Research Article Correlation of Serum Soluble Interleukin-7 …downloads.hindawi.com/journals/ad/2016/8252605.pdf · 2019-07-30 · Research Article Correlation of Serum Soluble Interleukin-7

Research ArticleCorrelation of Serum Soluble Interleukin-7Receptor and Anti-C1q Antibody in Patients withSystemic Lupus Erythematosus

Shuhong Chi1 Jing Xue2 Feng Li3 Caixia Zhu1 Yunxia Yu1 Haibo Li1 Xuemei Wang1

Yurong Zhang3 Jijuan Yang1 Shaolan Zhou1 Lijuan Yang1 Chen Ji1 and Xiaoming Liu4

1Department of Rheumatology General Hospital of Ningxia Medical University Yinchuan Ningxia 750004 China2College of Life Science Ningxia University Yinchuan Ningxia 750021 China3The Center of Laboratory Medicine General Hospital of Ningxia Medical University Yinchuan 750004 China4Institute of Human Stem Cell Research at General Hospital of Ningxia Medical University YinchuanNingxia 750004 China

Correspondence should be addressed to Xiaoming Liu erc1080163com

Received 17 January 2016 Accepted 15 February 2016

Academic Editor Ricard Cervera

Copyright copy 2016 Shuhong Chi et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Background Serum concentrations of soluble interleukin-7 receptor (sIL-7R) and anti-C1q antibody have recently been identified asunique serologicalmarkers for lupus nephritis (LN) in patients with systemic lupus erythematosus (SLE) In this study we evaluatedthe correlation of serum sIL-7R and anti-C1q in SLE patients Methods Sera from 134 patients with SLE and 84 healthy cohortswere tested for levels of sIL-7R and anti-C1q antibodies in terms of ELISA Correlations of the sIL-7R and anti-C1q autoantibodieswere evaluated Results The serum concentrations of sIL-7R and anti-C1q antibodies were significantly higher in SLE patientsand LN patients in comparison with healthy individualscontrols and SLE patients with non-LN respectively In addition bothsIL-7R and anti-C1q concentrations were found to significantly correlate with the SLE disease activity as evaluated by SLEDAIscores Interestingly the serum sIL-7R concentration was strongly correlated with the level of anti-C1q antibodies (119903 = 02871119901 = 00008) but not statistically correlated with other serological markers including the anti-dsDNA and complements C3 andC4 concentrations in SLE patients Conclusion Both serum sIL-7R and anti-C1q antibodies were strongly associated with diseaseactivity and LN in SLE patients suggesting that they may be reliable serological markers for identification of SLE patients withactive diseases and LN

1 Introduction

Systemic lupus erythematosus (SLE) is a chronic autoimmunedisease that is able to affect multiple systems and majororgans among which lupus nephritis (LN) is one of the mostcommonmajor organmanifestations and a main cause of themorbidity and mortality of the disease [1] An involvementof renal disease activity is thus one of the most importantprognostic factors for SLE patients and an identification ofLN in SLE patients has an important clinical implicationin guiding treatments for SLE in a clinical setting [2]Owing to the serological hallmark of aberrant production

of a broad heterogenous group of autoantibodies in SLEpatients an evaluation of clinical relevance of these profilesof autoantibodies and disease parameters thus has aided inidentifying SLE patients at risk for specific complications atan early stage and enabling clinicians to initiate an effectivetherapeutic strategy and possibly decrease the morbidity andmortality for SLE patients [1ndash4]

There are more than 180 autoantibodies that have beenreported in SLE patients among which antibodies (autoan-tibodies) against complement C1q (anti-C1q) and nuclear(antinuclear antibodies ANA) and double-strandDNA (anti-dsDNA) spurred the most interests in clinical settings [5] In

Hindawi Publishing CorporationAutoimmune DiseasesVolume 2016 Article ID 8252605 11 pageshttpdxdoiorg10115520168252605

2 Autoimmune Diseases

this respect anti-dsDNA and anti-C1q antibodies exhibited astronger association with clinical features of active SLE par-ticularly with the renal disease activity than other serologicalantibodies indicating an important value of measuring theseautoantibodies in SLE patients [4 6] Indeed SLE patientswith both anti-dsDNA and anti-C1q antibodies often had amanifestation of renal disease and poor renal outcome andan increased serum concentration of anti-C1q antibodies isoften accompanied with a decreased serum level of comple-ment C1q in patients with active LN [7 8] Serum anti-C1qantibodies are thus considered as a biomarker for predictionof renal flares in SLE and have been extensively studied [67 9ndash15] Of note in addition to the increased concentrationof anti-C1q antibodies serum levels of complements C1q C3and C4 are often decreased in SLE patients [16] Thereforecombinations of serum levels of C1q C3 and C4 andor theautoantibodies to C1q dsDNA and chromatinnucleosomehave been evaluated as important immunologicalmarkers fordiagnosis of SLE particularly for LN disease [6 8 10ndash12 16ndash18]

In general SLE is recognized as a disease that is primarilyattributed to autoantibodies and immune complex deposi-tion However mounting evidence has recently suggestedthat cytokines are also involved in the pathogenesis of SLE[1 19] Cytokines are important soluble mediators of inter-cellular communication and orchestrate the interaction ofimmune cells during immune responses which play crucialroles in the differentiation maturation and activation ofvarious immune cells With respect to SLE cytokines are keyplayers of general immune dysregulation not only in SLEpathogenesis but also in the local inflammatory responsesthat ultimately lead to tissue injury and organ damage [1 19]Therefore cytokines may serve as predictive biomarkers forSLE diagnosis and prognosis as well as therapeutic targetsfor disease treatments [20 21] Several cytokines have beeninvestigated as biomarkers of SLE manifestations includingthe LN among which the interleukin-7 (IL-7)IL-7 receptor(IL-7R) signaling recently received an increased attentionowing to its strong association with the activity of LN of SLEpatients [22ndash26]

IL-7 has been demonstrated to play a fundamental rolein T-cell development homeostasis and immune tolerance[27] Under physiological conditions IL-7 is controlled in alimited resource since tonic IL-7 signals can be continuouslydelivered to T-cells and provides continuous survival signalsto naıve T-cells This differs from activation cytokines ofwhich the cytokine production and receptor expression onlymediate transient effects following immune activation [2829] Therefore a reduced IL-7 consumption in lymphopenichosts sequentially leads to an elevated IL-7 level which inturn enhances proliferative responses to weak self-antigensand results in a homeostatic proliferation [30] Severallines of study have recently demonstrated that an increasedlevel of soluble IL-7R (sIL-7R) had clinical implications inautoimmune diseases including rheumatoid arthritis (RA)multiple sclerosis (MS) and SLE [26 31ndash33] In this contextthe circulating sIL-7R binds to IL-7 and competes withthe cell-associated IL-7R complex to reduce excessive IL-7signaling consequently leads to a deceased consumption of

