Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum : mechanism and characterization of the AmtR regulon

Molecular Microbiology (2005)

58

(2), 580–595 doi:10.1111/j.1365-2958.2005.04855.xFirst published online 13 September 2005

© 2005 The AuthorsJournal compilation © 2005 Blackwell Publishing Ltd

Blackwell Science, LtdOxford, UKMMIMolecular Microbiology0950-382X© 2005 The Author; Journal compilation © 2005 Blackwell Publishing Ltd

? 2005

58

2580595

Original Article

AmtR-dependent regulation in C. glutamicumG. Beckers

et al.

Accepted 11 August, 2005. *For correspondence. [email protected]; Tel. (

+

49) 9131 85 28086; Fax(

+

49) 9131 85 28082.

†

Present address: Lehrstuhl für Mikrobiologie,Universität Erlangen-Nürnberg, Staudtstr. 5, D-91058 Erlangen,Germany.

Regulation of AmtR-controlled gene expression in

Corynebacterium glutamicum

: mechanism and characterization of the AmtR regulon

Gabriele Beckers,

1

Julia Strösser,

1

Ulrich Hildebrandt,

2

Jörn Kalinowski,

3

Mike Farwick,

4

Reinhard Krämer

1

and Andreas Burkovski

1

*

†

1

Institut für Biochemie der Universität zu Köln, Zülpicher Str. 47, D-50674 Köln, Germany.

2

Institut für Botanik der Universität zu Köln, Gyrhofstr. 15, D-50931 Köln, Germany.

3

Institut für Genomforschung, Universität Bielefeld, Universitätsstr. 25, D-33615 Bielefeld, Germany.

4

Degussa AG, Kantstr. 10, D-33788 Halle-Künsebeck, Germany.

Summary

AmtR, the master regulator of nitrogen control in


, represses transcrip-tion of a number of genes during nitrogen surplus.Repression is released by an interaction of AmtR withsignal transduction protein GlnK. As shown by pull-down assays and gel retardation experiments, onlyadenylylated GlnK, which is present in the cells dur-ing nitrogen limitation, is able to bind to AmtR.

The AmtR regulon was characterized in this studyby a combination of bioinformatics, transcriptomeand proteome analyses. At least 33 genes are directlycontrolled by the repressor protein including thoseencoding transporters and enzymes for ammoniumassimilation (

amtA

,

amtB

,

glnA

,

gltBD

), urea andcreatinine metabolism (

urtABCDE

,

ureABCEFGD

,

crnT

,

codA

), a number of biochemically uncharac-terized enzymes and transport systems (NCgl1099,NCgl1100, NCgl 1915–1918) as well as signal trans-duction proteins (

glnD

,

glnK

). For the AmtR regulon,an AmtR box has been defined which comprises thesequence tttCTATN

6

AtAGat/aA. Furthermore, the tran-scriptional organization of AmtR-regulated genes andoperons was characterized.

Introduction


was isolated in 1957 byKinoshita and coworkers in a screening program for

L

-glutamate-producing bacteria from a soil sample collectedat Ueno Zoo in Tokyo and at that time designated as

Micrococcus glutamicus

(Kinoshita

et al

. 1957; Udaka,1960; Eggeling and Sahm, 2001). Less than 50 yearslater, enormous amounts of

L

-glutamate (more than1 400 000 t per year) and

L

-lysine (more than 560 000 tper year) are produced by use of different

C. glutamicum

strains, in addition to smaller amounts of some industriallyless important amino acids (

L

-alanine,

L

-isoleucine and

L

-proline) and in addition to different nucleotides (Leuchten-berger, 1996; Hermann, 2003).

The regulation of nitrogen metabolism in

C. glutamicum

and related species was the subject of research mainly inthe last years (for review, see Burkovski, 2003a,b). For

C.glutamicum

, detailed information on transport and assim-ilation of nitrogen sources as well as nitrogen regulationis available on a molecular level (for review, see Burkovski,2003a,b; 2005). Uptake systems for ammonium, creati-nine, glutamate and urea were studied and assimilatoryenzymes and pathways were investigated. Additionally,the key components of nitrogen control were identified,namely, GlnK, the sole P

II

-type signal transduction proteinin this organism, two adenylyltransferases encoded by

glnE

and

glnD

, and AmtR, a TetR-type repressor protein.The expression of nitrogen starvation-induced genes in

C.glutamicum

is controlled by this transcriptional regulator.AmtR blocks transcription of various genes during nitro-gen surplus. Consequently, deletion of the

amtR

geneleads to a deregulated transcription of AmtR-regulatedgenes (Jakoby

et al

., 2000). Gel-retardation experimentsin which extracts from

amtR

-expressing

Escherichia coli

cells or purified AmtR protein were used, indicated thatAmtR binds to the sequence ATCTATAGN

4

ATAG upstreamof the

amtA

gene and subsequent studies showed thatAmtR not only regulates transcription of

amtA

, but alsoexpression of the

amtB-glnK-glnD

operon encoding anammonium carrier, GlnK and GlnD (Jakoby

et al

., 2000)as well as the

gltBD

operon encoding glutamate synthase(Beckers

et al

., 2001) and the

glnA

gene coding forglutamine synthetase (Nolden

et al

., 2001a). AmtR is

mailto:[email protected]

AmtR-dependent regulation in

C. glutamicum 581

© 2005 The AuthorsJournal compilation © 2005 Blackwell Publishing Ltd,

Molecular Microbiology

,

58

, 580–595

assumed to be controlled by a signal cascade includingGlnD and GlnK, most likely by a direct interaction with theGlnK protein, which is adenylylated during nitrogen star-vation (Strösser

et al

., 2004). Deletion of the

glnD

or

glnK

gene or replacement of the conserved tyrosine residue 51by phenylalanine in GlnK interrupts the transfer of thenitrogen starvation signal to AmtR and leads to a perma-nent repression of AmtR-controlled genes (Nolden

et al

.,2001b).

This study was initiated to investigate AmtR-dependentregulation in detail and to define the

C. glutamicum

AmtRregulon. For this purpose, different global analysis tech-niques were applied, i.e. a bioinformatics approach forgenome data mining, transcriptome analyses by DNAmicroarrays and characterization of cellular protein pro-files by two-dimensional gel electrophoresis and peptidemass fingerprint analyses.

Results

AmtR forms a complex with signal transduction protein GlnK

In response to nitrogen limitation, AmtR it released fromits target DNA and transcription of various genes is notlonger blocked (Burkovski, 2003a,b; 2005). The signal forthe release of AmtR from the DNA was unclear until now.However, an interaction of the repressor protein with GlnKwas assumed based on site-directed mutagenesis exper-iments. Cells carrying a

glnK

allele which codes for a GlnKprotein with an exchange of tyrosine 51 to phenylalanine(GlnKY51F) do not respond to nitrogen limitation on thelevel of transcription (Nolden

et al

., 2001b) even whendepleted of all nitrogen sources for several hours.

As a first approach interaction of AmtR and GlnK wasaddressed by native gel electrophoresis. Strain ATCC13032 pEKEXglnK was grown in the presence of 0.5 mMIPTG to induce

glnK

expression. Depending on the nitro-gen supply, nitrogen-rich or nitrogen-free medium, GlnKwas present in its unmodified or adenylylated form inthese cells. To investigate protein–protein interactions,

cytoplasmic protein fractions were subjected to nativepolyacrylamide gel electrophoresis, either in the absenceor presence of purified AmtR

∼

His

6

protein. After gelelectrophoresis, proteins were blotted and subsequentlyprobed with a GlnK-specific antiserum. While the additionof AmtR to cell extract containing unmodified GlnK had noeffect on GlnK mobility, AmtR incubation with GlnK-AMPresulted in a strong retardation of the GlnK band indicatingan AmtR/GlnK–AMP interaction (Fig. 1).

To verify the AmtR/GlnK–AMP interaction, an AmtR pro-tein carrying a C-terminal hexahistidine tag (AmtR

∼

His

6

)was coupled to an affinity column. Cytoplasmic proteinextracts from

C. glutamicum

cells grown in nitrogen-richstandard minimal medium and from nitrogen-starved cellswere applied on the AmtR

∼

His

6

column. After washingand elution, protein fractions were separated by SDS-PAGE and stained with Coomassie brilliant blue. All pro-teins eluted were excised and identified by MALDI-TOF-MS and peptide mass fingerprint analyses. In addition,presence or absence of GlnK in the elution fractions wastested by Western blot analyses using a GlnK-specificantiserum (Fig. 2). Four minor

E. coli

contaminations(DNA cytosine methylase, 50S ribosomal subunit L28,small ribosomal subunit pseudo uridinesynthase A, N-alanyl-

γ

-D-glutamyl-meso-diaminopimelate ligase) fromthe AmtR

∼

His6-expressing strain were detectable in allelution fractions (data not shown). More interestingly,Western blot experiments as well as the mass spectro-metric analyses revealed that AmtR is able to bind GlnKonly when the protein is present in its adenylylated form,i.e. when the cells face nitrogen limitation. UnmodifiedGlnK, which indicates nitrogen-rich conditions, is notbound (Fig. 2A). Because the active form of GlnK is atrimer, not only homotrimeric completely modified orunmodified protein complexes, but also heterotrimers withone or two adenylylated and corresponding numbers ofunmodified GlnK proteins were observed in

C. glutamicum

(Jakoby

et al

., 1999; Nolden

et al

., 2001a). Native poly-acrylamide gel electrophoresis was used to study, whichGlnK forms were present in the fractions used for interac-tion studies (Fig. 2B). While completely adenylylated GlnK

GlnK

GlnK-AMP + AmtR

GlnK-AMP

+N –N

GlnK

+N –N

– AmtR + AmtR

Fig. 1.

