Research: Camellia chekiangoleosa Joanna Kukla NANJING FORESTRY UNIVERSITY EXPERIENCE.

Research: Camellia chekiangoleosa

Joanna Kukla

NANJING FORESTRY UNIVERSITY EXPERIENCE

南京林业大学经验

Introduction • The genus Camellia, belonging to the family Theaceae, is native to eastern Asia. There are over 3,000 cultivated varieties of ornamental Camellia worldwide. About 90% of its species originated in Southeastern China (Mondal 2011).•Camellia has great economic importance to many Asian countries due to its ability to produce tea, oil, ornamental flowers, and pharmaceutical products.

•C. sinensis is the most common species to prepare tea because of its containment of caffeine (2.78%) and its ability to stimulate the central nervous system (Mondal 2011).

Camellia Oil•Camellia chekiangoleosa, also known as cháhuā or flowering tea, is used to produce oil.•Camellia oil’s composition is made up of mostly Oleic and Linoleic acids. • It serves as a healthy alternative to other oils due to its ability to prevent cardiovascular cirrhosis, lower blood pressure, reduce body fat, and even prevent cancer (Wu et al 2005).•Six genes that are involved with the plant’s fatty acid synthesis were isolated and cloned.•C. chekiangoleosa is a diploid plant with a chromosome number of 2n=30.

Genes Cloned• Stearoyl-ACP desaturase (SAD)

• A key enzyme that catalyzes saturated fatty acids bonded to ACP carrier protein and dehydrogenates the fatty acids into oleic acids (Broadwater et al 1998).

• It controls the content of oleic acid and the proportion between saturated and unsaturated fatty acids.

• Palmitoyl Thioesterase (PT)• Releases palmitic acid from a fatty acid synthesis complex.

• Acetyl-CoA carboxylase (ACCase)• An enzyme that controls the speed of fatty acid synthesis• It catalyzes the first intermediate in the fatty acid synthesis

(Konishi and Sasaki 1994).

• Biotin carboxylase (BC)• A subunit of ACCase

• 3-ketoacyl-CoA synthase (KCS)• This gene controls oil composition and catalyzes the condensation

of malonyl-CoA with acyl-CoA (Lassner et al 1996).

• Acyl-acyl carrier protein thioesterases type B (FatB)• Hydrolyze saturated acyl-ACP thioester bonds, releasing free

saturated fatty acids and ACP.• This protein also plays a key role in determining the composition

of storage lipids.

ACC/BC

KCS

SAD

PT

FatB

• I worked directly with Mr. Zhongwei Wang (Ph.D student). His research is focused on gene cloning and transformation of C. chekiangoleosa. •We carried out research designed to identify and characterize each gene as described in previous slides.• Transformed each gene to E. coli to be cloned, and sequenced the cloned gene.

My Research

The overall goal of this research is to produce a transgenic tea

plant expressing specific genes conferring tolerance to abiotic stress conditions such as heat, physical wounds, and drought.

Specific Objectives• Clone the six genes involved in fatty acid biosynthetic pathway.• Design suitable vectors for transformation of each gene.• Study the mechanism of gene expression in the seeds of C. chekiangoleosa.•Quantify the level of fatty acid synthesis at different developmental stages.

MATERIALS AND METHODS

General Steps for Gene Cloning and Transformation

RNA/DNA EXTRACTION• Samples are taken from the species • RNA/DNA is isolated and purified using the

CTAB methodFINDING THE GENES• Primers are designed and the genes of

interest are amplified using PCR• A plasmid vector is attached

E. COLI TRANSFORMATION• The gene attached to a vector is

transformed into E. coli and allowed to replicate

• Cloned genes are verified using PCR and Gel electrophoresis

SEQUENCING• Successfully cloned genes are sequenced• Biosynthetic analysis from the sequence

determines whether the gel results were false positive

TRANSFORMATION INTO SPECIES• The genes are transformed into a plant at

the cell level• Plant is grown to maturity and induced

with stress to observe how the gene expressions change

Step one: Identifying the Genes1A. Designing Primers• Primers are designed to amplify the targeted region of cDNA that contains the gene of interest. • BLAST was used to find the DNA sequence.• Primer Premier 5 software was used to design the primers.• Oligo 6 software was used to analyze the primers• This software allows you to choose a primer that is

unique and will have minimal amounts of hairpins, mismatch, and primer dimer.

