Top Banner
Recombinant DNA Technology
38

Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Dec 25, 2015

Download

Documents

Georgina Willis
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Recombinant DNA Technology

Page 2: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Further Historical Perspective

Geneticists have known for a long time how to isolate DNA from cells.

Geneticists have known for a long time how to chop DNA into small pieces.

What geneticists did not know how to do until the early 1970s was to replicate small fragments of DNA.

Page 3: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

1970s Breakthrough

• The discovery of the restriction enzyme

(or restriction endonuclease).

Page 4: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Properties of RE

• Cut double-stranded DNA at specific target sites.

• Allow fragments of DNA that have been cut with the same RE to be rejoined.

Page 5: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 6: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

AnimationAnimation

• Recombinant DNA_Animation_1

• Recombinant DNA_Animation_2

Page 7: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

The joining of two DNA fragments by DNA ligase produces a recombinant DNA molecule

Page 8: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 9: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 10: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 11: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 12: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Therefore, eukaryotic DNA could be propagated in prokaryotic cells.

A great breakthrough!!!!!

Page 13: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Carriers of foreign DNA are Vectors:

• Most carriers are

• 1. Plasmids

• 2. Bacteriophages (viruses)

Page 14: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• A bacteriophage is a virus that

infects a bacteria.

Page 15: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 16: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Introduction to PCR• PCR (polymerase chain reaction)

• PCR is a means to enhance/replicate the amount of DNA collected (in vitro)

* p r c

Page 17: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

PCR Creates more DNA for Study

• PCR Animation

Page 18: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Add DNA polymerase, all 4 DNA building blocks ???

5’ CTGACGCTGCTGCATGCTAGCT 3’

3’ GACTACGACGACGTACGATCGA 5’

Page 19: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Primers are required:

5’ CTGACGCTGCTGCATGCTAGCT 3’

CGA 5’

5’ CTG

3’ GACTACGACGACGTACGATCGA 5’

Page 20: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Primers are required:

5’ CTGACGCTGCTGCATGCTAGCT 3’

. . . t a c g a t CGA 5’

5’ CTG a t g c t g . . . .

3’ GACTACGACGACGTACGATCGA 5’

Page 21: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 22: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 23: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 24: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 25: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Introduction to Agarose Gel Electrophoresis

Page 26: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Weigh out ~ a gram of agarose.

Page 27: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Mix the agarose with 50- 100 ml of buffer.

Page 28: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Heat to dissolve the agarose.

Page 29: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Assemble the gel tray and comb.

Page 30: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Pour the gel.

Page 31: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Pick up the DNA sample with a micro-pipettor.

Page 32: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Load one DNA sample into each well on the gel.

Page 33: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Connect the gel to a low voltage power supply.

Page 34: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

After completion of the run, add a DNA staining material and visualize the DNA

under UV light.

Page 35: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Analyze the results.

Page 36: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 37: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Gel Electrophoresis – demonstration

• Ensure you’re plugged into the web ;)

Page 38: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Electrophoresis Demo 1 – flash simulation

• Electrophoresis Demo 2 – java applet

• You need to be hooked to the web for these to work ;)