Analysis of AmtR–GlnK interaction by native gel electrophoresis. ATCC 13032 pEKEXglnK cells were grown in the presence of 0.5 mM IPTG to induce

glnK

expression. Depending on the nitrogen supply (

+

N, –N) GlnK was present in its unmodified or adenyly-lated form. Twenty-five microgram of cytoplas-mic protein fractions of these cells were subjected to native polyacrylamide gel electro-phoresis, either in the absence (left panel) or presence (right panel) of 1

μ

g of purified AmtR

∼

His

6

. Cell extract containing GlnK-AMP resulted in a shift of AmtR motility.

582

G. Beckers

et al.



,

58

, 580–595

trimers were present in the cell extract of nitrogen-starvedcells and completely unmodified GlnK trimers wereobserved in cells incubated for 30 min in the presence ofammonium, cells harvested shortly after ammonium pulsecontained a mixture of (GlnK-AMP)

3

(GlnK-AMP)

2

/GlnK,GlnK-AMP/(GlnK)

2

and GlnK

3

. The data obtained indi-cated that only the fully adenylylated GlnK trimer binds toAmtR (Fig. 2B).

AmtR–GlnK interaction is sufficient to stop AmtR repression

In order to demonstrate a physiological function of AmtRinteraction with GlnK-AMP, gel retardation experimentswere carried out. A promoter fragment of

amtB

, carryinga putative AmtR binding site (Jakoby

et al

., 2000) wasmixed with isolated AmtR protein. Due to the binding ofAmtR, a retardation of this DNA fragment was observed(Fig. 3). The rapid electrophoretic mobility of the free DNAwas recovered by the addition of cell extract from nitrogen-starved cells, which contained GlnK-AMP, but not with cellextract containing unmodified GlnK protein (Fig. 3, upperpanel). This strongly indicates that GlnK-AMP is able torelease the repression of AmtR. The result obtained was

independent from the time of preincubation of AmtR withGlnK (with time points between 0 and 30 min tested).Addition of GlnK-AMP results in an immediate loss ofAmtR binding to its target DNA. Because cell extract wasapplied in these experiments, the presence of additionaleffectors could not be excluded. Therefore, the experi-ments were repeated with elution fractions from the AmtR-affinity column. Also in this case, AmtR was released fromits target DNA in the presence of GlnK-AMP only (Fig. 3,lower panel), which indicates that GlnK-AMP alone is suf-ficient to unblock AmtR-dependent repression. For con-trol, gel retardation experiments were repeated with the

gltB

upstream region. As the ammonium transporter-encoding

amtB

gene, expression of the glutamate syn-thase encoding

gltBD

operon is AmtR-controlled (Beckers

et al

., 2001) and identical results were obtained when the

gltB

promoter was used instead of the

amtB

upstreamregion in the two sets of experiments using cell extractsor immuno-purified GlnK (data not shown).

Bioinformatic screening of new AmtR-controlled genes

A number of AmtR-regulated genes has been identifiedand binding motifs have been characterized. These

A

B

GlnK GlnK-AMP

GlnK-AMP

1 2 3

AmtR

1 2 3

GlnK3

GlnK-AMP3

Fig. 2.

AmtR–GlnK complex formation shown by pull-down experiments.A. By variation of nitrogen supply,

C. glutamicum

cell extract were prepared, which contained exclusively GlnK-AMP (Western blot of SDS-PAGE, upper panel, lane 1, cells incubated for 1.5 h in nitrogen-free minimal medium), a mixture of GlnK-AMP and GlnK (lane 2, cells harvested 5 min after an ammo-nium pulse), or only GlnK (lane 3, cells har-vested 10 min after an ammonium pulse). Twenty-five microgram of these protein extracts were loaded on columns with immobilized AmtR protein. Washing and elution fractions were tested for the presence of AmtR and GlnK by Western blotting. Lower panels show sec-tions of blots representing elution fractions of these columns probed with AmtR- and GlnK-specific antisera. While AmtR was eluted from all columns, GlnK was detectable only when present in its modified form. The adenylylation of GlnK, indicated by the apparent molecular mass of the protein, was validated by mass spectrometry (data not shown).B. Native gel electrophoresis of protein frac-tions. Twenty-five microgram of the protein frac-tion applied in the pull-down experiments described in A were separated by native PAGE. The gel was blotted and probed with GlnK-specific antisera. Trimeric GlnK complexes in these protein fractions were either fully adeny-lylated (GlnK-AMP

3

, lane 1), a mixture of GlnK-AMP

3

, GlnK-AMP

2

/GlnK, GlnK-AMP/GlnK

2

and GlnK

3

(lane 2), or trimers of fully unmodified GlnK (GlnK

3

, lane 3).

AmtR-dependent regulation in

C. glutamicum 583



,

58

, 580–595

include extensive motifs like ATCTATAG-N

4

-ATAGupstream of the

amtA

gene as well as ATCTATAG-N1-ATAG upstream of the amtB-glnK-glnD operon, mid-sizesequences like ATCTATAG upstream of the gltBD operon,and small, truncated forms like ATCTAT upstream of theglnA gene. These known AmtR binding sequences wereused for a genome-wide screening for new AmtR-regu-lated candidate genes using Blast searches and Hidden-Markov models. The results of this approach are summa-rized in Table 1. In summary, binding sites upstream of 14different genes were predicted by computer analyses,including new putative AmtR binding sites upstream ofthe genes gdh, gluA, hkm, NCgl1099, NCgl1100 andNCgl1915. However, because the AmtR binding motifmight be located on the sense or antisense strand, in caseof divergently organized genes like gltB and hkm orNCgl1099 and 1100 it is unclear which gene is in factregulated by AmtR. Consequently, experimental verifica-tion of AmtR regulation is crucial.

Transcriptome analyses using DNA microarrays

As a first experimental validation of putative AmtR-regulated genes identified by the genome-wide bioinfor-matics screening, DNA microarray analyses were carriedout. The transcriptome of the C. glutamicum wild-typestrain ATCC 13032 and the corresponding amtR deletionstrain MJ6-18 was investigated in cells grown in nitrogen-rich standard minimal medium. Alterations of geneexpression is represented by the ratio of each of thegenes, which was obtained by dividing the intensity of thehybridization signal obtained for RNA of the amtR deletionstrain by that of the wild type. Ratios beyond a thresholdof 2 (< 0.5 and > 2.0) were taken as significant for generegulation by AmtR. 28 genes with derepessed transcrip-tion in the mutant strain were observed (see Table 2). Outof these 10 were identified by bioinformatics analysis. Thereason, why the latter approach gave less targets, resultsfrom the fact, that AmtR does not only repress expression

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

cell extract

purified GlnK

Fig. 3. Control of AmtR repression by GlnK-AMP. Upper panel: Gel retardation experiments were carried out with amtB promoter DNA (0.4 ng μl−1), which was mixed with 50 ng μl−1 purified AmtR protein. To test the influence of GlnK, cell extract, which contained exclusively GlnK-AMP (lanes 3–5), a mixture of GlnK-AMP and GlnK (lanes 8–10), or only GlnK (lanes 13–15) was applied. GlnK concentrations in the different protein fractions were quantified by Western blot analyses and identical amounts of the different GlnK forms were applied. Lanes 1, 6, 11 labelled DNA without AmtR addition, lanes 2, 7, 12, amtB fragment plus AmtR. Lower panel: In this set of experiments, instead of cell extract, GlnK from corresponding elution fractions from AmtR affinity columns (see Fig. 2) were added (protein concentrations used were 0.1, 0.2 and 0.5 μg μl−1) with lanes 12–15 being negative controls without GlnK-AMP.

584 G. Beckers et al.

© 2005 The AuthorsJournal compilation © 2005 Blackwell Publishing Ltd, Molecular Microbiology, 58, 580–595

of monocistronic genes, but of whole operons as well. Forexample, a transcriptional coupling of amtB-glnK-glnD(Jakoby et al., 2000), gltBD (Beckers et al., 2001), ureAB-CEFGD and urtABCDE (Beckers et al., 2004) was shown.The operon structure of other genes was addressed in anadditional set of experiments (see below).

Another reason for differing results might be a changeof expression below the detection limit of microarrays. Forexample the hkm gene was described to be moderatelynitrogen starvation-dependent (Schulz et al., 2001) wasidentified by the bioinformatics approach, but not inmicroarray experiments.

Organization of AmtR-regulated genes

For the putative AmtR-regulated genes identified by thebioinformatics approach or by the DNA microarray exper-iments transcription units were deduced from the organi-zation of the genome. To prove the resulting putativeoperon structures, reverse transcriptase polymerasechain reaction (RT-PCR) experiments were carried outusing total RNA isolated from the wild type as well as fromstrain MJ6-18 and primer pairs annealing to the first andlast gene of the putative transcription units. Control PCRexperiments carried out without RT verified that the RNApreparations used were DNA-free, while the RT-PCRexperiments revealed cotranscription of amtA, ocd andsoxA coding for a methylammonium/ammonium per-mease, a putative ornithine cyclodeaminase and a puta-tive sarcosine oxidase, a common transcript of thegluABCD cluster encoding the primary glutamate uptakesystem of C. glutamicum, and a transcription unit compris-

ing the NCgl1915–1918 genes encoding a putative ABColigopeptide uptake system (Fig. 4).

The analyses of transcriptional organization revealedthat especially the last genes of some operons (amtB-glnK-glnD, gluABCD, oppABCD) were not detected inmicroarray experiments. Possible reasons for this effectmight be an inefficient hybridization of the probe immobi-lized on the chip, RNA degradation or operon polarityeffects.

