Research Article T-Cell Cytokine Gene Polymorphisms and ...downloads.hindawi.com/journals/jdr/2014/120317.pdf · T-Cell Cytokine Gene Polymorphisms and Vitamin D Pathway Gene Polymorphisms
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Research ArticleT-Cell Cytokine Gene Polymorphisms and Vitamin D PathwayGene Polymorphisms in End-Stage Renal Disease due to Type 2Diabetes Mellitus Nephropathy Comparisons with Health Statusand Other Main Causes of End-Stage Renal Disease
Alicja E Grzegorzewska1 Grzegorz Ostromecki2 Paulina ZieliNska3
Adrianna Mostowska4 and PaweB P JagodziNski4
1Department of Nephrology Transplantology and Internal Diseases Poznan University of Medical Sciences (PUMS)49 Przybyszewskiego Boulevard 60-355 Poznan Poland2DaVita Clinic Piła Dialysis Center Wojska Polskiego 43 64-420 Piła Poland3Student Nephrology Research Group Department of Nephrology Transplantology and Internal Diseases PUMSPrzybyszewskiego 49 60-355 Poznan Poland4Department of Biochemistry and Molecular Biology PUMS Swięcickiego 6 60-781 Poznan Poland
Correspondence should be addressed to Alicja E Grzegorzewska alicja grzegorzewskayahoocom
Received 17 July 2014 Revised 22 September 2014 Accepted 22 September 2014 Published 22 December 2014
Academic Editor Salwa Ibrahim
Copyright copy 2014 Alicja E Grzegorzewska et alThis is an open access article distributed under the Creative CommonsAttributionLicense which permits unrestricted use distribution and reproduction in anymedium provided the originalwork is properly cited
Background T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms were evaluated as possiblyassociated with end-stage renal disease (ESRD) resulting from type 2 diabetes mellitus (DM) nephropathyMethods Studies wereconducted among hemodialysis (HD) patients with ESRD due to type 2 DM nephropathy chronic glomerulonephritis chronicinfective tubulointerstitial nephritis and hypertensive nephropathy as well as in healthy subjects A frequency distribution of T-cell-related interleukin (IL) genes (IL18 rs360719 IL12A rs568408 IL12B rs3212227 IL4R rs1805015 IL13 rs20541 IL28B rs8099917 IL28Band rs12979860) and vitamin D pathway genes (GC genes rs2298849 rs7041 and rs1155563 VDR genes rs2228570 rs1544410and RXRA genes rs10776909 rs10881578 and rs749759) was compared between groups Results No significant differences in afrequency distribution of tested polymorphisms were shown between type 2 DM nephropathy patients and controls A differencewas found in IL18 rs360719 polymorphic distribution between the former group and chronic infective tubulointerstitial nephriticpatients (Ptrend = 0033) which also differed in this polymorphism from controls (Ptrend = 0005) Conclusion T-cell cytokine andvitamin D pathway gene polymorphisms are not associated with ESRD due to type 2 DM nephropathy in Polish HD patients IL18rs360719 is probably associated with the pathogenesis of chronic infective tubulointerstitial nephritis
1 Introduction
Diabetes mellitus (DM) is the most common cause of end-stage renal disease (ESRD) in many hemodialysis (HD)centers In Australia and New Zealand the incident ESRDpopulation (1991ndash2005) who began renal replacement ther-apy (RRT) included 300 type 2 DM and 45 type 1 DMsubjects [1] In the HEMODIALYSIS (HEMO) study thegroup of HD patients comprised approximately 45 of DMsubjects [2]
Diabetic ESRD patients compared to nondiabetic ESRDsubjects showhigher bothmortality rate [3] and prevalence ofcoronary artery disease (CAD) [4] are more prone to severeinfections [5] and worse response to hepatitis B vaccination[6] and more often suffer from adynamic bone diseaseassociatedwith low serumparathyroid hormone (PTH) levels[7] In this paper we will focus on ESRD due to type 2 DMnephropathy Together with altered glucose metabolism andinsulin resistance deficiency of vitamin D [8] and aberrantT-cell cytokine balance [9] were found to be associated with
Hindawi Publishing CorporationJournal of Diabetes ResearchVolume 2014 Article ID 120317 17 pageshttpdxdoiorg1011552014120317
2 Journal of Diabetes Research
Table1HRM
andRF
LPcond
ition
sfor
theidentificatio
nof
polymorph
ismsg
enotyped
inthev
itamin
Dpathway
related
genes
Genes
ymbo
lrsnu
mber
Alleles
Prim
ersfor
PCRam
plificatio
n(51015840-31015840)
Ann
ealin
gtemp(∘ C
)PC
Rprod
uct
leng
th(bp)
HRM
aanalysis
RFLP
banalysis
Meltingtemp
range(∘C)
Restric
tion
enzyme
Restric
tionfragment
leng
th(bp)
GC
rs7041
GT
FGGAG
GTG
AGTT
TATG
GAAC
AGC
663
493
HaeIII
T=493
RGGCA
TTAAG
CTGGTA
TGAG
GTC
G=414+79
rs1155563
CT
FGGTT
ATTC
TAAG
ACTG
TGCT
CTTG
C630
11671ndash78
RAT
GTG
TTCT
CACT
GTT
CGAC
TCC
rs2298849
CT
FTC
CACT
GGCA
AAAC
ACAT
TAC
606
11873ndash83
RGGGAC
ATCT
GCA
TTTA
TCCT
G
RXRA
rs10881578
AG
FTC
TTGAG
CAAT
GCC
AGCA
G606
7580ndash9
0R
CCAC
AGCT
CACA
CATC
CAAT
C
rs10776909
CT
FCA
GCC
TGTG
GCC
TGCT
CA606
9582ndash92
RAAC
CTCC
GGCC
CTTG
GAG
rs749759
AG
FAT
AGGGCT
TGCC
TGCC
TAGA
626
382
BstXI
A=382
RCT
CCAC
CATA
GCC
CAAG
TGA
G=243+139
VDR
rs1544
410
AG
FGGAG
ACAC
AGAT
AAG
GAAAT
AC606
248
FspI
A(B)=
248
RCC
GCA
AGAAAC
CTCA
AAT
AAC
AG(b)=
175+73
rs2228570
CT
FGCA
CTGAC
TCTG
GCT
CTGAC
725
341
FokI
C(F)=
341
RAC
CCTC
CTGCT
CCTG
TGGCT
T(f)=
282+59
a HRM
analysis
high
resolutio
nmelt
analysis
b RFL
Panalysis
restr
ictio
nfragmentlengthpo
lymorph
ismanalysis
Journal of Diabetes Research 3
Table 2 Characteristics of hemodialysis patients (119899 = 893)
Parameter Type 2 DM nephropathy Other causes of ESRD 119875 valueDemographic data 119899 = 366 119899 = 527Male sex 119899 ( of all) 201 (549) 307 (583) 0337b
Age at RRT beginning years 629 plusmn 141 572 plusmn 172 lt00001c
RRT duration years 329 (006ndash280) 442 (012ndash282) lt00001c
Death rate cases per 100 patient-years 048 042Death rate cases per 100 RRT-years 797 463Clinical data 119899 = 332 119899 = 527Coronary artery disease 119899 ( of all) 174 (524) 168 (319) lt00001b
Total alkaline phosphatase (UL) 982 (258ndash1353) 971 (405ndash1684) 0528c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapyA significant difference is indicated using bold fonta119899 = 66 for type 2 DM nephropathy 119899 = 96 for other renal diseases
this severe complication of type 2DMThere is a link betweenvitamin D and T-cell functional balance active form ofvitamin D [125(OH)
2D] has the inhibitory effect on the T
helper (Th) 17 andTh1 response [10]Abnormalities in T-cell cytokine equilibrium [11ndash13] and
plasma vitamin D concentrations [14ndash16] are related tocardiovascular events [13 16] and immunononcompetenceduring infections [11 14] and vaccinations [12 15] SerumPTH levels are dependent on serum vitamin D concentra-tions [17] andT cells are implicated in themechanismof PTHaction in bone [18]
Vitamin D activity may be adequately expressed if vita-min D pathway components (vitamin D binding proteinalso referred to as group-specific component (GC) vitaminD receptor (VDR) and retinoid X receptors (RXRs)) areproperly structured and regulatedThe recent study by Zhanget al [19] has shown thatVDRBsmI polymorphism correlateswith type 2 DMnephropathy andmay be susceptible for earlyonset of this nephropathy Among T-cell-related cytokinegene polymorphisms promoter polymorphic variants of IL10[20 21] and IL6 [22] were already associated with therisk of type 2 DM nephropathy Monocyte chemoattractantprotein 1 (MCP-1) has been reported to participate in the
