Research Article Synergistic Effects of Sulfated Polysaccharides from Mexican Seaweeds ...downloads.hindawi.com/journals/bmri/2016/8502123.pdf · 2019-07-30 · Research Article Synergistic
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Research ArticleSynergistic Effects of Sulfated Polysaccharides fromMexican Seaweeds against Measles Virus
Karla Moraacuten-Santibantildeez1 Lucia Elizabeth Cruz-Suaacuterez2 Denis Ricque-Marie2
Daniel Robledo3 Yolanda Freile-Pelegriacuten3 Mario A Pentildea-Hernaacutendez1
Cristina Rodriacuteguez-Padilla1 and Laura M Trejo-Avila1
1Laboratorio de Inmunologıa y Virologıa Facultad de Ciencias Biologicas Universidad Autonoma de Nuevo LeonCiudad Universitaria CP 66455 San Nicolas de los Garza NL Mexico2Programa Maricultura Facultad de Ciencias Biologicas Universidad Autonoma de Nuevo LeonCiudad Universitaria CP 66455 San Nicolas de los Garza NL Mexico3Cinvestav Unidad Merida Km 6 Carretera Antigua a Progreso Cordemex AP 73 97310 Merida YUC Mexico
Correspondence should be addressed to Laura M Trejo-Avila lauratrejoavuanledumx
Received 18 March 2016 Revised 11 May 2016 Accepted 16 May 2016
Academic Editor Ibrahim M Banat
Copyright copy 2016 Karla Moran-Santibanez et alThis is an open access article distributed under theCreative CommonsAttributionLicense which permits unrestricted use distribution and reproduction in anymedium provided the originalwork is properly cited
Sulfated polysaccharides (SPs) extracted from five seaweed samples collected or cultivated in Mexico (Macrocystis pyrifera Eiseniaarborea Pelvetia compressa Ulva intestinalis and Solieria filiformis) were tested in this study in order to evaluate their effect onmeasles virus in vitro All polysaccharides showed antiviral activity (as measured by the reduction of syncytia formation) and lowcytotoxicity (MTT assay) at inhibitory concentrations SPs from Eisenia arborea and Solieria filiformis showed the highest antiviralactivities (confirmed by qPCR) and were selected to determine their combined effect Their synergistic effect was observed at lowconcentrations (00274120583gmL and 0011120583gmL of E arborea and S filiformis SPs resp) which exhibited by far a higher inhibitoryeffect (96 syncytia reduction) in comparison to the individual SP effects (50 inhibition with 0275120583gmL and 0985 120583gmL ofE arborea and S filiformis resp) Time of addition experiments and viral penetration assays suggest that best activities of these SPsoccur at different stages of infection The synergistic effect would allow reducing the treatment dose and toxicity and minimizingor delaying the induction of antiviral resistance sulfated polysaccharides of the tested seaweed species thus appear as promisingcandidates for the development of natural antiviral agents
1 Introduction
LatinAmerica has an important and diverse group of seaweedspecies [1] Recent data on seaweed management in thisregion have described the main harvest and aquaculturetaking place in Argentina Brazil Chile Peru andMexico [2]One of the goals of seaweeds exploitation is to diversify theirapplication by screening their diverse bioactive compoundswhich remain unexplored in nutraceutical and pharmaceuti-cal areas [3] Different chemical compounds have been iso-lated from algae including polysaccharides which have beensubjected to a variety of studies due to their extensive bioac-tivities and applications [4]
An increasing number of biological activities of seaweedpolysaccharides have been reported in the last decades where
sulfated polysaccharides (SPs) are among the most studiedcompounds [5] SPs include a complex group of macro-molecules with numerous activities such as antioxidant [6 7]antitumor [8 9] anticoagulant [6] anti-inflammatory [6 10]and antiviral [11 12]
Antiviral activity of SPs was first reported in 1958 [13] andover the years a substantial research has been focused on thisfield SP can be obtained from each of the three main classesof seaweed fucoidans and alginates from brown algal speciesagaroids and carrageenans from red macroalgae and ulvansfrom green seaweeds [14]
Fucoidans have shown a potent antiviral activity againstnumerous enveloped viruses including herpes simplex virustype 1 (HSV-1) [15] human immunodeficiency virus [16]
Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 8502123 11 pageshttpdxdoiorg10115520168502123
2 BioMed Research International
influenza A virus [17] and different kind of paramyxovirusessuch as Newcastle disease virus (NDV) and canine distempervirus (CDV) [18 19] In vitro and in vivo antiretroviral effectsof alginates preventing syncytium formation and reducingthe P24 core antigen level have been demonstrated [20]Antiviral activity of carrageenans has been demonstrated invitro against human papillomavirus (HPV) acting mainly onthe inhibition ofHPV virions binding to cells and also in vivoby preventing infection by different HPV genotypes [21 22]Recently antiviral activity against NDV of ulvan from Ulvaclathrata cultivated in Mexico has been reported [23]
Nowadays combining multiple drugs is a primaryapproach for improving antiviral effects within the antiviraldrug therapy field The advantages of multidrugs combina-tion are the reduction of individual drugs doses a decrease inthe side effects of antiviral agents and the prevention of drug-resistant viruses emergence Drug combination theories pro-vide an ideal tool for this purpose to understand the benefitsof multidrugs combinations therapy [24]
Measles virus (MeV) belongs to the Paramyxoviridaefamily of Mononegavirales is a nonsegmented negative-strand RNA virus and causes a highly contagious disease[25] Although preventable by vaccination measles stillremains one of the causes of death among young childrenworldwide [26] Many new antiviral drugs have been licensedin recent years most of which are used for the treatment ofHIV infections [27] The investigation of natural antiviralsisolated frommarine sources is an interesting approach in thedevelopment of new antiviral agents In the present study wetested the antiviral activity of SPs isolated from five Mexicanseaweeds againstMeVThe aimof this researchwas to developnew candidates of antiviral drugs that could help to controlviral infection diseases
2 Materials and Methods
21 Antiviral Agents
211 Collection of Seaweed Five species of macroalgae werecollected from the Mexican coasts and tested for this studythree brown seaweeds from Baja California (Macrocystispyrifera Eisenia arborea and Pelvetia compressa) one greenseaweed from Southern Baja California (Ulva intestinalis)and one red seaweed from Yucatan (Solieria filiformis)
Macrocystis pyrifera (Linnaeus) C Agardh was collectedin Bahıa de Ensenada (Manto Jantay) in front of the Sal-sipuedes beach (31983ndash116815) in January 2013 Eiseniaarborea J E Areschoug and Pelvetia compressa (J Agardh)De Toni were collected in the Escalera Zone North of PuntaChina (31520ndash116650) in December 2014-January 2015 Thegreen algaUlva intestinalis (Linnaeus) was collected from thewater drainage channel of the Gran Mar shrimp farm on theBaja California West coast (24434ndash111584) in August 2014
Solieria filiformis (Kutzing) P W Gabrielson a red sea-weed considered as a potential source of 120580-carrageenan [28]was obtained from an aquaculture facility at the TelchacMarine station-CINVESTAV Yucatan (Mexico) where it isperiodically cultivated in bimonthly cycles in semiopen tanksas part of an Integrated Multitrophic aquaculture system
The sample used came from a batch cultured from April toMay 2014
Once harvested the brown and green algae samples werewashed in seawater to eliminate sand shells and epibiontsand dried under shade while the cultivated red algae waswashedwith freshwater and dried in an oven at 60∘C Prior toextraction the samples were cut into small 2-3 cm pieces andground to pass through a 05mm sieve (Turbomolino Pulvex200 mill)
212 Extraction and Purification of Sulfated PolysaccharidesPolysaccharides extraction was performed after extraction ofpolyphenols [29] Briefly 10 g of alga powder was washedwithdistillated water and dried at room temperature overnightThe washed powder was extracted with 200mL 50 vvethanol and sonicated for 30min at room temperaturefollowed with an extraction period in a bath shaker at70∘C during 2 hours The samples were centrifuged for15min (2500 rpm)The pellet was used for the polysaccharideextraction according to the procedure described by Tako et al2000 and Ale et al 2012 [30 31] Briefly 200mL of 01M HClwas added to the algae pellet and heated for 1 hour at boilingtemperature and centrifuged at 3500 rpm for 10 minutesThe supernatant was recovered and absolute ethanol wasadded (4 1) for polysaccharides precipitation Once precip-itated the polysaccharides were separated from the aqueousmedium by centrifugation at 3500 rpm for 10 minutes thesupernatant was discarded and the pellet was washed threetimes with 96 ethanol to remove residual pigments andfinally resuspended in a minimum amount of distilled waterfor a 72-hour dialysis with stirring The dialyzed productwas precipitated with absolute ethanol (4 1) Polysaccharideextracts were lyophilized and weighed to calculate their yield
213 Characterization of Selected Polysaccharide Extracts
(1) FT-IR Spectra Analysis IR spectra of aqueous extractedpolysaccharides from Solieria filiformis and Eisenia arboreawere obtained using diffuse reflectance infrared Fouriertransform spectroscopy (DRIFTS) Scans were performed atroom temperature in the infrared region between 4000 and400 cmminus1 on a Thermo Nicolet Nexus 670 FT-IR spectrome-terThe infrared spectra of commercial available carrageenan(120580-carrageenan C1138 120581-carrageenan C1013) fucoidan fromFucus vesiculosus (F5631) alginic acid (A7003) from Sigma-Aldrich (St LouisMOUSA) and 120582-carrageenan fromCelticColloids Inc (B Blakemore) were included for comparison
(2) NMR Spectra Analysis 13C-NMR spectra were acquiredon a Varian 600 spectrometer The extracts were exchangedtwice with 998 deuterium oxide (D2O) with intermediatelyophilization and dissolved at 10mgmLminus1 in D2O Sodium[3-trimethylsilyl 221015840331015840-2-H4] propionate (TSP-d4) wasused as an internal reference to 000 ppm
(3) Carbohydrate Determination For determination of totalsugars in the samples acid hydrolysis of the extracts wasperformed A solution with 25mg of polysaccharide extractin 100mL of 1MH
2SO4was prepared and boiled for 3 hours
BioMed Research International 3
subsequently an aliquot of 1mL of each extract was takenAnthrone reagent (5mL) was added to the aliquot placed ina water bath for 12 minutes and cooled down at room tem-perature Absorbance was read at 630 nm Quantification wasperformed against a calibration curve of a stock solution offucose
(4) Sulfate Content Determination The analysis was per-formed using the turbidimetric method of Jackson andMcCandless 1978 [32] Briefly this quantification of sulfateswas determined by measuring turbidity as barium sulfatewhen adding 12mL of TCA 8 and 06mL of 001 reactionreagent (agarosebarium chloride) to the sample reactionwas homogenized by stirring for 35 minutes The turbiditywas determined at 500 nm in a ShimadzuUV-Vis spectropho-tometer 1601 The calibration curve was performed withpotassium sulfate (K
2SO4) with a concentration of 0 to 100 120583g
of SO4
minus2mL SP extracts of Solieria filiformis and Eiseniaarboreawere weighed (7mg) and 1mL of 1N HCl was addedand heated at 105∘C for 12 hours in a thermoblock (Lab line)A dilution was performed with 10mL of deionized watersamples were then filtered using a microfilter with Whatmanpaper of 12 120583m and an aliquot of 11mL of the samples wastaken for quantificationAnalysiswas performedby triplicate
22 Cells and Virus Vero cells were grown at 37∘C in a5 CO
2atmosphere in Dulbeccorsquos Modified Eagle Medium
Nutrient Mixture F-12 (DMEMF12 Gibco Invitrogen USA)supplemented with 5 fetal bovine serum (FBS GibcoInvitrogen USA) and 1 antibiotic (Gibco Invitrogen USA)
Measles virus (Edmonston strain) was purchased fromATCC (ATCCVR-24) Virus was propagated onVero cellsand viral titers were determined by cytopathogenic effect andexpressed as 50 tissue culture infectious dose (TCID50)mL Aliquots of viral stock were stored at minus80∘C until use