RNA hybridization analyses

To validate the results obtained by DNA microarray anal-yses and genome screening for AmtR binding motifs, RNAhybridization experiments were carried out using anti-sense probes for the different genes and total RNA iso-lated from the wild type and amtR deletion strain MJ6-18grown in nitrogen-rich minimal medium and starved fornitrogen. Most candidate genes identified by the bioinfor-matics approach and DNA microarray analysis wereAmtR-regulated (Fig. 5). Only for gdh and hkm transcrip-tion, which was found by the bioinformatics approach, andfor NCgl2787, which was detected in microarray experi-ments, an influence of amtR deletion was not detectable(data not shown).

While the majority of genes investigated in the wild typeshowed a low basal transcription during growth in nitro-gen-rich medium, which was increased upon nitrogenstarvation, two genes showed a more complex expressionpattern. When transcription of gluA and NCgl1915 codingfor components of ABC transporters for the uptake ofglutamate and a putative oligopeptide uptake system was

Table 1. Putative AmtR-regulated genes identified by bioinformatics. Sequence and position of AmtR binding sites are indicated.

Gene (NCBI accession no.) AmtR binding sequence Position Reference

amtA (NCgl1521) TTTTTACCTATCGTTCTATAGATTTCTG −103 to −76 Jakoby et al. (2000)GTATTTTCTATTCCGCTATAGATAAACC −66 to −39

amtB (NCgl 1983) ATATTTTCTATAGTTTAACAGGTAATTT −186 to −159 Jakoby et al. (2000)GCTCTAACTATAGACCTACAGAAACTAA −118 to −91

codA (NCgl0075) ATCTATTCTATTGCTTGACAGGTATTAG −86 to −59 Bendt et al. (2004)crnT (NCgl0075) ATACTTTCTATAGATTGATAGAAATGTG

CCCTTTTCTATCAATCTATAGAAACTTG−81 to −54−35 to −8

Bendt et al. (2004)

gdh (NCgl 1999) TACAAATTGATAACCTAAAGAAATTTT −370 to −343 This studyglnA (NCgl2133) AAAGTTTTGATAGATCGACAGGTAATGC −151 to −124 Nolden et al. (2000)gluA (NCgl 1875) GCAATATCTATCATGTGATAGGTAAATT −195 to −168 This studygltB (NCgl0181) CGTTTTCCTATAGGTTGATCGAAAGTAA −117 to −90 Beckers et al. (2001)

TTATTATCGAACGATTGATAGAAACAGG −48 to −21hkm (NCgl0180) TTATTATCGAACGATTGATAGAAACAGG −181 to −154 This study

CGTTTTCCTATAGGTTGATCGAAAGTAA −112 to −85NCgl1099 TTATTTTCTATCAATCTATAGATACTAG −42 to −15 This studyNCgl1100 TTATTTTCTATCAATCTATAGATACTAG −43 to −16 This studyNCgl 1915 CAAATTTCTATCAAACTATAGAAAGATA −220 to −193 This studyureA (NCgl0083) AGTAGCGCTACATCTGCATATCTACCCC −135 to −108 Beckers et al. (2004)urtA (NCgl0893) CAACTACCTATAGGCTGACAGAAACTCT −70 to −43 Beckers et al. (2004)

CTAAAAACTATAGAGCTATAGAAACTTT −44 to −17

Highly conserved positions in these sequences are shown in bold. References indicate first report of AmtR-control of the corresponding genes.

AmtR-dependent regulation in C. glutamicum 585


investigated, these genes revealed a high basal expres-sion in the presence of ammonium and urea. In responseto depletion of nitrogen sources by centrifugation andsuspension in prewarmed medium without nitrogensources, expression of the two genes decreased in thefirst 10 min, but later increased to a slightly higher levelthan before starvation. In amtR deletion strain MJ6-18,transcription of these genes was significantly, but onlyslightly enhanced compared with the wild type. Theseresults hint to more than one regulatory mechanism con-trolling expression of these genes, e.g. carbon cataboliterepression or regulation by RNA degradation.

Quantification of AmtR repression by real-time PCR

As an independent assay for the quantification of the C.

glutamicum response to nitrogen deprivation, real-timePCR experiments were carried out for 12 genes (Table 3)which represent a total of 32 nitrogen-controlled genesdue to their transcriptional organization in operons. For anexact quantification of real-time PCR results, dilutionseries were tested for each pair of oligonucleotide primersto determine its PCR efficiency and the total amount ofRNA applied in the real-time PCR experiments wasexactly determined using RiboGreen. This method allowsnormalization of the results obtained without additionalcontrol reactions using housekeeping genes or 16S rRNA(Hashimoto et al., 2004).

AmtR-dependent regulation was verified for 10 of the12 genes tested by real-time RT-PCR. Factors for dere-pression of transcription in the amtR deletion strain com-pared with the wild type, which were obtained by this

Table 2. DNA microarray experiment.

Gene(NCBI accession no.)

Factor of transcription (mean ± SD)a

Transcriptional organization (reference) Function of gene product

Transport proteinsamtA (NCgl1521) 4.11 ± 2.02 amtA-ocd-soxA (this study) Methylammonium/ammonium permeaseamtB (NCgl1983) 2.25 ± 0.19 amtB-glnK-glnD (Jakoby et al., 2000) Ammonium transportercrnT (NCgl0075) 2.7 ± 2.28 crnT (Bendt et al., 2004) Creatinine transportergluA (NCgl1875) 3.05 ± 0.80 gluABCD (this study) Glutamate uptake system, ATP binding proteingluB (NCgl1876) 2.71 ± 0.58 gluABCD (this study) Glutamate uptake system, L-glutamate binding proteingluC (NCgl1877) 2.20 ± 0.41 gluABCD (this study) Glutamate uptake system, integral membrane componentNCgl 1915 4.37 ± 1.90

4.01 ± 1.49NCgl 1915–NCgl 1918 (this study)

Putative oligopeptide uptake system, oligopeptide-binding protein

NCgl 1916 3.62 ± 1.90 NCgl 1915–NCgl 1918 (this study) Putative oligopeptide uptake system, permease componentNCgl 1917 2.70 ± 0.64 NCgl 1915–NCgl 1918 (this study) Putative oligopeptide uptake system, permease componenturtA (NCgl0893) 3.75 ± 2.21 urtABCDE (Beckers et al., 2004) Urea binding proteinurtB (NCgl0894) 4.09 ± 0.96 urtABCDE (Beckers et al., 2004) ABC transporter for urea uptake, permease componenturtC (NCgl0895) 2.84 ± 0.60 urtABCDE (Beckers et al., 2004) ABC transporter for urea uptake, permease componentvanK (NCgl2302) 4.22 ± 1.46

3.46 ± 2.12vanABK (Merkens et al., 2005) Putative of major facilitator superfamily

Ammonium assimilationgltD (NCgl0182) 2.82 ± 0.18 gltBD (Beckers et al., 2001) Glutamate synthase (GOGAT), small subunitglnA (NCgl2133) 2.94 ± 1.50 glnA (Nolden et al., 2001a) Glutamine synthetase I (β-subtype)

Use of alternative nitrogen sourcescodA (NCgl0075) 2.70 ± 2.28 Not determined Creatinine deaminaseureA (NCgl0083) 2.79 ± 0.59 ureABCEFGD (Beckers et al., 2004) Urease, γ subunitureB (NCgl0084) 3.54 ± 1.20 ureABCEFGD (Beckers et al., 2004) Urease, β subunitureC (NCgl0085) 3.08 ± 1.05 ureABCEFGD (Beckers et al., 2004) Urease, α subunitureE (NCgl0086) 4.35 ± 1.93 ureABCEFGD (Beckers et al., 2004) Urease accessory proteinureF (NCgl0087) 2.22 ± 0.77 ureABCEFGD (Beckers et al., 2004) Urease accessory protein

Signal transductionglnK (NCgl1982) 2.36 ± 0.74 amtB-glnK-glnD (Jakoby et al., 2000) GlnK (PII-type signal transduction protein)

Miscellaneous or unknown functionsNCgl2787 2.70 ± 0.64 Not determined Putative flavoprotein involved in K+-transportocd (NCgl1520) 2.88 ± 0.61 amtA-ocd-soxA (this study) Putative ornithine decarboxylasesoxA (NCgl1519) 2.92 ± 0.98 amtA-ocd-soxA (this study) Putative sarcosine oxidasevanA (NCgl2300) 12.05 ± 8.98

12.05 ± 8.96vanABK (Merkens et al., 2005) Vanillate demethylase

vanB (NCgl2301) 6.83 ± 1.676.83 ± 1.67

vanABK (Merkens et al., 2005) Vanillate demethylase

NCgl1099 2.17 ± 0.96 Not determined Putative hydrolase

The transcriptome of the wild type and of amtR deletion mutant MJ6-18 grown in nitrogen-rich standard minimal medium was compared in threeindependent experiments (biological replicates). Each DNA microarray covered the genome threefold (technical replicates).a. For some genes two different PCR products were spotted on the microarray.



approach, were in general higher than in the DNA micro-array experiments. Obviously, the microarray techniqueleads to a quenching of the response signal. Only for gluAand NCgl1915 regulation could not be verified, most likelydue to the ‘non-standard’ regulation of these genes (seeFig. 5).