pathogenesis of early type 2 DM nephropathy [23] butMCP1polymorphism in the promoter region was not differen-tially distributed between ESRD patients with type 2 DMnephropathy and healthy controls [24 25]
To our knowledge there are scarce data if any onESRD due to type 2 DM nephropathy showing a frequencydistribution of single nucleotide polymorphisms (SNPs) ofT-cell-related IL genes IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 IL13 rs20541 IL28B rs8099917and IL28B rs12979860 as well as vitamin D pathway genesGC genes (GC rs2298849 rs7041 and rs1155563) VDRgenes (VDR rs2228570 rs1544410) and RXR 120572 genes (RXRArs10776909 rs10881578 and rs749759) The aim of our studywas to determine the potential association between afore-mentioned polymorphisms of T-cell-related cytokine genesand vitamin D pathway genes and ESRD due to type 2 DMnephropathy For comparisons aforementioned genotypefrequencies of healthy controls as well as ESRD patientswith other main causes of ESRD were used Polymorphismrelated associations if exist could contribute to explanationof susceptibility to ESRD due to type 2 DM nephropathy andphenotype differences between ESRD patients with type 2DM nephropathy and other causes of ESRD
4 Journal of Diabetes Research
Table 3 Characteristics of hemodialysis patients grouped by a cause of ESRD
Parameter Type 2 DMnephropathy (1)
Chronicglomerulonephritis
(2)
Chronictubulointerstitialnephritis (3)
Hypertensivenephropathy (4) 119875 value
Demographic data 119899 = 366 119899 = 178 119899 = 118 119899 = 231Male sex 119899 ( of all) 201 (549) 110 (618) 63 (534) 134 (580) 0386b
Age at RRT beginningyears 629 plusmn 141 474 plusmn 176 599 plusmn 166 633 plusmn 136
lt00001c1 versus 2 lt0001c2 versus 3 lt0001c2 versus 4 lt0001c
lt00001c1 versus 2 lt0001c1 versus 3 lt005c1 versus 4 lt005c2 versus 4 lt0001c
Total ALP (UL) 982 (258ndash1353) 113 (445ndash860) 890 (405ndash1684) 909 (410ndash1110) 0010c2 versus 4 lt005c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapya119899 = 66 for type 2 DM nephropathy 119899 = 40 for chronic glomerulonephritis 119899 = 13 for chronic interstitial nephritis and 119899 = 43 for hypertensive nephropathy
bChi squared testcKruskal-Wallis testdANOVA testeFisherrsquos exact test
2 Material and Methods
21 Patients and Controls Blood samples for genotype anal-yses are collected since 2009 from ESRD patients (estimatedglomerular filtration rate (eGFR) category G5 in accordancewith KDIGO recommendations [26]) All subjects weretreated with HD on enrolment Controls were recruited fromblooddonors andhealthy volunteers unrelated to patients Allenrolled individuals livelived in the Greater Poland region ofPoland
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed in 2009ndash2012 using currently available mate-rial Results had been analyzed in our previous studies in thecontext of responsiveness to the surface antigen of hepatitis Bvirus (HBsAg) using data of all (not segregated) patients [27ndash30] For this study we used results of controls and patientswith type 2 DM nephropathy chronic glomerulonephritischronic infective tubulointerstitial nephritis and hyperten-sive nephropathy
IL28B rs8099917 IL28B rs12979860 GC rs2298849 GCrs7041GC rs1155563VDR rs2228570VDR rs1544410 RXRArs10776909 RXRA rs10881578 and RXRA rs749759 poly-morphisms were analyzed in winter 20132014 among HDpatients with ESRD (119899 = 893) due to type 2 DM nephropathy(119899 = 366) chronic glomerulonephritis (119899 = 178) chronicinfective tubulointerstitial nephritis (119899 = 118) and hyper-tensive nephropathy (119899 = 231) as well as healthy controls(119899 = 378)
DM was not diagnosed in patients having renal diseasesother than type 2 DM nephropathy
Healthy individuals and HD patients with other renaldiseases as cause of ESRD served as reference groups for afrequency distribution of tested polymorphic variants Allexamined subjects were of Caucasian race
Basic clinical and laboratory data were collected onenrolment and they are updated every year
22 Genotyping Genomic DNA for genotype analysis wasisolated from peripheral blood lymphocytes by salt-outextraction procedure
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed as previously described [27ndash30]
IL28B rs8099917 and IL28B rs12979860 polymorphismswere genotyped using high-resolution melting curve analysis(HRM) on the LightCycler 480 system (Roche DiagnosticsMannheim Germany) with the use of 5x HOT FIREPolEvaGreen HRM Mix (Solis BioDyne Tartu Estonia) ThePCR program consisted of an initial step at 95∘C for 15minto activate HOT FIREPol DNA polymerase followed by50 amplification cycles of denaturation at 95∘C for 10 sannealing at 61∘C for 10 s and elongation at 72∘C for 15 sAmplified DNA fragments were then subjected to HRMwith01∘C increments in temperatures ranging from 76 to 96∘CPrimers used for PCRwith subsequent HRM analysis were asfollows rs8099917F 51015840TTTGTCACTGTTCCTCCTTTTG31015840rs8099917R 51015840AAGACATAAAAAGCCAGCTACCA31015840
6 Journal of Diabetes Research
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 2 Characteristics of hemodialysis patients (119899 = 893)
Parameter Type 2 DM nephropathy Other causes of ESRD 119875 valueDemographic data 119899 = 366 119899 = 527Male sex 119899 ( of all) 201 (549) 307 (583) 0337b
Age at RRT beginning years 629 plusmn 141 572 plusmn 172 lt00001c
RRT duration years 329 (006ndash280) 442 (012ndash282) lt00001c
Death rate cases per 100 patient-years 048 042Death rate cases per 100 RRT-years 797 463Clinical data 119899 = 332 119899 = 527Coronary artery disease 119899 ( of all) 174 (524) 168 (319) lt00001b
Total alkaline phosphatase (UL) 982 (258ndash1353) 971 (405ndash1684) 0528c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapyA significant difference is indicated using bold fonta119899 = 66 for type 2 DM nephropathy 119899 = 96 for other renal diseases
this severe complication of type 2DMThere is a link betweenvitamin D and T-cell functional balance active form ofvitamin D [125(OH)
2D] has the inhibitory effect on the T
helper (Th) 17 andTh1 response [10]Abnormalities in T-cell cytokine equilibrium [11ndash13] and
plasma vitamin D concentrations [14ndash16] are related tocardiovascular events [13 16] and immunononcompetenceduring infections [11 14] and vaccinations [12 15] SerumPTH levels are dependent on serum vitamin D concentra-tions [17] andT cells are implicated in themechanismof PTHaction in bone [18]
Vitamin D activity may be adequately expressed if vita-min D pathway components (vitamin D binding proteinalso referred to as group-specific component (GC) vitaminD receptor (VDR) and retinoid X receptors (RXRs)) areproperly structured and regulatedThe recent study by Zhanget al [19] has shown thatVDRBsmI polymorphism correlateswith type 2 DMnephropathy andmay be susceptible for earlyonset of this nephropathy Among T-cell-related cytokinegene polymorphisms promoter polymorphic variants of IL10[20 21] and IL6 [22] were already associated with therisk of type 2 DM nephropathy Monocyte chemoattractantprotein 1 (MCP-1) has been reported to participate in the
