopathic effect; PCR:Polymerase chain reaction;
RT-PCR: Retro transcription PCR; SPPV: Sheeppoxvirus; LSDV: Lumpy
Skin Disease Virus; MYXV: Myxoma virus; VACV: Vacciniavirus;
BHK-21: Baby Hamster Kidney cells; Vero: African green monkey
kidneycells; DMEM: Dulbecco’s modified Eagle’s medium; FBS: Fetal
bovine serum;FACS: Fluorescence-activated cell sorting; PBS:
Phosphate-buffered saline;MOI: Multiplicity of infection; PI:
Post-infection.
AcknowledgementsWe thank Yadong Zheng for thoughtful discussions
and assistance duringmanuscript preparation. The study was
supported by grants from the China’sMinistry of Agriculture
Genetically Modified Organisms Breeding TechnologyMajor Program
(no. 2009ZX08008-010B) and the National Natural ScienceFoundation
of China (no.31001056-C1803).
Author details1Key Laboratory of Animal virology of the Ministry
of Agriculture, State KeyLaboratory of Veterinary Etiological
Biology, Lanzhou Veterinary ResearchInstitute, Chinese Academy of
Agriculture Sciences, No. 1 Xujiaping, Lanzhou,Gansu 730046, PR
China. 2Lanzhou Veterinary Research Institute, ChineseAcademy of
Agriculture Sciences, No. 1 Xujiaping, Lanzhou, Gansu 730046,PR
China.
Authors’ contributionsQZ and XC designed research; ZZ performed
research and wrote the paper;GW helped to construct partial
plasmids and analyzed data; XZ contributednew reagents/analytic
tools; XY provided partial plasmids. HZ helped toculture cells; JL
helped to culture viruses; YX D had a co-ordination role inthis
work. All authors read and approved the final manuscript.
Competing interestsThe authors declare that they have no
competing interests.
Received: 15 August 2011 Accepted: 17 February 2012Published: 17
February 2012
References1. Nawathe DR, Asagba MO, Abegunde A, Ajayi SA, Durkwa
L: Some
observations on the occurrence of lumpy skin disease in
Nigeria.Zentralbl Veterinarmed B 1982, 29:31-36.
2. Carn VM: Control of capripoxvirus infections. Vaccine 1993,
11:1275-1279.3. Tulman ER, Afonso CL, Lu Z, Zsak L, Sur JH,
Sandybaev NT,
Kerembekova UZ, Zaitsev VL, Kutish GF, Rock DL: The genomes
ofsheeppox and goatpox viruses. J Virol 2002, 76:6054-6061.
4. Johnston JB, Barrett JW, Nazarian SH, Goodwin M, Ricciuto D,
Wang G,McFadden G: A poxvirus-encoded pyrin domain protein
interacts withASC-1 to inhibit host inflammatory and apoptotic
responses to infection.Immunity 2005, 23:587-598.
5. Van Vliet K, Mohamed MR, Zhang L, Villa NY, Werden SJ, Liu J,
McFadden G:Poxvirus proteomics and virus-host protein interactions.
Microbiol MolBiol Rev 2009, 73:730-749.
6. Kovacs GR, Moss B: The vaccinia virus H5R gene encodes late
genetranscription factor 4: purification, cloning, and
overexpression. J Virol1996, 70:6796-6802.
7. Maa JS, Esteban M: Structural and functional studies of a
39,000-Mrimmunodominant protein of vaccinia virus. J Virol 1987,
61:3910-3919.
8. Sharp PA, Zamore PD: Molecular biology. RNA interference.
Science 2000,287:2431-2433.
9. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K,
Tuschl T: Duplexesof 21-nucleotide RNAs mediate RNA interference in
cultured mammaliancells. Nature 2001, 411:494-498.
10. Sohail M, Doran G, Riedemann J, Macaulay V, Southern EM: A
simple andcost-effective method for producing small interfering
RNAs with highefficacy. Nucleic Acids Res 2003, 31:e38.
11. Brummelkamp TR, Bernards R, Agami R: A system for stable
expression ofshort interfering RNAs in mammalian cells. Science
2002, 296:550-553.