23 Cytotoxicity Assays The effect of SPs on cell viabilityof Vero cells was determined by MTT assay The cells werecultured in 96-well plates at a density of 15 times 104 cellswellat 37∘C in an atmosphere of CO
2 After 1 day of incubation
increasing concentrations of SPs diluted in DMEM wereadded after 48 h of incubation the media were replaced with22120583L of 25mgmL MTT dissolved in phosphate-bufferedsaline (PBS) After 1 h 30min 150 120583L of DMSOwas added andincubated at room temperature for 15minTheoptical density(OD450 nm) was measured using a microplate reader (Mul-tiskan FCThermo USA) Cell viability was expressed by per-centage as the mean value of three independent experimentsconsidering control cells absorbance as 100viable CC
50was
the concentration of the test substances that inhibited theVero cells growth by 50 compared with the growth of theuntreated cells
24 Syncytia Reduction Assays The antiviral activity of theSPs was evaluated by syncytia reduction assays Vero cellsseeded in 12-well plates were treated with different concen-trations of SPs (001ndash5120583gmL) and infected with MeV (1 times1035 TCID50 of Edmonston strain) at the same time After
virus adsorption for 1 h at 37∘C the medium was removedand monolayers were washed with PBS after which thecorresponding concentrations of SPs were added againEach concentration was tested using three culture wellsper PS concentration per experiment the experiments wereperformed by triplicate After incubation of 48 or 72 h at37∘C in a 5 CO
2incubator monolayers were fixed with
methanol acetone (1 1) and stained with 1 crystal violetSyncytia were counted and the result was expressed as a per-centage of the number of syncytia observed in viral controlmonolayers (untreated cultures) IC
50was determined from
dose-response curves The selectivity index (SI) values werecalculated as CC
50IC50 SPs showing the best SI were selected
for the subsequent experiments
25 Quantitative Real-Time PCR Total RNA was isolatedfrom treated Vero cells using RNAzol RT (MRC IncUSA) Reverse transcription was performed using the HighCapacity cDNA Reverse Transcription Kit (Applied Biosys-tems USA) and the viral genome was amplified with spe-cific primers (MeVF 51015840 GAGGGTCAAACAGAGTCGAG 31015840MeVR 51015840 CGGTTGGAAGATGGGCAG 31015840) that amplifieda 95 nt fragment The real-time PCR was carried out usingSensiFAST SYBR No-ROX Kit (BIOLINE USA) and theChromo4 Real-Time PCR Detector (Bio-Rad USA) withthe following procedures 95∘C for 2min followed by 50cycles of 95∘C for 2 s 60∘C for 10 s and 72∘C for 20 s Thenumber of viral copies was calculated by using a standardcurve Serial 10-fold dilutions of a synthetic oligonucleotideencompassing the target measles gene were used to establishthe standard curves
26 Evaluation of SPs Synergy Potential synergistic effectsof selected SPs on MeV infection were evaluated usingsyncytia reduction assays Each combination was tested onits corresponding IC
75 IC50 and IC
25values The synergistic
effect of SPs was calculated by using a combination index(CI) described previously by Chou [33] and CompuSynsoftware CI was calculated from the data as a measure of theinteraction among drugs CI values lower than 09 indicatesynergy CI values from 09 to 11 indicate an additive effectand CI values higher than 11 indicate antagonism Combina-tions with synergistic antiviral effect were selected and qPCRassays were performed in order to confirm the inhibitoryeffect as described above
27 Time of Addition Assay Vero cell monolayers wereinfected with MeV SPs were added at a concentration of5 120583gmL at different times of infection 60min before infec-tion and 0 15 30 60 and 120min after infection Thereafterfor each treatment cells were incubated with SP for 1 h andthen washed three times with PBS Monolayers were fixedwithmethanol acetone after incubation for 48 or 72 h at 37∘Cand 5 CO
2and stained with 1 crystal violet syncytia were
counted subsequently
28 Viral PenetrationAssay Virus penetration intoVero cellswas evaluated according to the method reported by Huangand Wagner [34] with some modifications [18] Vero cell
4 BioMed Research International
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(a)
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(b)
Figure 1 Confirmation of antiviral activity of Eisenia arborea (a) and Solieria filiformis (b) SPs at their best inhibitory concentrations bysyncytia reduction and qPCR assays Syncytia count and viral RNA copies number are given in of the untreated control values
monolayers precooled at 4∘C for 3 h were infected with MeVat 4∘C for 1 h in the absence of SP After washing three timeswith ice-cold PBS different concentrations of SP were addedto the monolayers and the temperature was shifted to 37∘CAfter 1 h of incubation at 37∘C the cells were treated with40mM citrate buffer (pH 30) to inactivate unpenetratedviruses Buffer was replaced by culture medium and the cellswere incubated for 48 or 72 h at 37∘C and 5CO
2and stained
with 1 crystal violet syncytia were counted subsequently
29 Statistical Analysis The variables (tested by triplicate ineach experiment that were in turn repeated at least threetimes) were submitted to a one-way analysis of variancefollowed by Dunnettrsquos test (SPSS software 120572 = 005) CC
50
and IC50values were determined by probit regression analy-
sis
3 Results
31 Cytotoxicity and Antiviral Activity of SPs TheMTT assayindicated no cytotoxicity for any of the SPs at concentrationsfrom 01 to 1500 120583gmL up to 2 days (data not shown)
Antiviral activity of SPs against MeV was evaluated bysyncytia reduction inhibition assays at concentrations of 00101 1 and 5 120583gmL of each compound (data not shown)All tested compounds showed significant antiviral activitybut only compounds with the best SI values were selectedfor the subsequent experiments As shown in Table 1 SPsof Eisenia arborea and Solieria filiformis exhibited antiviralactivity at the lowest concentrations (IC
500275 120583gmL and
0985 120583gmL resp) without cytotoxic effect at concentrationsof 01 to 1500120583gmL Therefore SPs of Eisenia arborea andSolieria filiformiswere selected based on their SI and antiviralactivity for the combination experiments
Table 1 Cytotoxic effect antiviral activity and selectivity index ofSPs
Algaea CC50
(120583gmL)b IC50
(120583gmL)c SId
Macrocystis pyrifera gt1500 100 gt1500Eisenia arborea gt1500 0275 gt545454Pelvetia compressa gt1500 100 gt1500Ulva intestinalis gt1500 36 gt4167Solieria filiformis gt1500 0985 gt152284aAlgal sulfated polysaccharide extract bConcentration of test compound(120583gmL) that reduced Vero cell viability by 50 cConcentration of a testcompound that reduced the number of MeV syncytia in Vero cells by 50dSelectivity index value
Antiviral effect of selected SPs was confirmed by qPCRassays as shown in Figure 1 Inhibitory effect of Eiseniaarborea and Solieria filiformis SP was tested at the bestinhibitory concentrations (1120583gmL and 5 120583gmL for bothSPs) Results of qPCR assays were consistent with the resultsobserved by syncytia reduction inhibition assays
32 Characterization of SPs Infrared spectroscopy has beenused for the qualitative characterization of carrageenans andhas proven to be a valuable tool for the characterizationof sulfated oligosaccharides [35] FT-IR and NMR spectraanalyses of selected SPs extracts were performed The FT-IRspectrum of Solieria filiformis extract (Figure 2(a)) indicatesthe presence of a typical 120580-carrageenan type Characteristicssignal bands are indicated 36 anhydrogalactose-2-sulfate(804 cmminus1) characteristic of 120580-carrageenan galactose-4-sulfate (846 cmminus1) signal present in 120581- and 120580-carrageenanThesignal between 1210 and 1260 cmminus1 is common to all types ofcompounds containing sulfate
BioMed Research International 5
2000 1800 1600 1400 1200 1000 800 600
1210ndash1260 804846929
D
C
B
A
1639
(cmminus1)
(a)
2000 1800 1600 1400 1200 1000 800 600
C
B
124414101627
1039ndash1041
A
(cmminus1)
(b)
Figure 2 (a) Infrared spectra of (A) Solieria filiformis aqueous extract (B) 120580-carrageenan (C) 120581-carrageenan and (D) 120582-carrageenan (b)Infrared spectra of (A) Eisenia arborea aqueous extract (B) fucoidan and (C) alginic acid
13C-NMR spectroscopy has been highly recommendedfor distinguishing the polysaccharides of the agar and car-rageenan group [36] Spectrum and expansion 13C-NMR ofthe S filiformis extract (Figure 3(a)) showed signals at 20and 60 ppm typical of residual ethanol Carbohydrates sig-nals (6379ndash10466 ppm) observed particularly two upfield-shifted signals (9451 and 10466 ppm) suggest that themolecule has two anomeric carbons Overall its spectrumshowed the presence of the 120580-carrageenan The next assign-ment is the mapping of the carbon signals of the moleculeCarbons of 2-sulfate-36-anhydrogalactose are 9451 (C1)7744 (C2) 8025 (C3) 8084 (C4) 7949 (C5) and 7233(C6) ppm [37] Carbons of 4-sulfate-galactose are 10466(C1) 7168 (C2) 7927 (C3) 7451 (C4) 7727 (C5) and 6379(C6) ppm [37] Sulfate content of S filiformis showed 2114(plusmn0056) of total sulfate and total polysaccharide determina-tion resulted in 91 of polysaccharide
The FT-IR spectrum of Eisenia arborea extract (Fig-ure 2(b)) indicates the presence of a mixture of fucoidanand alginic acid Characteristics signal bands are indicatedcarboxylate vibrations (1627 and 1410 cmminus1) can be attributedto uronic acids Stretching vibrations at 1039ndash1041 cmminus1 canbe assigned to pyranose ring from guluronic andmannuronicacid residues The broad band at 1244 cmminus1 indicates thepresence of sulfated ester groups which are characteristicin fucoidans 13C-NMR spectrum of E arborea extract(Figure 3(b)) showed typical signals of alginate ranging from6604 to 17768 ppmThe signal at 6604 ppm is characteristicof carbon-2 of guluronic acid (G) [38] The signals at 72517279 7407 7890 8082 10281 10293 and 17768 ppm corre-spond to repeating blocks of mannuronic (M) and guluronicacid [39] The signals at 10281 and 10293 ppm may indicatethe presence of two repeating units one ofMMMand anotherof GMM [39] Sulfate content of E arborea showed 1285(plusmn0346) of total sulfate
33 Combined Antiviral Effect of SPs The combined effectof SPs of Eisenia arborea and Solieria filiformis on MeVinfections was examined each SP was tested at different con-centrations combining its corresponding IC
25 IC50 and IC
75
values E25 E50 and E
75correspond to IC
25 IC50 and IC
75
values of Eisenia arborea SPs and S25 S50 and S
75correspond
to the respective values of Solieria filiformis SP (Table 2)Syncytia reduction assay results were expressed in relativesyncytia percentage according to the number of syncytia inviral control Best inhibitory effect was observed for E
50-S25
combinationThe evaluation of drug synergism based on a median-
effect equation has been extensively used in the literatureCI values of SPs combinations were calculated as describedpreviously using the CompuSyn software and are givenin Table 2 Median-effect and the normalized isobologramgenerated with the software determined the presence of threesynergistic combinations represented by points below thelines at normalized isobologram (Figure 4)
Results showed strong synergistic effects at low concen-trations combinations (E
50-S25 E25-S50 and E
25-S25) and
antagonism at high concentrations combinations (E25-S75
E50-S50 E50-S75 E75-S25 E70-S50 and E
75-S75) Combinations
with synergistic effect were selected and qPCR assays wereperformed As shown in Figure 5 the inhibitory effect ofthe synergistic combinations was confirmed These datawere consistent with results observed by syncytia reductioninhibition assays
34 Effect of SPs on Viral Infection at Different Times ofAddition In order to determine which step of the MeV cyclewas targeted by SPs ldquotime of additionrdquo experiments wereperformed in Vero cells infected withMeV and exposed to PSat different times of infectionThemost efficient inhibition byS filiformis was observed in early phases of infection 0 and
6 BioMed Research International
7
1
4
3
12
6
59
2
11
10 8
O O OO
O
OH
OH 1
234
6
5
78
10
9
12
11
TSP-d4
OSO3minus
HOCH2CH3
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
105 100 95 90 85 80 75 70 65
(ppm)
O3minusSO
10466
9451
8084
8025
7948
7927
7743
7727
7451
7233