pathogenesis of early type 2 DM nephropathy [23] butMCP1polymorphism in the promoter region was not differen-tially distributed between ESRD patients with type 2 DMnephropathy and healthy controls [24 25]
To our knowledge there are scarce data if any onESRD due to type 2 DM nephropathy showing a frequencydistribution of single nucleotide polymorphisms (SNPs) ofT-cell-related IL genes IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 IL13 rs20541 IL28B rs8099917and IL28B rs12979860 as well as vitamin D pathway genesGC genes (GC rs2298849 rs7041 and rs1155563) VDRgenes (VDR rs2228570 rs1544410) and RXR 120572 genes (RXRArs10776909 rs10881578 and rs749759) The aim of our studywas to determine the potential association between afore-mentioned polymorphisms of T-cell-related cytokine genesand vitamin D pathway genes and ESRD due to type 2 DMnephropathy For comparisons aforementioned genotypefrequencies of healthy controls as well as ESRD patientswith other main causes of ESRD were used Polymorphismrelated associations if exist could contribute to explanationof susceptibility to ESRD due to type 2 DM nephropathy andphenotype differences between ESRD patients with type 2DM nephropathy and other causes of ESRD
4 Journal of Diabetes Research
Table 3 Characteristics of hemodialysis patients grouped by a cause of ESRD
Parameter Type 2 DMnephropathy (1)
Chronicglomerulonephritis
(2)
Chronictubulointerstitialnephritis (3)
Hypertensivenephropathy (4) 119875 value
Demographic data 119899 = 366 119899 = 178 119899 = 118 119899 = 231Male sex 119899 ( of all) 201 (549) 110 (618) 63 (534) 134 (580) 0386b
Age at RRT beginningyears 629 plusmn 141 474 plusmn 176 599 plusmn 166 633 plusmn 136
lt00001c1 versus 2 lt0001c2 versus 3 lt0001c2 versus 4 lt0001c
lt00001c1 versus 2 lt0001c1 versus 3 lt005c1 versus 4 lt005c2 versus 4 lt0001c
Total ALP (UL) 982 (258ndash1353) 113 (445ndash860) 890 (405ndash1684) 909 (410ndash1110) 0010c2 versus 4 lt005c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapya119899 = 66 for type 2 DM nephropathy 119899 = 40 for chronic glomerulonephritis 119899 = 13 for chronic interstitial nephritis and 119899 = 43 for hypertensive nephropathy
bChi squared testcKruskal-Wallis testdANOVA testeFisherrsquos exact test
2 Material and Methods
21 Patients and Controls Blood samples for genotype anal-yses are collected since 2009 from ESRD patients (estimatedglomerular filtration rate (eGFR) category G5 in accordancewith KDIGO recommendations [26]) All subjects weretreated with HD on enrolment Controls were recruited fromblooddonors andhealthy volunteers unrelated to patients Allenrolled individuals livelived in the Greater Poland region ofPoland
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed in 2009ndash2012 using currently available mate-rial Results had been analyzed in our previous studies in thecontext of responsiveness to the surface antigen of hepatitis Bvirus (HBsAg) using data of all (not segregated) patients [27ndash30] For this study we used results of controls and patientswith type 2 DM nephropathy chronic glomerulonephritischronic infective tubulointerstitial nephritis and hyperten-sive nephropathy
IL28B rs8099917 IL28B rs12979860 GC rs2298849 GCrs7041GC rs1155563VDR rs2228570VDR rs1544410 RXRArs10776909 RXRA rs10881578 and RXRA rs749759 poly-morphisms were analyzed in winter 20132014 among HDpatients with ESRD (119899 = 893) due to type 2 DM nephropathy(119899 = 366) chronic glomerulonephritis (119899 = 178) chronicinfective tubulointerstitial nephritis (119899 = 118) and hyper-tensive nephropathy (119899 = 231) as well as healthy controls(119899 = 378)
DM was not diagnosed in patients having renal diseasesother than type 2 DM nephropathy
Healthy individuals and HD patients with other renaldiseases as cause of ESRD served as reference groups for afrequency distribution of tested polymorphic variants Allexamined subjects were of Caucasian race
Basic clinical and laboratory data were collected onenrolment and they are updated every year
22 Genotyping Genomic DNA for genotype analysis wasisolated from peripheral blood lymphocytes by salt-outextraction procedure
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed as previously described [27ndash30]
IL28B rs8099917 and IL28B rs12979860 polymorphismswere genotyped using high-resolution melting curve analysis(HRM) on the LightCycler 480 system (Roche DiagnosticsMannheim Germany) with the use of 5x HOT FIREPolEvaGreen HRM Mix (Solis BioDyne Tartu Estonia) ThePCR program consisted of an initial step at 95∘C for 15minto activate HOT FIREPol DNA polymerase followed by50 amplification cycles of denaturation at 95∘C for 10 sannealing at 61∘C for 10 s and elongation at 72∘C for 15 sAmplified DNA fragments were then subjected to HRMwith01∘C increments in temperatures ranging from 76 to 96∘CPrimers used for PCRwith subsequent HRM analysis were asfollows rs8099917F 51015840TTTGTCACTGTTCCTCCTTTTG31015840rs8099917R 51015840AAGACATAAAAAGCCAGCTACCA31015840
6 Journal of Diabetes Research
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 2 Characteristics of hemodialysis patients (119899 = 893)
Parameter Type 2 DM nephropathy Other causes of ESRD 119875 valueDemographic data 119899 = 366 119899 = 527Male sex 119899 ( of all) 201 (549) 307 (583) 0337b
Age at RRT beginning years 629 plusmn 141 572 plusmn 172 lt00001c
RRT duration years 329 (006ndash280) 442 (012ndash282) lt00001c
Death rate cases per 100 patient-years 048 042Death rate cases per 100 RRT-years 797 463Clinical data 119899 = 332 119899 = 527Coronary artery disease 119899 ( of all) 174 (524) 168 (319) lt00001b
Total alkaline phosphatase (UL) 982 (258ndash1353) 971 (405ndash1684) 0528c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapyA significant difference is indicated using bold fonta119899 = 66 for type 2 DM nephropathy 119899 = 96 for other renal diseases
this severe complication of type 2DMThere is a link betweenvitamin D and T-cell functional balance active form ofvitamin D [125(OH)
2D] has the inhibitory effect on the T
helper (Th) 17 andTh1 response [10]Abnormalities in T-cell cytokine equilibrium [11ndash13] and
plasma vitamin D concentrations [14ndash16] are related tocardiovascular events [13 16] and immunononcompetenceduring infections [11 14] and vaccinations [12 15] SerumPTH levels are dependent on serum vitamin D concentra-tions [17] andT cells are implicated in themechanismof PTHaction in bone [18]
Vitamin D activity may be adequately expressed if vita-min D pathway components (vitamin D binding proteinalso referred to as group-specific component (GC) vitaminD receptor (VDR) and retinoid X receptors (RXRs)) areproperly structured and regulatedThe recent study by Zhanget al [19] has shown thatVDRBsmI polymorphism correlateswith type 2 DMnephropathy andmay be susceptible for earlyonset of this nephropathy Among T-cell-related cytokinegene polymorphisms promoter polymorphic variants of IL10[20 21] and IL6 [22] were already associated with therisk of type 2 DM nephropathy Monocyte chemoattractantprotein 1 (MCP-1) has been reported to participate in the