Gel shift experiments

In addition to the RNA hybridization experiments, for thegenes codA, crnT, glnA, NCgl1099 and NCgl1100 as wellas for the operons amtB-glnK-glnD, gluABCD, gltBD and

NCgl 1915-NCgl 1918, ureABCEFGD and urtABCDEAmtR-dependent regulation was verified by gel retarda-tion experiments. Digoxygenin-labelled primers or PCRfragments comprising the DNA motif(s) identified by thebioinformatics approach were used together with cell

Fig. 4. Transcriptional organization of AmtR-regulated gene clusters. Reverse transcriptase (RT)-PCR using primers annealing to (A) amtA and soxA (B) gluA and gluD and to (C) NCgl 1915 and NCgl 1918. Total RNA was used as a template isolated from wild-type strain ATCC 13032 grown in nitrogen-rich minimal medium (1, 5) and after 30 min of nitrogen starvation (2, 6), and from amtR deletion strain MJ6-18 grown under nitrogen surplus (3, 7) and starved for nitrogen (4, 8). The RT-PCR products showed the expected size for the differ-ent operons (1.8, 2.1 and 3.5 kb respectively). Control reactions with-out the addition of RT (5, 6, 7 and 8) gave no PCR product validating that the RNA preparations used were DNA-free. Sizes of DNA marker bands are indicated.

amtA-ocd-soxA

gluABCD

NCgl1915-1918

1929

1371 1264

702

5687482243243675

2323

14140845372426369

1 2 3 4 5 6 7 8

5687 4822 4324 3675 2323

8453 7242 6369

5687 4822 4324 3675 2323

8453

72426369

Fig. 5. RNA hybridization experiments. Total RNA (1 μg per slot) was prepared from wild type grown in nitrogen-rich minimal medium (lane 1) and after 5, 15 and 30 min of nitrogen limitation (lanes 2–4) as well as from amtR deletion strain MJ6-18 grown in nitrogen-rich minimal medium (5) and incubated in nitrogen-free medium for 30 min (6).

1 2 3 4 5 6

amtB

gltB

glnA

crnT

codA

amtA

gluA

NCgl1915

NCgl1099

NCgl1100

ureA

urtA



extracts of E. coli cells carrying an amtR expression plas-mid or the vector without amtR gene for control. For allDNA regions mentioned above, a gel shift was observed.This could be prevented by the addition of unlabelledprimers comprising the estimated binding sequences. Inall cases, a surplus of these oligonucleotides suppressedbinding of AmtR to the digoxigenin-labelled PCR fragment(Fig. 6). Interestingly, a direct correlation of the number ofpredicted AmtR binding sites and the number of observedbands with decreased electrophoretic mobility was onlyobserved in the case of glnA and urtA. For several pro-moters, namely the amtB, crnT, gltB, NCgl1099 andNCgl1100 upstream region less shifted bands thanexpected were found, while for codA, glnA, NCgl1915 andureA the number of shifted bands exceeded the predictedbinding sites. These results might reflect different bindingaffinities and binding of AmtR multimers.

Only one gene cluster, which was found to be highlyexpressed in response to nitrogen starvation and whichshowed deregulated transcription in an amtR deletionstrain, the vanABK operon, exhibits no AmtR binding siteand shows consequently no electrophoretic motility shiftin response to AmtR addition in the gel retardation assay(Merkens et al., 2005). Obviously, these genes are regu-lated indirectly by AmtR. The exact control mechanism isunclear.

Two-dimensional gel electrophoresis

In principle, the alteration observed on the level of geneexpression should be reflected by the protein pattern ofthe cell. To show such changes in the concentration ofdistinct proteins, proteome analyses were carried out.Cytoplasmic protein fractions from wild type and amtRmutant cells grown in nitrogen-rich standard minimalmedium were prepared and separated by two-dimen-sional gel electrophoresis. After staining with colloidalCoomassie brilliant blue several spots with increased size

and intensity were observed in the protein pattern of amtRdeletion strain MJ6-18 (Fig. 7). These spots were excisedand subjected to tryptic in-gel digest and MALDI-TOF-MSfingerprint analysis. By this approach five out of sevenurease subunits, namely UreA, UreB, UreC, UreE andUreF, were identified, besides creatinine deaminase,glyceraldehyde-3-phosphate dehydrogenase, subunitA of vanillate demethylase, acetyl-CoA hydrolase, theNCgl1099 gene product, and a putative catalase.

While urease subunits, creatinine deaminase andNCgl1099 were shown to be under direct AmtR control bybioinformatics and transcript analyses and vanillate dem-ethylase is indirectly regulated by AmtR (see transcrip-tome analyses presented above and Merkens et al.,2005), three proteins identified were encoded by genes

Table 3. Real-time RT-PCR.

Gene name NCgl number Factor of upregulation

crnT NCgl0074 168 ± 2codA NCgl0075 35 ± 2.0ureA NCgl0083 24 ± 3gltB NCgl0181 591 ± 2urtA NCgl0893 1581 ± 2– NCgl1099 32 ± 1– NCgl1100 41 ± 2amtB NCgl1983 137 ± 2amtA NCgl1521 415 ± 2glnA NCgl2133 8 ± 2gluA NCgl1875 1.0 ± 1.6– NCgl1915 1.5 ± 1.4

RNA isolated from the wild-type ATCC 13032 and amtR-deletionmutant MJ6-18 grown in nitrogen-rich minimal medium was used astemplate for quantification of expression of the indicated genes.

Fig. 6. Gel retardation experiments. Increasing amounts of AmtR-containing E. coli cell extracts (lanes 1–5: 0, 0.5, 5, 50 and 100 ng protein, respectively) were added to a digoxigenin-labelled DNA frag-ments (0.4 ng) from the different promoter regions spanning the iden-tified putative AmtR binding sites. As a control, 10 ng of unlabelled oligonucleotides spanning the putative AmtR binding site were added to 5 ng (6) or 50 ng AmtR (7) to suppress binding to the labelled DNA.

NCgl1099/NCgl1100

1 2 3 4 5 6 7 1 2 3 4 5 6 7

codA

ureA

gluA

NCgl1915

glnA crnT

gltB

urtA

amtB



which were not observed in the bioinformatics or tran-scriptome analyses and are therefore considered to benot part of the AmtR regulon. The appearance of theseproteins, namely glyceraldehyde-3-phosphate dehydroge-nase, acetyl-CoA hydrolase and a putative catalase, mightbe the result of a post-translational processing event dueto metabolic perturbations caused by the absence ofAmtR. For example, phosphorylation which would resultin the appearance of a new spot shifted to the acidic pHrange of the gel was already shown for C. glutamicumglyceraldehyde-3-phosphate dehydrogenase (Bendtet al., 2003).

Discussion

Methodological considerations

Different methods to analyse AmtR-dependent transcrip-tion were used in this study. When transcriptome analysesusing DNA microarrays were performed, in general lowfactors of transcriptional changes, not higher than 20-fold,were determined. This low signal intensity of DNA microar-rays was also observed by others (for review, see Conwayand Schoolnik, 2003), making an independent quantifica-tion of transcriptional changes, for example by real-timeRT-PCR assays, necessary. In fact, real-time PCRapproaches carried out in parallel in this study showedfactors for the increase of expression higher than 1500-fold and reflect the results of RNA hybridization experi-ments much better than the microarray data, e.g. for thestrictly regulated ammonium transporter-encoding genesamtA and amtB, for the gltBD operon coding for glutamatesynthase, and for urtA, the first gene of the urea trans-porter-encoding urtABCDE operon. Nevertheless, tran-scriptome analyses are a valuable tool for the globalcharacterization of bacterial regulatory networks, espe-cially in combination with other global analysis techniques.

AmtR, a new interaction partner of GlnK in C. glutamicum

Corynebacterium glutamicum GlnK is a typical member ofthe PII-type signal transduction protein family (for review,see Arcondéguy et al., 2001). Binding of these proteins tothe adenylyltransferase regulating glutamine synthetaseactivity (Jiang et al., 1998), two-component sensor kinase

DamtR wild type

3 3 4 4

5 5

6 7

6 7

1 1

2 2

9 9

1010

11

pH 4.2-4.4 pH 4.2-4.4

pH 4.3-4.5 pH 4.3-4.5

pH 5.0-5.2 pH 5.0-5.2

pH 5.0-5.2 pH 5.0-5.2

pH 5.2-5.4 pH 5.2-5.4

pH 5.2-5.4 pH 5.2-5.4

MW24Ø17

MW30Ø23

MW65Ø50

MW55Ø35

MW25Ø16

MW35Ø25

MW14Ø10

8 8

pH 6.0-6.2 pH 6.0-6.2

11

Fig. 7. Proteome analysis by two-dimensional gel electrophoresis. Protein profiles of ΔamtR strain MJ6-18 (left column) and wild type (right column) grown in minimal medium with high nitrogen supply were compared. Sections of cytoplasmic protein maps which revealed differences in three independent biological and technical replicates are shown. The following proteins were identified by peptide mass fingerprint analyses: (1) UreB, (2) UreG, (3) UreC, (4) acetyl CoA hydrolase, (5) a putative catalase, (6) vanillate demethylase subunit A, (7) creatinine deaminase, (8) glyceraldehyde-3-phosphate dehy-drogenase, (9) UreE, (10) UreA and (11) the NCgl1099 gene product.