7219
7167
6379
(a)
[MMM][GMM]
Carbonyl signalof uronic acids
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
(ppm)
TSP-d4
18783
17768
10293
10281
8082
7890
7407
7279
7251
6604
4683
(b)
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
influenza A virus [17] and different kind of paramyxovirusessuch as Newcastle disease virus (NDV) and canine distempervirus (CDV) [18 19] In vitro and in vivo antiretroviral effectsof alginates preventing syncytium formation and reducingthe P24 core antigen level have been demonstrated [20]Antiviral activity of carrageenans has been demonstrated invitro against human papillomavirus (HPV) acting mainly onthe inhibition ofHPV virions binding to cells and also in vivoby preventing infection by different HPV genotypes [21 22]Recently antiviral activity against NDV of ulvan from Ulvaclathrata cultivated in Mexico has been reported [23]
Nowadays combining multiple drugs is a primaryapproach for improving antiviral effects within the antiviraldrug therapy field The advantages of multidrugs combina-tion are the reduction of individual drugs doses a decrease inthe side effects of antiviral agents and the prevention of drug-resistant viruses emergence Drug combination theories pro-vide an ideal tool for this purpose to understand the benefitsof multidrugs combinations therapy [24]
Measles virus (MeV) belongs to the Paramyxoviridaefamily of Mononegavirales is a nonsegmented negative-strand RNA virus and causes a highly contagious disease[25] Although preventable by vaccination measles stillremains one of the causes of death among young childrenworldwide [26] Many new antiviral drugs have been licensedin recent years most of which are used for the treatment ofHIV infections [27] The investigation of natural antiviralsisolated frommarine sources is an interesting approach in thedevelopment of new antiviral agents In the present study wetested the antiviral activity of SPs isolated from five Mexicanseaweeds againstMeVThe aimof this researchwas to developnew candidates of antiviral drugs that could help to controlviral infection diseases
2 Materials and Methods
21 Antiviral Agents
211 Collection of Seaweed Five species of macroalgae werecollected from the Mexican coasts and tested for this studythree brown seaweeds from Baja California (Macrocystispyrifera Eisenia arborea and Pelvetia compressa) one greenseaweed from Southern Baja California (Ulva intestinalis)and one red seaweed from Yucatan (Solieria filiformis)
Macrocystis pyrifera (Linnaeus) C Agardh was collectedin Bahıa de Ensenada (Manto Jantay) in front of the Sal-sipuedes beach (31983ndash116815) in January 2013 Eiseniaarborea J E Areschoug and Pelvetia compressa (J Agardh)De Toni were collected in the Escalera Zone North of PuntaChina (31520ndash116650) in December 2014-January 2015 Thegreen algaUlva intestinalis (Linnaeus) was collected from thewater drainage channel of the Gran Mar shrimp farm on theBaja California West coast (24434ndash111584) in August 2014
Solieria filiformis (Kutzing) P W Gabrielson a red sea-weed considered as a potential source of 120580-carrageenan [28]was obtained from an aquaculture facility at the TelchacMarine station-CINVESTAV Yucatan (Mexico) where it isperiodically cultivated in bimonthly cycles in semiopen tanksas part of an Integrated Multitrophic aquaculture system
The sample used came from a batch cultured from April toMay 2014
Once harvested the brown and green algae samples werewashed in seawater to eliminate sand shells and epibiontsand dried under shade while the cultivated red algae waswashedwith freshwater and dried in an oven at 60∘C Prior toextraction the samples were cut into small 2-3 cm pieces andground to pass through a 05mm sieve (Turbomolino Pulvex200 mill)
212 Extraction and Purification of Sulfated PolysaccharidesPolysaccharides extraction was performed after extraction ofpolyphenols [29] Briefly 10 g of alga powder was washedwithdistillated water and dried at room temperature overnightThe washed powder was extracted with 200mL 50 vvethanol and sonicated for 30min at room temperaturefollowed with an extraction period in a bath shaker at70∘C during 2 hours The samples were centrifuged for15min (2500 rpm)The pellet was used for the polysaccharideextraction according to the procedure described by Tako et al2000 and Ale et al 2012 [30 31] Briefly 200mL of 01M HClwas added to the algae pellet and heated for 1 hour at boilingtemperature and centrifuged at 3500 rpm for 10 minutesThe supernatant was recovered and absolute ethanol wasadded (4 1) for polysaccharides precipitation Once precip-itated the polysaccharides were separated from the aqueousmedium by centrifugation at 3500 rpm for 10 minutes thesupernatant was discarded and the pellet was washed threetimes with 96 ethanol to remove residual pigments andfinally resuspended in a minimum amount of distilled waterfor a 72-hour dialysis with stirring The dialyzed productwas precipitated with absolute ethanol (4 1) Polysaccharideextracts were lyophilized and weighed to calculate their yield
213 Characterization of Selected Polysaccharide Extracts
(1) FT-IR Spectra Analysis IR spectra of aqueous extractedpolysaccharides from Solieria filiformis and Eisenia arboreawere obtained using diffuse reflectance infrared Fouriertransform spectroscopy (DRIFTS) Scans were performed atroom temperature in the infrared region between 4000 and400 cmminus1 on a Thermo Nicolet Nexus 670 FT-IR spectrome-terThe infrared spectra of commercial available carrageenan(120580-carrageenan C1138 120581-carrageenan C1013) fucoidan fromFucus vesiculosus (F5631) alginic acid (A7003) from Sigma-Aldrich (St LouisMOUSA) and 120582-carrageenan fromCelticColloids Inc (B Blakemore) were included for comparison
(2) NMR Spectra Analysis 13C-NMR spectra were acquiredon a Varian 600 spectrometer The extracts were exchangedtwice with 998 deuterium oxide (D2O) with intermediatelyophilization and dissolved at 10mgmLminus1 in D2O Sodium[3-trimethylsilyl 221015840331015840-2-H4] propionate (TSP-d4) wasused as an internal reference to 000 ppm
(3) Carbohydrate Determination For determination of totalsugars in the samples acid hydrolysis of the extracts wasperformed A solution with 25mg of polysaccharide extractin 100mL of 1MH
2SO4was prepared and boiled for 3 hours
BioMed Research International 3
subsequently an aliquot of 1mL of each extract was takenAnthrone reagent (5mL) was added to the aliquot placed ina water bath for 12 minutes and cooled down at room tem-perature Absorbance was read at 630 nm Quantification wasperformed against a calibration curve of a stock solution offucose
(4) Sulfate Content Determination The analysis was per-formed using the turbidimetric method of Jackson andMcCandless 1978 [32] Briefly this quantification of sulfateswas determined by measuring turbidity as barium sulfatewhen adding 12mL of TCA 8 and 06mL of 001 reactionreagent (agarosebarium chloride) to the sample reactionwas homogenized by stirring for 35 minutes The turbiditywas determined at 500 nm in a ShimadzuUV-Vis spectropho-tometer 1601 The calibration curve was performed withpotassium sulfate (K
2SO4) with a concentration of 0 to 100 120583g
of SO4
minus2mL SP extracts of Solieria filiformis and Eiseniaarboreawere weighed (7mg) and 1mL of 1N HCl was addedand heated at 105∘C for 12 hours in a thermoblock (Lab line)A dilution was performed with 10mL of deionized watersamples were then filtered using a microfilter with Whatmanpaper of 12 120583m and an aliquot of 11mL of the samples wastaken for quantificationAnalysiswas performedby triplicate
22 Cells and Virus Vero cells were grown at 37∘C in a5 CO
2atmosphere in Dulbeccorsquos Modified Eagle Medium
Nutrient Mixture F-12 (DMEMF12 Gibco Invitrogen USA)supplemented with 5 fetal bovine serum (FBS GibcoInvitrogen USA) and 1 antibiotic (Gibco Invitrogen USA)
Measles virus (Edmonston strain) was purchased fromATCC (ATCCVR-24) Virus was propagated onVero cellsand viral titers were determined by cytopathogenic effect andexpressed as 50 tissue culture infectious dose (TCID50)mL Aliquots of viral stock were stored at minus80∘C until use
23 Cytotoxicity Assays The effect of SPs on cell viabilityof Vero cells was determined by MTT assay The cells werecultured in 96-well plates at a density of 15 times 104 cellswellat 37∘C in an atmosphere of CO
2 After 1 day of incubation
increasing concentrations of SPs diluted in DMEM wereadded after 48 h of incubation the media were replaced with22120583L of 25mgmL MTT dissolved in phosphate-bufferedsaline (PBS) After 1 h 30min 150 120583L of DMSOwas added andincubated at room temperature for 15minTheoptical density(OD450 nm) was measured using a microplate reader (Mul-tiskan FCThermo USA) Cell viability was expressed by per-centage as the mean value of three independent experimentsconsidering control cells absorbance as 100viable CC
50was
the concentration of the test substances that inhibited theVero cells growth by 50 compared with the growth of theuntreated cells
24 Syncytia Reduction Assays The antiviral activity of theSPs was evaluated by syncytia reduction assays Vero cellsseeded in 12-well plates were treated with different concen-trations of SPs (001ndash5120583gmL) and infected with MeV (1 times1035 TCID50 of Edmonston strain) at the same time After
virus adsorption for 1 h at 37∘C the medium was removedand monolayers were washed with PBS after which thecorresponding concentrations of SPs were added againEach concentration was tested using three culture wellsper PS concentration per experiment the experiments wereperformed by triplicate After incubation of 48 or 72 h at37∘C in a 5 CO
2incubator monolayers were fixed with
methanol acetone (1 1) and stained with 1 crystal violetSyncytia were counted and the result was expressed as a per-centage of the number of syncytia observed in viral controlmonolayers (untreated cultures) IC
50was determined from
dose-response curves The selectivity index (SI) values werecalculated as CC
50IC50 SPs showing the best SI were selected
for the subsequent experiments
25 Quantitative Real-Time PCR Total RNA was isolatedfrom treated Vero cells using RNAzol RT (MRC IncUSA) Reverse transcription was performed using the HighCapacity cDNA Reverse Transcription Kit (Applied Biosys-tems USA) and the viral genome was amplified with spe-cific primers (MeVF 51015840 GAGGGTCAAACAGAGTCGAG 31015840MeVR 51015840 CGGTTGGAAGATGGGCAG 31015840) that amplifieda 95 nt fragment The real-time PCR was carried out usingSensiFAST SYBR No-ROX Kit (BIOLINE USA) and theChromo4 Real-Time PCR Detector (Bio-Rad USA) withthe following procedures 95∘C for 2min followed by 50cycles of 95∘C for 2 s 60∘C for 10 s and 72∘C for 20 s Thenumber of viral copies was calculated by using a standardcurve Serial 10-fold dilutions of a synthetic oligonucleotideencompassing the target measles gene were used to establishthe standard curves
26 Evaluation of SPs Synergy Potential synergistic effectsof selected SPs on MeV infection were evaluated usingsyncytia reduction assays Each combination was tested onits corresponding IC
75 IC50 and IC
25values The synergistic
effect of SPs was calculated by using a combination index(CI) described previously by Chou [33] and CompuSynsoftware CI was calculated from the data as a measure of theinteraction among drugs CI values lower than 09 indicatesynergy CI values from 09 to 11 indicate an additive effectand CI values higher than 11 indicate antagonism Combina-tions with synergistic antiviral effect were selected and qPCRassays were performed in order to confirm the inhibitoryeffect as described above
27 Time of Addition Assay Vero cell monolayers wereinfected with MeV SPs were added at a concentration of5 120583gmL at different times of infection 60min before infec-tion and 0 15 30 60 and 120min after infection Thereafterfor each treatment cells were incubated with SP for 1 h andthen washed three times with PBS Monolayers were fixedwithmethanol acetone after incubation for 48 or 72 h at 37∘Cand 5 CO
2and stained with 1 crystal violet syncytia were
counted subsequently
28 Viral PenetrationAssay Virus penetration intoVero cellswas evaluated according to the method reported by Huangand Wagner [34] with some modifications [18] Vero cell
4 BioMed Research International