pathogenesis of early type 2 DM nephropathy [23] butMCP1polymorphism in the promoter region was not differen-tially distributed between ESRD patients with type 2 DMnephropathy and healthy controls [24 25]
To our knowledge there are scarce data if any onESRD due to type 2 DM nephropathy showing a frequencydistribution of single nucleotide polymorphisms (SNPs) ofT-cell-related IL genes IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 IL13 rs20541 IL28B rs8099917and IL28B rs12979860 as well as vitamin D pathway genesGC genes (GC rs2298849 rs7041 and rs1155563) VDRgenes (VDR rs2228570 rs1544410) and RXR 120572 genes (RXRArs10776909 rs10881578 and rs749759) The aim of our studywas to determine the potential association between afore-mentioned polymorphisms of T-cell-related cytokine genesand vitamin D pathway genes and ESRD due to type 2 DMnephropathy For comparisons aforementioned genotypefrequencies of healthy controls as well as ESRD patientswith other main causes of ESRD were used Polymorphismrelated associations if exist could contribute to explanationof susceptibility to ESRD due to type 2 DM nephropathy andphenotype differences between ESRD patients with type 2DM nephropathy and other causes of ESRD
4 Journal of Diabetes Research
Table 3 Characteristics of hemodialysis patients grouped by a cause of ESRD
Parameter Type 2 DMnephropathy (1)
Chronicglomerulonephritis
(2)
Chronictubulointerstitialnephritis (3)
Hypertensivenephropathy (4) 119875 value
Demographic data 119899 = 366 119899 = 178 119899 = 118 119899 = 231Male sex 119899 ( of all) 201 (549) 110 (618) 63 (534) 134 (580) 0386b
Age at RRT beginningyears 629 plusmn 141 474 plusmn 176 599 plusmn 166 633 plusmn 136
lt00001c1 versus 2 lt0001c2 versus 3 lt0001c2 versus 4 lt0001c
lt00001c1 versus 2 lt0001c1 versus 3 lt005c1 versus 4 lt005c2 versus 4 lt0001c
Total ALP (UL) 982 (258ndash1353) 113 (445ndash860) 890 (405ndash1684) 909 (410ndash1110) 0010c2 versus 4 lt005c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapya119899 = 66 for type 2 DM nephropathy 119899 = 40 for chronic glomerulonephritis 119899 = 13 for chronic interstitial nephritis and 119899 = 43 for hypertensive nephropathy
bChi squared testcKruskal-Wallis testdANOVA testeFisherrsquos exact test
2 Material and Methods
21 Patients and Controls Blood samples for genotype anal-yses are collected since 2009 from ESRD patients (estimatedglomerular filtration rate (eGFR) category G5 in accordancewith KDIGO recommendations [26]) All subjects weretreated with HD on enrolment Controls were recruited fromblooddonors andhealthy volunteers unrelated to patients Allenrolled individuals livelived in the Greater Poland region ofPoland
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed in 2009ndash2012 using currently available mate-rial Results had been analyzed in our previous studies in thecontext of responsiveness to the surface antigen of hepatitis Bvirus (HBsAg) using data of all (not segregated) patients [27ndash30] For this study we used results of controls and patientswith type 2 DM nephropathy chronic glomerulonephritischronic infective tubulointerstitial nephritis and hyperten-sive nephropathy
IL28B rs8099917 IL28B rs12979860 GC rs2298849 GCrs7041GC rs1155563VDR rs2228570VDR rs1544410 RXRArs10776909 RXRA rs10881578 and RXRA rs749759 poly-morphisms were analyzed in winter 20132014 among HDpatients with ESRD (119899 = 893) due to type 2 DM nephropathy(119899 = 366) chronic glomerulonephritis (119899 = 178) chronicinfective tubulointerstitial nephritis (119899 = 118) and hyper-tensive nephropathy (119899 = 231) as well as healthy controls(119899 = 378)
DM was not diagnosed in patients having renal diseasesother than type 2 DM nephropathy
Healthy individuals and HD patients with other renaldiseases as cause of ESRD served as reference groups for afrequency distribution of tested polymorphic variants Allexamined subjects were of Caucasian race
Basic clinical and laboratory data were collected onenrolment and they are updated every year
22 Genotyping Genomic DNA for genotype analysis wasisolated from peripheral blood lymphocytes by salt-outextraction procedure
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed as previously described [27ndash30]
IL28B rs8099917 and IL28B rs12979860 polymorphismswere genotyped using high-resolution melting curve analysis(HRM) on the LightCycler 480 system (Roche DiagnosticsMannheim Germany) with the use of 5x HOT FIREPolEvaGreen HRM Mix (Solis BioDyne Tartu Estonia) ThePCR program consisted of an initial step at 95∘C for 15minto activate HOT FIREPol DNA polymerase followed by50 amplification cycles of denaturation at 95∘C for 10 sannealing at 61∘C for 10 s and elongation at 72∘C for 15 sAmplified DNA fragments were then subjected to HRMwith01∘C increments in temperatures ranging from 76 to 96∘CPrimers used for PCRwith subsequent HRM analysis were asfollows rs8099917F 51015840TTTGTCACTGTTCCTCCTTTTG31015840rs8099917R 51015840AAGACATAAAAAGCCAGCTACCA31015840
6 Journal of Diabetes Research
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
lt00001c1 versus 2 lt0001c1 versus 3 lt005c1 versus 4 lt005c2 versus 4 lt0001c
Total ALP (UL) 982 (258ndash1353) 113 (445ndash860) 890 (405ndash1684) 909 (410ndash1110) 0010c2 versus 4 lt005c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapya119899 = 66 for type 2 DM nephropathy 119899 = 40 for chronic glomerulonephritis 119899 = 13 for chronic interstitial nephritis and 119899 = 43 for hypertensive nephropathy
bChi squared testcKruskal-Wallis testdANOVA testeFisherrsquos exact test
2 Material and Methods
21 Patients and Controls Blood samples for genotype anal-yses are collected since 2009 from ESRD patients (estimatedglomerular filtration rate (eGFR) category G5 in accordancewith KDIGO recommendations [26]) All subjects weretreated with HD on enrolment Controls were recruited fromblooddonors andhealthy volunteers unrelated to patients Allenrolled individuals livelived in the Greater Poland region ofPoland
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed in 2009ndash2012 using currently available mate-rial Results had been analyzed in our previous studies in thecontext of responsiveness to the surface antigen of hepatitis Bvirus (HBsAg) using data of all (not segregated) patients [27ndash30] For this study we used results of controls and patientswith type 2 DM nephropathy chronic glomerulonephritischronic infective tubulointerstitial nephritis and hyperten-sive nephropathy
IL28B rs8099917 IL28B rs12979860 GC rs2298849 GCrs7041GC rs1155563VDR rs2228570VDR rs1544410 RXRArs10776909 RXRA rs10881578 and RXRA rs749759 poly-morphisms were analyzed in winter 20132014 among HDpatients with ESRD (119899 = 893) due to type 2 DM nephropathy(119899 = 366) chronic glomerulonephritis (119899 = 178) chronicinfective tubulointerstitial nephritis (119899 = 118) and hyper-tensive nephropathy (119899 = 231) as well as healthy controls(119899 = 378)
DM was not diagnosed in patients having renal diseasesother than type 2 DM nephropathy
Healthy individuals and HD patients with other renaldiseases as cause of ESRD served as reference groups for afrequency distribution of tested polymorphic variants Allexamined subjects were of Caucasian race
Basic clinical and laboratory data were collected onenrolment and they are updated every year