IL-7 and enhances an overall IL-7 bioavailability since IL-7 is a limited resource whose level is regulated primarily viareceptor-mediated clearance In addition sIL-7R is also ableto modulate the quality of the IL-7 signal to decrease theinduction of negative regulator [24]

With respect to SLE involvements of IL-7 and sIL-7R inits disease progression were evidenced by studies of geneticassociation and assessment of plasma sIL-7R concentration[23 24 26 34] Polymorphic analysis identified several IL-7Rsingle nucleotide polymorphisms (SNPs) that were associatedwith the susceptibility to SLE andor LN in SLE patients[24 34] For example Wang et al recently examined an asso-ciation of IL-7R SNP rs6897932 (CT) with the susceptibilityto SLE and found that the major allele C of this SNP wasassociated with increased SLE risk in Chinese populationsalthough no significant association of the SNP and thepresence of 11 subphenotypes including the LN was estab-lished [34] In another study Lundstrom et al measured theplasma sIL-7R120572 concentrations between multiple sclerosis(MS) patients with IL-7RlowastCC (autoimmune-predisposing)and IL-7RlowastTT (autoimmune protective) genotypes and theyfound about 3-fold higher sIL-7R120572 in MS patients harboringIL-7RlowastCC gene relative to those who had an IL-7RlowastTTgenotype [24] Indeed several lines of study have recentlysuggested that an elevated level of plasma sIL-7R in SLEpatients was correlated with or predicted the occurrenceof an SLE nephritis flare indicating that the serum sIL-7R concentration may be a potential biomarker with highsensitivity and specificity for diagnosis of SLE patients withLN [25 26 35]

A compelling body of evidence has shown that a combi-nation of anti-C1q anti-dsDNA andor nucleosome antibod-ies was strongly correlated with renal diseases and could beused for prognosis of patients with LN [6 8 11] Furthermoreanti-C1q antibodies have been suggested to be more stronglycorrelated with renal flares compared to other serologicalmarkers [36] and patients free of anti-C1q antibodies areless likely to have active renal diseases [6 10 11 37] Giventhe fact that both serum anti-C1q and sIL-7R were stronglyassociated with SLE disease activity and LN this may implya correlation between the anti-C1q and sIL-7R which may bea valuable diagnostic and prognostic marker for SLE and LNTherefore there is a need to further evaluate the correlationof anti-C1q and sIL-7R levels in sera of SLE patients inclinical settings The objective of present report was firstto determine associations of serum concentrations of anti-C1q antibodies and sIL-7R with LN and further evaluated acorrelation between serum anti-C1q antibodies and sIL-7Rof 134 SLE patients in a single center Our results showeda strong association of serum anti-C1q or sIL-7R with renaldisease activity in SLE patients and these two serologicalmarkers also had a strong correlation in SLE patients with LN

2 Materials and Methods

21 Ethics Statement Human blood samples were collectedwith a protocol approved by the Ethic Committee for theConduct of Human Research at Ningxia Medical University(NXMU-E2012-102p) Written consent was obtained from

Autoimmune Diseases 3

Table 1 Demographics of patients with systemic lupus erythematosus (SLE) (119873 = 134)

Demographics LN SLE Non-LN SLE 119901

Patient number () 58134 (4328) 76134 (5672) NAAge (mean plusmn SEM) (range years) 3734 plusmn 155 (18ndash65) 3927 plusmn 159 (12ndash68) 02359Gender (malefemale) ( female) 652 (8966) 1066 (8684) NADisease duration (mean plusmn SD) (range years) 623 plusmn 056 (05ndash20) 530 plusmn 079 (02ndash18) 03768SLEDAI score (range) 1405 plusmn 097 (0ndash36) 662 plusmn 052 (0ndash18) lt00001lowastlowastlowast

ACL Ab (+) number () 4258 (7241) 4876 (6318) NAAnti-C1q (+) number () 4958 (8448) 3176 (4079) NAAnti-C1q (AUmL) 7863 plusmn 1687 2688 plusmn 9236 lt00001lowastlowastlowast

Anti-dsDNA (+) number () 5858 (100) 7676 (100) NAAnti-dsDNA (IUmL) 6763 plusmn 1170 4833 plusmn 7721 01554ANA (+) number () 5758 (9828) 7376 (9605) NAANA titer 3038 plusmn 4662 2499 plusmn 3765 03553Anti-Rib-P (+) number () 1258 (2069) 1276 (1579) NAAnti-Smith (Sm) (+) number () 1858 (3103) 1576 (1974) NAAnti-SSA Ab (+) number () 2858 (4828) 2776 (3553) NAAnti-SSB Ab (+) number () 1558 (2586) 1076 (1316) NApANCA (+) number () 1658 (2759) 1776 (3036) NAcANCA (+) number () 158 (172) 076 (000) NAC3 (120583gmL) 05091 plusmn 00340 06680 plusmn 003485 00018lowast

C4 (120583gmL) 008557 plusmn 00082 01145 plusmn 00112 00508Ab antibody ACL anticardiolipin ANA antinuclear antibody cANCA cytoplasmic antineutrophil cytoplasmic antibody LN lupus nephritis pANCAperinuclear antineutrophil cytoplasmic antibody Rib-P ribosomal P-proteins RNP ribonucleoprotein SSA Sjogrenrsquos syndrome A SSB anti-Sjogrenrsquossyndrome Blowastlowastlowast119901 lt 00001 and lowast119901 lt 001

every individual according to the Ethic Committee for theConduct of Human Research protocol For the participantsyounger than 18 years written inform consents were obtainedfrom their guardians or parents on behalf of the children Allparticipants were provided a written informed consent forthe publication of the data The PI of this study maintainshuman research records including signed and dated consentdocuments for ten (10) years after the age of majority TheEthic Committee the Conduct of HumanResearch at NingxiaMedical University approved the consent procedure for thisstudy (NXMU-2012-102e)