NtrB (Jiang and Ninfa, 1999) and ammonium transportprotein AmtB (Coutts et al., 2002; Javelle et al., 2004) wasdescribed for E. coli. In Rhodobacter capsulatus PII

proteins interact with nitrogenase switch-off systemDraT/DraG, NtrB, NifA1 and NifA2 (Hallenbeck, 1992;Pawlowski et al., 2003) and in the diazotrophic bacteriumAzotobacter vinelandii interaction of PII with the NifA-NifLsystem was reported (Little et al., 2000). Recently, novelPII interaction partners were characterized in cyanobacte-ria (for recent review, see Herrero, 2004). For Synechoc-occus elongatus, it was shown that the PII signaltransduction protein controls arginine synthesis by com-plex formation with N-acetyl-L-glutamate kinase (Heinrichet al., 2004; Maheswaran et al., 2004). Besides in bacte-ria, protein interactions with GlnK were also reported inarchaea. For example, stable complexes of GlnK withglutamine synthetase were reported in the methanogenicarchaeon Methanosarcina mazei recently and a new reg-ulatory influence of GlnK on glutamine synthetase activitywas suggested (Ehlers et al., 2005).

Interaction of GlnK with different proteins in the variousorganisms depends on the modification status of the pro-tein. Unmodified GlnK activates for example phosphataseactivity of NtrB in enterobacteria, while activation of NifAin Rhodospirillum rubrum requires the modified, i.e. uridy-lylated form of this PII-protein (Zhang et al., 2004). InC. glutamicum interaction of native GlnK with the AmtBammonium transport protein was suggested based on theAmtB-dependent membrane sequestration of GlnK afteran ammonium pulse following a period of nitrogen starva-tion (Strösser et al., 2004). In this study, we identified anovel GlnK receptor, the AmtR protein. AmtR, the masterregulator of nitrogen control in C. glutamicum, is a TetR-type repressor protein with an N-terminally located helix-turn-helix motif for DNA binding. Typically, these class oftranscriptional regulators bind small effector molecules,e.g. tetracycline, in order to fulfil their function. In thiscase, however, protein complex formation between AmtRand GlnK was shown. Only the adenylylated form of GlnK,which is present in a situation of nitrogen limitation is ableto bind AmtR. If small effector molecules influence ormodulate the interaction of the two proteins has to beinvestigated in future studies.

Characterization of the AmtR regulon

The C. glutamicum AmtR regulon was characterized by acombination of bioinformatics approaches and transcrip-tome analyses, which was also applied successfully toinvestigate the Bacillus subtilis Fur and TnrA regulon(Baichoo et al., 2002; Yoshida et al., 2003). Based onthese investigations, AmtR is the master regulator of nitro-gen metabolism on the level of transcription in C.glutamicum. Expression of 33 genes is directly controlled

by AmtR as indicated by bioinformatics and transcriptomeanalyses in this study. For further three genes, thevanABK operon, an indirect regulatory effect was shown(Merkens et al., 2005).

Different functional categories of genes regulateddirectly by AmtR, which were identified by bioinformaticsapproaches, DNA microarray analyses and operon deter-minations, have been observed. This includes genes cod-ing for proteins involved in transport (amtA, amtB, crnT,gluABCD AND NCgl1915–1918, urtABCDE), which allowthe uptake of alternative and low concentrated nitrogensources, ammonium assimilation (glnA, gltBD), utilizationof alternative nitrogen sources (codA, ureABCEFGD), sig-nal transduction (glnD, glnK) and proteins of unknown orputative function (NCgl1099, NCgl1100, ocd, soxA). Obvi-ously, C. glutamicum cells challenged with a situation ofammonium limitation try to scavenge nitrogen sourcesfrom the surrounding medium. A similar strategy wasdescribed for E. coli (Zimmer et al. 2000). In C.glutamicum, however, the rearrangement of different met-abolic pathways is an equally important response.

An AmtR binding site consensus motif was deducedfrom the target sequences obtained by the bioinformaticsapproach, which were subsequently verified by transcrip-tome analyses and gel retardation assays. The resultingAmtR box with the nucleotide sequence tttCTATN6AtAGat/aA (with bases represented by capital letters being highlyconserved) is a palindromic sequence (Fig. 8) and can belocated in the promoter region either on the sense orantisense strand. We assume that the strength of AmtRrepression is modulated by the number of AmtR bindingsites and the conservation of the motif.

Experimental procedures

Strains and growth conditions

Strains and plasmids used in this study are listed in Table 4.Bacteria were routinely grown at 30°C (C. glutamicum) or37°C (E. coli). If appropriate, antibiotics were added in stan-dard concentrations (Ausubel et al., 1987; Sambrook et al.,1989). In order to study the effects of nitrogen starvationunder highly comparable conditions, a standard inoculationscheme was applied. A fresh C. glutamicum culture in BHImedium was used to inoculate minimal medium (per litre 42 gMOPS, 20 g (NH4)2S04, 5 g urea, 0.5 g K2HPO4 × 3 H2O,0.5 g KH2PO4, 0.25 g MgSO4 × 7 H2O, 0.01 g CaCl2, 50 gglucose, 0.2 mg biotin, 10 mg FeSO4, 10 mg MnSO4, 1 mgZnSO4, 0.2 mg CuSO4, 0.02 mg NiCl2 × 6 H2O, 0.09 mgH3BO3, 0.06 mg CoCl2 × 6 H2O, 0.009 mg NaMoO4 × 2 H2O;pH adjusted to pH 7.0 using NaOH; Keilhauer et al., 1993)for overnight growth. This culture, with an overnight OD600 ofapproximately 25–30, was used to inoculate fresh minimalmedium to an OD600 of approximately 1, and cells were grownfor 4–6 h until the exponential growth phase was reached(OD600 approximately 4–5). To induce nitrogen starvation,cells were harvested by centrifugation and the pellet was



suspended in and transferred to prewarmed minimal mediumwithout nitrogen source. The nitrogen-deprived cells wereincubated at 30°C under aeration.

General molecular biology techniques

For plasmid isolation, transformation, and cloning standard

techniques were used (Ausubel et al., 1987; Sambrook et al.,1989). E. coli strains JM109 and JM110 were used as cloninghosts. Competent C. glutamicum cells were prepared accord-ing to van der Rest et al. (1999). Chromosomal C. glutamicumDNA was isolated as described (Eikmanns et al., 1994). DNAsequence analyses were carried out by the bioanalytics ser-vice unit at the Center for Molecular Medicine Cologne.

Fig. 8. The AmtR box of C. glutamicum. An AmtR binding consensus motif was established based on the binding sites predicted by bioinformatics analyses, which were verified by RNA hybridization analyses, real-time RT PCR and gel retardation tests. Putative binding sites upstream of unclear candidate genes (e.g. gdh and NCgl2787) and indirectly regulated genes (vanABK) were not introduced. The height of letters represents the frequency of the corresponding nucleotides in the AmtR box. The figure was generated using the WebLogo server (Crooks et al., 2004).

Table 4. Strains and plasmids used in this study.

Strains/plasmids Relevant genotype/description Reference

C. glutamicumATCC 13032 wild type Abe et al. (1967)MJ6-18 ΔamtR Jakoby et al. (2000)

E. coliJM109 F′ traD36 lacIq Δ(lacZ)M15 proA+B+/e14–

(McrA–) Δ(lac-proAB) thi gyrA96 (Nxr) endA1 hsdR17 (rk

–mk–) relA1 supE44 recA1

Yanisch-Perron et al. (1985)

JM110 F′ traD36 lacIq Δ(lacZ)M15 proA+B+/rpsL(Smr) thr leu thi lacY galK galT ara fhu dam dcm supE44 Δ(lac-proAB)

Yanisch-Perron et al. (1985)

PlasmidspEKEX2 E. coli–C. glutamicum shuttle vector, Knr, ptac,

lacI qEikmanns et al. (1991)

pEKEXglnK glnK ligated to pEKex2 for overexpression This studypGEM3z E. coli plasmid for in vitro transcription, Apr Promega, Mannheim, GermanypGEMamtA 0.5 kb internal amtA fragment in pGEM3z Jakoby et al. (2000)

Nolden et al. (2001b)pGEMamtB 1.0. kb internal amtB fragment in pGEM3z Jakoby et al. (2000)

Nolden et al. (2001b)pGEMcodA 0.5 kb internal amtA fragment in pGEM3z Bendt et al. (2004)pGEMcrnT 0.5 kb internal crnT fragment in pGEM3z Bendt et al. (2004)pGEMgltB 0.5 kb internal gltB fragment in pGEM3z Beckers et al. (2001)pGEMgluA 0.5 kb internal gluA fragment in pGEM3z This studypGEMNCgl1099 0.5 kb internal NCgl1099 fragment in pGEM3z This studypGEMNCgl1100 0.5 kb internal NCgl1100 fragment in pGEM3z This studypGEMNCgl1362 0.5 kb internal NCgl1362 fragment in pGEM3z This studypGEMNCgl 1915 0.5 kb internal NCgl1915 fragment in pGEM3z This studypGEMglnA 0.5 kb internal glnA fragment in pGEM3z This studypGEM-urtA 0.5 kb internal urtA fragment in pGEM-3z Beckers et al. (2004)pGEM-ureA 0.3 kb internal ureA fragment in pGEM3z Beckers et al. (2004)pQE60 His-tag expression vector, Apr Qiagen, Hilden, GermanypQE60-amtR amtR gene in pQE60, C-terminal His-tag This study

r (superscript), resistance to; Ap, ampicillin; Kn, kanamycin; Nx, nalidixic acid; Sm, streptomycin.



Construction of an expression vector for the production of AmtR-His6

The amtR gene was amplified by PCR using chromosomalDNA as template and the following oligonucleotides:5′-GCGCGCGAATTCTATGGCAGGAGCAGTGGGA-3′/5′-GCGCGCGGATCCTTTCGCGTCAGCCTGCTTG-3′. The 0.7 kbPCR product was ligated to plasmid pQE60 using the EcoRIand BamHI sites introduced by the oligonucleotide primers(shown in bold) and the resulting plasmid, pQE60-amtR wassequenced for control.