22 Genotyping Genomic DNA for genotype analysis wasisolated from peripheral blood lymphocytes by salt-outextraction procedure
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed as previously described [27ndash30]
IL28B rs8099917 and IL28B rs12979860 polymorphismswere genotyped using high-resolution melting curve analysis(HRM) on the LightCycler 480 system (Roche DiagnosticsMannheim Germany) with the use of 5x HOT FIREPolEvaGreen HRM Mix (Solis BioDyne Tartu Estonia) ThePCR program consisted of an initial step at 95∘C for 15minto activate HOT FIREPol DNA polymerase followed by50 amplification cycles of denaturation at 95∘C for 10 sannealing at 61∘C for 10 s and elongation at 72∘C for 15 sAmplified DNA fragments were then subjected to HRMwith01∘C increments in temperatures ranging from 76 to 96∘CPrimers used for PCRwith subsequent HRM analysis were asfollows rs8099917F 51015840TTTGTCACTGTTCCTCCTTTTG31015840rs8099917R 51015840AAGACATAAAAAGCCAGCTACCA31015840
6 Journal of Diabetes Research
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
lt00001c1 versus 2 lt0001c1 versus 3 lt005c1 versus 4 lt005c2 versus 4 lt0001c
Total ALP (UL) 982 (258ndash1353) 113 (445ndash860) 890 (405ndash1684) 909 (410ndash1110) 0010c2 versus 4 lt005c
25(OH)D 25-hydroxycholecalciferol anti-HBc antibodies to core antigen of hepatitis B virus anti-HCV antibodies to hepatitis C virusHBsAg surface antigenof hepatitis B virus DM diabetes mellitus ESRD end-stage renal disease HCV RNA ribonucleic acid of hepatitis C virus PTH parathyroid hormone andRRT renal replacement therapya119899 = 66 for type 2 DM nephropathy 119899 = 40 for chronic glomerulonephritis 119899 = 13 for chronic interstitial nephritis and 119899 = 43 for hypertensive nephropathy
bChi squared testcKruskal-Wallis testdANOVA testeFisherrsquos exact test
2 Material and Methods
21 Patients and Controls Blood samples for genotype anal-yses are collected since 2009 from ESRD patients (estimatedglomerular filtration rate (eGFR) category G5 in accordancewith KDIGO recommendations [26]) All subjects weretreated with HD on enrolment Controls were recruited fromblooddonors andhealthy volunteers unrelated to patients Allenrolled individuals livelived in the Greater Poland region ofPoland
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed in 2009ndash2012 using currently available mate-rial Results had been analyzed in our previous studies in thecontext of responsiveness to the surface antigen of hepatitis Bvirus (HBsAg) using data of all (not segregated) patients [27ndash30] For this study we used results of controls and patientswith type 2 DM nephropathy chronic glomerulonephritischronic infective tubulointerstitial nephritis and hyperten-sive nephropathy
IL28B rs8099917 IL28B rs12979860 GC rs2298849 GCrs7041GC rs1155563VDR rs2228570VDR rs1544410 RXRArs10776909 RXRA rs10881578 and RXRA rs749759 poly-morphisms were analyzed in winter 20132014 among HDpatients with ESRD (119899 = 893) due to type 2 DM nephropathy(119899 = 366) chronic glomerulonephritis (119899 = 178) chronicinfective tubulointerstitial nephritis (119899 = 118) and hyper-tensive nephropathy (119899 = 231) as well as healthy controls(119899 = 378)
DM was not diagnosed in patients having renal diseasesother than type 2 DM nephropathy
Healthy individuals and HD patients with other renaldiseases as cause of ESRD served as reference groups for afrequency distribution of tested polymorphic variants Allexamined subjects were of Caucasian race
Basic clinical and laboratory data were collected onenrolment and they are updated every year
22 Genotyping Genomic DNA for genotype analysis wasisolated from peripheral blood lymphocytes by salt-outextraction procedure
Genotyping of IL18 rs360719 IL12A rs568408 IL12Brs3212227 IL4R rs1805015 and IL13 rs20541 polymorphismswas performed as previously described [27ndash30]
IL28B rs8099917 and IL28B rs12979860 polymorphismswere genotyped using high-resolution melting curve analysis(HRM) on the LightCycler 480 system (Roche DiagnosticsMannheim Germany) with the use of 5x HOT FIREPolEvaGreen HRM Mix (Solis BioDyne Tartu Estonia) ThePCR program consisted of an initial step at 95∘C for 15minto activate HOT FIREPol DNA polymerase followed by50 amplification cycles of denaturation at 95∘C for 10 sannealing at 61∘C for 10 s and elongation at 72∘C for 15 sAmplified DNA fragments were then subjected to HRMwith01∘C increments in temperatures ranging from 76 to 96∘CPrimers used for PCRwith subsequent HRM analysis were asfollows rs8099917F 51015840TTTGTCACTGTTCCTCCTTTTG31015840rs8099917R 51015840AAGACATAAAAAGCCAGCTACCA31015840
6 Journal of Diabetes Research
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 4 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and healthy subjects
ParameterType 2 DMnephropathy(frequency)
Healthy subjects(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Genotyping of the GC rs1155563 GC rs2298849 RXRArs10881578 and RXRA rs10776909 polymorphisms was car-ried out by HRM on the Bio-Rad CFX96 Real Time PCRsystem (Bio-Rad Hercules CA) DNA fragments amplified
with the use of specific primers were subjected to HRMwith 01∘C increments in temperatures ranging from 71to 92∘C Genotyping of the GC rs7041 RXRA rs749759VDR rs1544410 and VDR rs2228570 was performed usingthe polymerase chain reaction and restriction fragmentlength polymorphism (PCR-RFLP) method according to the
8 Journal of Diabetes Research
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 5 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis chronictubulointerstitial nephritis and hypertensive nephritis)
Genotype Type 2 DM nephropathy(frequency)
Other causes of ESRD(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
manufacturerrsquos instructions (Fermentas Vilnius Lithuania)Primer sequences and conditions for HRM and PCR-RFLPanalyses are presented in Table 1
For quality control the genotyping analysis was blindedto the subjectrsquos case-control status In addition approximately10 of the randomly chosen samples were regenotypedSamples that failed the genotyping were excluded fromfurther statistical analyses
23 25(OH)D Testing Plasma 25(OH)D was determined inblindly selected 162 HD patients in the winter season ofthe year to avoid differences in sunlight exposure betweenpatients who used to sunbathe and those who did not Plasma25(OH)D concentration was measured in HD patients whohad not been treated with vitamin D or had stopped such atreatment for at least 3 weeks to obtain the so-called basicvitaminD concentrationsUnder these conditions therewere
10 Journal of Diabetes Research
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 6 Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients chronicinfective tubulointerstitial nephritic patients and healthy subjects
Genotype Genotype frequencies Odds ratio (95 CI) Two-tailed 119875 119875trend
CC 4 (005) 21 (009) 0427 (0140ndash1303) 0160CT + CC 23 (030) 119 (050) 0433 (0250ndash0750) 0004a
MAF 27 (018) 140 (029) 0516 (0326ndash0818) 0006DM diabetes mellitus MAF minor allele frequencySignificant differences are indicated using bold fontaSignificant after the Bonferroni correction (119875 lt 0017)
no patients showing optimal plasma 25(OH)D levels (35ndash80 ngmL for adults) To examine plasma 25(OH)D levels achemiluminescent microparticle immunoassay (CMIA) wasused according to the manufacturerrsquos instructions (AbbottDiagnostics ARCHITECT 25-OH VITAMIN D CMIA)
24 Statistical Methods Results are presented as percentagefor categorical variables asmeanwith one standard deviationfor normally distributed continuous variables or as medianwith range for not normally distributed continuous variablesas tested by the Shapiro-Wilk test Statistical tests used forcomparison of data obtained in selected groups are indicatedat 119875 values
Hardy-Weinberg equilibrium (HWE) was tested to com-pare the observed genotype frequencies to the expected onesusing Chi-square test Distributions of tested polymorphismswere consistent with HWE with three exceptions which areindicated in tables showing analysis of genotype and alleledistributions The Fisher exact probability test or Chi-squaretest was used to evaluate differences in genotype and alleleprevalence between the examined groups Homozygotes forthe major allele were the reference group The odds ratio(OR) with 119875 value and 95 confidence intervals (95CI) value were calculated All probabilities were two-tailedPolymorphisms were tested for association using the Chi-square test for trend (119875trend) Power analysis was performedby Fisherrsquos exact test
Values of119875 lt 005were judged to be significantHoweverassociations were reported only if the following conditionswere fulfilled
(1) A genotype distribution was consistent with HWE ina tested group and a referent group
(2) 119875trend was below 005
(3) Odds ratio remained significant after the Bonferronicorrection applied for multiple testing if appropriate
Aforementioned statistical calculations were performedusing GraphPad InStat 310 32 bit for Windows created onJuly 9 2009 (GraphPad Software Inc La Jolla USA) Cytel-Studio version 100 created on January 16 2013 (CytelStudioSoftware Corporation Cambridge USA) and Statistica ver-sion 10 2011 (StatSoft Inc Tulsa USA)
3 Results
Characteristics of the examined HD patients are presented inTables 2 and 3 ESRD patients due to type 2 DM nephropathycompared to non-DM ESRD patients showed older ageat RRT onset shorter treatment with RRT higher deathrate on RRT higher prevalence of CAD and myocardialinfarction lower serum PTH level and lower frequency ofparathyroidectomy and treatment with cinacalcet
In respect of the examined parameters type 2 DMnephropathy patients differed the most significantly fromchronic glomerulonephritic subjects the least significantlyfrom hypertensive nephropathy patients
There were no differences in frequency distributions oftested genotypes between type 2 DM nephropathy patientsand healthy subjects (Table 4) as well as other ESRD patientsanalyzed together (Table 5) which could be judged as signifi-cant associations
Comparisons of genotype and allele frequencies betweentype 2 DM nephropathy patients and other ESRD groupsrevealed associations only with chronic infective tubulointer-stitial nephritic patients in respect of IL18 rs360719 (Table 6no significant results are shown) Frequency of IL18 rs360719allele C carriers was higher in type 2 DM nephropathypatients than in those with chronic infective tubulointerstitial
Journal of Diabetes Research 11
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 7 Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due totype 2 DM nephropathy grouped by diagnosis of CAD
Parameter Type 2 DM nephropathywith CAD (frequency)
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
nephritis The latter group showed lower frequency of IL18rs360719 allele C carriers compared to healthy controls(Table 6)
Type 2 DM nephropathy patients with diagnosed CADdiffered in tested genotype frequencies neither from type 2DM nephropathy subjects without CAD (Table 7) nor fromhealthy controls (Table 8)
4 Discussion
Genetic studies involving DM nephropathy and relatedcomplications are not consistent in many aspects [31ndash34]Some polymorphisms tested in this study were reportedas being associated with type 1 DM (IL12B rs3212227 [35]IL4R [36 37] IL13 [37] VDR rs1544410 [38 39] and VDR
Journal of Diabetes Research 13
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
Table 8 Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis ofCAD and healthy controls
Parameter Type 2 DM nephropathywith CAD (frequency)
Healthy controls(frequency) Odds ratio (95 CI) Two-tailed 119875 119875trend
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
rs2228570 [38]) type 2 DM susceptibility (VDR rs2228570[40]VDR rs1544410 [41]) and phenotype of type 2DM(VDRrs2228570 [42] VDR rs1544410 [41 43]) VDR rs2228570and IL4 polymorphisms were also related to the risk ofchronic kidney disease [44 45] On the other hand there arealso data indicating no major effect of IL12B on type 1 DMsusceptibility in the entire study group [46] no associationof IL4R with type 1 DM [47] no evident causal relationshipbetween vitaminDpathway genes and type 2DMmyocardialinfarction ormortality [48] similar distribution of genotypesallele and haplotypes of VDR rs2228570 and VDR rs731236between type 2 DM patients and controls [49] no contribu-tion of VDR rs1544410 to type 1 DM susceptibility [50] andno association ofVDR rs1544410 with chronic kidney diseasesusceptibility [51]
In this study we were not able to show significantdifferences in the frequency distribution of tested polymor-phic variants of T-cell-related cytokine genes or vitamin Dpathway genes between HD patients with ESRD due to type2 DM nephropathy and controls as well as HD patientswith other causes of ESRD analyzed together This lack ofassociation was present although the examined type 2 DMnephropathy patients showed clinical complications morefrequently than HD patients with other renal diseases higherdialysis related mortality rate [3] higher prevalence of CADincluding myocardial infarction [4] lower serum PTH andlower frequency of parathyroidectomy and treatment withcinacalcet all of them predictive for higher tendency toadynamic bone disease [7] Type 2 DM nephropathy patientswith or without diagnosis of CAD also did not differ in testedgenotype distributions
Development of ESRD substantially ameliorates interpa-tient clinical variability related to underlying renal impair-ment and exposes uremia-related signs and symptoms Com-parisons of type 2 DM nephropathy patients in respect oftested genotype frequencies with subjects showing othercommon causes of ESRD revealed that the former group hasa higher IL18 rs360719 minor allele frequency than chronicinfective tubulointerstitial nephritic group In this case lowerIL18 rs360719 minor allele frequency in tubulointerstitialnephritic patients was observed also when their results werecompared to those of healthy subjects Sanchez et al [52] havefound a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor alleleIL-18 is IFN-120574 inducing factor Infective tubulointerstitialnephritic patients are known to have diminished ability ofblood leukocytes to produce IFN-120574 [53] Our study indicatesthat this may be related to lower frequency of IL18 rs360719minor allele in this group compared to controls and type 2DM nephropathy patients In type 2 DM patients with overtnephropathy positive correlations between plasma IFN-120574proteinuria and eGFR were found [54]
Due to limited financial support we did not perform anyfunctional studies regarding T-cell-related interleukin andvitamin D pathway genes especially that multiple influencesindependent or dependent on genetic profile need to be takeninto account in such studies conducted in the uremic milieuAlthough the examined patients showing ESRD due to type2 DM nephropathy were well-defined group they obviously
were not consistent in HLA DRB1 alleles The latter could beimportant in modulating susceptibility to advanced type 2DMnephropathy and related complications like it was shownfor type 1 DM [55] or type 2 DM [41] regardless of theircomplications
5 Summary
Distributions of tested T-cell cytokine gene polymorphismsor vitamin D pathway gene polymorphisms are not signifi-cantly different among patients with ESRD due to type 2 DMnephropathy and healthy individuals Subjects with ESRDdue to type 2DMnephropathy differ in clinical manifestationfrom patients with other nephropathies leading to dialysisdependency but differences in tested genotype distributionswere found only in IL18 rs360719 compared with chronictubulointerstitial nephritic patients This difference probablyarose from the fact that pathology of chronic infectivetubulointerstitial nephritis might have been associated withthis specific polymorphism
6 Conclusions
In Polish HD patients T-cell cytokine gene polymorphismsand vitamin D pathway gene polymorphisms are not asso-ciated with ESRD due to type 2 DM nephropathy IL18polymorphism is worthy to be further investigated in chronicinfective tubulointerstitial nephritic patients as being possiblyassociated with this disease
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
References
[1] E Villar H C Sean and S P McDonald ldquoIncidences treat-ments outcomes and sex effect on survival in patients withend-stage renal disease by diabetes status in Australia and NewZealand (1991ndash2005)rdquo Diabetes Care vol 30 no 12 pp 3070ndash3076 2007
[2] A Sattar C Argyropoulos L Weissfeld et al ldquoAll-cause andcause-specific mortality associated with diabetes in prevalenthemodialysis patientsrdquo BMC Nephrology vol 13 article 1302012
[3] F Chantrel I Enache M Bouiller et al ldquoAbysmal prognosisof patients with type 2 diabetes entering dialysisrdquo NephrologyDialysis Transplantation vol 14 no 1 pp 129ndash136 1999
[4] H Al-Thani A Shabana A Hussein et al ldquoCardiovas-cular complications in diabetic patients undergoing regularhemodialysis a 5-year observational studyrdquo Angiology 2014
[5] M J Sarnak and B L Jaber ldquoMortality caused by sepsis inpatients with end-stage renal disease comparedwith the generalpopulationrdquo Kidney International vol 58 no 4 pp 1758ndash17642000
[6] S-M Alavian and S V Tabatabaei ldquoThe effect of diabetesmellitus on immunological response to hepatitis B virus vaccinein individuals with chronic kidney disease a meta-analysis ofcurrent literaturerdquo Vaccine vol 28 no 22 pp 3773ndash3777 2010
16 Journal of Diabetes Research
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
[7] D Zayour M Daouk W Medawar M Salamoun and G El-Hajj Fuleihan ldquoPredictors of bone mineral density in patientson hemodialysisrdquoTransplantation Proceedings vol 36 no 5 pp1297ndash1301 2004
[8] D M Li Y Zhang B Ding et al ldquoThe association betweenvitamin D deficiency and diabetic nephropathy in type 2diabetic patientsrdquo Zhonghua Nei Ke Za Zhi vol 52 no 11 pp970ndash974 2013 (Chinese)
[9] C-C Wu H-K Sytwu K-C Lu and Y-F Lin ldquoRole of Tcells in type 2 diabetic nephropathyrdquo Experimental DiabetesResearch vol 2011 Article ID 514738 9 pages 2011
[10] Y Tian C Wang Z Ye X Xiao A Kijlstra and P Yang ldquoEffectof 125-Dihydroxyvitamin D3 on Th17 and Th1 response inpatients with Behcets diseaserdquo Investigative Ophthalmology andVisual Science vol 53 no 10 pp 6434ndash6441 2012
[11] J Stachowski ldquoHepatitis C virus infection in renal diseases stateof knowledge therapeutic problems and perspectivesrdquo PolskiMerkuriusz Lekarski vol 8 no 46 pp 303ndash306 2000 (Polish)
[12] B D Livingston J Alexander C Crimi et al ldquoAltered helper Tlymphocyte function associated with chronic hepatitis B virusinfection and its role in response to therapeutic vaccination inhumansrdquo Journal of Immunology vol 162 no 5 pp 3088ndash30951999
[13] J Zhang G Hua X Zhang R Tong X Du and Z LildquoRegulatory T cellsT-helper cell 17 functional imbalance inuraemic patients on maintenance haemodialysis a pivotallink between microinflammation and adverse cardiovasculareventsrdquo Nephrology vol 15 no 1 pp 33ndash41 2010
[14] E Borella G Nesher E Israeli and Y Shoenfeld ldquoVitamin Da new anti-infective agentrdquo Annals of the New York Academy ofSciences vol 1317 no 1 pp 76ndash83 2014
[15] E Zitt H Sprenger-Mahr F Knoll U Neyer and K LhottaldquoVitamin D deficiency is associated with poor response toactive hepatitis B immunisation in patients with chronic kidneydiseaserdquo Vaccine vol 30 no 5 pp 931ndash935 2012
[16] T Shoji andYNishizawa ldquoVitaminD and survival of hemodial-ysis patientsrdquo Clinical calcium vol 14 no 9 pp 64ndash68 2004(Japanese)
[17] L Steingrimsdottir O Gunnarsson O S Indridason L Franz-son and G Sigurdsson ldquoRelationship between serum parathy-roid hormone levels vitaminD sufficiency and calcium intakerdquoThe Journal of the AmericanMedical Association vol 294 no 18pp 2336ndash2341 2005
[18] R Pacifici ldquoRole of T cells in the modulation of PTH actionphysiological and clinical significancerdquo Endocrine vol 44 no3 pp 576ndash582 2012
[19] H Zhang JWang B Yi et al ldquoBsmI polymorphisms in vitaminD receptor gene are associated with diabetic nephropathy intype 2 diabetes in the Han Chinese populationrdquo Gene vol 495no 2 pp 183ndash188 2012
[20] N Mtiraoui I Ezzidi M Kacem et al ldquoPredictive value ofinterleukin-10 promoter genotypes andhaplotypes in determin-ing the susceptibility to nephropathy in type 2 diabetes patientsrdquoDiabetesMetabolismResearch andReviews vol 25 no 1 pp 57ndash63 2009
[21] I Ezzidi N Mtiraoui M Kacem et al ldquoInterleukin-10-592CA-819CT and -1082AG promoter variants affect the suscep-tibility to nephropathy in Tunisian type 2 diabetes (T2DM)patientsrdquo Clinical Endocrinology vol 70 no 3 pp 401ndash4072009
[22] M Karadeniz M Erdogan A Berdeli and C Yilmaz ldquoAsso-ciation of interleukin-6 -174 GgtC promoter polymorphism
with increased risk of type 2 diabetes mellitus patients withdiabetic nephropathy in Turkeyrdquo Genetic Testing and MolecularBiomarkers vol 18 no 1 pp 62ndash65 2014
[23] M Murea T C Register J Divers et al ldquoRelationshipsbetween serum MCP-1 and subclinical kidney disease AfricanAmerican-Diabetes Heart Studyrdquo BMC Nephrology vol 13 no1 article 148 2012
[24] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoPolymporphism of monocyte chemoattractantprotein 1 (MCP1-2518 AG) and responsiveness to hepatitisB vaccination in hemodialysis patientsrdquo Polskie ArchiwumMedycyny Wewnetrznej vol 124 no 1-2 pp 10ndash18 2014
[25] A E Grzegorzewska D Pajzderski A Sowinska and P PJagodzinski ldquoMonocyte chemoattractant protein-1 gene (MCP-1-2518 AG) polymorphism and serological markers of hepatitisB virus infection in hemodialysis patientsrdquo Medical ScienceMonitor vol 20 pp 1101ndash1116 2014
[26] Group KDIGOKCW ldquoKDIGO 2012 clinical practice guidelinefor the evaluation and management of chronic kidney diseaserdquoKidney International Supplements vol 3 pp 1ndash150 2013
[27] A E Grzegorzewska P Wobszal and P P JagodzinskildquoInterleukin-18 promoter polymorphism and development ofantibodies to surface antigen of hepatitis B virus in hemodialy-sis patientsrdquo Kidney and Blood Pressure Research vol 35 no 1pp 1ndash8 2012
[28] A E Grzegorzewska P M Wobszal A Sowinska AMostowska and P P Jagodzinski ldquoAssociation of theinterleukin-12 polymorphic variants with the developmentof antibodies to surface antigen of hepatitis B virus inhemodialysis patients in response to vaccination or infectionrdquoMolecular Biology Reports vol 40 no 12 pp 6899ndash6911 2013
[29] A E Grzegorzewska P M Wobszal A Mostowska and P PJagodzinski ldquoAntibodies to hepatitis B virus surface antigenand interleukin 12 and interleukin 18 gene polymorphisms inhemodialysis patientsrdquo BMC Nephrology vol 13 no 1 article75 2012
[30] A E Grzegorzewska D Pajzderski A Sowinska AMostowska and P P Jagodzinski ldquoIL4R and IL13 polymorphicvariants and development of antibodies to surface antigen ofhepatitis B virus in hemodialysis patients in response to HBVvaccination or infectionrdquo Vaccine vol 31 no 14 pp 1766ndash17702013
[31] S S Rich ldquoGenetics of diabetes and its complicationsrdquo Journalof the American Society of Nephrology vol 17 no 2 pp 353ndash3602006
[32] N D Palmer and B I Freedman ldquoInsights into the geneticarchitecture of diabetic nephropathyrdquoCurrent Diabetes Reportsvol 12 no 4 pp 423ndash431 2012
[33] N Franceschini NM Shara HWang et al ldquoThe association ofgenetic variants of type 2 diabetes with kidney functionrdquoKidneyInternational vol 82 no 2 pp 220ndash225 2012
[34] N D Palmer C W McDonough P J Hicks et al ldquoA genome-wide association search for type 2 diabetes genes in africanamericansrdquo PLoS ONE vol 7 no 1 Article ID e29202 2012
[35] A Davoodi-Semiromi J J Yang and J-X She ldquoIL-12p40 isassociated with type 1 diabetes in Caucasian-American fami-liesrdquo Diabetes vol 51 no 7 pp 2334ndash2336 2002
[36] D B Mirel A M Valdes L C Lazzeroni R L Reynolds HA Erlich and J A Noble ldquoAssociation of IL4R haplotypes withtype 1 diabetesrdquo Diabetes vol 51 no 11 pp 3336ndash3341 2002
[37] T L Bugawan D B Mirel A M Valdes A Panelo P Pozzilliand H A Erlich ldquoAssociation and interaction of the IL4R
Journal of Diabetes Research 17
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009
IL4 and IL13 loci with type 1 diabetes among filipinosrdquo TheAmerican Journal of Human Genetics vol 72 no 6 pp 1505ndash1514 2003
[38] B Frederiksen E Liu J Romanos et al ldquoInvestigation of thevitamin D receptor gene (VDR) and its interaction with proteintyrosine phosphatase non-receptor type 2 gene (PTPN2) onrisk of islet autoimmunity and type 1 diabetes the DiabetesAutoimmunity Study in the Young (DAISY)rdquo The Journal ofSteroid Biochemistry and Molecular Biology vol 133 no 1 pp51ndash57 2013
[39] C Panierakis G Goulielmos D Mamoulakis E Petraki EPapavasiliou and E Galanakis ldquoVitamin D receptor genepolymorphisms and susceptibility to type 1 diabetes in CreteGreecerdquo Clinical Immunology vol 133 no 2 pp 276ndash281 2009
[40] Q Wang B Xi K H Reilly M Liu and M Fu ldquoQuantitativeassessment of the associations between four polymorphisms(FokI ApaI BsmI TaqI) of vitamin D receptor gene and riskof diabetes mellitusrdquo Molecular Biology Reports vol 39 no 10pp 9405ndash9414 2012
[41] N M Al-Daghri O Al-Attas M S Alokail et al ldquoVitamin Dreceptor gene polymorphisms and HLA DRB1lowast04 cosegrega-tion in Saudi type 2 diabetes patientsrdquo Journal of Immunologyvol 188 no 3 pp 1325ndash1332 2012
[42] F-L Velayoudom-Cephise L Larifla J-P Donnet et al ldquoVita-min D deficiency vitamin D receptor gene polymorphisms andcardiovascular risk factors in Caribbean patients with type 2diabetesrdquo Diabetes amp Metabolism vol 37 no 6 pp 540ndash5452011
[43] D A F Ferrarezi N Bellili-Munoz D Dubois-Laforgue et alldquoAllelic variations of the vitamin D receptor (VDR) gene areassociated with increased risk of coronary artery disease in type2 diabetics the DIABHYCAR prospective studyrdquo Diabetes andMetabolism vol 39 no 3 pp 263ndash270 2013
[44] T B Zhou Z P Jiang M F Huang and N Su ldquoAssociation ofvitamin D receptor Fok1 (rs2228570) TaqI (rs731236) and ApaI(rs7975232) gene polymorphismwith the risk of chronic kidneydiseaserdquo Journal of Receptors and Signal Transduction Researchvol 5 pp 1ndash5 2014
[45] R D Mittal and P K Manchanda ldquoAssociation of interleukin(IL)-4 intron-3 and IL-6 -174 GC gene polymorphism withsusceptibility to end-stage renal diseaserdquo Immunogenetics vol59 no 2 pp 159ndash165 2007
[46] G Morahan E McKinnon J Berry et al ldquoEvaluation of IL12Bas a candidate type I diabetes susceptibility gene using datafrom the Type I Diabetes Genetics Consortiumrdquo Genes andImmunity vol 10 supplement 1 pp S64ndashS68 2009
[47] H A Erlich K Lohman S J MacK et al ldquoAssociation analysisof SNPs in the IL4R locus with type i diabetesrdquo Genes andImmunity vol 10 supplement 1 pp S33ndashS41 2009
[48] R Jorde H Schirmer T Wilsgaard et al ldquoPolymorphismsrelated to the serum 25-Hydroxyvitamin D level and riskof Myocardial infarction diabetes cancer and mortality TheTromsoslash studyrdquo PLoS ONE vol 7 no 5 Article ID e37295 2012
[49] H Bid R Konwar C Aggarwal et al ldquoVitamin D receptor(FokI BsmI and TaqI) gene polymorphisms and type 2 diabetesmellitus a North Indian studyrdquo Indian Journal of MedicalSciences vol 63 no 5 pp 187ndash194 2009
[50] MC Lemos A Fagulha E Coutinho et al ldquoLack of associationof vitamin D receptor gene polymorphisms with susceptibilityto type 1 diabetes mellitus in the Portuguese populationrdquoHuman Immunology vol 69 no 2 pp 134ndash138 2008
[51] T B Zhou Z P Jiang andM F Huang ldquoAssociation of vitaminD receptor BsmI (rs1544410) gene polymorphism with thechronic kidney disease susceptibilityrdquo Journal of Receptors andSignal Transduction Research 2014
[52] E Sanchez R J Palomino-Morales N Ortego-Centeno et alldquoIdentification of a new putative functional IL18 gene variantthrough an association study in systemic lupus erythematosusrdquoHuman Molecular Genetics vol 18 no 19 pp 3739ndash3748 2009
[53] I P Kudriashova T P Ospelrsquonikova and F I ErshovldquoCycloferon administration in chronic pyelonephritis changesin interferon statusrdquo Terapevticheskiı Arkhiv vol 83 no 6 pp33ndash35 2011 (Russian)
[54] C-C Wu J-S Chen K-C Lu et al ldquoAberrant cytok-ineschemokines production correlate with proteinuria inpatients with overt diabetic nephropathyrdquoClinica Chimica Actavol 411 no 9-10 pp 700ndash704 2010
[55] N Israni R Goswami A Kumar and R Rani ldquoInteraction ofVitamin D receptor with HLA DRB1lowast0301 in Type 1 diabetespatients from North Indiardquo PLoS ONE vol 4 no 12 Article IDe8023 2009