22 Blood Samples Blood samples of 134 consecutive SLEpatient samples (118 females and 16 males) were collectedfrom the outpatient rheumatology clinics of the General Hos-pital of NingxiaMedical University from January 2014 to June2015 The mean plusmn SEM age for the SLE patients at the time ofthe sample drawnwas 3841plusmn114 years (range 12 to 68) withan average duration of diseases of 587plusmn084 (02 to 20 years)The American College of Rheumatology (ACR) criteria wereused to diagnose a patient with SLE [38 39] and the diseaseactivity was defined according to SLE Disease Activity Index(SLEDAI) criteria [40 41] A patient with SLEDAI ge10was defined as active SLE Renal involvement was definedbased on clinical and laboratory manifestations An activeLN was defined as urine protein excretion ge500mgday orcellular casts [38] Sera of 84 gender and age-matched healthyindividuals (6 males and 78 females) were also collectedThese healthy control cohorts were recruited from thosewho had undergone comprehensive medical screening at theGeneral Hospital of Ningxia Medical University and who

had no history of chronic diseases and no family historyof autoimmune diseases The demographics of individualsinvolved in this study were outlined in Table 1 All serawere treated with heparin and frozen in 100 120583L aliquots atminus80∘Cuntil being analyzedTherewas no genetic relationshipamong these individuals All the samples were collectedunder an informed consent

23 Detection of Anti-C1q IgG Autoantibodies The concen-tration of serum anti-C1q antibody was measured by anenzyme-linked immunosorbent assay (ELISA) using com-mercially available kits according to the manufacturerrsquosinstruction (INOVA Diagnostics Inc San Diego CA USA)as previously described in our lab [6] Briefly sera werediluted 1100 and then added into each well the wells werewashed with high ionic strength buffer after being incubatedat room temperature for 1 h Then horseradish peroxidasecoupled to anti-human IgG conjugate supplied with the kitwas used as the secondary antibody After 30min incubationthe wells were extensively washed for three times followedby the addition of 100 120583L trimethylbenzene solution andincubation for 30min before 100120583L of stopping solution wasadded into each well The optical density was then measuredat 450 nm The absorbance (OD

450 nm) was then convertedinto a concentration through standard curve with a cutoffvalue of 10AUmL (determined by the manufacturer) Thecutoff values of anti-C1q in this study were lt10 AUmL andge10 AUmL was considered as positive as suggested by themanufacturer Other laboratory data including serum levelsof complementC3C4 andhemoglobin antinuclear antibod-ies (ANA) anti-dsDNA antibodies antiribonucleoprotein

4 Autoimmune Diseases

perinuclear antineutrophil cytoplasmic antibody (pANCA)antibodies to Sjogrenrsquos syndrome A (SSA) and B (SSB) andanti-Smith (Sm) were also recorded respectively (Table 1)

24 ELISA for sIL-7R Serum sIL-7R concentration wasdetermined using a biotin-avidin sandwich ELISA kit ofhuman IL-7R according to the manufacturerrsquos instruction(Elabscience Biotech Wuhan China) In this kit the firstanti-IL-7R antibody served as the capture antibody the sIL-7R was detected with a biotinylated anti-IL-7R antibodygenerated in species other than that for producing the IL-7Rcapture antibody Streptavidin-HRPwas applied to determinethe abundance of antigen-antibody binding as previouslyreported [33]

25 RNA Isolation and Real-Time Quantitative RT-PCR Thetotal RNA of peripheral blood mononuclear cells (PBMCs)was purified from whole blood using EasyPure Blood RNAkit permanufacturerrsquos instruction (Transgen Biotech BeijingChina) The quality of RNA was assayed by calculation ofthe RNA integrity number (RIN) High quality RNA (RINvalue was greater than 90) was used for reverse transcriptionof first-strand cDNA synthesis by reverse transcription usingM-MLV reverse transcriptase (TaKaRa Dalian China) Thequantitative real-time RT-PCR (qRT-PCR) was performed inthe Roche Lightcycler 20 using TaKaRa SYBR Green I kit(Takara Dalian China) the thermal cycling condition forPCR amplification was 95∘C for 30 sec 40 cycles of 95∘C for5 sec 60∘C for 20 sec and 72∘C for 20 sec followed by 40∘Cfor 20min The sequences of primer sets used for internalcontrol 120573-actin and sIL-7R cDNA amplification were as fol-lows 120573-actin forward 51015840AGCGAGCATCCCCAAAGTT31015840and reverse 51015840GGGCACGAAGGCTCATCATT31015840 sIL-7Rforward 51015840GGATGTAGTCATCACTCCCAGAAAG31015840 andreverse 51015840GGACCTGGAAGAGGAGAGAATA31015840 [26] Aninternal control was always included to normalize each reac-tion with respect to RNA integrity sample loading and inter-PCR variations The relative expression ratio was calculatedfrom the real-time PCR efficiencies and the crossing pointdeviation of sIL-7R gene against 120573-actin gene The specificityof PCR was determined by sequencing of the PCR products

26 Statistical Analysis All laboratory data were entered intoand extracted from PRISM (version 5) (GraphPad SoftwareLa Jolla CA USA) andor SPSS for Windows (version 170)(SPSS Inc Chicago IL USA) Statistical evaluation of thedata was performed by a t-test for comparison of differencesbetween the two groups The association between qualitativevariables was evaluated by Spearman correlation Data waspresented as the mean plusmn standard error of mean (SEM) A 119901value of less than 005 was considered statistically significantlowast

119901 lt 005 lowastlowast119901 lt 001 and lowastlowastlowast119901 lt 00001 (NS no statisticaldifference)

3 Results

31 SLE Demographics Data The unselected SLE populationstudied in this study included 118 s (8676) females and 16

(1324) males with a mean age of 3841 plusmn 114 years (range12 to 68) and the average duration of diseases was 587plusmn084(02 to 20 years) The mean of SLEDAI score of SLE was980 plusmn 065 (range 0 to 36) The data of demographics andother clinical parameters of SLE patients with LN and non-LN were presented in Table 1

32 Serum Levels of sIL-7R and Anti-C1q Antibodies in SLEPatients Mounting evidence has revealed increased concen-trations of sIL-7R and anti-C1q antibodies in sera of SLEpatients which were strongly associated with the diseaseactivity of SLE and LN [6 26 35] In line with these findingsan elevated sIL-7R was also determined in SLE patients withLN as compared to non-LN SLE patients (3529 plusmn 15 ngmLversus 277 plusmn 10 ngmL 119901 lt 00001) and healthy cohorts(3529 plusmn 15 ngmL versus 2269 plusmn 10 ngmL 119901 lt 00001)(Figure 1(a)) The serum concentration of sIL-7R in non-LN SLE patients was also higher in comparison with that inhealthy controls (277 plusmn 10 ngmL versus 2269 plusmn 10 ngmL119901 lt 00007) (Figure 1(a)) Interestingly the abundance ofsIL-7R transcript of PBMCs exhibited no statistical differencebetween these groups (Figure 1(b)) which was in agreementwith the finding reported by Badot et al [26] Consistentwith our previous findings [6] the SLEDAI scores andconcentration of anti-C1q were greater in LN SLE patientsthan those in non-LN SLE patients and healthy individuals(Figure 2) The average SLEDAI scores in SLE patients withLN versus SLE patients without LN were (1405 plusmn 097 versus662 plusmn 052 119901 lt 00001) (Figure 2(a) and Table 1) Thetiter of anti-C1q antibody in SLE patients with LN versusSLE patients without LN was 1071 plusmn 1163AUmL versus4918 plusmn 736AUmL 119901 lt 00001 in SLE patients withoutLN versus healthy individuals was 4918plusmn736AUmL versus5705 plusmn 173AUmL 119901 lt 00001 and in SLE patients withLN versus healthy cohorts was 1071 plusmn 1163AUmL versus5705 plusmn 173AUmL 119901 lt 00001 (Figure 2(b) and Table 1)