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 8 of 9
http://www.ambion.com/http://www.ambion.com/http://www.ncbi.nlm.nih.gov/pubmed/7090644?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/7090644?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8296478?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12021338?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12021338?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16356857?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16356857?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19946139?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8794318?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8794318?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3316708?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3316708?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/10766620?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11373684?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11373684?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11373684?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12655026?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12655026?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12655026?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11910072?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11910072?dopt=Abstract
-
12. Pinkenburg O, Platz J, Beisswenger C, Vogelmeier C, Bals R:
Inhibition ofNF-kappaB mediated inflammation by siRNA expressed by
recombinantadeno-associated virus. J Virol Methods 2004,
120:119-122.
13. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers C, Yang L,
Kopinja J,Rooney DL, Zhang M, Ihrig MM, McManus MT, Gertler FB,
Scott ML, VanParijs L: A lentivirus-based system to functionally
silence genes inprimary mammalian cells, stem cells and transgenic
mice by RNAinterference. Nat Genet 2003, 33:401-406.
14. Zhao LJ, Jian H, Zhu H: Specific gene inhibition by
adenovirus-mediatedexpression of small interfering RNA. Gene 2003,
316:137-141.
15. He YX, Hua RH, Zhou YJ, Qiu HJ, Tong GZ: Interference of
porcinereproductive and respiratory syndrome virus replication on
MARC-145cells using DNA-based short interfering RNAs. Antiviral Res
2007, 74:83-91.
16. Haasnoot J, Westerhout EM, Berkhout B: RNA interference
against viruses:strike and counterstrike. Nat Biotechnol 2007,
25:1435-1443.
17. Luo J, Du J, Gao S, Zhang G, Sun J, Cong G, Shao J, Lin T,
Chang H:Lentviral-mediated RNAi to inhibit target gene expression
of the porcineintegrin av subunit, the FMDV receptor, and against
FMDV infection inPK-15 cells. Virol J 2011, 8:428.
18. Chen W, Liu M, Jiao Y, Yan W, Wei X, Chen J, Fei L, Liu Y,
Zuo X, Yang F,Lu Y, Zheng Z: Adenovirus-mediated RNA interference
against foot-and-mouth disease virus infection both in vitro and in
vivo. J Virol 2006,80:3559-3566.
19. Yin R, Ding Z, Liu X, Mu L, Cong Y, Stoeger T: Inhibition of
Newcastledisease virus replication by RNA interference targeting
the matrixprotein gene in chicken embryo fibroblasts. J Virol
Methods 2010,167:107-111.
20. Li J, Guo H, Shi Z, Tu C: In vitro inhibition of CSFV
replication byretroviral vector-mediated RNA interference. J Virol
Methods 2010,169:316-321.
21. Alkhalil A, Strand S, Mucker E, Huggins JW, Jahrling PB,
Ibrahim SM:Inhibition of Monkeypox virus replication by RNA
interference. Virol J2009, 6:188.
22. Brummelkamp TR, Bernards R, Agami R: Stable suppression
oftumorigenicity by virus-mediated RNA interference. Cancer Cell
2002,2:243-247.
23. McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H,
Wieland SF,Marion PL, Kay MA: Inhibition of hepatitis B virus in
mice by RNAinterference. Nat Biotechnol 2003, 21:639-644.
24. Miyagishi M, Taira K: U6 promoter-driven siRNAs with four
uridine 3’overhangs efficiently suppress targeted gene expression
in mammaliancells. Nat Biotechnol 2002, 20:497-500.
25. Paddison PJ, Caudy AA, Sachidanandam R, Hannon GJ: Short
hairpinactivated gene silencing in mammalian cells. Methods Mol
Biol 2004,265:85-100.
26. Paul CP, Good PD, Winer I, Engelke DR: Effective expression
of smallinterfering RNA in human cells. Nat Biotechnol 2002,
20:505-508.
27. Elbashir SM, Harborth J, Weber K, Tuschl T: Analysis of gene
function insomatic mammalian cells using small interfering RNAs.
Methods 2002,26:199-213.