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(a)
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(b)
Figure 1 Confirmation of antiviral activity of Eisenia arborea (a) and Solieria filiformis (b) SPs at their best inhibitory concentrations bysyncytia reduction and qPCR assays Syncytia count and viral RNA copies number are given in of the untreated control values
monolayers precooled at 4∘C for 3 h were infected with MeVat 4∘C for 1 h in the absence of SP After washing three timeswith ice-cold PBS different concentrations of SP were addedto the monolayers and the temperature was shifted to 37∘CAfter 1 h of incubation at 37∘C the cells were treated with40mM citrate buffer (pH 30) to inactivate unpenetratedviruses Buffer was replaced by culture medium and the cellswere incubated for 48 or 72 h at 37∘C and 5CO
2and stained
with 1 crystal violet syncytia were counted subsequently
29 Statistical Analysis The variables (tested by triplicate ineach experiment that were in turn repeated at least threetimes) were submitted to a one-way analysis of variancefollowed by Dunnettrsquos test (SPSS software 120572 = 005) CC
50
and IC50values were determined by probit regression analy-
sis
3 Results
31 Cytotoxicity and Antiviral Activity of SPs TheMTT assayindicated no cytotoxicity for any of the SPs at concentrationsfrom 01 to 1500 120583gmL up to 2 days (data not shown)
Antiviral activity of SPs against MeV was evaluated bysyncytia reduction inhibition assays at concentrations of 00101 1 and 5 120583gmL of each compound (data not shown)All tested compounds showed significant antiviral activitybut only compounds with the best SI values were selectedfor the subsequent experiments As shown in Table 1 SPsof Eisenia arborea and Solieria filiformis exhibited antiviralactivity at the lowest concentrations (IC
500275 120583gmL and
0985 120583gmL resp) without cytotoxic effect at concentrationsof 01 to 1500120583gmL Therefore SPs of Eisenia arborea andSolieria filiformiswere selected based on their SI and antiviralactivity for the combination experiments
Table 1 Cytotoxic effect antiviral activity and selectivity index ofSPs
Algaea CC50
(120583gmL)b IC50
(120583gmL)c SId
Macrocystis pyrifera gt1500 100 gt1500Eisenia arborea gt1500 0275 gt545454Pelvetia compressa gt1500 100 gt1500Ulva intestinalis gt1500 36 gt4167Solieria filiformis gt1500 0985 gt152284aAlgal sulfated polysaccharide extract bConcentration of test compound(120583gmL) that reduced Vero cell viability by 50 cConcentration of a testcompound that reduced the number of MeV syncytia in Vero cells by 50dSelectivity index value
Antiviral effect of selected SPs was confirmed by qPCRassays as shown in Figure 1 Inhibitory effect of Eiseniaarborea and Solieria filiformis SP was tested at the bestinhibitory concentrations (1120583gmL and 5 120583gmL for bothSPs) Results of qPCR assays were consistent with the resultsobserved by syncytia reduction inhibition assays
32 Characterization of SPs Infrared spectroscopy has beenused for the qualitative characterization of carrageenans andhas proven to be a valuable tool for the characterizationof sulfated oligosaccharides [35] FT-IR and NMR spectraanalyses of selected SPs extracts were performed The FT-IRspectrum of Solieria filiformis extract (Figure 2(a)) indicatesthe presence of a typical 120580-carrageenan type Characteristicssignal bands are indicated 36 anhydrogalactose-2-sulfate(804 cmminus1) characteristic of 120580-carrageenan galactose-4-sulfate (846 cmminus1) signal present in 120581- and 120580-carrageenanThesignal between 1210 and 1260 cmminus1 is common to all types ofcompounds containing sulfate
BioMed Research International 5
2000 1800 1600 1400 1200 1000 800 600
1210ndash1260 804846929
D
C
B
A
1639
(cmminus1)
(a)
2000 1800 1600 1400 1200 1000 800 600
C
B
124414101627
1039ndash1041
A
(cmminus1)
(b)
Figure 2 (a) Infrared spectra of (A) Solieria filiformis aqueous extract (B) 120580-carrageenan (C) 120581-carrageenan and (D) 120582-carrageenan (b)Infrared spectra of (A) Eisenia arborea aqueous extract (B) fucoidan and (C) alginic acid
13C-NMR spectroscopy has been highly recommendedfor distinguishing the polysaccharides of the agar and car-rageenan group [36] Spectrum and expansion 13C-NMR ofthe S filiformis extract (Figure 3(a)) showed signals at 20and 60 ppm typical of residual ethanol Carbohydrates sig-nals (6379ndash10466 ppm) observed particularly two upfield-shifted signals (9451 and 10466 ppm) suggest that themolecule has two anomeric carbons Overall its spectrumshowed the presence of the 120580-carrageenan The next assign-ment is the mapping of the carbon signals of the moleculeCarbons of 2-sulfate-36-anhydrogalactose are 9451 (C1)7744 (C2) 8025 (C3) 8084 (C4) 7949 (C5) and 7233(C6) ppm [37] Carbons of 4-sulfate-galactose are 10466(C1) 7168 (C2) 7927 (C3) 7451 (C4) 7727 (C5) and 6379(C6) ppm [37] Sulfate content of S filiformis showed 2114(plusmn0056) of total sulfate and total polysaccharide determina-tion resulted in 91 of polysaccharide
The FT-IR spectrum of Eisenia arborea extract (Fig-ure 2(b)) indicates the presence of a mixture of fucoidanand alginic acid Characteristics signal bands are indicatedcarboxylate vibrations (1627 and 1410 cmminus1) can be attributedto uronic acids Stretching vibrations at 1039ndash1041 cmminus1 canbe assigned to pyranose ring from guluronic andmannuronicacid residues The broad band at 1244 cmminus1 indicates thepresence of sulfated ester groups which are characteristicin fucoidans 13C-NMR spectrum of E arborea extract(Figure 3(b)) showed typical signals of alginate ranging from6604 to 17768 ppmThe signal at 6604 ppm is characteristicof carbon-2 of guluronic acid (G) [38] The signals at 72517279 7407 7890 8082 10281 10293 and 17768 ppm corre-spond to repeating blocks of mannuronic (M) and guluronicacid [39] The signals at 10281 and 10293 ppm may indicatethe presence of two repeating units one ofMMMand anotherof GMM [39] Sulfate content of E arborea showed 1285(plusmn0346) of total sulfate
33 Combined Antiviral Effect of SPs The combined effectof SPs of Eisenia arborea and Solieria filiformis on MeVinfections was examined each SP was tested at different con-centrations combining its corresponding IC
25 IC50 and IC
75
values E25 E50 and E
75correspond to IC
25 IC50 and IC
75
values of Eisenia arborea SPs and S25 S50 and S
75correspond
to the respective values of Solieria filiformis SP (Table 2)Syncytia reduction assay results were expressed in relativesyncytia percentage according to the number of syncytia inviral control Best inhibitory effect was observed for E
50-S25
combinationThe evaluation of drug synergism based on a median-
effect equation has been extensively used in the literatureCI values of SPs combinations were calculated as describedpreviously using the CompuSyn software and are givenin Table 2 Median-effect and the normalized isobologramgenerated with the software determined the presence of threesynergistic combinations represented by points below thelines at normalized isobologram (Figure 4)
Results showed strong synergistic effects at low concen-trations combinations (E
50-S25 E25-S50 and E
25-S25) and
antagonism at high concentrations combinations (E25-S75
E50-S50 E50-S75 E75-S25 E70-S50 and E
75-S75) Combinations
with synergistic effect were selected and qPCR assays wereperformed As shown in Figure 5 the inhibitory effect ofthe synergistic combinations was confirmed These datawere consistent with results observed by syncytia reductioninhibition assays
34 Effect of SPs on Viral Infection at Different Times ofAddition In order to determine which step of the MeV cyclewas targeted by SPs ldquotime of additionrdquo experiments wereperformed in Vero cells infected withMeV and exposed to PSat different times of infectionThemost efficient inhibition byS filiformis was observed in early phases of infection 0 and
6 BioMed Research International
7
1
4
3
12
6
59
2
11
10 8
O O OO
O
OH
OH 1
234
6
5
78
10
9
12
11
TSP-d4
OSO3minus
HOCH2CH3
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
105 100 95 90 85 80 75 70 65
(ppm)
O3minusSO
10466
9451
8084
8025
7948
7927
7743
7727
7451
7233
7219
7167
6379
(a)
[MMM][GMM]
Carbonyl signalof uronic acids
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
(ppm)
TSP-d4
18783
17768
10293
10281
8082
7890
7407
7279
7251
6604
4683
(b)
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
subsequently an aliquot of 1mL of each extract was takenAnthrone reagent (5mL) was added to the aliquot placed ina water bath for 12 minutes and cooled down at room tem-perature Absorbance was read at 630 nm Quantification wasperformed against a calibration curve of a stock solution offucose
(4) Sulfate Content Determination The analysis was per-formed using the turbidimetric method of Jackson andMcCandless 1978 [32] Briefly this quantification of sulfateswas determined by measuring turbidity as barium sulfatewhen adding 12mL of TCA 8 and 06mL of 001 reactionreagent (agarosebarium chloride) to the sample reactionwas homogenized by stirring for 35 minutes The turbiditywas determined at 500 nm in a ShimadzuUV-Vis spectropho-tometer 1601 The calibration curve was performed withpotassium sulfate (K
2SO4) with a concentration of 0 to 100 120583g
of SO4
minus2mL SP extracts of Solieria filiformis and Eiseniaarboreawere weighed (7mg) and 1mL of 1N HCl was addedand heated at 105∘C for 12 hours in a thermoblock (Lab line)A dilution was performed with 10mL of deionized watersamples were then filtered using a microfilter with Whatmanpaper of 12 120583m and an aliquot of 11mL of the samples wastaken for quantificationAnalysiswas performedby triplicate
22 Cells and Virus Vero cells were grown at 37∘C in a5 CO
2atmosphere in Dulbeccorsquos Modified Eagle Medium
Nutrient Mixture F-12 (DMEMF12 Gibco Invitrogen USA)supplemented with 5 fetal bovine serum (FBS GibcoInvitrogen USA) and 1 antibiotic (Gibco Invitrogen USA)
Measles virus (Edmonston strain) was purchased fromATCC (ATCCVR-24) Virus was propagated onVero cellsand viral titers were determined by cytopathogenic effect andexpressed as 50 tissue culture infectious dose (TCID50)mL Aliquots of viral stock were stored at minus80∘C until use
23 Cytotoxicity Assays The effect of SPs on cell viabilityof Vero cells was determined by MTT assay The cells werecultured in 96-well plates at a density of 15 times 104 cellswellat 37∘C in an atmosphere of CO
2 After 1 day of incubation
increasing concentrations of SPs diluted in DMEM wereadded after 48 h of incubation the media were replaced with22120583L of 25mgmL MTT dissolved in phosphate-bufferedsaline (PBS) After 1 h 30min 150 120583L of DMSOwas added andincubated at room temperature for 15minTheoptical density(OD450 nm) was measured using a microplate reader (Mul-tiskan FCThermo USA) Cell viability was expressed by per-centage as the mean value of three independent experimentsconsidering control cells absorbance as 100viable CC
50was
the concentration of the test substances that inhibited theVero cells growth by 50 compared with the growth of theuntreated cells
24 Syncytia Reduction Assays The antiviral activity of theSPs was evaluated by syncytia reduction assays Vero cellsseeded in 12-well plates were treated with different concen-trations of SPs (001ndash5120583gmL) and infected with MeV (1 times1035 TCID50 of Edmonston strain) at the same time After
virus adsorption for 1 h at 37∘C the medium was removedand monolayers were washed with PBS after which thecorresponding concentrations of SPs were added againEach concentration was tested using three culture wellsper PS concentration per experiment the experiments wereperformed by triplicate After incubation of 48 or 72 h at37∘C in a 5 CO
2incubator monolayers were fixed with
methanol acetone (1 1) and stained with 1 crystal violetSyncytia were counted and the result was expressed as a per-centage of the number of syncytia observed in viral controlmonolayers (untreated cultures) IC
50was determined from
dose-response curves The selectivity index (SI) values werecalculated as CC
50IC50 SPs showing the best SI were selected
for the subsequent experiments