33 Serum Levels of Complements C3 and C4 Anti-dsDNAand Antinuclear Antibody in SLE Patients Serum concen-trations of complements C3 and C4 were lower in patientswith LN as compared with those without LN disease (Figures3(a) and 3(b) Table 1) The C3 concentrations between SLEpatients with LN and without LNwere 051plusmn003 120583gmL and069plusmn004 120583gmL respectively (119901 = 00018) (Figure 3(a)) theC4 concentrations between SLE patients with LN andwithoutLN were 0086 plusmn 001 120583gmL and 0115 plusmn 001 120583gmL respec-tively (119901 = 00508) (Figure 3(b)) Antibodies to ds-DNAand antinuclear antibody (ANA) were the most prevalentautoantibodies observed in these SLE cohorts as determinedby ELISA which were detected in 100 (134134) and 9702(130134) of SLE patients respectively (Table 1) In line withthe concentrations of anti-C1q antibodies detected in SLEthe titers of anti-dsDNA and ANA were moderately higherin SLE patients with LN as compared with those withouta renal involvement but there was no statistical differencedetermined in this study respectively (Figures 3(c) and 3(d)Table 1) The titers of anti-dsDNA antibodies were 6763 plusmn1170 IUmL in the SLE with LN and 4833 plusmn 772 IUmL in

Autoimmune Diseases 5

sIL-7R

pro

tein

(ng

mL)

LN SLE Non-LN SLE HealthyGroups

sIL-7R proteinlowastlowastlowastp lt 00001

lowastlowastlowastp lt 00001

lowastlowastlowastp = 000073529 plusmn 15

277 plusmn 10

2269 plusmn 10

N = 58

N = 76

N = 84

120

100

80

60

40

20

0

(a)

LN SLE Non-LN SLE HealthyGroups

sIL-7R mRNA

Fold

of r

elat

ive s

IL-7

R tr

ansc

ript o

ver 120573

-act

in p = 04196 (NS)

p = 01372 (NS)

p = 03369 (NS)

0044 plusmn 000

0033 plusmn 000

0038 plusmn 000

05

04

03

02

01

00

N = 58

N = 76

N = 84

(b)

Figure 1 Increased soluble interleukin-7 receptor (sIL-7R) concentrations in sera of SLE patients with lupus nephritis (LN) (a) sIL-7Rconcentrations were measured by an ELISA in serum samples from SLE 58 patients with LN (LN-SLE) (119873 = 58) 76 SLE patients without LN(non-LN SLE) and 84 healthy individuals (b) Quantitative PCR evaluation of the sIL-7R gene expression in peripheral blood mononuclearcells (PBMCs) collected from 136 SLE patients and 84 healthy individuals 119901 value by Studentrsquos 119905-test Data presents as the mean plusmn SEM ineach group NS no statistical difference (lowastlowastlowast119901 lt 00001)

1405 plusmn 097

662 plusmn 052

SLEDAI

SLED

AI

60

40

20

0

LN SLE Non-LN SLEGroups

lowastlowastlowastp lt 00001

N = 58

N = 76

(a)

1071 plusmn 1163

4918 plusmn 736

5705 plusmn 17253

Ant

i-C1

q an

tibod

y (A

Um

L)

Anti-C1q antibody600

500

400

300

200

100

0

LN SLE Non-LN SLE HealthyGroups

lowastlowastlowastp lt 00001

lowastlowastlowastp lt 00001

lowastlowastlowastp lt 00001

N = 58

N = 76

N = 84

(b)

Figure 2 Higher SLE Disease Activity Index (SLEDAI) scores and serum anti-C1q antibody concentrations in SLE patients with lupusnephritis (LN) relative to non-LN SLE patients (a) SLEDAI scores between LN SLE patients (119873 = 58) and non-LN SLE patients (119873 = 76)(b) Concentrations of anti-C1q antibody were measured by an ELISA in serum samples from SLE 58 patients with LN (LN-SLE) (119873 = 58)76 SLE patients without LN (non-LN SLE) and 84 healthy individuals 119901 value by Studentrsquos 119905-test Data presents as the mean plusmn SEM in eachgroup

the SLE without LN (119901 = 01554) (Figure 3(c)) the titers ofANA were 3038 plusmn 4468 in the SLE with LN and 2499 plusmn 3765in the SLE without LN (119901 = 03553) (Figure 3(c)) Otherautoantibodies including antibodies to cardiolipin (ACL)cytoplasmic antineutrophil cytoplasmic antibody (cANCA)perinuclear neutrophil cytoplasmics (pANCA) ribosomal P-proteins (Rib-P) ribonucleoprotein and Sjogrenrsquos syndromeA and B were also detected in SLE patients which werelisted in Table 1 Of note significant differences betweenSLE patients with LN and non-LN were only observed in

serum levels of sIL-7R anti-C1q and complement C3 in thisstudy

34 Correlations of SLEDAI Scores of sIL-7R and OtherSerological Biomarkers In order to reveal the clinical sig-nificances of circulating biomarkers in SLE the correlationsbetween SLEDAI scores and several serological biomarkersincluding sIL-7R were evaluated (Figure 4) The correla-tion coefficients between SLEDAI scores and sIL-7R ANAanti-C1q antibodies and anti-dsDNA antibodies were 119903 =

6 Autoimmune Diseases

LN SLE Non-LN SLEGroups

N = 58

N = 76

0509 plusmn 003

0668 plusmn 004

Serum C3C3

conc

entr

atio

n (120583

gm

L)3

2

1

0

lowastp = 00018

(a)

LN SLE Non-LN SLEGroups

N = 58 N = 76

0086 plusmn 001 0115 plusmn 001

Serum C4

C4co

ncen

trat

ion

(120583g

mL)

10

08

06

04

02

00

p = 00508 (NS)