28. Reed LJ, Muench HA: A simple method of estimating fifty
percent endpoints. Am J Hyg 1938, 27:493-497.
29. Goff A, Twenhafel N, Garrison A, Mucker E, Lawler J, Paragas
J: In vivoimaging of cidofovir treatment of cowpox virus infection.
Virus Res 2007,128:88-98.
30. Nilsen TW, Maroney PA, Baglioni C: Maintenance of protein
synthesis inspite of mRNA breakdown in interferon-treated HeLa
cells infected withreovirus. Mol Cell Biol 1983, 3:64-69.
31. Miyagishi M, Taira K: Development and application of siRNA
expressionvector. Nucleic Acids Res Suppl 2002, 2:113-114.
32. Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J,
Lee SK,Collman RG, Lieberman J, Shankar P, Sharp PA: siRNA-directed
inhibitionof HIV-1 infection. Nat Med 2002, 8:681-686.
33. Sen A, Steele R, Ghosh AK, Basu A, Ray R, Ray RB: Inhibition
of hepatitis Cvirus protein expression by RNA interference. Virus
Res 2003, 96:27-35.
34. Ge Q, Filip L, Bai A, Nguyen T, Eisen HN, Chen J: Inhibition
of influenzavirus production in virus-infected mice by RNA
interference. Proc NatlAcad Sci USA 2004, 101:8676-8681.
35. Akerstrom S, Mirazimi A, Tan YJ: Inhibition of SARS-CoV
replication cycleby small interference RNAs silencing specific SARS
proteins, 7a/7b, 3a/3b and S. Antiviral Res 2007, 73:219-227.
36. Huang F, Hua X, Yang S, Yuan C, Zhang W: Effective
inhibition of hepatitisE virus replication in A549 cells and
piglets by RNA interference (RNAi)targeting RNA-dependent RNA
polymerase. Antiviral Res 2009, 83:274-281.
37. Amarzguioui M, Rossi JJ, Kim D: Approaches for chemically
synthesizedsiRNA and vector-mediated RNAi. FEBS Lett 2005,
579:5974-5981.
doi:10.1186/1743-422X-9-48Cite this article as: Zhao et al.: RNA
interference targeting virion coreprotein ORF095 inhibits Goatpox
virus replication in Vero cells. VirologyJournal 2012 9:48.
Submit your next manuscript to BioMed Centraland take full
advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at www.biomedcentral.com/submit
Zhao et al. Virology Journal 2012,
9:48http://www.virologyj.com/content/9/1/48
Page 9 of 9
http://www.ncbi.nlm.nih.gov/pubmed/15234817?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15234817?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15234817?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12590264?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12590264?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12590264?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/14563560?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/14563560?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16730075?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16730075?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16730075?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18066040?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18066040?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/21899738?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/21899738?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/21899738?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16537624?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16537624?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20171246?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20171246?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20171246?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20691206?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20691206?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19889227?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12242156?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12242156?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12740585?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12740585?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11981564?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11981564?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11981564?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15103070?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15103070?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11981566?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/11981566?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12054897?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12054897?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17524511?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17524511?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6828030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6828030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6828030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12903131?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12903131?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12042777?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12042777?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12951263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12951263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15173599?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15173599?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17112601?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17112601?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17112601?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19576249?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19576249?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19576249?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16199038?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16199038?dopt=Abstract
AbstractBackgroundResultsConclusions
BackgroundMaterials and methodsViruses and cellsConstruction of
plasmidsTarget sequence selection and vector
constructionTransfection of the siRNA expression cassettes into
BHK-21 cellsAnalysis of EGFP expression in BHK-21 cells and flow
cytometry assayReverse transcription (RT)-PCRReal-time PCR
analysisTransfection and GTPV infection Vero cellsVirus
titration
ResultsTransient cellular transfection and analysis of the
targeted gene and EGFP expression in BHK-21 cellsInterference of
GTPV replication by shRNA expression vectorDose-dependent
inhibitory effect of shRNA expression vector p70/GFP
DiscussionConclusionAcknowledgementsAuthor detailsAuthors'
contributionsCompeting interestsReferences