• It also analyzes the ΔG value and the annealing temperature of the primer.

1A. Designed Primers• The primers were amplified in the PCR with a 60°C

annealing temperatureGene

Primer

SAD 5’ ACACAGTTCCATCAGGGTCAATCTCAAAGAGCTT 3’

3’ ATCTACACTTCGTTTCAAGAGAGAGCAACCT 5’

PT 5’ CGCCTTCTTGCTCGCCACCTGAGAAAGTCC 3’

3’ AGTGAAGGTTACAACATAGTTGGACTTTCTCAGG 5’

BC 5’ GTTCAATAGCTCTCTCTCTTGTTGGAGCCCATAC 3’

3’ TTGTATGGGCTCCAACAAGAGAGAGAGCTATT 5’

KCS 5’ TCCACATGAATTGGCAGCAGCTGCAAATTCTTCT 3’

5’ ACGCTTGCATTTGATCATTTCTGCATACATGC 3’

ACC 5’ TCAGCAAATATGAGCTCTGTGACTTTAAGAACT 3’ 3’ GGATTCAAAGATTGCGGAAGGCAGAGAAGAT 5’

FatB 5’ CATCTGGTATCTTAGATAACCTCCGTGTCTCT 3’

3’ GAATGGTATGCGGCGTGATTGGATTGTCCAT 5’

1B. Polymerase Chain Reaction• PCR was done using the designed primers to amplify the desired

sequence.• PCR cocktail• 5µL LA-buffer • 4µL MgCl2• 4µL DNTP• 2µL designed forward primer• 2µL universal reverse primer• 2.5 µl RNA template• 0.3µL LA- Taq polymerase• 30.2 µL Water

PCR Thermocycler

94°C Initial denaturation for 3 min94°C Denaturation for 30 sec60-62°C Annealing for 30 sec72°C Elongation for 30 sec

72°C Final elongation for 4 min

30 cycles

Results

• This gel represents the PCR amplification of each gene from the designed primers

• There was successful amplification of SAD, BC, KCS, ACC, and FatB

• PT was not successful in any of the gels and was therefore never cloned.

• If the cDNA was amplified successfully, the band was then cut from the gel and the cDNA was recovered using a TIANGel Midi Purification Kit (Tiagen, China).

• cDNA yeild was measured using ND 1000 UV-Vis Spectrophotometer (NanoDrop Technologies, New Zealand)

4,5003,0002,0001,200

800500

200

Ladder SAD PT BC KCS ACC FatB

Step 2: Gene Cloning and Transformation

2A. Vector Ligation• A pMD 19-T vector produced by Takara (Takara Bio Inc., Japan) was attached to the amplified cDNA• This allows the for cloning to occur in the E.coli• Vector was ligated using PCR

• 2.5 µL of PCR buffer• 0.5 µL Vector• 2.0 µL RNA template• Placed in PCR at 16°C for 3 hours

•Once the gene is ligated to the vector it is ready to be transformed into the E. coli. • First Top Ten E. coli produced by Tiangen, is added to the gene and then shocked by a 42°C heat bath and then placed in ice. • This step activates the Top Ten.

• This solution is then added to an SOC culture medium and placed in a shaker for 1 hour at 37°C.• The solution is centrifuged and 200µL is pipetted onto a petri dish prepared with LB and ampicillin.• The DNA is left over night to clone.

2B. Transformation to E. c

2C. PCR Verification•Verification that the genes were cloned• Samples are taken from colonies of E. coli that have grown on the petri dish. • DNA is amplified using PCR• 2µL LA-buffer

• 1.6µL MgCl2

• 1.6µL DNTP

• 0.5µL designed forward primer

• 0.5µL universal reverse primer

• 2 µl cDNA template

• 0.3µL LA- Taq polymerase

• 11.5 µL Water

PCR Thermocycler

94°C Initial denaturation for 3 min94°C Denaturation for 30 sec55°C Annealing for 30 sec72°C Elongation for 30 sec

72°C Final elongation for 4 min

28 cycles

Results

4,5003,0002,0001,200

800500

200

Ladder 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

• Electrophoresis was conducted using 1% agarose TAE gel

• Gene samples from E. coli of KCS, SAD, and ACC are displayed above.

• KCS occupied lanes 1-6 and was successful in lane 4• SAD occupied lanes 7-12 and was successful in lane 11• ACC occupied lanes 13-18 and was successful in lanes

13-17

Results (cont)

Ladder 1 2 3 4 5 6 7 8 9 10 11 12

4,000

2,0001,5001,000

500300

• Gel electrophoresis was conducted using gene samples from E. coli of BC and FatB.

• BC occupied lanes 1-6 and was successful in lane 6• FatB occupied lanes 7-12 and was successful in lane 9

Step 3: Sequencing and Analysis

3A. BGI Sequencing• The cloned cDNA was sent to the company

BGI LifeTech Co. in Beijing, China to be sequenced.

• This company used an ABI 3730 DNA analyzer to obtain the nucleotide sequence of the gene.

• The obtained sequences were checked and edited manually by using BioEdit 5.0.9 software.

3B. Bioinformatics Analysis•Once the cloned cDNA had been sequenced, a biosynthetic analysis occurred to identify the gene. • The known primers in the sequence were removed and it was processed through BLAST.• If BLAST recognized that the sequence was the same as the gene in a similar plant then the cloning of the gene was successful

3C. Protein sequences were examined using Clustal X software to find similar species

• The letters represent each protein • If any of the five species has the same color in a given column then that protein is the same in each specie’s sequence

• A phylogenetic tree was created using Mega 5 software.• The tree is made up of species that are similar to C. chekiangoleosa based on similar protein sequences found using the Clustal X Program.

3D. Phylogenetic Tree

Conclusion

• Future Research: Transformation into C. chekiangoleosa• Once all the genes for fatty acid synthesis have been cloned and sequenced, their expression will be studied in the seeds of the plant.• Each gene’s expression and amount of fatty acid they produce will be measured by an HPLC machine.• The variable changed throughout this step in the experiment will be the developmental stage of the seeds.

• 5 out of the 6 genes involved in fatty acid synthesis for C. chekiangoleosa were successfully identified, cloned, sequenced, and characterized.

• I was able to practice and become familiar with the protocols used during this process.

•Protoplast Isolation• Protoplasts are cells that have had their cell wall broken

down leaving just the cell membrane, this allows foreign DNA to penetrate the surface and replicate within the cell.• Ph.D student, Cong Jiang, allowed me to assist in his

protoplast isolation for the chitin elictor receptor kinase (CERK ) gene in Populus canadensis Moench. This gene is believed to play a role in chitin-induced signal pathway. It can also trigger the immune system of the plant (Miya et al 2007).• The objective of the experiment was to determine the

physical location of the expressed gene. • Mr. Jiang worked with me through the different steps

involved in this process.

Additional Experimental Techniques Utilized

The results showed that the gene (florescent green) is expressed in the cell membrane of the cell

Cultural Experiences

BEIJING THE

BEAUTIFUL

Acknowledgments

• National Science Foundation (NSF)国家科学基金

• Alabama A&M University• Nanjing Forestry University

南京林业大学• Professor Li-an Xu 徐立安• Professor Yu-long Ding 丁雨龙• Dr. Soliman• Dr. Wong • Ms. Lisa Gardner and Dr. Elica Moss• Mr. Zhongwei Wang and his colleagues

王仲伟和他的同事

谢谢 !