(b)

LN SLE Non-LN SLEGroups

N = 58N = 766763 plusmn 1170

4833 plusmn 772

Ant

i-dsD

NA

antib

ody

(IU

mL)

Serum anti-dsDNA500

400

300

200

100

0

p = 01554 (NS)

(c)

LN SLE Non-LN SLEGroups

N = 58N = 76

p = 03553 (NS)

3038 plusmn 4468 2499 plusmn 3765

Ant

inuc

lear

antib

ody

(tite

r)

Serum antinuclear antibody20000

16000

12000

8000

4000

0

(d)

Figure 3 Levels of serum C3 C4 anti-dsDNA antibody and antinuclear antibody (ANA) between SLE patients with LN and SLE patientswithout active LN (a) Serum C3 concentration between LN SLE patients and non-LN SLE patients (b) Serum C4 concentration betweenLN SLE patients and non-LN SLE patients (c) Concentration of serum anti-dsDNA between LN SLE patients and non-LN SLE patients (d)Concentration of serum antinuclear antibody between LN SLE patients and non-LN SLE patients 119901 value by Studentrsquos 119905-test Data presentsas the mean plusmn SEM in each group NS no statistical difference

02354 (119901 = 00062) (Figure 4(a)) 119903 = 02901 (119901 = 00007)(Figure 4(b)) 119903 = 03172 (119901 = 00002) (Figure 4(c)) and119903 = 04248 (119901 lt 00001) (Figure 4(d)) respectively Ofinterest the concentrations or titers of these serum markershad statistically significant correlations with SLEDAI scores

35 A Positive Correlation between Serum sIL-7R and Anti-C1q Antibodies in SLE Patients We next sought to ana-lyze whether the sIL-7R correlated with other serologicalbiomarkers The correlation coefficients between sIL-7R andanti-C1q antibodies anti-dsDNA antibody and C3 and C4concentrations were 119903 = 02871 (119901 = 00008) (Figure 5(a))119903 = 01048 (119901 = 02282) (Figure 5(b)) 119903 = minus01259(119901 = 01471) (Figure 5(c)) and 119903 = minus01335 (119901 = 01254)

(Figure 5(d)) respectively Of interest only the anti-C1qantibodies showed a statistically significant association withsIL-7R (Figure 5(a)) There was no significant associationdetected between the sIL-7R and serological biomarkersother than the anti-C1q antibodies ANA also had no corre-lation with sIL-7R (data not shown) These data imply that acombination of anti-C1q antibodies and sIL-7R may enhancethe specificity in the identification of patients with active SLEand LN

4 Discussion

The sIL-7R is a novel circulating biomarker that has diag-nostic and prognostic values for disease activity and renal

Autoimmune Diseases 7

sIL-7

R pr

otei

n (n

gm

L)100

80

60

40

20

0

0 10 20 30 40

SLEDAI

Correlation of SLEDAI and sIL-7R

Spearmanr = 02354

= 00062lowastp

(a)

Ant

inuc

lear

antib

ody

(tite

r)

12000

10000

8000

6000

4000

2000

0

0 10 20 30 40

SLEDAI

Correlation of SLEDAI and ANA

Spearmanr = 02901

= 00007lowastlowastp

(b)

Ant

i-C1

q (A

Um

L)

300

200

100

0

0 10 20 30 40

SLEDAI

Correlation of SLEDAI and anti-C1q

Spearmanr = 03172

= 00002lowastlowastp

(c)

Ant

i-dsD

NA

(IU

mL)

300

200

100

0

0 10 20 30 40

SLEDAI

Correlation of SLEDAI and anti-dsDNA

Spearmanr = 04248

lowastlowastlowastp lt 00001

(d)

Figure 4 Correlation between SLEDAI scores and serum concentrations of sIL-7R anti-nuclear antibody anti-C1q antibody and anti-dsDNA antibody in SLE patients (a) Correlation between SLEDAI scores and the serum concentration of sIL-7R in SLE patients (119873 = 136)(b) Correlation between SLEDAI scores and the concentration of serum antinuclear antibody in SLE patients (119873 = 136) (c) Correlationbetween SLEDAI scores and the concentration of serum anti-C1q antibody in SLE patients (119873 = 136) (d) Correlation between SLEDAIscores and the serum concentration of anti-dsDNA antibody in SLE patients (119873 = 136) Spearman 119903 and 119901 values are displayed in eachgraph 119901 value by two-tailed Pearson correlation test

flares in SLE patients In this report we evaluated the serumconcentrations of sIL-7R and anti-C1q autoantibodies andanalyzed correlations of sIL-7R with SLE disease activity(SLEDAI scores) and other serological biomarkers in 134SLE patients The results showed that both sIL-7R and anti-C1q were strikingly elevated in patients with active SLEand LN relative to patients with inactive SLE and non-LN and healthy control individuals In addition the serumlevels of sIL-7R and anti-C1q antibodies were positivelycorrelated with SLEDAI scores in SLE patients Interestinglythe sIL-7R displayed a strong association with serum anti-C1q antibodies in SLE patients implying that both of them

may be novel biomarkers in SLE and a combination of sIL-7Rand anti-C1q antibodies or other serological biomarkersmay increase the diagnostic specificity for identification ofpatients with active SLE or LN Such observation is consistentwith findings from other groups [6 10 12 14 23 26 35]

Since the involvement of renal flare in SLE diseasesrepresents a major complication in the treatment an earlyidentification of LN would guide an early intervention forrheumatologists in a clinical setting A compelling body ofstudies has indicated that the anti-dsDNA and anti-Sm anti-bodies are useful serologicalmarker for identifying active SLEandLNactivity [42]However different assays of anti-dsDNA

8 Autoimmune Diseases

Correlation of sIL-7R and anti-C1q

r = 02871

Serum sIL-7R protein0 20 40 60 80

Ant

i-C1

q (A

Um

L) = 00008

Spearman

300

200

100

0

lowastlowastp

(a)

Correlation of sIL-7R and anti-dsDNA

r = 01048

sIL-7R protein (ngmL)0 20 40 60 80

Ant

i-dsD

NA

(IU

mL)

Spearman

300

200

100

0

p = 02282 (NS)

(b)

Serum sIL-7R protein0 20 40 60 80

20

15

10

05

00

Seru

m C3

(120583g

mL)

Spearman

p = 01471 (NS)

Correlation of serum sIL-7R and C3

r = minus01259

(c)

Correlation of serum sIL-7R and C4

Serum sIL-7R protein0 20 40 60 80

10

08

06

04

02

00

Seru

m C4

(120583g

mL)

Spearman

p = 01254 (NS)

r = minus01335

(d)