Construction of a GlnK-delivery plasmid

The glnK gene was amplified by PCR using chromosomalDNA as template and the following oligonucleotides:5′-GCGCGCGGATCCATGAAACTCATCACCGCAATT-3′/5′-GCGCGCGAATTCTTAAAGGGCTGCTTCGCCG-3′. The PCRproduct was ligated to plasmid pEKEX2 using the BamHI andEcoRI sites introduced by the oligonucleotide primers (shownin bold). The resulting plasmid, pEKEXglnK was sequencedfor control.

Construction of antisense probes

For the generation of antisense probes internal DNA frag-ments of the corresponding genes were amplified by PCRand cloned into plasmid pGEM plasmids (Promega, Man-nheim, Germany) using restriction sites added to the primersequence (Table 5). For cloning of the ureA gene fragmentan EcoRI and an HindIII site was introduced (primer se-quences: 5′-GCGCGCGAATTCCGTCGCCGTAAAGATCG-3′/5′-GCGCGCAAGCTTATCAAACGTTGCTTCAACC-3′), andfor the urtA probe an EcoRI and a HindIII restriction site wasadded (5′-GCGCGCGAATTCGGCTTGGACTTTGAAGACG-3′/5-GCGCGCAAGCTTCACCGTGATCAACAAATGG-3′) toinsert the PCR products into plasmid pGEM-3z. The hybrid-ization probes were produced by in vitro transcription usingthe SP6-polymerase.

RNA preparation, hybridization analysis and RT-PCR

Total RNA was prepared after disruption of C. glutamicumcells by glass beads using the RNeasy Mini Kit (Qiagen,Hilden, Germany). For hybridization experiments the RNA(approximately 5 μg per sample, diluted in 10× SSC) wasspotted onto nylon membranes. After drying and UV fixation(120 mJ cm−2), hybridization was carried out as described(Roche, Mannheim, Germany; ‘DIG application guide’). ForRT-PCR the OneStep RT-PCR Kit (QIAGEN, Hilden, Ger-many) was used.

Real-time RT-PCR

For real-time RT-PCR, a TaqMan device (Applied Biosystems,CA, USA), the QuantiTect SYBR Green RT-PCR kit (Qiagen,Hilden, Germany), 0.5 μM primers (Table 5) and 100 ng oftemplate RNA were used. Reverse transcription was carriedout at 50°C for 30 min, the RT was inactivated and the poly-

merase activated by 15 min incubation at 94°C, PCR wascarried out by 40 cycles of the following program: DNA dena-turation for 15 s at 94°C, primer annealing for 30 s at 60°C,and DNA polymerization for 30 s at 72°C. All experimentswere carried out at least in triplicate with templates fromindependent cultures. For an exact quantification of real-timePCR results, dilution series were tested for each pair ofprimers to determine its PCR efficiency and the total amountof RNA applied in the real-time PCR experiments was deter-mined using the RiboGreen RNA Quantitation Kit (MolecularProbes, Eugene, OR).

Gel retardation experiments

To investigate AmtR binding gel-shift assays were carried out.For the upstream region of the different genes PCR-gener-ated DNA fragments spanning the corresponding putativeAmtR binding sites were labelled with digoxigenin using theDIG Oligonucleotide 3′-End Labelling Kit, 2nd Generation(Roche, Mannheim, Germany). The labelled DNA was incu-bated for 20 min on ice with different amounts of AmtR-containing E. coli cell extract (DH5αmcr pUC11-1.8) or con-trol extract lacking AmtR (DH5αmcr pUC18) or with purifiedAmtR protein. The formation of unspecific DNA–protein com-plexes was minimized by adding sheared salmon sperm DNA(Eppendorf, Hamburg, Germany) and BSA (AppliChem,Darmstadt, Germany). DNA–protein complexes were sepa-rated from free DNA on a non-denaturing 6% polyacrylamide-TBE gel by electrophoresis at 20 mA. The DNA was blottedonto a positively charged nylon membrane (Roche, Man-nheim, Germany) and the digoxigenin-labelled DNA wasdetected with a Fuji luminescent image analyzer LAS1000(Raytest, Straubenhardt, Germany).

Transcriptome analyses using DNA microarrays

Custom-made microarrays were manufactured by GeneScanEurope AG (Freiburg, Breisgau). Altogether 3556 PCR-products were spotted in triplicate on aminosilan-coatedglass slides (CMT_GAPS, Corning GmbH, Wiesbaden). Fortranscriptome analyses 50 μg RNA were concentrated to avolume of 20 μl, mixed with 10 μl random-primers (100 nM,hexamer:octamer ratio 1:1) and denatured at 70°C. Aftercooling down 3 μl Cy3 or Cy5 dUTP (Amersham Biosciences,Freiburg, Germany) were added. Then a mixture containing1 μl nucleotide mix (25 mM dATP, dGTP, dCTP and 5mMdTTP), 10 μl first strand buffer (5×, Gibco, Eggenstein),5 μl 100 mM DTT and 2 μl superscript II RT (200 U μl−1,Gibco, Eggenstein) was apposed and held for 10 min at RTand subsequently for 110 min at 42°C. The RT activity wasinactivated incubation for 10 min at 70°C after the addition of2.5 μl EDTA (20 mM) and 2.5 μl NaOH (500 mM). NaOH wasneutralized by the addition of 2.5 μl HCl (500 mM). Purifica-tion of the cDNA was rendered possible by the High PurePCR Product Purification Kit (Roche, Mannheim).

The Cy3 and Cy5 marked cDNAs were mixed in a ratio of1:1. After the addition of 3 μl herring sperm DNA solution(10 mg ml−1), the composition was again denatured for 5 minat 95°C and cooled down rapidly. The solution was thenbrought onto the microarray. Hybridization was carried out



Name Sequence

RNA hybridization experimentscodA-1 GCGCGCGAATTCACGTAGATGTCACCGATCCcodA-2 GCGCGCAAGCTTGCATACTGCAAAACGAACCgluA-1 GCGCGCGAATTCTCGAAATCGATGGAAAGGgluA-2 GCGCGCCTGCAGTGCACGATCAGACTTAGGGNCgl1099-1 GCGCGCGAGCTCATCAGTGGGACACCCTAGCNCgl1099-2 GCGCGCCTGCAGCGGGTTAGCTCGATTGCNCgl1100-1 GCGCGCGAATTCGTGGATATGTGGTCCATGCNCgl1100-2 GCGCGCAAGCTTAGCTTCCCAAAGAAACAGCNCgl 1915-1 GCGCGCGAATTCGCAACACCAACGAAGTAGGNCgl 1915-2 GCGCGCCTGCAGGGTGTAGTCCGCGTTAGGureA-1 GCGCGCGAATTCCGTCGCCGTAAAGATCGureA-2 GCGCGCAAGCTTATCAAACGTTGCTTCAACCurtA-1 GCGCGCAAGCTTCACCGTGATCAACAAATGGurtA-2 GCGCGCGAATTCGGCTTGGACTTTGAAGACG

Organization of gene clustersOB-amt-ocd-soxA-1 CTGGAAGAAGGGACACCGOB-amt-ocd-soxA-2 GCCATGCGAAACAGTCGGOB-gluABCD-1 GATCGTGTGTTGTTCATGGCOB-gluABCD-2 GTTTGGGAATTGATGAACGGOB-NCgl 1915–1918-1 GCACGCTGTCCTCCTACTTCOB-NCgl 1915–1918-2 GTCGATTTACCTGAACCGGA

Real-time RT-PCRamt_realtime 1 GCGTCCACACAACCTTCCACamt_realtime 2 GCGGTACCACCATTGAATCCamtB-realtime 1 AGTGGTGGTGGCATGGATGamtB-realtime 2 GAATGCGATGAGCGCAGTAAcodA realtime 1 TCGCCACAGAATGAGACACCcodA realtime 2 CCCGATTTGTCGAAGTCCTCcrnT-realtime 1 GGCTGTTGCTGCGAATACAACcrnT-realtime 2 GACGGCACCTCCATCAACTCglnA-realtime 1 TCCATTCCACAGGCACCAAglnA-realtime 2 GACGTCAGACCGGTGAGGATgltB-realtime 1 GCAGCATGCAACTCGTTCTGgltB-realtime 2 CCCAAGCGAGTGGATTGATCgluA realtime 1 ACCTGCGATGAACCCAAAGATgluA realtime 2 CCATGACGTCCAACACTTCGTNCgl1099 realtime 1 GTAGTGGCAATGCGCAGTTGNCgl1099 realtime 2 TTCTGAGCTGGACCGACGATNCgl1100 realtime 1 TCCCAGTCCATAGCCGTTTCNCgl1100 realtime 2 TCGGAATCTGGCACCTCAANCgl 1915 realtime 1 CGACGGCGTGAAGTTCATCTNCgl 1915 realtime 2 GATAGCGTCCAGCACATCCAAureA realtime 1 TCGCCCTCATCACGTATGAAureA realtime 2 TCAAAATGGTGCTTCCCCAGurtA realtime 1 TTCTTCCGCCAGTACAACAGCurtA realtime 2 CGATGCCTCCGACTTCTTCTT