25 Quantitative Real-Time PCR Total RNA was isolatedfrom treated Vero cells using RNAzol RT (MRC IncUSA) Reverse transcription was performed using the HighCapacity cDNA Reverse Transcription Kit (Applied Biosys-tems USA) and the viral genome was amplified with spe-cific primers (MeVF 51015840 GAGGGTCAAACAGAGTCGAG 31015840MeVR 51015840 CGGTTGGAAGATGGGCAG 31015840) that amplifieda 95 nt fragment The real-time PCR was carried out usingSensiFAST SYBR No-ROX Kit (BIOLINE USA) and theChromo4 Real-Time PCR Detector (Bio-Rad USA) withthe following procedures 95∘C for 2min followed by 50cycles of 95∘C for 2 s 60∘C for 10 s and 72∘C for 20 s Thenumber of viral copies was calculated by using a standardcurve Serial 10-fold dilutions of a synthetic oligonucleotideencompassing the target measles gene were used to establishthe standard curves
26 Evaluation of SPs Synergy Potential synergistic effectsof selected SPs on MeV infection were evaluated usingsyncytia reduction assays Each combination was tested onits corresponding IC
75 IC50 and IC
25values The synergistic
effect of SPs was calculated by using a combination index(CI) described previously by Chou [33] and CompuSynsoftware CI was calculated from the data as a measure of theinteraction among drugs CI values lower than 09 indicatesynergy CI values from 09 to 11 indicate an additive effectand CI values higher than 11 indicate antagonism Combina-tions with synergistic antiviral effect were selected and qPCRassays were performed in order to confirm the inhibitoryeffect as described above
27 Time of Addition Assay Vero cell monolayers wereinfected with MeV SPs were added at a concentration of5 120583gmL at different times of infection 60min before infec-tion and 0 15 30 60 and 120min after infection Thereafterfor each treatment cells were incubated with SP for 1 h andthen washed three times with PBS Monolayers were fixedwithmethanol acetone after incubation for 48 or 72 h at 37∘Cand 5 CO
2and stained with 1 crystal violet syncytia were
counted subsequently
28 Viral PenetrationAssay Virus penetration intoVero cellswas evaluated according to the method reported by Huangand Wagner [34] with some modifications [18] Vero cell
4 BioMed Research International
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(a)
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
Concentration (120583gmL)
Syncytia reduction assayqPCR assay
(b)
Figure 1 Confirmation of antiviral activity of Eisenia arborea (a) and Solieria filiformis (b) SPs at their best inhibitory concentrations bysyncytia reduction and qPCR assays Syncytia count and viral RNA copies number are given in of the untreated control values
monolayers precooled at 4∘C for 3 h were infected with MeVat 4∘C for 1 h in the absence of SP After washing three timeswith ice-cold PBS different concentrations of SP were addedto the monolayers and the temperature was shifted to 37∘CAfter 1 h of incubation at 37∘C the cells were treated with40mM citrate buffer (pH 30) to inactivate unpenetratedviruses Buffer was replaced by culture medium and the cellswere incubated for 48 or 72 h at 37∘C and 5CO
2and stained
with 1 crystal violet syncytia were counted subsequently
29 Statistical Analysis The variables (tested by triplicate ineach experiment that were in turn repeated at least threetimes) were submitted to a one-way analysis of variancefollowed by Dunnettrsquos test (SPSS software 120572 = 005) CC
50
and IC50values were determined by probit regression analy-
sis
3 Results
31 Cytotoxicity and Antiviral Activity of SPs TheMTT assayindicated no cytotoxicity for any of the SPs at concentrationsfrom 01 to 1500 120583gmL up to 2 days (data not shown)
Antiviral activity of SPs against MeV was evaluated bysyncytia reduction inhibition assays at concentrations of 00101 1 and 5 120583gmL of each compound (data not shown)All tested compounds showed significant antiviral activitybut only compounds with the best SI values were selectedfor the subsequent experiments As shown in Table 1 SPsof Eisenia arborea and Solieria filiformis exhibited antiviralactivity at the lowest concentrations (IC
500275 120583gmL and
0985 120583gmL resp) without cytotoxic effect at concentrationsof 01 to 1500120583gmL Therefore SPs of Eisenia arborea andSolieria filiformiswere selected based on their SI and antiviralactivity for the combination experiments
Table 1 Cytotoxic effect antiviral activity and selectivity index ofSPs
Algaea CC50
(120583gmL)b IC50
(120583gmL)c SId
Macrocystis pyrifera gt1500 100 gt1500Eisenia arborea gt1500 0275 gt545454Pelvetia compressa gt1500 100 gt1500Ulva intestinalis gt1500 36 gt4167Solieria filiformis gt1500 0985 gt152284aAlgal sulfated polysaccharide extract bConcentration of test compound(120583gmL) that reduced Vero cell viability by 50 cConcentration of a testcompound that reduced the number of MeV syncytia in Vero cells by 50dSelectivity index value
Antiviral effect of selected SPs was confirmed by qPCRassays as shown in Figure 1 Inhibitory effect of Eiseniaarborea and Solieria filiformis SP was tested at the bestinhibitory concentrations (1120583gmL and 5 120583gmL for bothSPs) Results of qPCR assays were consistent with the resultsobserved by syncytia reduction inhibition assays
32 Characterization of SPs Infrared spectroscopy has beenused for the qualitative characterization of carrageenans andhas proven to be a valuable tool for the characterizationof sulfated oligosaccharides [35] FT-IR and NMR spectraanalyses of selected SPs extracts were performed The FT-IRspectrum of Solieria filiformis extract (Figure 2(a)) indicatesthe presence of a typical 120580-carrageenan type Characteristicssignal bands are indicated 36 anhydrogalactose-2-sulfate(804 cmminus1) characteristic of 120580-carrageenan galactose-4-sulfate (846 cmminus1) signal present in 120581- and 120580-carrageenanThesignal between 1210 and 1260 cmminus1 is common to all types ofcompounds containing sulfate
BioMed Research International 5
2000 1800 1600 1400 1200 1000 800 600
1210ndash1260 804846929
D
C
B
A
1639
(cmminus1)
(a)
2000 1800 1600 1400 1200 1000 800 600
C
B
124414101627
1039ndash1041
A
(cmminus1)
(b)
Figure 2 (a) Infrared spectra of (A) Solieria filiformis aqueous extract (B) 120580-carrageenan (C) 120581-carrageenan and (D) 120582-carrageenan (b)Infrared spectra of (A) Eisenia arborea aqueous extract (B) fucoidan and (C) alginic acid
13C-NMR spectroscopy has been highly recommendedfor distinguishing the polysaccharides of the agar and car-rageenan group [36] Spectrum and expansion 13C-NMR ofthe S filiformis extract (Figure 3(a)) showed signals at 20and 60 ppm typical of residual ethanol Carbohydrates sig-nals (6379ndash10466 ppm) observed particularly two upfield-shifted signals (9451 and 10466 ppm) suggest that themolecule has two anomeric carbons Overall its spectrumshowed the presence of the 120580-carrageenan The next assign-ment is the mapping of the carbon signals of the moleculeCarbons of 2-sulfate-36-anhydrogalactose are 9451 (C1)7744 (C2) 8025 (C3) 8084 (C4) 7949 (C5) and 7233(C6) ppm [37] Carbons of 4-sulfate-galactose are 10466(C1) 7168 (C2) 7927 (C3) 7451 (C4) 7727 (C5) and 6379(C6) ppm [37] Sulfate content of S filiformis showed 2114(plusmn0056) of total sulfate and total polysaccharide determina-tion resulted in 91 of polysaccharide
The FT-IR spectrum of Eisenia arborea extract (Fig-ure 2(b)) indicates the presence of a mixture of fucoidanand alginic acid Characteristics signal bands are indicatedcarboxylate vibrations (1627 and 1410 cmminus1) can be attributedto uronic acids Stretching vibrations at 1039ndash1041 cmminus1 canbe assigned to pyranose ring from guluronic andmannuronicacid residues The broad band at 1244 cmminus1 indicates thepresence of sulfated ester groups which are characteristicin fucoidans 13C-NMR spectrum of E arborea extract(Figure 3(b)) showed typical signals of alginate ranging from6604 to 17768 ppmThe signal at 6604 ppm is characteristicof carbon-2 of guluronic acid (G) [38] The signals at 72517279 7407 7890 8082 10281 10293 and 17768 ppm corre-spond to repeating blocks of mannuronic (M) and guluronicacid [39] The signals at 10281 and 10293 ppm may indicatethe presence of two repeating units one ofMMMand anotherof GMM [39] Sulfate content of E arborea showed 1285(plusmn0346) of total sulfate
33 Combined Antiviral Effect of SPs The combined effectof SPs of Eisenia arborea and Solieria filiformis on MeVinfections was examined each SP was tested at different con-centrations combining its corresponding IC
25 IC50 and IC
75
values E25 E50 and E
75correspond to IC
25 IC50 and IC
75
values of Eisenia arborea SPs and S25 S50 and S
75correspond
to the respective values of Solieria filiformis SP (Table 2)Syncytia reduction assay results were expressed in relativesyncytia percentage according to the number of syncytia inviral control Best inhibitory effect was observed for E
50-S25
combinationThe evaluation of drug synergism based on a median-
effect equation has been extensively used in the literatureCI values of SPs combinations were calculated as describedpreviously using the CompuSyn software and are givenin Table 2 Median-effect and the normalized isobologramgenerated with the software determined the presence of threesynergistic combinations represented by points below thelines at normalized isobologram (Figure 4)
Results showed strong synergistic effects at low concen-trations combinations (E
50-S25 E25-S50 and E
25-S25) and
antagonism at high concentrations combinations (E25-S75
E50-S50 E50-S75 E75-S25 E70-S50 and E
75-S75) Combinations
with synergistic effect were selected and qPCR assays wereperformed As shown in Figure 5 the inhibitory effect ofthe synergistic combinations was confirmed These datawere consistent with results observed by syncytia reductioninhibition assays
34 Effect of SPs on Viral Infection at Different Times ofAddition In order to determine which step of the MeV cyclewas targeted by SPs ldquotime of additionrdquo experiments wereperformed in Vero cells infected withMeV and exposed to PSat different times of infectionThemost efficient inhibition byS filiformis was observed in early phases of infection 0 and
6 BioMed Research International
7
1
4
3
12
6
59
2
11
10 8
O O OO
O
OH
OH 1
234
6
5
78
10
9
12
11
TSP-d4
OSO3minus
HOCH2CH3
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
105 100 95 90 85 80 75 70 65
(ppm)
O3minusSO
10466
9451
8084
8025
7948
7927
7743
7727
7451
7233
7219
7167
6379
(a)
[MMM][GMM]
Carbonyl signalof uronic acids
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
(ppm)
TSP-d4
18783
17768
10293
10281
8082
7890
7407
7279
7251
6604
4683
(b)
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Figure 1 Confirmation of antiviral activity of Eisenia arborea (a) and Solieria filiformis (b) SPs at their best inhibitory concentrations bysyncytia reduction and qPCR assays Syncytia count and viral RNA copies number are given in of the untreated control values
monolayers precooled at 4∘C for 3 h were infected with MeVat 4∘C for 1 h in the absence of SP After washing three timeswith ice-cold PBS different concentrations of SP were addedto the monolayers and the temperature was shifted to 37∘CAfter 1 h of incubation at 37∘C the cells were treated with40mM citrate buffer (pH 30) to inactivate unpenetratedviruses Buffer was replaced by culture medium and the cellswere incubated for 48 or 72 h at 37∘C and 5CO
2and stained
with 1 crystal violet syncytia were counted subsequently
29 Statistical Analysis The variables (tested by triplicate ineach experiment that were in turn repeated at least threetimes) were submitted to a one-way analysis of variancefollowed by Dunnettrsquos test (SPSS software 120572 = 005) CC
50
and IC50values were determined by probit regression analy-
sis
3 Results
31 Cytotoxicity and Antiviral Activity of SPs TheMTT assayindicated no cytotoxicity for any of the SPs at concentrationsfrom 01 to 1500 120583gmL up to 2 days (data not shown)
Antiviral activity of SPs against MeV was evaluated bysyncytia reduction inhibition assays at concentrations of 00101 1 and 5 120583gmL of each compound (data not shown)All tested compounds showed significant antiviral activitybut only compounds with the best SI values were selectedfor the subsequent experiments As shown in Table 1 SPsof Eisenia arborea and Solieria filiformis exhibited antiviralactivity at the lowest concentrations (IC
500275 120583gmL and
0985 120583gmL resp) without cytotoxic effect at concentrationsof 01 to 1500120583gmL Therefore SPs of Eisenia arborea andSolieria filiformiswere selected based on their SI and antiviralactivity for the combination experiments
Table 1 Cytotoxic effect antiviral activity and selectivity index ofSPs
Algaea CC50
(120583gmL)b IC50
(120583gmL)c SId
Macrocystis pyrifera gt1500 100 gt1500Eisenia arborea gt1500 0275 gt545454Pelvetia compressa gt1500 100 gt1500Ulva intestinalis gt1500 36 gt4167Solieria filiformis gt1500 0985 gt152284aAlgal sulfated polysaccharide extract bConcentration of test compound(120583gmL) that reduced Vero cell viability by 50 cConcentration of a testcompound that reduced the number of MeV syncytia in Vero cells by 50dSelectivity index value
Antiviral effect of selected SPs was confirmed by qPCRassays as shown in Figure 1 Inhibitory effect of Eiseniaarborea and Solieria filiformis SP was tested at the bestinhibitory concentrations (1120583gmL and 5 120583gmL for bothSPs) Results of qPCR assays were consistent with the resultsobserved by syncytia reduction inhibition assays
32 Characterization of SPs Infrared spectroscopy has beenused for the qualitative characterization of carrageenans andhas proven to be a valuable tool for the characterizationof sulfated oligosaccharides [35] FT-IR and NMR spectraanalyses of selected SPs extracts were performed The FT-IRspectrum of Solieria filiformis extract (Figure 2(a)) indicatesthe presence of a typical 120580-carrageenan type Characteristicssignal bands are indicated 36 anhydrogalactose-2-sulfate(804 cmminus1) characteristic of 120580-carrageenan galactose-4-sulfate (846 cmminus1) signal present in 120581- and 120580-carrageenanThesignal between 1210 and 1260 cmminus1 is common to all types ofcompounds containing sulfate
BioMed Research International 5
2000 1800 1600 1400 1200 1000 800 600
1210ndash1260 804846929
D
C
B
A
1639
(cmminus1)
(a)
2000 1800 1600 1400 1200 1000 800 600
C
B
124414101627
1039ndash1041
A
(cmminus1)
(b)
Figure 2 (a) Infrared spectra of (A) Solieria filiformis aqueous extract (B) 120580-carrageenan (C) 120581-carrageenan and (D) 120582-carrageenan (b)Infrared spectra of (A) Eisenia arborea aqueous extract (B) fucoidan and (C) alginic acid
13C-NMR spectroscopy has been highly recommendedfor distinguishing the polysaccharides of the agar and car-rageenan group [36] Spectrum and expansion 13C-NMR ofthe S filiformis extract (Figure 3(a)) showed signals at 20and 60 ppm typical of residual ethanol Carbohydrates sig-nals (6379ndash10466 ppm) observed particularly two upfield-shifted signals (9451 and 10466 ppm) suggest that themolecule has two anomeric carbons Overall its spectrumshowed the presence of the 120580-carrageenan The next assign-ment is the mapping of the carbon signals of the moleculeCarbons of 2-sulfate-36-anhydrogalactose are 9451 (C1)7744 (C2) 8025 (C3) 8084 (C4) 7949 (C5) and 7233(C6) ppm [37] Carbons of 4-sulfate-galactose are 10466(C1) 7168 (C2) 7927 (C3) 7451 (C4) 7727 (C5) and 6379(C6) ppm [37] Sulfate content of S filiformis showed 2114(plusmn0056) of total sulfate and total polysaccharide determina-tion resulted in 91 of polysaccharide
The FT-IR spectrum of Eisenia arborea extract (Fig-ure 2(b)) indicates the presence of a mixture of fucoidanand alginic acid Characteristics signal bands are indicatedcarboxylate vibrations (1627 and 1410 cmminus1) can be attributedto uronic acids Stretching vibrations at 1039ndash1041 cmminus1 canbe assigned to pyranose ring from guluronic andmannuronicacid residues The broad band at 1244 cmminus1 indicates thepresence of sulfated ester groups which are characteristicin fucoidans 13C-NMR spectrum of E arborea extract(Figure 3(b)) showed typical signals of alginate ranging from6604 to 17768 ppmThe signal at 6604 ppm is characteristicof carbon-2 of guluronic acid (G) [38] The signals at 72517279 7407 7890 8082 10281 10293 and 17768 ppm corre-spond to repeating blocks of mannuronic (M) and guluronicacid [39] The signals at 10281 and 10293 ppm may indicatethe presence of two repeating units one ofMMMand anotherof GMM [39] Sulfate content of E arborea showed 1285(plusmn0346) of total sulfate
33 Combined Antiviral Effect of SPs The combined effectof SPs of Eisenia arborea and Solieria filiformis on MeVinfections was examined each SP was tested at different con-centrations combining its corresponding IC
25 IC50 and IC
75
values E25 E50 and E
75correspond to IC
25 IC50 and IC
75
values of Eisenia arborea SPs and S25 S50 and S
75correspond
to the respective values of Solieria filiformis SP (Table 2)Syncytia reduction assay results were expressed in relativesyncytia percentage according to the number of syncytia inviral control Best inhibitory effect was observed for E
50-S25
combinationThe evaluation of drug synergism based on a median-
effect equation has been extensively used in the literatureCI values of SPs combinations were calculated as describedpreviously using the CompuSyn software and are givenin Table 2 Median-effect and the normalized isobologramgenerated with the software determined the presence of threesynergistic combinations represented by points below thelines at normalized isobologram (Figure 4)
Results showed strong synergistic effects at low concen-trations combinations (E
50-S25 E25-S50 and E
25-S25) and
antagonism at high concentrations combinations (E25-S75
E50-S50 E50-S75 E75-S25 E70-S50 and E
75-S75) Combinations
with synergistic effect were selected and qPCR assays wereperformed As shown in Figure 5 the inhibitory effect ofthe synergistic combinations was confirmed These datawere consistent with results observed by syncytia reductioninhibition assays
34 Effect of SPs on Viral Infection at Different Times ofAddition In order to determine which step of the MeV cyclewas targeted by SPs ldquotime of additionrdquo experiments wereperformed in Vero cells infected withMeV and exposed to PSat different times of infectionThemost efficient inhibition byS filiformis was observed in early phases of infection 0 and
6 BioMed Research International
7
1
4
3
12
6
59
2
11
10 8
O O OO
O
OH
OH 1
234
6
5
78
10
9
12
11
TSP-d4
OSO3minus
HOCH2CH3
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
105 100 95 90 85 80 75 70 65
(ppm)
O3minusSO
10466
9451
8084
8025
7948
7927
7743
7727
7451
7233
7219
7167
6379
(a)
[MMM][GMM]
Carbonyl signalof uronic acids
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
(ppm)
TSP-d4
18783
17768
10293
10281
8082
7890
7407
7279
7251
6604
4683
(b)
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Figure 2 (a) Infrared spectra of (A) Solieria filiformis aqueous extract (B) 120580-carrageenan (C) 120581-carrageenan and (D) 120582-carrageenan (b)Infrared spectra of (A) Eisenia arborea aqueous extract (B) fucoidan and (C) alginic acid
13C-NMR spectroscopy has been highly recommendedfor distinguishing the polysaccharides of the agar and car-rageenan group [36] Spectrum and expansion 13C-NMR ofthe S filiformis extract (Figure 3(a)) showed signals at 20and 60 ppm typical of residual ethanol Carbohydrates sig-nals (6379ndash10466 ppm) observed particularly two upfield-shifted signals (9451 and 10466 ppm) suggest that themolecule has two anomeric carbons Overall its spectrumshowed the presence of the 120580-carrageenan The next assign-ment is the mapping of the carbon signals of the moleculeCarbons of 2-sulfate-36-anhydrogalactose are 9451 (C1)7744 (C2) 8025 (C3) 8084 (C4) 7949 (C5) and 7233(C6) ppm [37] Carbons of 4-sulfate-galactose are 10466(C1) 7168 (C2) 7927 (C3) 7451 (C4) 7727 (C5) and 6379(C6) ppm [37] Sulfate content of S filiformis showed 2114(plusmn0056) of total sulfate and total polysaccharide determina-tion resulted in 91 of polysaccharide
The FT-IR spectrum of Eisenia arborea extract (Fig-ure 2(b)) indicates the presence of a mixture of fucoidanand alginic acid Characteristics signal bands are indicatedcarboxylate vibrations (1627 and 1410 cmminus1) can be attributedto uronic acids Stretching vibrations at 1039ndash1041 cmminus1 canbe assigned to pyranose ring from guluronic andmannuronicacid residues The broad band at 1244 cmminus1 indicates thepresence of sulfated ester groups which are characteristicin fucoidans 13C-NMR spectrum of E arborea extract(Figure 3(b)) showed typical signals of alginate ranging from6604 to 17768 ppmThe signal at 6604 ppm is characteristicof carbon-2 of guluronic acid (G) [38] The signals at 72517279 7407 7890 8082 10281 10293 and 17768 ppm corre-spond to repeating blocks of mannuronic (M) and guluronicacid [39] The signals at 10281 and 10293 ppm may indicatethe presence of two repeating units one ofMMMand anotherof GMM [39] Sulfate content of E arborea showed 1285(plusmn0346) of total sulfate
33 Combined Antiviral Effect of SPs The combined effectof SPs of Eisenia arborea and Solieria filiformis on MeVinfections was examined each SP was tested at different con-centrations combining its corresponding IC
25 IC50 and IC
75
values E25 E50 and E
75correspond to IC
25 IC50 and IC
75
values of Eisenia arborea SPs and S25 S50 and S
75correspond
to the respective values of Solieria filiformis SP (Table 2)Syncytia reduction assay results were expressed in relativesyncytia percentage according to the number of syncytia inviral control Best inhibitory effect was observed for E
50-S25
combinationThe evaluation of drug synergism based on a median-
effect equation has been extensively used in the literatureCI values of SPs combinations were calculated as describedpreviously using the CompuSyn software and are givenin Table 2 Median-effect and the normalized isobologramgenerated with the software determined the presence of threesynergistic combinations represented by points below thelines at normalized isobologram (Figure 4)
Results showed strong synergistic effects at low concen-trations combinations (E
50-S25 E25-S50 and E
25-S25) and
antagonism at high concentrations combinations (E25-S75
E50-S50 E50-S75 E75-S25 E70-S50 and E
75-S75) Combinations
with synergistic effect were selected and qPCR assays wereperformed As shown in Figure 5 the inhibitory effect ofthe synergistic combinations was confirmed These datawere consistent with results observed by syncytia reductioninhibition assays
34 Effect of SPs on Viral Infection at Different Times ofAddition In order to determine which step of the MeV cyclewas targeted by SPs ldquotime of additionrdquo experiments wereperformed in Vero cells infected withMeV and exposed to PSat different times of infectionThemost efficient inhibition byS filiformis was observed in early phases of infection 0 and
6 BioMed Research International
7
1
4
3
12
6
59
2
11
10 8
O O OO
O
OH
OH 1
234
6
5
78
10
9
12
11
TSP-d4
OSO3minus
HOCH2CH3
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
105 100 95 90 85 80 75 70 65
(ppm)
O3minusSO
10466
9451
8084
8025
7948
7927
7743
7727
7451
7233
7219
7167
6379
(a)
[MMM][GMM]
Carbonyl signalof uronic acids
250
240
230
220
210
200
190
180
170
160
150
140
130
120
110
100
90 80 70
60
50
40
30 20 10 0
minus10
minus20
(ppm)
TSP-d4
18783
17768
10293
10281
8082
7890
7407
7279
7251
6604
4683
(b)
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Figure 3 (a) Spectrum and expansion 13C-NMR of the aqueous extract of S filiformis (b) 13C-NMR spectrum of the aqueous extract of Earborea
BioMed Research International 7
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Table 2 Synergistic effects of SPs on MeV infection
Compoundscombination
Compound concentration (120583gmL) relative syncytia formation in presence ofthe different SPs combinations SD CI Description
Eisenia arborea Solieria filiformisIC75
-IC75
298 3027 345 44 1059 AntagonismIC75
-IC50
298 0985 264 56 308 AntagonismIC75
-IC25
298 0011 33 73 147 AntagonismIC50
-IC75
0275 3027 284 41 371 AntagonismIC50
-IC50
0275 0985 32 59 188 AntagonismIC50
-IC25
0275 0011 4 32 0001 SynergismIC25
-IC75
001 3027 225 66 185 AntagonismIC25
-IC50
001 0985 167 71 031 SynergismIC25
-IC25
001 0011 394 25 005 Synergism
2
minus2
minus2
2
SfEa
Comb
log (FaFu)
log (D)
(a)
1
05
00 05 1
A
B
E50-S25E25-S50E25-S25
(b)
Figure 4 Analysis of Eisenia arborea and Solieria filiformis combinations (a) Median-effect plot for combinations of Eisenia arborea andSolieria filiformis was generated with the CompuSyn software (119865
119886
affected fraction 119865119906
unaffected fraction 119863 concentration of SP used SfSolieria filiformis SP Ea Eisenia arborea SP Comb Eisenia arborea and Solieria filiformis combinations) (b) Normalized isobologram plotsfor Sf and Ea at nonconstant combination ratios For each SP different combinations of various concentrations based on IC
25
IC50
valueswere tested and combination index (CI) values were determined using the CompuSyn software CI values represented by points below thelines indicate synergy
15min after infection (Figure 6) syncytia inhibition beforeinfection and 30min after infection was not significant Earborea showed the most efficient inhibition 1 hour beforeinfection and 0 and 15min after infection At 30 60 and120min after infection a minimal syncytia inhibition by Earborea was still observed
35 Effect of Fucoidan on Viral Penetration into Host CellsViral penetration assays were performed to determinewhether entry events downstream of virus binding wereinhibited by SPs Vero cells were plated and incubated withMeV at 4∘C for 1 h to allow virus binding but prevent viral
internalization Unbound virus was inactivated and SPs(1 120583gmL or 5120583gmL) were added to the cells and incubatedat 37∘C Figure 7 shows that SP from S filiformis (5 120583gmL)significantly decreased viral infection by 58 while SPs fromE arborea (5 120583gmL) decreased viral infection only by 24when compared with the findings in infected cells in theabsence of treatment
4 Discussion
Since the first studies by Gerber in 1958 showing the inhi-bition of mumps and influenza B virus by marine algae
8 BioMed Research International
0
20
40
60
80
100
120
UntreatedConcentration (120583gmL)
Syncytia reduction assayqPCR assay
sy
ncyt
ia co
unt o
r vira
l RN
A co
pies
E50S25 E25S50 E25S25
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Figure 5 Antiviral activity confirmation by qPCR of the RNAextracted from Vero cells infected with MeV and cultivated inpresence of synergistic SPs combinations E
25
and E50
are the SPsconcentrations corresponding to IC
25
and IC50
values of Eiseniaarborea SPs S
25
and S50
concentrations correspond to the respectiveIC values of Solieria filiformis SP
0
20
40
60
80
100
120
Untreated minus60 0 15 30 60 120
sy
ncyt
ia co
unt
Time (minutes)
Solieria filiformisEisenia arborea
Figure 6 Time of addition experiments Antiviral activity of SPwas tested at different times of infection and analyzed by syncytiainhibition assays SPs were added at 60min before infection and0 15 30 60 and 120min after infection The data are expressedas relative syncytia count () compared to that of untreated virus-infected control cells which was defined as 100 The data shownare the mean plusmn SD of triplicate experiments
polysaccharides increased efforts and research have beencarried out in this field [13] Previous studies have alsodemonstrated no cytotoxicity of SPs isolated fromcertain sea-weed species [40]The absence of cytotoxicity to the host cellsis one of the principal challenges in the development of newantivirals
Eisenia arborea an edible brown alga used in folkmedicine in Japan is the kelp species with the largest andmost southerly latitudinal distribution on the North PacificEast Coast [41 42] Researches on Eisenia biological activitieshave been focused on the evaluation of their polyphenoliccompounds [43] To our knowledge the antiviral effects of
0
20
40
60
80
100
120
Untreated 1 5
sy
ncyt
ia co
unt
Concentration (120583gmL)
Solieria filiformisEisenia arborea
Figure 7 Effect of SPs on viral penetration Vero cells were infectedwith MeV at 4∘C in the absence of SPs and then shifted to 37∘Cto permit penetration of the adsorbed virus in the presence of SPsAntiviral effect of SPs was evaluated using syncytia inhibition assaysThe data shown are the mean plusmn SD of triplicate experiments
Eisenia arborea extracts have never been tested before Inthis study the extract of Eisenia arborea is rich in fucoidansand alginates and also showed the best SI of the five seaweedextracts (Table 1) Previous chemical characterization ofMexican E arborea extracts also reported the presence ofalginates with higher yields than the one reported in thisstudy [44] Alginates with antiviral effects have been previ-ously tested against HIV IAV and HBV showing a potentantiviral activity [4] Antiviral activity of fucoidan has beenalso reported in vitro and in vivo againstmanyRNA andDNAviruses such as HIV HSV1-2 dengue virus and influenzavirus [39 45ndash47]
Macrocystis pyrifera has been harvested since 1956 alongthe Pacific coast of Baja California and exported to theUnitedStates for the production of alginates [48] SPs extracts ofMexican Macrocystis pyrifera showed a significant antiviraleffect but were not selected for subsequent assays becauseof their IC
50value (Table 1) Previous studies with crude
dialyzed extracts ofMacrocystis pyrifera have shown antiviraleffects against VSV with the fucoidan being responsible forthese results [49]
In this study antiviral effects of the extract from Solieriafiliformis display the second lowest IC
50among the analyzed
extracts In vitro studies have reported antiviral properties ofcarrageenans againstDNAandRNAviruses [21 50] Recentlyit has been shown that carrageenan (Rong Yuan FFI CoLtd) can inhibit influenza virusASwineShandong7312009H1N1 (SW731) responsible for the influenza pandemic of2009 Carrageenans can significantly inhibit SW731 replica-tion by interfering with different steps of viral replicationincluding adsorption transcription and expression of theviral proteins however they act especially by inhibiting theinteractions between the viral receptor (HA) and the targetcell [51] Sulfate content analysis and total polysaccharidedetermination of S filiformis extract resulted in 2114(plusmn0056) total sulfate and 91 polysaccharide these data areconsistent with previous reports [52] Degree of sulfation hasa major impact on the antiviral activity of polysaccharidesincluding carrageenans [53]
BioMed Research International 9
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
In relation to the combination therapy approach usedin this study results showed a strong synergistic effect atlow concentrations combinations of SPs and antagonism athigh concentrations combinations Our results determinedthat low concentrations combinations (00274 120583gmL and0011 120583gmL of E arborea and S filiformis resp) exhibitedthe higher inhibitory effect (96) in comparison to the indi-vidual effect of SP (50 of inhibition with 0275120583gmL and0985 120583gmL of E arborea and S filiformis resp) Synergisticeffect observed in this study has been also reported for thesulfated polysaccharides from Fucus vesiculosus in combina-tion with AZT against HIV [54] Furthermore this effect hasbeen also observed with acyclovir in combination with 3 19-isopropylideneandrographolide against herpes simplex virus(wild type) and drug-resistant strains Low concentrationsof these compounds were required for a complete inhibitionof DNA replication and late protein synthesis of HSV-1 wildtype and drug-resistant HSV-1 [55] The combined effect ofnitazoxanidewith neuraminidase inhibitors against influenzaA viruses tested in vitro suggests that regimens that combineneuraminidase inhibitors and nitazoxanide exert synergisticanti-influenza effects [56] In contrast antagonistic effectsat high concentrations were observed in our study thisantagonism of SPs was previously observed in a combinationof ulvan and fucoidan against NDV infection [23] Partic-ular chemical features of SPs like chain ramifications couldexplain antagonism effects of SPs Moreover carbohydrate tocarbohydrate interactions could be responsible to adhesionevents these aggregates have been previously observed inmarine sponges [57]
To understand if a synergistic effect was related to differ-ent modes of action of the tested SPs viral penetration andtime of addition assays were performed Results suggestedthe possibility that SP from S filiformis inhibits postbindingevents because best inhibition effect was observed at 0 and 15minutes after viral infection (Figure 6) To support this idea aviral penetration assay was performed (Figure 7) and resultsshow the best antiviral effect after viral adsorption Ourresults are in agreement with those observed by Elizondo-Gonzalez et al [18] who demonstrated the ability of fucoidanfromC okamuranus to be responsible for the antiviral activityagainst Newcastle disease virus suggesting that fucoidaninhibits viral penetration into host cells must probably byblocking the F protein
Similar results were also observed by Bouhlal et al [58]who suggested that carrageenans can inhibit DENV repli-cation by interfering viral entrance but they also suggestedthat SPs could avoid viral adsorption into the cell as a secondmode of action This mode of action could be similar to themechanism observed with SPs of E arborea Alginates andfucoidan of E arborea were able to show the best antiviraleffect 1 hour before infection and this effect lasted up to 0ndash15minutes after infection Although both SPs from S filiformisand E arborea exhibited antiviral activity at 0 and 15minafter infection only E arborea showed inhibitory effect at60minThis result suggests the capability of these SPs to avoidviral adsorption to the cell these data were confirmed by viralpenetration assays where we observed less antiviral activityafter viral attachment to the cell More recent studies have
demonstrated that fucoidans exhibit their antiviral activitywhen the compound is present during the virus adsorptionperiod by blocking the interaction of viruses to the cells [59]
SPs tested in this study exhibit the best antiviral effectat different stages of infection viral penetration and viraladsorption (S filiformis and E arborea resp) Multiple-drugantiviral therapy with two or more drugs that target differentproteins or act in different stages of infection may decreasedrug resistance and may enhance clinical outcomes byallowing a reduction of individual drug doses thus decreas-ing dose-related drug toxicity [60]
5 Conclusions
In this study sulfated polysaccharides from Mexican sea-weed showed antiviral activity against measles virus Dueto the lack of cytotoxicity at inhibitory concentrations asindicated by the selectivity index potential application canbe found for these SPs Eisenia arborea and Solieria filiformisextracts showed the higher antiviral activity andwere selectedto determine their combined effect Synergistic effect wasobserved at the lowest concentrations tested for each SP ofthese species Results suggest that SPs combined in this studyare acting at different level of first stages in viral infectionSynergistic therapeutic effect allows dose and toxicity reduc-tion and would minimize or delay the induction of antiviralresistance Sulfated polysaccharides of Mexican seaweed arepotential candidates for the development of new antiviraldrugs that can help to control viral infection diseases
Competing Interests
The authors declare that they have no competing interests
Acknowledgments
The authors thank E Hernandez E Caamal and C Chavezfor chemical analytical support M Maldonado for polysac-charide extraction support I Beamonte R Marcos and ROjeda for seaweed collection support S Salcedo for the con-firmation of seaweeds species identification and K Ledezmafor cytotoxicity assays support This work was supported byConsejo Nacional de Ciencia y Tecnologıa (CONACYT)Mexico (Project no 10002-255075)
References
[1] R OrsquoDor P Miloslavich and K Yarincik ldquoMarine biodiversityand biogeographymdashregional comparisons of global issues anintroductionrdquo PLoS ONE vol 5 no 8 Article ID e11871 2010
[2] C Rebours E Marinho-Soriano J A Zertuche-Gonzalez et alldquoSeaweeds an opportunity forwealth and sustainable livelihoodfor coastal communitiesrdquo Journal of Applied Phycology vol 26no 5 pp 1939ndash1951 2014
[3] L Wang X Wang H Wu and R Liu ldquoOverview on biologicalactivities and molecular characteristics of sulfated polysaccha-rides from marine green algae in recent yearsrdquo Marine Drugsvol 12 no 9 pp 4984ndash5020 2014
[4] A Ahmadi S Zorofchian Moghadamtousi S Abubakar andK Zandi ldquoAntiviral potential of algae polysaccharides isolated
10 BioMed Research International
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
from marine sources a reviewrdquo BioMed Research Internationalvol 2015 Article ID 825203 10 pages 2015
[5] S Kraan ldquoAlgal polysaccharides novel applications and out-lookrdquo in CarbohydratesmdashComprehensive Studies on Glycobiol-ogy and Glycotechnology InTech 2012
[6] C M P G Dore M G D C Faustino Alves L S E PofırioWill et al ldquoA sulfated polysaccharide fucans isolated frombrown algae Sargassum vulgare with anticoagulant antithrom-botic antioxidant and anti-inflammatory effectsrdquoCarbohydratePolymers vol 91 no 1 pp 467ndash475 2013
[7] B W S Souza M A Cerqueira A I Bourbon et al ldquoChemicalcharacterization and antioxidant activity of sulfated polysaccha-ride from the red seaweed Gracilaria birdiaerdquo Food Hydrocol-loids vol 27 no 2 pp 287ndash292 2012
[8] V Suresh N Senthilkumar R Thangam et al ldquoSepara-tion purification and preliminary characterization of sulfatedpolysaccharides from Sargassum plagiophyllum and its in vitroanticancer and antioxidant activityrdquo Process Biochemistry vol48 no 2 pp 364ndash373 2013
[9] P Shao X Chen and P Sun ldquoChemical characterizationantioxidant and antitumor activity of sulfated polysaccharidefrom Sargassum hornerirdquo Carbohydrate Polymers vol 105 no1 pp 260ndash269 2014
[10] C O Coura I W F de Araujo E S O Vanderlei et alldquoAntinociceptive and anti-inflammatory activities of sulphatedpolysaccharides from the red seaweed Gracilaria corneardquo Basicand Clinical Pharmacology and Toxicology vol 110 no 4 pp335ndash341 2012
[11] C A Pujol S Ray B Ray and E B Damonte ldquoAntiviral activityagainst dengue virus of diverse classes of algal sulfated polysac-charidesrdquo International Journal of Biological Macromoleculesvol 51 no 4 pp 412ndash416 2012
[12] H H A Gomaa and G A Elshoubaky ldquoAntiviral activity ofsulfated polysaccharides carrageenan from some marine sea-weedsrdquo International Journal of Current Pharmaceutical Reviewand Research vol 7 no 1 pp 34ndash42 2016
[13] P Gerber J D Dutcher E V Adams and J H Sherman ldquoPro-tective effect of seaweed extracts for chicken embryos infectedwith influenza B or mumps virusrdquo Experimental Biology andMedicine vol 99 no 3 pp 590ndash593 1958
[14] M F De Jesus Raposo A M B De Morais and R M S CDe Morais ldquoMarine polysaccharides from algae with potentialbiomedical applicationsrdquoMarine Drugs vol 13 no 5 pp 2967ndash3028 2015
[15] S F Mohamed and F A Agili ldquoAntiviral sulphated polysac-charide from brown algae Padina pavonia characterizationand structure elucidationrdquo International Journal of ChemTechResearch vol 5 no 4 pp 1469ndash1476 2013
[16] T T T Thuy B M Ly T T T Van et al ldquoAnti-HIV activityof fucoidans from three brown seaweed speciesrdquo CarbohydratePolymers vol 115 pp 122ndash128 2015
[17] M Kim J H Yim S-Y Kim et al ldquoIn vitro inhibitionof influenza A virus infection by marine microalga-derivedsulfated polysaccharide p-KG03rdquoAntiviral Research vol 93 no2 pp 253ndash259 2012
[18] R Elizondo-Gonzalez L E Cruz-Suarez D Ricque-MarieE Mendoza-Gamboa C Rodriguez-Padilla and L M Trejo-Avila ldquoIn vitro characterization of the antiviral activity offucoidan from Cladosiphon okamuranus against NewcastleDisease Virusrdquo Virology Journal vol 9 no 1 article 307 2012
[19] L M Trejo-Avila M E Morales-Martınez D Ricque-Marie etal ldquoIn vitro anti-canine distemper virus activity of fucoidan
extracted from the brown algaCladosiphon okamuranusrdquoVirus-Disease vol 25 no 4 pp 474ndash480 2014
[20] G Meiyu L Fuchuan X Xianliang L Jing Y Zuowei andG Huashi ldquoThe potential molecular targets of marine sulfatedpolymannuroguluronate interfering with HIV-1 entry interac-tion between SPMG and HIV-1 rgp120 and CD4 moleculerdquoAntiviral Research vol 59 no 2 pp 127ndash135 2003
[21] C B Buck C D Thompson J N Roberts M Muller D RLowy and J T Schiller ldquoCarrageenan is a potent inhibitorof papillomavirus infectionrdquo PLoS Pathogens vol 2 no 7 pp0671ndash0680 2006
[22] A Rodrıguez K Kleinbeck O Mizenina et al ldquoIn vitro andin vivo evaluation of two carrageenan-based formulations toprevent HPV acquisitionrdquo Antiviral Research vol 108 no 1 pp88ndash93 2014
[23] J A Aguilar-Briseno L E Cruz-Suarez J-F Sassi et al ldquoSul-phated polysaccharides from Ulva clathrata and Cladosiphonokamuranus seaweeds both inhibit viral attachmententry andcell-cell fusion in NDV infectionrdquoMarine Drugs vol 13 no 2pp 697ndash712 2015
[24] Y Koizumi and S Iwami ldquoMathematical modeling of multi-drugs therapy a challenge for determining the optimal com-binations of antiviral drugsrdquo Theoretical Biology amp MedicalModelling vol 11 p 41 2014
[25] W J Moss and D E Griffin ldquoMeaslesrdquoThe Lancet vol 379 no9811 pp 153ndash164 2012
[26] W J Moss and D E Griffin ldquoGlobal measles eliminationrdquoNature Reviews Microbiology vol 4 no 12 pp 900ndash908 2006
[27] G Antonelli and O Turriziani ldquoAntiviral therapy old andcurrent issuesrdquo International Journal of Antimicrobial Agentsvol 40 no 2 pp 95ndash102 2012
[28] D Robledo and Y Freile-Pelegrın ldquoProspects for the cultiva-tion of economically important carrageenophytes in SoutheastMexicordquo Journal of Applied Phycology vol 23 no 3 pp 415ndash4192011
[29] J Xi D Shen S Zhao B Lu Y Li and R Zhang ldquoCharac-terization of polyphenols from green tea leaves using a highhydrostatic pressure extractionrdquo International Journal of Phar-maceutics vol 382 no 1-2 pp 139ndash143 2009
[30] M Tako E Yoza and S Tohma ldquoChemical characterizationof acetyl fucoidan and alginate from commercially culturedCladosiphon okamuranusrdquo Botanica Marina vol 43 no 4 pp393ndash398 2000
[31] M T Ale J DMikkelsen andA SMeyer ldquoDesigned optimiza-tion of a single-step extraction of fucose-containing sulfatedpolysaccharides from Sargassum sprdquo Journal of Applied Phycol-ogy vol 24 no 4 pp 715ndash723 2012
[32] S G Jackson and E L McCandless ldquoSimple rapid tur-bidometric determination of inorganic sulfate andor proteinrdquoAnalytical Biochemistry vol 90 no 2 pp 802ndash808 1978
[33] T-C Chou ldquoTheoretical basis experimental design and com-puterized simulation of synergism and antagonism in drugcombination studiesrdquo Pharmacological Reviews vol 58 no 3pp 621ndash681 2006
[34] A S Huang and R R Wagner ldquoPenetration of herpes simplexvirus into human epidermoid cellsrdquo Proceedings of the Societyfor Experimental Biology and Medicine vol 116 no 4 pp 863ndash869 1964
[35] P Volery R Besson and C Schaffer-Lequart ldquoCharacterizationof commercial carrageenans by Fourier transform infraredspectroscopy using single-reflection attenuated total reflectionrdquo
BioMed Research International 11
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010
Journal of Agricultural and Food Chemistry vol 52 no 25 pp7457ndash7463 2004
[36] V L Campo D F Kawano D B da Silva Jr and I CarvalholdquoCarrageenans biological properties chemical modificationsand structural analysismdasha reviewrdquo Carbohydrate Polymers vol77 no 2 pp 167ndash180 2009
[37] F Van De Velde L Pereira and H S Rollema ldquoThe revisedNMR chemical shift data of carrageenansrdquo CarbohydrateResearch vol 339 no 13 pp 2309ndash2313 2004
[38] D D McIntyre H Ceri and H J Vogel ldquoNuclear magneticresonance studies of the heteropolysaccharides alginate Gumarabic and gum xanthanrdquo Starch vol 48 no 7-8 pp 285ndash2911996
[39] H Grasdalen B Larsen and O Smisrod ldquo 13C-nmr studiesof monomeric composition and sequence in alginaterdquo Carbo-hydrate Research vol 89 no 2 pp 179ndash191 1981
[40] S Dinesh T Menon L E Hanna V Suresh M Sathuvan andM Manikannan ldquoIn vitro anti-HIV-1 activity of fucoidan fromSargassum swartziirdquo International Journal of Biological Macro-molecules vol 82 pp 83ndash88 2016
[41] Y Sugiura K Matsuda Y Yamada et al ldquoAnti-allergicphlorotannins from the edible brown alga Eisenia arboreardquoFood Science and Technology Research vol 13 no 1 pp 54ndash602007
[42] J A Zertuche-Gonzalez M Sanchez-Barredo J M Guzman-Calderon and Z Altamirano-Gomez ldquoEisenia arborea JEAreschoug as abalone diet on an IMTA farm in Baja CaliforniaMexicordquo Journal of Applied Phycology vol 26 no 2 pp 957ndash960 2014
[43] Q-T Le Y Li Z-J Qian M-M Kim and S-K Kim ldquoInhib-itory effects of polyphenols isolated from marine alga Eckloniacava on histamine releaserdquo Process Biochemistry vol 44 no 2pp 168ndash176 2009
[44] D L Arvizu Y E Rodrıguez G Hernandez and J I MurilloldquoChemical constituents of Eisenia arboreaAreschoug from BajaCalifornia Sur Mexicordquo Investigaciones Marinas vol 35 no 2pp 63ndash69 2007
[45] K I P J Hidari N Takahashi M Arihara M Nagaoka KMorita and T Suzuki ldquoStructure and anti-dengue virus activityof sulfated polysaccharide from amarine algardquo Biochemical andBiophysical Research Communications vol 376 no 1 pp 91ndash952008
[46] K Hayashi T Nakano M Hashimoto K Kanekiyo and THayashi ldquoDefensive effects of a fucoidan from brown algaUndaria pinnatifida against herpes simplex virus infectionrdquoInternational Immunopharmacology vol 8 no 1 pp 109ndash1162008
[47] KHayashi J-B Lee T Nakano andTHayashi ldquoAnti-influenzaA virus characteristics of a fucoidan from sporophyll ofUndariapinnatifida in mice with normal and compromised immunityrdquoMicrobes and Infection vol 15 no 4 pp 302ndash309 2013
[48] M C Valdez E S Zaragoza D L Belda R Marcos and R ARamırez ldquoEffect of climatic change on the harvest of the kelpMacrocystis Pyrifera on the Mexican Pacific coastrdquo Bulletin ofMarine Science vol 73 no 3 pp 545ndash556 2003
[49] A M S Mayer A Diaz A Pesce M Criscuolo J F Groismanand R M de Lederkremer ldquoBiological activity in Macrocystispyrifera from Argentina sodium alginate fucoidan and lami-naran III Antiviral activityrdquo Hydrobiologia vol 151-152 no 1pp 497ndash500 1987
[50] Z Luo D Tian M Zhou et al ldquo120582-Carrageenan P32 is a potentinhibitor of rabies virus infectionrdquo PLoS ONE vol 10 no 10Article ID e0140586 2015
[51] Q Shao Q Guo W P Xu Z Li and T T Zhao ldquoSpecificinhibitory effect of 120581-carrageenan polysaccharide on swinepandemic 2009 H1N1 influenza virusrdquo PLoS ONE vol 10 no 5Article ID e0126577 2015
[52] I W F De Araujo E D S O Vanderlei J A G Rodrigueset al ldquoEffects of a sulfated polysaccharide isolated from thered seaweed Solieria filiformis on models of nociception andinflammationrdquo Carbohydrate Polymers vol 86 no 3 pp 1207ndash1215 2011
[53] T Ghosh K Chattopadhyay M Marschall P Karmakar PMandal and B Ray ldquoFocus on antivirally active sulfatedpolysaccharides from structure-activity analysis to clinicalevaluationrdquo Glycobiology vol 19 no 1 pp 2ndash15 2009
[54] I Sugawara W Itoh S Kimura S Mori and K ShimadaldquoFurther characterization of sulfated homopolysaccharides asanti-HIV agentsrdquo Experientia vol 45 no 10 pp 996ndash998 1989
[55] T Priengprom T Ekalaksananan B Kongyingyoes S Sueb-sasana C Aromdee and C Pientong ldquoSynergistic effects ofacyclovir and 3 19- isopropylideneandrographolide on herpessimplex virus wild types and drug-resistant strainsrdquo BMCComplementary and Alternative Medicine vol 15 no 1 article56 2015
[56] G Belardo O Cenciarelli S La Frazia J F Rossignol andM G Santoroa ldquoSynergistic effect of nitazoxanide with neu-raminidase inhibitors against influenza A viruses in vitrordquoAntimicrobial Agents and Chemotherapy vol 59 no 2 pp 1061ndash1069 2015
[57] E Vilanova C C Coutinho and P A S Mourao ldquoSulfatedpolysaccharides from marine sponges (Porifera) an ancestorcell-cell adhesion event based on the carbohydrate-carbohy-drate interactionrdquoGlycobiology vol 19 no 8 pp 860ndash867 2009
[58] R Bouhlal C Haslin J-C Chermann et al ldquoAntiviral activ-ities of sulfated polysaccharides isolated from Sphaerococcuscoronopifolius (Rhodophytha Gigartinales) and Boergeseniellathuyoides (Rhodophyta Ceramiales)rdquo Marine Drugs vol 9 no7 pp 1187ndash1209 2011
[59] N N Besednova I D Makarenkova T N Zvyagintseva T IImbs L M Somova and T S Zaporozhets ldquoAntiviral activityand pathogenetic targets for seaweed sulfated polysaccharidesin herpesvirus infectionsrdquo Biochemistry (Moscow) SupplementSeries B Biomedical Chemistry vol 10 no 1 pp 31ndash42 2016
[60] E A Govorkova and R G Webster ldquoCombination chemother-apy for influenzardquo Viruses vol 2 no 8 pp 1510ndash1529 2010