Figure 5 Correlation between serum concentrations of sIL-7R and serum concentrations of anti-C1q antibody anti-dsDNA antibody C3and C4 in SLE patients (a) Correlation between serum sIL-7R concentration and the level of anti-C1q antibody in SLE patients (119873 = 136) (b)Correlation between serum sIL-7R concentration and the level of anti-dsDNA antibody in SLE patients (119873 = 136) (c) Correlation betweenserum sIL-7R concentration and the C3 concentration in SLE patients (119873 = 136) (d) Correlation between serum sIL-7R concentration andthe C4 concentration in SLE patients (119873 = 136) Spearman 119903 and 119901 values are displayed in each of the graphs 119901 value by two-tailed Pearsoncorrelation test NS no statistical difference

antibodies and complements C3 and C4 have significantimpacts on diagnosing SLE disease activity in terms of thesensitivity and specificity [16] Such variations in serologicalindices of systemic disease activity do not accurately reflectthe activity of SLEThese biomarkers are not necessarily asso-ciated with active renal disease although they may be a highpredictive negative value in SLE [43] In addition althoughthe presence of renal-specific haematuria and the quantifica-tion of proteinuria are apparently associated with the pres-ence of glomerular lesions they may be from a consequenceof glomerular damage rather than inflammation A histo-logical evaluation of repeat-biopsy specimens is thus usuallyrequired for assessment of renal disease activity in SLE

Recently an elevated level of antibodies to C1q wasfrequently observed in the sera of patients with active SLE

and LN which was strongly associated with the hypocomple-mentemia and development of LN and SLE patients free ofthese antibodies were very unlikely to have active renal flares[2 3 6 10 44ndash46] Mechanistically an elevated anti-C1qmay induce the formation of C1q-anti-C1q complexes andpromote the production of inflammatorymediators which inturn inhibits the activation of complement and the clearanceof immune complexes sequentially results in further releaseof autoantigens production of autoantibodies and formationof complexes eventually activates diseases and leads to tissuedamage [47]With respect to hypocomplementemia the anti-C1q can activate the classical pathway and lectin pathway butnot the alternative pathway of complement depending onthe anti-C1q immunoglobulin-class repertoire present in thesera of SLE patients suggesting an important role of anti-C1q

Autoimmune Diseases 9

in SLE hypocomplementemia [48] In the present studyan elevated level of anti-C1q antibodies was also detectedin patients with active SLE and LN in comparison withhealthy cohorts and those with inactive SLE and nonrenalinvolvement This finding supports the view of the factthat anti-Clq antibodies alone or in combination with otherserological markers can be used as an important diagnosticparameter for identifying SLE patients with active disease andLN [2 3 6 8 10 11 15]

Apart from anti-C1q autoantibodies certain cytokinesmay also serve as serological markers to monitor diseaseactivity and predict disease severity Among these serumcytokines sIL-7R has recently spurred an increased interestas a serological marker owing to its strong associationwith autoimmune diseases and the activity of renal flaresin SLE patients [24 26 31 35] In the current context anincreased circulating sIL-7R concentration can potentiate IL-7 bioactivity and promote autoimmunity in vivo througha mechanism by which the sIL-7R is able to compete withcell-associated IL-7 receptor and diminish excessive IL-7consumption sequentially enhances proliferative responsesof T-cells to weak self-antigens and leads to autoimmunediseases such as type I diabetes RAMS and SLE [24 25 30]This notionwas further supported by polymorphic analysis inhuman MS and SLE in which polymorphisms of IL-7R wereassociated with the susceptibility to autoimmune diseasessuch as SLE [24 34]

With respect to the concentration of circulating sIL-7Rit was observed to be elevated in synovial tissue and seraof RA patients [31 49 50] and patients with MS [24] andSLE [26 35] Importantly the level of serum sIL-7R wasfound to be strongly correlated with the disease activity andrenal flares in SLE patients [26 35] which was consistentwith a finding in RA patients in whom an increased serumsIL-7R concentration was associated with poor response to(methotrexate andTNF-blocking) therapy [31] In the presentstudy a significantly higher level of sIL-7R was also detectedin sera of SLE patients with LN in comparison with non-LNpatients which was also positively correlated with the diseaseactivity as determined by SLEDAI scores These studiesand ours suggest that the serum sIL-7R may be a uniquesurrogate marker for accessing renal flares in SLE patientsFurthermore a combination of sIL-7R and other biomarkerssuch as anti-C1q anti-dsDNA andor complements C3 andC4 may increase the specificity for identification of activeLN in SLE patients with complex disease manifestations[35] Particularly the titer of anti-C1q was observed topositively correlate with serum concentration of sIL-7R inthis study implying that a combination of sIL-7R and anti-C1q may enhance the diagnostic and prognostic specificityfor LNusing serological biomarkers in clinical settings whichwarrants further investigation

Interestingly the abundance of IL-7R transcript wasnot statistically altered in PBMCs from patients with LNcompared with those without LN and control individualswhich was in disagreement with its protein concentrationdetected in sera but was in line with the finding reportedby Badot et al [26] Together with expression of IL-7R inkidney perivascular cells this observation may indicate that

an elevated concentration of sIL-7R in sera of patients withLN reflects activation of renal cells [26]

5 Conclusions

Collectively this study in 134 SLE patients further confirmsa previous finding of a correlation of serum sIL-7R con-centration with SLE disease activity and LN Intriguinglyserum levels of sIL-7R were positively correlated with theabundances of anti-C1q antibodies in SLE patientsThis studythus supports a view of the fact that sIL-7R is a uniqueserological marker for SLE disease activity and LN and acombination of sIL-7R and other markers such as anti-C1qmay increase the specificity for assessment of disease activityin SLE patients in clinical settings Limitations of this studyinclude the fact that only a small size of SLE samples wasstudied and follow-up data were also lacking the LN activitywasmainly determined by laboratory parameters and clinicalmanifestations rather than by pathogenic analysis in renalbiopsies

Conflict of Interests

The authors declare that they have no competing interests

Authorsrsquo Contribution

Shuhong Chi and Xiaoming Liu conceived and designed theexperiments Shuhong Chi and Jing Xue analyzed the dataand drafted the paper Feng Li Shuhong Chi Jing Xue CaixiaZhu Yunxia Yu and Haibo Li performed experiments andacquired data Xuemei Wang Yurong Zhang Jijuan YangShaolan Zhou Lijuan Yang and Chen Ji collected samplesXiaoming Liu interpreted data and critically revised thepaper All authors read and approved the final version of thepaper Shuhong Chi and Jing Xue contributed equally to thiswork