Gel retardation experimentsamtB-gr-1 CCAGCTCTAACTATAGACCTACAGAAACTAATTTCamtB-gr-2 CAATACATCTATAGAATAGGTTTTGGAGGGamtB-gr-3 GGATATTTTCTATAGTTTAACAGGTAATTTAATGamtB-GS-1 CCTTTTGGGATTGACACCamtB-GS-2 TTTGCCTGGGTACCACCcodA-gr CCAGATGCTATCTATTCTATTGCTTGACAGGTATTAGTGcrnT-gr-1 AAACTCCCTTTTCTATCAATCTATAGAAACTTGCAAAATCcrnT-gr-2 AAGTCATACTTTCTATAGATTGATAGAAATGTGGGGAGcrnT-GS-1 GAGGGCTTTATCATCGCCcrnT-GS-2 CTGGAACATCTAACAGCCCglnA-gr AAGTTTTGATAGATCGACAGGTAATGCATTATACgltBD-gr-1 CCTCCCGTTTTCCTATAGGTTGATCGAAAGTAACCgltBD-gr-2 CTTATTATCGAACGATTGATAGAAACAGGATTAgltBD-GS-1 GGTGGATAGGCGAACATCgltBD-GS-2 CCTTGTGGTTTCATGCGGgluA-gr AACACGCAATATCTATCATGTGATAGGTAAATTTCGGNCgl1099/1100-gr CTAAATTATTTTCTATCAATCTATAGATACTAGGTCTATTNCgl1915-gr CTCACAAATTTCTATCAAACTATAGAAAGATATTTGureA-gr-1 CAGTGAAAAGAGAATTCTATAGGACGCCAGACTTAGureA-gr-2 GCTTCATTTTTAAGGGGGTAGATATGCAGATGTAGCGCureA-gr-3 GCTAAACTAATTTCTGTTACCTGACAGAAAGGGGCAAureA-GS-1 TCATCGGTGCAAGCTTACGureA-GS-2 AGTGATATGCAATTTTGCCCurtA-gr-1 CAAAAACAACTACCTATAGGCTGACAGAAACTCTAAurtA-gr-2 ACTCTAAAAACTATAGAGCTATAGAAACTTTAACTTurtA-GS-1 GGCTGAAATGTAAGACACGurtA-GS-2 GGACGGGACATGAATACC

Table 5. Oligonucleotide primers used in thisstudy. Restriction sites added to the primersequences are written in bold letters.



over night in a hybridization chamber (Vysis HYBrite, AbbottDiagnostika, Wiesbaden) at 50°C. Subsequently, the microar-ray was washed first two times with 2× SSC, 0.2% SDS, thentwice in 1× SSC, 0.1% SDS, followed by one washing stepin 0.5% SSC and once in distilled water. Hybridization signalswere detected by a GSI-Lumonics laser scanner (ScanArray400, Perkin Elmer, Wellesley, MA) and analysed using theQuantArray software package version 3.0.0.0 (PackardBio-Science, Meriden, CT). For global and local normalization ofdata and graphical output the GeneSpring 3.2.12 softwarepackage (Silicon Genetics, Redwood City, CA) was used. Toavoid problems due to different labelling efficiencies by Cy3and Cy5, dye switch experiments were carried out.

Two-dimensional gel electrophoresis and MALDI-TOF-MS

Corynebacterium glutamicum cells were disrupted usingglass beads and a Q-BIOgene FastPrep FP120 instrument(Q-BIOgene, Heidelberg, Germany) in the presence of pro-teinase inhibitor Complete as recommended by the supplier(Roche, Mannheim, Germany). Membranes were removedfrom the cell extract by ultracentrifugation (Hermann et al.,1998; 2000; 2001) and the cytoplasmic proteins were furtheranalysed. Protein concentrations were determined using theRoti-Nanoquant assay (Roth, Karlsruhe, Germany).

For isoelectric focusing (IEF) 24 cm precast IPG strips pI4–7 and an IPGphor IEF unit (Amersham Biosciences,Freiburg, Germany) were used as described (Hermann et al.,2000). 120 μg of protein were focused for 68 000 Vh in asample buffer containing 6 M urea, 2 M thiourea, 4% CHAPS,0.5% Pharmalyte (3–10) and 0.4% DTT. For the seconddimension electrophoresis was carried out using precast 12–14% polyacrylamide linear gradient gels (ExcelGel GradientXL 12–14, Amersham Biosciences, Freiburg, Germany) inthe Multiphor II apparatus as described (Hermann et al.,2000; 2001). After electrophoresis 2-D gels were stained withcolloidal Coomassie brilliant blue. The Coomassie-stainedgels were aligned using the Delta2D software, version 3.1(Decodon, Greifswald, Germany). MALDI-TOF-MS for pep-tide mass fingerprint analyses was carried out by the bioan-alytics service unit at the Center for Molecular MedicineCologne.

Affinity purification of AmtR and GlnK coprecipitation

For affinity purification of AmtR∼His6 and coprecipitationexperiments, E. coli cell extract was prepared from strainJM109 pQE60-amtR grown to an OD600 of approximately 0.6and then induced with 1 mM IPTG for 5 h. The cells werelysed using glass beads and a Q-BIOgene FastPrep FP120instrument (Q-BIOgene, Heidelberg, Germany), cell debriswas removed by centrifugation and approximately 45 μg ofcell extract were loaded on a 12 ml ‘Ni Sepharose HighPer-formance’ (Amersham Biosciences, Freiburg, Germany). Thecolumn was washed with 10 volumes of 300 mM NaCl,50 mM NaH2PO4 and 20 mM imidazol (pH 8.0). Subse-quently, 25 mg C. glutamicum cell extract prepared accordingto Strösser et al. (2004) was applied on the column. Thecolumn was washed (see above) and bound proteins wereeluted using the following buffer: 300 mM NaCl, 50 mMNaH2PO4 and 500 mM imidazol (pH 8.0).

Bioinformatic analyses

The recently published genome sequence of C. glutamicumtype strain ATCC 13032 (Kalinowski et al., 2003) wasscreened for putative AmtR binding sequences essentially asdescribed by Rey and coworkers for the genome-widescreening of McbR binding sites (Rey et al., 2005). The AmtRbinding sites found upstream of amtA, amtB, glnA and gltBwere aligned and used to create an Hidden Markov modelusing the HMMER 2.1.1 software package (http://hmmer.wustl.edu). The calculated HMM was applied toscreen the C. glutamicum genome sequence for the pres-ence of putative AmtR binding sites. In addition, theFUZZNUC program package (http://www.hgmp.mrc.ac.uk/Software/EMBOSS/) was used to identify new AmtR bindingsites.

Acknowledgements

The authors wish to thank Jennifer Brehme and Astrid Wirtzfor excellent technical assistance in DNA microarray analy-ses and protein purification experiments. This work was sup-ported by the Deutsche Forschungsgemeinschaft (SFB635/TP17 and BU894/1–3) and by the Bundesministerium fürBildung und Forschung (GenoMik program).

References

Abe, S., Takayama, K., and Kinoshita, S. (1967) Taxonomicalstudies on glutamic acid-producing bacteria. J Gen Micro-biol 13: 279–301.

Arcondéguy, T., Jack, R., and Merrick, M. (2001) PII signaltransduction proteins, pivotal players in microbial nitrogencontrol. Microbiol Mol Biol Rev 65: 80–105.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,Seidman, J.G., Smith, J.A., and Struhl, K. (1987) CurrentProtocols in Molecular Biology. New York: Greene Publish-ing Associates and Wiley Interscience. John Wiley andSons.

Baichoo, N., Wang, T., Ye, R., and Helmann, J.D. (2002)Global analysis of the Bacillus subtilis Fur regulon and ironstarvation stimulon. Mol Microbiol 45: 1613–1629.

Beckers, G., Nolden, L., and Burkovski, A. (2001) Glutamatesynthase of Corynebacterium glutamicum is not essentialfor glutamate synthesis and is regulated by the nitrogenstatus. Microbiology 147: 2961–2970.

Beckers, G., Bendt, A.K., Krämer, R., and Burkovski, A.(2004) Molecular identification of the urea uptake systemand transcriptional analysis of urea transporter- andurease-encoding genes in Corynebacterium glutamicum.J Bacteriol 186: 7645–7652.

Bendt, A.K., Krämer, R., Burkovski, A., Schaffer, S., Bott, M.,Busker, E., et al. (2003) Towards a phospho-proteome mapof Corynebacterium glutamicum. Proteomics 3: 1637–1646.

Bendt, A.K., Beckers, G., Silberbach, M., Wittmann, A., andBurkovski, A. (2004) Utilization of creatinine as an alterna-tive nitrogen source in Corynebacterium glutamicum. ArchMicrobiol 181: 443–450.

Burkovski, A. (2003a) I do it my way: regulation of ammonium

http://hmmer.wustl.edu

http://hmmer.wustl.edu

http://www.hgmp.mrc.ac.uk/Software/EMBOSS

http://www.hgmp.mrc.ac.uk/Software/EMBOSS



uptake and ammonium assimilation in Corynebacteriumglutamicum. Arch Microbiol 179: 83–88.

Burkovski, A. (2003b) Ammonium assimilation and nitrogencontrol in Corynebacterium glutamicum and its relatives:an example for new regulatory mechanisms in actino-mycetes. FEMS Microbiol Rev 27: 617–628.

Burkovski, A. (2005) Nitrogen metabolism and its regulation.In Handbook of Corynebacterium glutamicum. Bott, M.,and Eggeling, L. (eds). Boca Raton, FL: CRC Press LLC,333–349.

Conway, T., and Schoolnik, G.K. (2003) Microarray expres-sion profiling: capturing a genome-wide portrait of the tran-scriptome. Mol Microbiol 47: 879–889.

Coutts, G., Thomas, G., Blakey, D., and Merrick, M. (2002)Membrane sequestration of the signal transduction proteinGlnK by the ammonium transporter AmtB. EMBO J 21:536–545.

Crooks, G.E., Hon, G., Chandonia, J.M., and Brenner, S.E.(2004) WebLogo: a sequence logo generator. GenomeRes 14: 1188–1190.

Eggeling, L., and Sahm, H. (2001) The cell wall barrier ofCorynebacterium glutamicum and amino acid efflux. J Bio-sci Bioeng 92: 201–213.

Ehlers, C., Weidenbach, K., Veit, K., Forchhammer, K., andSchmitz, R.A. (2005) Unique mechanistic features of post-translational regulation of glutamine synthetase activity inMethanosarcina mazei strain Gö1 in response to nitrogenavailability. Mol Microbiol 54: 1841–1854.

Eikmanns, B.J., Kleinertz, E., Liebl, W., and Sahm, H. (1991)A family of Corynebacterium glutamicum/Escherichia colishuttle vectors for cloning, controlled gene expression, andpromoter probing. Gene 102: 93–98.

Eikmanns, B.J., Thum-Schmitz, N., Eggeling, L., Lüdtke, K.-U., and Sahm, H. (1994) Nucleotide sequence, expressionand transcriptional analysis of the Corynebacteriumglutamicum gltA gene encoding citrate synthase. Microbi-ology 140: 1817–1828.

Hallenbeck, P.C. (1992) Mutations affecting nitrogenaseswitch-off in Rhodobacter capsulatus. Biochim BiophysActa 1118: 161–168.

Hashimoto, J.G., Beadles-Bohling, A.S., and von Wiren, K.M.(2004) Comparison of RiboGreen and 18S rRNA quantita-tion for normalizing real-time RT-PCR expression analysis.Biotechniques 36: 54–60.

Heinrich, A., Maheswaran, M., Ruppert, U., and Forchham-mer, K. (2004) The Synechococcus elongatus PII signaltransduction protein controls arginine synthesis bycomplex formation with N-acetyl-L-glutamate kinase. MolMicrobiol 52: 1303–1314.

Hermann, T. (2003) Industrial production of amino acids bycoryneform bacteria. J Biotechnol 104: 155–172.

Hermann, T., Wersch, G., Uhlemann, E.-M., Schmid, R., andBurkovski, A. (1998) Mapping and identification of Coryne-bacterium glutamicum proteins by two-dimensional gelelectrophoresis and microsequencing. Electrophoresis 19:3217–3221.

Hermann, T., Finkemeier, M., Pfefferle, W., Wersch, G.,Krämer, R., and Burkovski, A. (2000) Two-dimensionalelectrophoretic analysis of Corynebacterium glutamicummembrane fraction and surface proteins. Electrophoresis21: 654–659.

Hermann, T., Pfefferle, W., Baumann, C., Busker, E., Schaf-fer, S., Bott, M., et al. (2001) Proteome analysis of Coryne-bacterium glutamicum. Electrophoresis 22: 1712–1723.

Herrero, A. (2004) New targets of the PII signal transductionprotein identified in cyanobacteria. Mol Microbiol 52: 1225–1228.

Jakoby, M., Krämer, R., and Burkovski, A. (1999) Nitrogenregulation in Corynebacterium glutamicum: isolation ofgenes involved and biochemical characterization of thecorresponding proteins. FEMS Microbiol Lett 173: 303–310.

Jakoby, M., Nolden, L., Meier-Wagner, J., Krämer, R., andBurkovski, A. (2000) AmtR, a global repressor in the nitro-gen regulation system of Corynebacterium glutamicum.Mol Microbiol 37: 964–977.

Javelle, A., Severi, E., Thornton, J., and Merrick, M. (2004)Ammonium sensing in E. coli: the role of the ammoniumtransporter AmtB and AmtB–GlnK complex formation.J Biol Chem 279: 8530–8538.

Jiang, P., and Ninfa, A.J. (1999) Regulation of autophospho-rylation of Escherichia coli nitrogen regulator II by the PIIsignal transduction protein. J Bacteriol 181: 1906–1911.

Jiang, P., Peliska, J.A., and Ninfa, A.J. (1998) The regulationof Escherichia coli glutamine synthetase revisited: role of2-ketoglutarate in the regulation of glutamine synthetaseadenylylation state. Biochemistry 37: 12802–12810.

Kalinowski, J., Bathe, B., Bischoff, N., Bott, M., Burkovski, A.,Dusch, N., et al. (2003) The complete Corynebacteriumglutamicum ATCC 13032 genome sequence and its impacton the production of 1-aspartate-derived amino acids andvitamins. J Biotechnol 104: 5–25.

Keilhauer, C., Eggeling, L., and Sahm, H. (1993) Isoleucinesynthesis in Corynebacterium glutamicum: molecular anal-ysis of the ilvB-ilvN-ilvC operon. J Bacteriol 175: 5595–5603.

Kinoshita, S., Udaka, S., and Chimono, M. (1957) Amino acidfermentation. I. Production of L-glutamic acid by variousmicroorganisms. J Gen Appl Microbiol 3: 193–205.

Leuchtenberger, W. (1996) Amino acids – technical produc-tion and use. In Roehr, M. (ed.). Biotechnology, Vol. VI.Weinheim: VCH, pp. 466–501.

Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W.C.,and Dixon, R. (2000) Signal transduction to the Azoto-bacter vinelandii NIFL-NIFA regulatory system is influ-enced directly by interaction with 2-oxoglutarate and thePII regulatory protein. EMBO J 19: 6041–6050.

Maheswaran, M., Urbanke, C., and Forchhammer, K. (2004)Complex formation and catalytic activation by the PII sig-nalling protein of N-acetyl-L-glutamate kinase from Syn-echococcus elongates strain PCC 7942. J Biol Chem 279:55202–55210.

Merkens, H., Beckers, G., Wirtz, A., and Burkovski, A. (2005)Vanillate metabolism in Corynebacterium glutamicum. CurrMicrobiol 51: 59–65.

Nolden, L., Beckers, G., Möckel, B., Pfefferle, W., Nam-poothiri, K.M., Krämer, R., and Burkovski, A. (2000)Urease of Corynebacterium glutamicum: organization ofcorresponding genes and investigation of activity. FEMSMicrobiol Lett 189: 305–310.

Nolden, L., Farwick, M., Krämer, R., and Burkovski, A.(2001a) Glutamine synthetases in Corynebacterium



glutamicum: transcriptional control and regulation of activ-ity. FEMS Microbiol Lett 201: 91–98.

Nolden, L., Ngouoto-Nkili, C.-E., Bendt, A.K., Krämer, R., andBurkovski, A. (2001b) Sensing nitrogen limitation inCorynebacterium glutamicum: the role of glnK and glnD.Mol Microbiol 42: 1281–1295.

Pawlowski, A., Riedel, K.U., Klipp, W., Dreiskemper, P.,Groß, S., Bierhoff, H., et al. (2003) Yeast two-hybrid studieson interaction of proteins involved in regulation of nitrogenfixation in the phototrophic bacterium Rhodobacter capsu-latus. J Bacteriol 185: 5240–5247.

van der Rest, M.E., Lange, C., and Molenaar, D. (1999) Aheat shock following electroporation induces highly effi-cient transformation of Corynebacterium glutamicum withxenogeneic plasmid DNA. Appl Microbiol Biotechnol 52:541–545.

Rey, D.A., Nentwich, S.S., Koch, D.J., Rückert, C., Pühler,A., Tauch, A., and Kalinowski, J. (2005) The McbR repres-sor modulated by the effector substance S-adenosylho-mocysteine controls directly the transcription of a reguloninvolved in sulphur metabolism of Corynebacteriumglutamicum ATCC 13032. Mol Microbiol 56: 871–887.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-lar Cloning: a Laboratory Manual, 2nd edn. Cold SpringHabor, New York: Cold Spring Habor Laboratory Press.

Schulz, A.A., Collett, H.J., and Reid, S.J. (2001) Regulationof glutamine synthetase and glutamate synthase in

Corynebacterium glutamicum ATCC 13032. FEMS Micro-biol Lett 205: 361–367.

Strösser, J., Lüdke, A., Schaffer, S., Krämer, R., and Burk-ovski, A. (2004) Regulation of GlnK activity: modification,membrane sequestration, and proteolysis as regulatoryprinciples in the network of nitrogen control In Corynebac-terium Glutamicum. Mol Microbiol 54: 132–147.

Udaka, S. (1960) Screening method for microorganismsaccumulating metabolites and its use in the isolation ofMicrococcus glutamicus. J Bacteriol 79: 745–755.

Yanisch-Perron, C., Vieira, L., and Messing, J. (1985)Improved M13 phage cloning vectors and host strains:nucleotide sequences of M13mp18 and pUC19 vectors.Gene 33: 103–119.

Yoshida, K., Yamaguchi, H., Kinehara, M., Ohki, Y., Nakaura,Y., and Fujita, Y. (2003) Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrAbox. Mol Microbiol 49: 157–165.

Zhang, Y., Pohlmann, E.L., and Roberts, G.P. (2004) Identi-fication of critical residues in GlnB for its activation of NifAactivity in the photosynthetic bacterium Rhodospirillumrubrum. Proc Natl Acad Sci USA 101: 2782–2787.

Zimmer, D.P., Soupene, E., Lee, H.L., Wendisch, V.F., Kho-dursky, A.B., Peter, B.J., et al. (2000) Nitrogen regulatoryprotein C-controlled genes of Escherichia coli: scavengingas a defense against nitrogen limitation. Proc Natl AcadSci USA 97: 14674–14679.

Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum : mechanism and characterization of the AmtR regulon

Documents