Acknowledgments

This work was supported by a Grant from Natural ScienceFoundation of Ningxia (NZ1213) to Shuhong Chi

References

[1] D Y Yap and K N Lai ldquoPathogenesis of renal disease insystemic lupus erythematosusmdashthe role of autoantibodies andlymphocytes subset abnormalitiesrdquo International Journal ofMolecular Sciences vol 16 no 4 pp 7917ndash7931 2015

[2] G Moroni S Quaglini A Radice et al ldquoThe value of a panelof autoantibodies for predicting the activity of lupus nephritis attime of renal biopsyrdquo Journal of Immunology Research vol 2015Article ID 106904 8 pages 2015

[3] P Eggleton O C Ukoumunne I Cottrell et al ldquoAutoantibodiesagainst C1q as a diagnostic measure of lupus nephritis system-atic review and meta-analysisrdquo Journal of Clinical amp CellularImmunology vol 5 no 2 article 210 2014

[4] B E Gilliam A K Ombrello R W Burlingame P HPepmueller and T L Moore ldquoMeasurement of autoantibodies

10 Autoimmune Diseases

in pediatric-onset systemic lupus erythematosus and theirrelationship with disease-associated manifestationsrdquo Seminarsin Arthritis and Rheumatism vol 41 no 6 pp 840ndash848 2012

[5] G Yaniv G Twig D B E-A Shor et al ldquoA volcanic explosion ofautoantibodies in systemic lupus erythematosus a diversity of180 different antibodies found in SLE patientsrdquo AutoimmunityReviews vol 14 no 1 pp 75ndash79 2015

[6] S Chi Y Yu J Shi et al ldquoAntibodies against C1q are avaluable serological marker for identification of systemic lupuserythematosus patients with active lupus nephritisrdquo DiseaseMarkers vol 2015 Article ID 450351 11 pages 2015

[7] F Q Wu Q Zhao X D Cui and W Zhang ldquoC1q and anti-C1qantibody levels are correlated with disease severity in Chinesepediatric systemic lupus erythematosusrdquo Rheumatology Inter-national vol 31 no 4 pp 501ndash505 2011

[8] X-W Yang Y Tan F Yu and M-H Zhao ldquoCombination ofanti-C1q and anti-dsDNA antibodies is associated with higherrenal disease activity and predicts renal prognosis of patientswith lupus nephritisrdquo Nephrology Dialysis Transplantation vol27 no 9 pp 3552ndash3559 2012

[9] M S EMAKaderMMA Elaziz andDHAhmed ldquoRole ofserum anti-C1q antibodies as a biomarker for nephritis activityin pediatric and adolescent Egyptian female patients with SLErdquoExpert Opinion on Medical Diagnostics vol 6 no 6 pp 489ndash498 2012

[10] L Gargiulo Mde G Gomez M Khoury et al ldquoAssociationbetween the presence of anti-C1q antibodies and active nephri-tis in patients with systemic lupus erythematosusrdquoMedicina (BAires) vol 75 no 1 pp 23ndash28 2015

[11] Y Yin X Wu G Shan and X Zhang ldquoDiagnostic value ofserum anti-C1q antibodies in patients with lupus nephritis ameta-analysisrdquo Lupus vol 21 no 10 pp 1088ndash1097 2012

[12] M Bock I Heijnen M Trendelenburg andM Kuwana ldquoAnti-C1q antibodies as a follow-up marker in SLE patientsrdquo PLoSONE vol 10 no 4 Article ID e0123572 2015

[13] M Mahler R A Van Schaarenburg and L A Trouw ldquoAnti-C1q autoantibodies novel tests and clinical consequencesrdquoFrontiers in Immunology vol 4 no MAY Article ID article 1172013

[14] A M Orbai L Truedsson G Sturfelt et al ldquoAnti-C1q antibod-ies in systemic lupus erythematosusrdquo Lupus vol 24 no 1 pp42ndash49 2015

[15] Y Tan D Song L-H Wu F Yu and M-H Zhao ldquoSerumlevels and renal deposition of C1q complement component andits antibodies reflect disease activity of lupus nephritisrdquo BMCNephrology vol 14 no 1 article 63 2013

[16] H Julkunen S Ekblom-Kullberg and A Miettinen ldquoNon-renal and renal activity of systemic lupus erythematosus acomparison of two anti-C1q and five anti-dsDNA assays andcomplement C3 and C4rdquo Rheumatology International vol 32no 8 pp 2445ndash2451 2012

[17] A A Jesus L M Campos B L Liphaus et al ldquoAnti-C1q anti-chromatinnucleosome and anti-dsDNA antibodies in juvenilesystemic lupus erythematosus patientsrdquo Revista Brasileira deReumatologia vol 52 no 6 pp 976ndash981 2012

[18] V Zivkovic A Stankovic T Cvetkovic et al ldquoAnti-dsDNAAnti-nucleosome and anti-C1q antibodies as disease activitymarkers in patients with systemic lupus erythematosusrdquo SrpskiArhiv za Celokupno Lekarstvo vol 142 no 7-8 pp 431ndash4362014

[19] D Y H Yap and K N Lai ldquoCytokines and their roles in thepathogenesis of systemic lupus erythematosus from basics to

recent advancesrdquo Journal of Biomedicine and Biotechnology vol2010 Article ID 365083 10 pages 2010

[20] B Stypinska and A Paradowska-Gorycka ldquoCytokines andMicroRNAs as candidate biomarkers for systemic lupus erythe-matosusrdquo International Journal ofMolecular Sciences vol 16 no10 pp 24194ndash24218 2015

[21] T A Gottschalk E Tsantikos and M L Hibbs ldquoPathogenicinflammation and its therapeutic targeting in systemic lupuserythematosusrdquo Frontiers in Immunology vol 6 article 5502015

[22] E Hoe F C McKay S D Schibeci et al ldquoFunctionallysignificant differences in expression of disease-associated IL-7receptor 120572 haplotypes in CD4 T cells and dendritic cellsrdquo TheJournal of Immunology vol 184 no 5 pp 2512ndash2517 2010

[23] J S Kim B A Cho J H Sim et al ldquoIL-7R120572119897119900119908 memory CD8+T cells are significantly elevated in patients with systemic lupuserythematosusrdquo Rheumatology vol 51 no 9 pp 1587ndash15942012

[24] W Lundstrom S Highfill S T Walsh et al ldquoSoluble IL7R120572potentiates IL-7 bioactivity and promotes autoimmunityrdquo Pro-ceedings of the National Academy of Sciences of the United Statesof America vol 110 no 19 pp E1761ndashE1770 2013

[25] X-S Wang B-Z Li L-F Hu et al ldquoPerspectives of therelationship between IL-7 and autoimmune diseasesrdquo ClinicalRheumatology vol 32 no 12 pp 1703ndash1709 2013

[26] V Badot R K M A C Luijten J A Van Roon et alldquoSerum soluble interleukin 7 receptor is strongly associatedwithlupus nephritis in patients with systemic lupus erythematosusrdquoAnnals of the Rheumatic Diseases vol 72 no 3 pp 453ndash4562013

[27] H Dooms ldquoInterleukin-7 fuel for the autoimmune attackrdquoJournal of Autoimmunity vol 45 pp 40ndash48 2013

[28] J T Tan E Dudl E LeRoy et al ldquoIL-7 is critical for homeostaticproliferation and survival of naıve T cellsrdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 98 no 15 pp 8732ndash8737 2001

[29] J-H Park Q Yu B Erman et al ldquoSuppression of IL7R120572transcription by IL-7 and other prosurvival cytokines a novelmechanism for maximizing IL-7-dependent T cell survivalrdquoImmunity vol 21 no 2 pp 289ndash302 2004

[30] M Guimond R G Veenstra D J Grindler et al ldquoInterleukin7 signaling in dendritic cells regulates the homeostatic prolifer-ation and niche size of CD4+ T cellsrdquo Nature Immunology vol10 no 2 pp 149ndash157 2009

[31] V Badot P Durez B J Van den Eynde A Nzeusseu-ToukapF A Houssiau and B R Lauwerys ldquoRheumatoid arthritissynovial fibroblasts produce a soluble form of the interleukin-7receptor in response to pro-inflammatory cytokinesrdquo Journal ofCellular and Molecular Medicine vol 15 no 11 pp 2335ndash23422011

[32] J Haas M Korporal A Schwarz B Balint and B WildemannldquoThe interleukin-7 receptor 120572 chain contributes to alteredhomeostasis of regulatory T cells in multiple sclerosisrdquo Euro-pean Journal of Immunology vol 41 no 3 pp 845ndash853 2011

[33] T Poiret L Rane M Remberger et al ldquoReduced plasmalevels of soluble interleukin-7 receptor during graft-versus-hostdisease (GVHD) in children and adultsrdquoBMC Immunology vol15 no 1 article 25 2014

[34] X-S Wang P-F Wen M Zhang et al ldquoInterleukin-7 receptorsingle nucleotide polymorphism rs6897932 (CT) and thesusceptibility to systemic lupus erythematosusrdquo Inflammationvol 37 no 2 pp 615ndash620 2014

Autoimmune Diseases 11

[35] B R Lauwerys S N Husson A L Maudoux V Badot and FA Houssiau ldquosIL7R concentrations in the serum reflect diseaseactivity in the lupus kidneyrdquo Lupus Science amp Medicine vol 1no 1 Article ID e000036 2014

[36] E Akhter R W Burlingame A L Seaman L Magder and MPetri ldquoAnti-C1q antibodies have higher correlationwith flares oflupus nephritis than other serum markersrdquo Lupus vol 20 no12 pp 1267ndash1274 2011

[37] N Marto M L Bertolaccini E Calabuig G R V Hughesand M A Khamashta ldquoAnti-C1q antibodies in nephritis Cor-relation between titres and renal disease activity and positivepredictive value in systemic lupus erythematosusrdquoAnnals of theRheumatic Diseases vol 64 no 3 pp 444ndash448 2005

[38] E M Tan A S Cohen J F Fries et al ldquoThe 1982 revisedcriteria for the classification of systemic lupus erythrematosusrdquoArthritis and Rheumatism vol 25 no 11 pp 1271ndash1277 1982

[39] M Petri N Kasitanon S-S Lee et al ldquoSystemic lupus inter-national collaborating clinics renal activityresponse exercisedevelopment of a renal activity score and renal response indexrdquoArthritis and Rheumatism vol 58 no 6 pp 1784ndash1788 2008

[40] D D Gladman D Ibanez and M B Urowltz ldquoSystemiclupus erythematosus disease activity index 2000rdquo Journal ofRheumatology vol 29 no 2 pp 288ndash291 2002

[41] Z Touma D D Gladman A MacKinnon et al ldquoDevelopmentand assessment of usersrsquo satisfaction with the systemic lupuserythematosus disease activity index 2000 responder index-50websiterdquo Journal of Rheumatology vol 40 no 1 pp 34ndash39 2013

[42] P Alba L Bento M J Cuadrado et al ldquoAnti-dsDNA anti-Sm antibodies and the lupus anticoagulant significant factorsassociated with lupus nephritisrdquo Annals of the RheumaticDiseases vol 62 no 6 pp 556ndash560 2003

[43] H Bootsma P Spronk R Derksen et al ldquoPrevention of relapsesin systemic lupus erythematosusrdquo Lancet vol 345 no 8965 pp1595ndash1599 1995

[44] MC Pickering andM Botto ldquoAre anti-C1q antibodies differentfrom other SLE autoantibodiesrdquo Nature Reviews Rheumatol-ogy vol 6 no 8 pp 490ndash493 2010

[45] A Matrat C Veysseyre-Balter P Trolliet et al ldquoSimultaneousdetection of anti-C1q and anti-double stranded DNA autoan-tibodies in lupus nephritis predictive value for renal flaresrdquoLupus vol 20 no 1 pp 28ndash34 2011

[46] C G Moura I Lima L Barbosa et al ldquoAnti-C1q antibodiesassociation with nephritis and disease activity in systemic lupuserythematosusrdquo Journal of Clinical Laboratory Analysis vol 23no 1 pp 19ndash23 2009

[47] L A Trouw and M R Daha ldquoRole of anti-C1q autoantibodiesin the pathogenesis of lupus nephritisrdquo Expert Opinion onBiological Therapy vol 5 no 2 pp 243ndash251 2005

[48] S Thanei D Vanhecke and M Trendelenburg ldquoAnti-C1qautoantibodies from systemic lupus erythematosus patientsactivate the complement system via both the classical and lectinpathwaysrdquo Clinical Immunology vol 160 no 2 pp 180ndash1872015

[49] V Badot C Galant A N Toukap et al ldquoGene expressionprofiling in the synovium identifies a predictive signature ofabsence of response to adalimumab therapy in rheumatoidarthritisrdquo Arthritis Research and Therapy vol 11 no 2 articleR57 2009

[50] A Nzeusseu Toukap C Galant I Theate et al ldquoIdentificationof distinct gene expression profiles in the synovium of patientswith systemic lupus erythematosusrdquoArthritis and Rheumatismvol 56 no 5 pp 1579ndash1588 2007

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom