Page 1
The National Ribat University
Faculty of Graduate Studies
and Scientific Research
Assessment of the level and Phenotype of Haptoglobin and Association
between the Polymorphisms of A disintegrin amp metalloprotease (ADAM) 33
Interleukin-4 promoter (-590) Interleukin-4receptor promoter (-576) and
Glutathione S-transferase (GSTT1ampGSTPi) genes in Sudanese with asthma
A thesis submitted in fulfillment of the requirement of the PhD degree in Human
Physiology
By
Randa Elfadil Ibrahim abdalla
BScVeterinary Medicine -University of Khartoum
MSc human physiology- The National Ribat University 2010
Supervisor Prof Omer Abdel Aziz Musa
MBBS DTCD PhD
Co supervisor
Dr Hanan Babiker Eltahir
BSc MSc PhD Medical Biochemistry U of K 2007
2015
List of contents
Subjects Page
No
List of contents I
Dedication VI
Acknowledgement VII
Abstract (English) VIII
Abstract (Arabic) X
List of tables XII
List of figures XIV
Abbreviations XVI
Declaration XVIII
Chapter one
Introduction and literature review
1 Introduction 1
11 Asthma 1
111 Definition 1
112 Epidemiology and global prevalence of asthma 2
113 Prevalence of Asthma in Sudan 2
114 Causes 3
1141 Environmental causes 3
1142 Genetic causes 4
11421 Genetic Analysis of Asthma Susceptibility 5
115 Inflammatory cells in asthma 7
116 Pathophysiology 7
12 Haptoglobin (Hp) 9
121 Haptoglobin (Hp) phenotype 9
122 Haptoglobin as a Diagnostic Marker 10
1221 Conditions Associated With an Elevated Plasma Hp Level 10
1222 Conditions Associated With Decreased plasma Hp Level 10
123 Physiology and Functions of Haptoglobin 11
1231 Role of Hp in regulation of the immune system 11
1232 Inhibition of Prostaglandins 12
1233 Antibacterial Activity 12
1234 Antioxidant Activity 12
1235 Activation of neutrophils 13
1236 Role of Hp in angiogenesis 13
1237 Hp is required to induce mucosal tolerance 14
124 Hp and asthma 15
13 A disintegrin and metalloprotease (ADAM) 33 15
131 Physiological functions of ADAM33 16
1311 ADAM 33 as a morphogenetic gene 16
132 ADAM 33 as a biomarker of severe asthma 16
133 ADAM 33 gene polymorphisms and asthma 17
134 Role of the gene-environment interaction and ADAM33 in
development of asthma
19
14 Interleukins and asthma 19
141 Interleukin-4 (IL-4) 19
1411 Physiological functions of IL4 20
1412 Interleukin-4 gene and asthma 20
142 IL4 Receptor 21
1421 Physiological functions of IL4Rα 21
1422 Interleukin 4 receptor (IL-4Rα) gene and asthma 22
143 Interleukin 13 23
1431 Physiological functions of IL13 23
14311 IL-13 role in mucus production 24
14312 IL-13 in airway hyperresponsiveness 24
14313 Interleukin-13 in pulmonary fibrosis 24
1432 IL 13 and inflammatory pathways in asthma 24
1433 Anti-interleukin-13 antibody therapy for asthma 25
15 Glutathione S-transferases (GSTs) 25
151 Functions of GSTs 26
1531 The detoxication functions of GSTs 26
1532 The metabolic function of GSTs 26
1533 The regulatory function of GSTs 27
154 GSTs and asthma 27
155 Glutathione S-transferase Theta 1 (GSTT1) 28
156 Glutathione S-transferase Pi 1(GSTP1) 29
16 Diagnosis 29
17 Classification and severity 29
18 Prevention and management 31
19 Justification 32
110 Objectives 33
Chapter two
Materials and methods
2 1 Materials 34
211 Electronic spirometer 34
212 Gel electrophoresis 36
213 PCR machine 37
214 Primers 38
215 Maxime PCR PreMix Kit ( i-Taq) 38
216 UV Transilluminator JY-02S analyzer 39
217 Microplate reader 40
218 ELIZA kits 40
219 Vertical electrophoresis cell 41
22 Methods 42
221 Study design 42
222 Study area 42
223 Study population 42
224 Ethical consideration 42
225 Procedures 42
2251 Questionnaire 42
2252 Clinical examination 43
2253 Body Mass Index (BMI) 43
2254 Lung functions test 43
2255 Sampling technique 44
2256 Molecular analysis 44
22561 DNA extraction 44
22562 Agarose gel electrophoresis requirements for DNA and
PCR product
46
22563 Polymerase chain reaction (PCR) 49
22564 Restriction Fragment Length Polymorphism Analysis
(RFLPs)
50
2257 Laboratories Analysis 50
22571 Polyacrylamide Gel Electrophoresis (PAGE) 50
225711 Preparation of the reagents 51
225712 Separating gel preparation 52
225713 Stacking gel preparation 52
225714 Sample preparation and loading 52
225714 Protein staining 53
22572 ELISA 53
225721 Quantitative assay for total IgE antibodies 53
225722 Quantitative assay for total Haptoglobin 54
225723 Quantitative assay for total IL4 56
23 Method of data analysis 58
Chapter three
Results
31 Study group 59
32 Asthma Control Test (ACT) 62
33 lung function tests 62
34 Serum level of IgE and IL4 in asthmatic and control 63
341 Serum level of IgE in different classes of asthma 64
342 Serum level of IL4 in different classes of asthma 65
35 Haptoglobin phenotypes and Level 65
36 ADAM33 polymorphism in chromosome 20 69
37 IL4 (-590 CT) polymorphism in chromosome 5 72
38 IL4Rα (- Q576R) polymorphism in chromosome 16 74
39 GSTs polymorphism 76
391 GSTT1 polymorphism in chromosome 22 76
392 GSTPi polymorphism in chromosome 11 77
310 Frequencies of mutant genotypes 80
Chapter four
Discussion
4 Discussion 81
Chapter five
Conclusion and Recommendations
51 Conclusion 87
52 Recommendations 88
Chapter six
References and Appendices
References 89
Questionnaire 126
Asthma control test 128
Maxime PCR PreMix kit 129
BsmF1 enzyme 130
BsmA1enzyme 131
Msp1 enzyme 132
The component of toatl IgE Eliza Kit 133
The components of the haptoglobin kit 134
Reagent Preparation (haptoglobin kit) 135
The components of the IL4 kit 136
Reagent Preparation (IL4 kit) 137
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 2
List of contents
Subjects Page
No
List of contents I
Dedication VI
Acknowledgement VII
Abstract (English) VIII
Abstract (Arabic) X
List of tables XII
List of figures XIV
Abbreviations XVI
Declaration XVIII
Chapter one
Introduction and literature review
1 Introduction 1
11 Asthma 1
111 Definition 1
112 Epidemiology and global prevalence of asthma 2
113 Prevalence of Asthma in Sudan 2
114 Causes 3
1141 Environmental causes 3
1142 Genetic causes 4
11421 Genetic Analysis of Asthma Susceptibility 5
115 Inflammatory cells in asthma 7
116 Pathophysiology 7
12 Haptoglobin (Hp) 9
121 Haptoglobin (Hp) phenotype 9
122 Haptoglobin as a Diagnostic Marker 10
1221 Conditions Associated With an Elevated Plasma Hp Level 10
1222 Conditions Associated With Decreased plasma Hp Level 10
123 Physiology and Functions of Haptoglobin 11
1231 Role of Hp in regulation of the immune system 11
1232 Inhibition of Prostaglandins 12
1233 Antibacterial Activity 12
1234 Antioxidant Activity 12
1235 Activation of neutrophils 13
1236 Role of Hp in angiogenesis 13
1237 Hp is required to induce mucosal tolerance 14
124 Hp and asthma 15
13 A disintegrin and metalloprotease (ADAM) 33 15
131 Physiological functions of ADAM33 16
1311 ADAM 33 as a morphogenetic gene 16
132 ADAM 33 as a biomarker of severe asthma 16
133 ADAM 33 gene polymorphisms and asthma 17
134 Role of the gene-environment interaction and ADAM33 in
development of asthma
19
14 Interleukins and asthma 19
141 Interleukin-4 (IL-4) 19
1411 Physiological functions of IL4 20
1412 Interleukin-4 gene and asthma 20
142 IL4 Receptor 21
1421 Physiological functions of IL4Rα 21
1422 Interleukin 4 receptor (IL-4Rα) gene and asthma 22
143 Interleukin 13 23
1431 Physiological functions of IL13 23
14311 IL-13 role in mucus production 24
14312 IL-13 in airway hyperresponsiveness 24
14313 Interleukin-13 in pulmonary fibrosis 24
1432 IL 13 and inflammatory pathways in asthma 24
1433 Anti-interleukin-13 antibody therapy for asthma 25
15 Glutathione S-transferases (GSTs) 25
151 Functions of GSTs 26
1531 The detoxication functions of GSTs 26
1532 The metabolic function of GSTs 26
1533 The regulatory function of GSTs 27
154 GSTs and asthma 27
155 Glutathione S-transferase Theta 1 (GSTT1) 28
156 Glutathione S-transferase Pi 1(GSTP1) 29
16 Diagnosis 29
17 Classification and severity 29
18 Prevention and management 31
19 Justification 32
110 Objectives 33
Chapter two
Materials and methods
2 1 Materials 34
211 Electronic spirometer 34
212 Gel electrophoresis 36
213 PCR machine 37
214 Primers 38
215 Maxime PCR PreMix Kit ( i-Taq) 38
216 UV Transilluminator JY-02S analyzer 39
217 Microplate reader 40
218 ELIZA kits 40
219 Vertical electrophoresis cell 41
22 Methods 42
221 Study design 42
222 Study area 42
223 Study population 42
224 Ethical consideration 42
225 Procedures 42
2251 Questionnaire 42
2252 Clinical examination 43
2253 Body Mass Index (BMI) 43
2254 Lung functions test 43
2255 Sampling technique 44
2256 Molecular analysis 44
22561 DNA extraction 44
22562 Agarose gel electrophoresis requirements for DNA and
PCR product
46
22563 Polymerase chain reaction (PCR) 49
22564 Restriction Fragment Length Polymorphism Analysis
(RFLPs)
50
2257 Laboratories Analysis 50
22571 Polyacrylamide Gel Electrophoresis (PAGE) 50
225711 Preparation of the reagents 51
225712 Separating gel preparation 52
225713 Stacking gel preparation 52
225714 Sample preparation and loading 52
225714 Protein staining 53
22572 ELISA 53
225721 Quantitative assay for total IgE antibodies 53
225722 Quantitative assay for total Haptoglobin 54
225723 Quantitative assay for total IL4 56
23 Method of data analysis 58
Chapter three
Results
31 Study group 59
32 Asthma Control Test (ACT) 62
33 lung function tests 62
34 Serum level of IgE and IL4 in asthmatic and control 63
341 Serum level of IgE in different classes of asthma 64
342 Serum level of IL4 in different classes of asthma 65
35 Haptoglobin phenotypes and Level 65
36 ADAM33 polymorphism in chromosome 20 69
37 IL4 (-590 CT) polymorphism in chromosome 5 72
38 IL4Rα (- Q576R) polymorphism in chromosome 16 74
39 GSTs polymorphism 76
391 GSTT1 polymorphism in chromosome 22 76
392 GSTPi polymorphism in chromosome 11 77
310 Frequencies of mutant genotypes 80
Chapter four
Discussion
4 Discussion 81
Chapter five
Conclusion and Recommendations
51 Conclusion 87
52 Recommendations 88
Chapter six
References and Appendices
References 89
Questionnaire 126
Asthma control test 128
Maxime PCR PreMix kit 129
BsmF1 enzyme 130
BsmA1enzyme 131
Msp1 enzyme 132
The component of toatl IgE Eliza Kit 133
The components of the haptoglobin kit 134
Reagent Preparation (haptoglobin kit) 135
The components of the IL4 kit 136
Reagent Preparation (IL4 kit) 137
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 3
1237 Hp is required to induce mucosal tolerance 14
124 Hp and asthma 15
13 A disintegrin and metalloprotease (ADAM) 33 15
131 Physiological functions of ADAM33 16
1311 ADAM 33 as a morphogenetic gene 16
132 ADAM 33 as a biomarker of severe asthma 16
133 ADAM 33 gene polymorphisms and asthma 17
134 Role of the gene-environment interaction and ADAM33 in
development of asthma
19
14 Interleukins and asthma 19
141 Interleukin-4 (IL-4) 19
1411 Physiological functions of IL4 20
1412 Interleukin-4 gene and asthma 20
142 IL4 Receptor 21
1421 Physiological functions of IL4Rα 21
1422 Interleukin 4 receptor (IL-4Rα) gene and asthma 22
143 Interleukin 13 23
1431 Physiological functions of IL13 23
14311 IL-13 role in mucus production 24
14312 IL-13 in airway hyperresponsiveness 24
14313 Interleukin-13 in pulmonary fibrosis 24
1432 IL 13 and inflammatory pathways in asthma 24
1433 Anti-interleukin-13 antibody therapy for asthma 25
15 Glutathione S-transferases (GSTs) 25
151 Functions of GSTs 26
1531 The detoxication functions of GSTs 26
1532 The metabolic function of GSTs 26
1533 The regulatory function of GSTs 27
154 GSTs and asthma 27
155 Glutathione S-transferase Theta 1 (GSTT1) 28
156 Glutathione S-transferase Pi 1(GSTP1) 29
16 Diagnosis 29
17 Classification and severity 29
18 Prevention and management 31
19 Justification 32
110 Objectives 33
Chapter two
Materials and methods
2 1 Materials 34
211 Electronic spirometer 34
212 Gel electrophoresis 36
213 PCR machine 37
214 Primers 38
215 Maxime PCR PreMix Kit ( i-Taq) 38
216 UV Transilluminator JY-02S analyzer 39
217 Microplate reader 40
218 ELIZA kits 40
219 Vertical electrophoresis cell 41
22 Methods 42
221 Study design 42
222 Study area 42
223 Study population 42
224 Ethical consideration 42
225 Procedures 42
2251 Questionnaire 42
2252 Clinical examination 43
2253 Body Mass Index (BMI) 43
2254 Lung functions test 43
2255 Sampling technique 44
2256 Molecular analysis 44
22561 DNA extraction 44
22562 Agarose gel electrophoresis requirements for DNA and
PCR product
46
22563 Polymerase chain reaction (PCR) 49
22564 Restriction Fragment Length Polymorphism Analysis
(RFLPs)
50
2257 Laboratories Analysis 50
22571 Polyacrylamide Gel Electrophoresis (PAGE) 50
225711 Preparation of the reagents 51
225712 Separating gel preparation 52
225713 Stacking gel preparation 52
225714 Sample preparation and loading 52
225714 Protein staining 53
22572 ELISA 53
225721 Quantitative assay for total IgE antibodies 53
225722 Quantitative assay for total Haptoglobin 54
225723 Quantitative assay for total IL4 56
23 Method of data analysis 58
Chapter three
Results
31 Study group 59
32 Asthma Control Test (ACT) 62
33 lung function tests 62
34 Serum level of IgE and IL4 in asthmatic and control 63
341 Serum level of IgE in different classes of asthma 64
342 Serum level of IL4 in different classes of asthma 65
35 Haptoglobin phenotypes and Level 65
36 ADAM33 polymorphism in chromosome 20 69
37 IL4 (-590 CT) polymorphism in chromosome 5 72
38 IL4Rα (- Q576R) polymorphism in chromosome 16 74
39 GSTs polymorphism 76
391 GSTT1 polymorphism in chromosome 22 76
392 GSTPi polymorphism in chromosome 11 77
310 Frequencies of mutant genotypes 80
Chapter four
Discussion
4 Discussion 81
Chapter five
Conclusion and Recommendations
51 Conclusion 87
52 Recommendations 88
Chapter six
References and Appendices
References 89
Questionnaire 126
Asthma control test 128
Maxime PCR PreMix kit 129
BsmF1 enzyme 130
BsmA1enzyme 131
Msp1 enzyme 132
The component of toatl IgE Eliza Kit 133
The components of the haptoglobin kit 134
Reagent Preparation (haptoglobin kit) 135
The components of the IL4 kit 136
Reagent Preparation (IL4 kit) 137
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 4
2 1 Materials 34
211 Electronic spirometer 34
212 Gel electrophoresis 36
213 PCR machine 37
214 Primers 38
215 Maxime PCR PreMix Kit ( i-Taq) 38
216 UV Transilluminator JY-02S analyzer 39
217 Microplate reader 40
218 ELIZA kits 40
219 Vertical electrophoresis cell 41
22 Methods 42
221 Study design 42
222 Study area 42
223 Study population 42
224 Ethical consideration 42
225 Procedures 42
2251 Questionnaire 42
2252 Clinical examination 43
2253 Body Mass Index (BMI) 43
2254 Lung functions test 43
2255 Sampling technique 44
2256 Molecular analysis 44
22561 DNA extraction 44
22562 Agarose gel electrophoresis requirements for DNA and
PCR product
46
22563 Polymerase chain reaction (PCR) 49
22564 Restriction Fragment Length Polymorphism Analysis
(RFLPs)
50
2257 Laboratories Analysis 50
22571 Polyacrylamide Gel Electrophoresis (PAGE) 50
225711 Preparation of the reagents 51
225712 Separating gel preparation 52
225713 Stacking gel preparation 52
225714 Sample preparation and loading 52
225714 Protein staining 53
22572 ELISA 53
225721 Quantitative assay for total IgE antibodies 53
225722 Quantitative assay for total Haptoglobin 54
225723 Quantitative assay for total IL4 56
23 Method of data analysis 58
Chapter three
Results
31 Study group 59
32 Asthma Control Test (ACT) 62
33 lung function tests 62
34 Serum level of IgE and IL4 in asthmatic and control 63
341 Serum level of IgE in different classes of asthma 64
342 Serum level of IL4 in different classes of asthma 65
35 Haptoglobin phenotypes and Level 65
36 ADAM33 polymorphism in chromosome 20 69
37 IL4 (-590 CT) polymorphism in chromosome 5 72
38 IL4Rα (- Q576R) polymorphism in chromosome 16 74
39 GSTs polymorphism 76
391 GSTT1 polymorphism in chromosome 22 76
392 GSTPi polymorphism in chromosome 11 77
310 Frequencies of mutant genotypes 80
Chapter four
Discussion
4 Discussion 81
Chapter five
Conclusion and Recommendations
51 Conclusion 87
52 Recommendations 88
Chapter six
References and Appendices
References 89
Questionnaire 126
Asthma control test 128
Maxime PCR PreMix kit 129
BsmF1 enzyme 130
BsmA1enzyme 131
Msp1 enzyme 132
The component of toatl IgE Eliza Kit 133
The components of the haptoglobin kit 134
Reagent Preparation (haptoglobin kit) 135
The components of the IL4 kit 136
Reagent Preparation (IL4 kit) 137
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 5
23 Method of data analysis 58
Chapter three
Results
31 Study group 59
32 Asthma Control Test (ACT) 62
33 lung function tests 62
34 Serum level of IgE and IL4 in asthmatic and control 63
341 Serum level of IgE in different classes of asthma 64
342 Serum level of IL4 in different classes of asthma 65
35 Haptoglobin phenotypes and Level 65
36 ADAM33 polymorphism in chromosome 20 69
37 IL4 (-590 CT) polymorphism in chromosome 5 72
38 IL4Rα (- Q576R) polymorphism in chromosome 16 74
39 GSTs polymorphism 76
391 GSTT1 polymorphism in chromosome 22 76
392 GSTPi polymorphism in chromosome 11 77
310 Frequencies of mutant genotypes 80
Chapter four
Discussion
4 Discussion 81
Chapter five
Conclusion and Recommendations
51 Conclusion 87
52 Recommendations 88
Chapter six
References and Appendices
References 89
Questionnaire 126
Asthma control test 128
Maxime PCR PreMix kit 129
BsmF1 enzyme 130
BsmA1enzyme 131
Msp1 enzyme 132
The component of toatl IgE Eliza Kit 133
The components of the haptoglobin kit 134
Reagent Preparation (haptoglobin kit) 135
The components of the IL4 kit 136
Reagent Preparation (IL4 kit) 137
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 6
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof Omer Abdel Aziz whose keen interest supervision and assistance
led to the initiation and completion of thesis work
I am greatly indebted to many individuals who helped with the
preparation of this work Dr Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 7
I also thank all the subjects who granted me their time I would like to
express my especial thanks to Dr Jehan Essa for her sustainable
presence and unlimited help I am very grateful to Dr Amel Osman Mr
Mohammed Elhadi Mr Ahmmed Brear and Ms Nagat Ahmmed for
their great help I wish to express my thanks to Dr Nasr mohammed
Nasr for taking the time to teach me about ELIZA technique I especially
want to thank Mr Kamal Eltayeb ndash department of biochemistry and
molecular biology-faculty of Science and Technology-AlNeelain
University I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College
Also I want to thank the Ministry of higher education and scientific
research for the financial support To all those who encouraged me I owe
and gladly acknowledge a considerable debt Finally I would like to
acknowledge and thank The National Ribat University
Abstract
Introduction
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator Recent studies have revealed evidence
for linkage of human chromosomes 5q23 11q13 16p121 20p13 and 22q112 as
regions likely to contain genes related to asthma Among the candidate genes in
these regions are the genes encoding for IL4 GSTPi IL4Rα ADAM33 and
GSTT1
Objectives
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 8
To assess the level and common phenotype of Hp among asthmatic and control
subjects Also to assess the frequency of the mutant ADAM 33 IL4 (-590) IL4R α
(-576) GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls
Methods
A total of 63 patients with allergic asthma and 53 normal subjects were studied
Serum levels of IgE IL-4 and Hp were measured by ELISA method Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis DNA was
extracted from blood using salting out method Polymorphisms were determined
by PCR method for GSTT1 PCR-RFLP method for ADAM33 IL4 and GSTPi
and allele specific PCR for IL4Rα
Results
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1 Hp2-1 and Hp2-2 among asthmatic
patients were175 508 and 317 respectively Distributions of different Hp
phenotypes in healthy controls were 76 66 and 264 respectively Serum
Hp level was higher in asthmatics than controls (0001)
The results showed that GSTT1 null genotype was higher (54) than control
(245) (P=0001)The mutant ADAM33 allele was higher (81) than control
(55) (P= 0000) IL4 (-590) allele was higher (698) than control (429)
(P=0000) IL4R α (-576) allele was higher (571) than control (481) (P=
0170) and no significant differences of GSTPi allele between asthmatics (348)
and controls (292) (p= 0358)
Conclusion
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 9
The level of serum IgE and IL4 in patients were higher in asthmatic patientsHp
phenotypes have no role in activation of the disease while Hp level was higher in
asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease
ةالخــــــــــلاصــــ
المقدمة
تؤثر ف كل المتعددة الت والبئة العوامل الوراثة التفاعل بن نتج من مرض التهاب الربو الشعب
مغر ف هوظائفاحدي و الحادة المرحلة هو بروتن( HP) ابتوغلوبنه للعلاج واستجابتها حدته من
الكروموسومات البشرة الربط بن دللا على الأخرة وقد كشفت الدراسات نظام المناعة
5q2311q13 16p121 20p13 22وq112 الجنات تحتوي على المحتمل أن المناطقو
IL4 GSTPi IL4Rα ADAM33 ه ف هذه المناطق الجنات المرشحة بن بالربو المرتبطة
GSTT1و
الأهــــداف
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES
Page 10
مجموعت التتم مو ال تتو م ضت تتي هترتتوللوتي للالتمم الاتري و لتقييم مستتو تهدف هذه الدراسه
و 33ADAM IL4 (095-) α IL4R (075-) GSTT1 لجيمتتر ل متمولتت ال وتي ةالتت لتقيتتيم أيضتتر
GSTPi الاصمرء مع مقر م مصرتي ترل توال الم ضىف
لطـــــرق ا
مجموعة 13شخص ف ولاة الخرطوم ) 111جرت هذه الدراسه المقطعه التحللة ف عدد ا
4 وانترلوكن E (IgE) ن وللوبقامنو مستوي اتجرت قاسوا مجموعة التحكم(33الدراسه( )
( (IL4 لوبنغو الهابتو(Hp) بواسطه السرم فELIZAجل باستخدام ونوع الهابتوقلوبن
PAGEالكهربائ بول أكرلامد
وGSTT1 لجن PCR من الدم وتحدد التغر الجن بواسطه DNA تم استخلاص
PCR-RFLP لجن ADAM33 IL4 GSTPiو allele specific PCR لجنIL4Rα
للتحلل الاحصائ SPSSمج تم استخدام برنا
النـتـائــج
عند مقارنة الاشخاص المصابن بالربو الشعب )مجموعة الدراسه ( مع الاشخاص الطبعن )مجموعة
توزع الشكل اعل عند مرض الربو الشعب HpوIL4 و IgEمستوي نجد ان قاسات التحكم(
317 و 508 و175 الربو الشعب هوعند مرض 2-2و 2-1و1-1الظاهري للهابتوقلوبن
عل التوال264و66 و 76عل التوال وعند مجموعة التحكم هو
مجموعة من( 05) عند مرض الربو أعلى GSTT1 النمط الجن المتحول النتائج أن وأظهرت
مجموعة التحكم من( 18)أعلى ADAM33 الالل المتحول كان ) P=0001( )550)التحكم
( 559)التحكم من( 591)أعلى -) 095IL4) وكان الالل المتحول (=5P 000( )00) على
((P=0000 كان الالل المتحولα IL4R (075- ) ( 518)التحكم من( 078)أعلى
((P=0170 للالل المتحولفروق ذات دلالة لوجود لا GSTPi م والتحك( 351) الربو بن
(595( )P=0358)
الخـاتــمه
اعل عند مرض الربو و لس هنالك اختلاف ف IgEو IL4و Hpقاسات مستوي الهابتوغلوبن
الشكل الظاهري للهابتوغلوبن
ف الإصرت تم ض ال تو مع قد تت افق ADAM33 IL4 و( 095) GSTT1 تعدد اش رل الجيمر
مدوث الم ض امهر ليس لهر دو ف يتدو ف المتمول IL4R α (-075) GSTPi السودا تيممر جيمر
List of tables
Tables Page
No Table (11) Prevalence of asthma symptoms in adults amp children (aged
13-14) in different areas in Sudan
3
Table (12) Clinical classification (ge 12 years old) 31
Table(21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα
ADAM33 GSTT1 and GSTP1 genes
48
Table (22) The Polymerase chain reaction protocol 49
Table(23) The restriction enzymes incubation protocol 50
Table(31) Distribution of anthropometric characteristics among female
subjects
60
Table(32) Distribution of anthropometric characteristics among male
subjects
61
Table(33) The asthma control test score in asthma patients 62
Table(34) Distribution of lung functions test among the study group 62
Table(35) Distribution of serum level of IgE and IL4 among the study
group
63
Table(36) Serum IgE in different classes of Asthma 64
Table(37) Serum Il4 in different classes of Asthma 65
Table(38) Distribution of haptoglobin phenotype among the study group 66
Table(39) Distribution of serum level of Hp among the study group 67
Table(310)A comparison of serum Hp in Patients and control with
different Hp phenotype
68
Table(311) Serum Hp in different classes of Asthma 68
Table(312) Allele and genotype frequencies for ADAM33 SNPs 69
Table(313) A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(314) Allele and genotype frequencies for IL4 SNPs 72
Table(315) Allele and genotype frequencies for IL4Rα (-576) SNPs 74
Table(316) Genotype distribution of GSTT1 SNPs 76
Table(317) Allele and genotype frequencies for GSTPi SNPs 78
Table(318) Combination of various risk mutant genotypes 80
List of figures
figures Page No
Figure (11) Inflammatory cells in asthma 7
Figure (12) Inflammatory pathways in asthma 8
Figure (13) The structure of the different haptoglobin phenotype 10
Figure (14) Key cells influenced by ADAM33 in airway remodelling
in asthma
18
Figure (21) Electronic Spirometer and mouth pieces 35
Figure (22) Gel electrophoresis cell 36
Figure (23) PCR machine 37
Figure (24) Forward and Reverse primers 38
Figure (25) Maxime PCR PreMix Kit ( i-Taq) 38
Figure (26)UV Transilluminator analyzer 39
Figure (27) Microplate reader 40
Figure (28) ELIZA kits for haptoglobin and IL4 40
Figure (29) Vertical electrophoresis 41
Figure(210) Precipitation of DNA 46
Figure (31) The percentage of females and males in the study group 59
Figure (32) The total number of females and males 60
Figure (33) The classification of asthmatic group 61
Figure (34) IgE level in asthmatic and control group 63
Figure (35) IL4 serum level in asthmatic and control 64
Figure (36) Determination of Haptoglobin phenotype electrophoresed
in polyacrylamid gel
66
Figure (37) Comparison of Hp level in serum of asthmatic and
Control
67
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control ()
70
Figure (39)The ADAM33 PCR product on 3 agarose 70
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose 71
Figure (311) Mutant Allelic frequencies of IL4 (-590) polymorphism
for asthmatic and control ()
73
Figure (312)The IL4 (-590) PCR product on 3 agarose 73
Figure (313) Mutant allelic frequencies of IL4Rα polymorphism for
asthmatic and control ()
75
Figure (314)The IL4Rα (-576) PCR product and analysis of
polymorphism on 3 agarose
75
Figure (315) GSTT1 null genotype frequencies for asthmatic and
control ()
76
Figure (316)Analysis of GSTT1 polymorphism on 3 agarose 77
Figure (317) Allele and genotype frequencies for GSTPi SNPs 78
Figure (318)The GSTPi Ile105Val PCR product on 3 agarose 79
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose 79
Figure (320)Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR airway hyperresponsiveness
GSTM1 glutathione S-transferase mu 2 (muscle)
CTLA-4 Cytotoxic T-Lymphocyte associated protein 4
SPINK5 Serine protease inhibitor Kazal- type 5
IL-4Rα Interleukin 4 receptor alpha
ADAM 33 A disintegrin and metalloprotease 33
ADRB2 adrenergic beta-2-receptor
BHR bronchial hyperactivity
SPT skin prick test
IgE Immunoglobulin E
CC16 Clara cell 16
CCL CC chemokine ligands
TLR toll-like receptor
NOD1 nucleotide-binding oligomerization domain containing 1
HLA Human leukocyte antigen cell
GSTP1 Glutathione S-transferase Pi 1
ALOX-5 arachidonate 5-lipoxygenase
NOS1 nitric oxide synthase 1
ECM extracellular matrix
ASM airway smooth muscle MCs mast cells
Hp haptoglobin
FEV1 Forced expiratory volume in one second
HMC-1 human mast cell line HMC-1
TNF tumour necrosis factor
ROS reactive oxygen species
Declaration
SNPs single nucleotide polymorphisms
EMTU epithelial mesenchymal tropic unit
EGF epidermal growth factor
TGF transforming growth factors
VCAM-1 vascular cell adhesion molecule 1
GM-CSF Granulocyte macrophage colony-stimulating factor
MHC II major histocompatibility class II
GSTPi Glutathione S-transferase Pi
GSH Glutathione
GST glutathione transferase
NF-AT nuclear factor of activated T cell
PEF Peak expiratory flow
GINA Global Initiative for Asthma
PAGE polyacrylamide gel electrophoresis
SDS Sodium dodecyl sulfate
TE Tris EDTA
dH2O distilled water
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology Faculty of Medicine The National Ribat University
Part of this work has been submitted to the 9th
Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form
1 RE Ibrahim HB Eltahir JE Abdelrahman A O Gundi O A Musa Genetic
polymorphisms of ADAM33 IL4 (-590) IL4Rα (-576) GSTT1 and GSTPi
genes in Sudanese with asthma Presented by Randa Ibrahim
Table (21) Single-nucleotide polymorphisms genotyped in IL-4 IL-4rα ADAM33 GSTT1
and GSTP1 genes
Gene location SNP amp
SNP
name
Sequence of primer Method PCR
product
Restriction
enzyme
Digested
Product
Length
IL4 5q23
-590CgtT
F 5΄ACTAGGCCTCACCTGATACG-3΄
R 5΄GTTGTAATGCAGTCCTCCTG-3΄
PCR+RE 254bp BsmFI 254-bp (T)
210 + 44bp
(C)
IL4Rα 16p121
-Q576R
T gtC
FInnerGCTTACCGCAGCTTCAGCACCT
RInner GACACGGTGACTGGCTCAGTG
FOuterTGGACCTGCTCGGAGAGGAGA
ROuterTAACCAGCCTCTCCTGGGGGC
PCR-
allele
specific
574 pb
Internal
control
324bp(T)
294pb(C)
---------- ---------
ADAM33 20p13
Intron6
F+1
GgtA
F5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R5΄GGACCCTGAGTGGAAGCTG-3΄
PCR+RE 166bp MspI 166 bp(A)
29+137(G)
GSTT1 22q112
null allele F 5-TTCCTTACTGGTCCTCACATCTC-3
R5 TCACCGGATCATGGCCAGCA-3
PCR 480 bp -------- --------
GSTPi 11q13 Ile105Va
l
313AgtG
F5-ACG CACATC CTC TTC CCC TC-3
R5-TAC TTG GCT GGTTGA TGT CC-3
PCR+RE 440bp BsmA1 440 bp (A)
212+228bp
(G)
PCR = polymerase chain reaction RE = restriction enzyme
Introduction amp Literature review 1 Introduction
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide (1)
Currently it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors (2 3)
During an asthma attack the airways that carry air to the lungs are
constricted and as a result less air is able to flow in and out of the lungs (4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening (4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are irreversible such as bronchiectasis chronic bronchitis and
emphysema(5)
Unlike these diseases the airway obstruction in asthma is usually
reversible if left untreated the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling(6)
In
contrast to emphysema asthma affects the bronchi not the alveoli (7)
11 Asthma
111Definition
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms reversible airflow obstruction and
bronchospasm(8)
Common symptoms include wheezing coughing chest
tightness and shortness of breath(9)
The definition of asthma according to
international guidelines (10)
includes the three domains of symptoms (1) variable
airway obstruction (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity) and (3) airway inflammation
112Epidemiology and global prevalence of asthma
The prevalence of asthma in different countries varies widely but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries (11)
Beginning in the 1960s the prevalence
morbidity and mortality associated with asthma have been on the rise (12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025 (13)
The greatest rise in asthma rates in USA was among black
children (almost a 50 increase) from 2001 through 2009(11)
In Africa in 1990
744 million asthma cases was reported this increased to 1193 million in 2010(14)
About 70 of asthmatics also have Allergies(13)
Workplace conditions such as
exposure to fumes gases or dust are responsible for 11 of asthma cases
worldwide(13)
While asthma is twice as common in boys as girls(10)
severe asthma
occurs at equal rates(15)
In contrast adult women have a higher rate of asthma than
men (10)
113 Prevalence of asthma in Sudan
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 11)The average prevalence of asthma in adults in Sudan was found
to be 104 (16)
Table (11)Prevalence of asthma symptoms in adults amp children (aged 13-14)
in different areas in Sudan
Areas Prevalence
Children
Khartoum (17)
122
Atbara (18)
42
Gadarif (19)
5
White Nile (20)
112
Adults Khartoum (16)
107
114 Causes
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions (22 23)
These factors influence both its
severity and its responsiveness to treatment (24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment (25)
1141 Environmental causes
Many environmental factors have been associated with asthma development and
exacerbation including allergens air pollution and other environmental
chemicals (26)
Asthma is associated with exposure to indoor allergens (27)
Common indoor allergens include dust mites cockroaches animal dander and
mold (28 29)
Efforts to decrease dust mites have been found to be ineffective (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms(10)
Exposure to indoor volatile organic compounds may be
a trigger for asthma formaldehyde exposure for example has a positive
association(31)
Certain viral respiratory infections may increase the risk of
Dongola (21)
96
Elobeid (16)
67
Kassala (16)
13
developing asthma when acquired in young children such as(8)
respiratory
syncytial virus and rhinovirus(15)
Certain other infections however may decrease
the risk(15)
Asthmatics in the Sudan are found to be sensitive to cockroach
allergens cat allergens Betulaceae trees allergens and the house dust mite (32)
1142 Genetic causes
Family history is a risk factor for asthma with many different genes being
implicated (33)
If one identical twin is affected the probability of the other having
the disease is approximately 25 (33)
Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population (34)
Heritability the proportion of
phenotypic variances that are caused by genetic effects varies from study to study
in asthma (35)
By the end of 2005 25 genes had been associated with asthma in
six or more separate populations including the genes GSTM1 IL10 CTLA-4
SPINK5LTC4S IL4R and ADAM33 among others(36)
Many of these genes are
related to the immune system or modulating inflammation Even among this list of
genes supported by highly replicated studies results have not been consistent
among all populations tested (36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone (36)
and more continue to be found
(37) Some genetic variants may only cause asthma when they are combined with
specific environmental exposures(23)
The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5 13 4
CD14 and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21 (36)
A
recent meta-analysis of genome-wide linkage studies of asthma bronchial
hyperresponsiveness (BHR) positive allergen skin prick test (SPT) and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p (38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13 (39)
11421 Genetic Analysis of Asthma Susceptibility
The numerous genome-wide linkage candidate gene and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis This list has been categorized into four broad functional groups by
several recent reviewers (40 41)
1 Epithelial barrier function
Studies of asthma genetics have raised new interest in the bodylsquos first line of
immune defense the epithelial barrier in the pathogenesis of asthma Filaggrin
(FLG) a protein involved in keratin aggregation is not expressed in the bronchial
mucosa (42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier (43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma These genes include defensin-beta1(an antimicrobial peptide) Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation) and several chemokines (CCL-5 -11 -24 and -26) involved in
the recruitment of T-cells and eosinophils(44 45 46)
2 Environmental sensing and immune detection
A second class of associated genes is involved in detection of pathogens and
allergens These genes include pattern recognition receptors and extracellular
receptors such as CD14 toll-like receptor 2 (TLR2) TLR4 TLR6 TLR10
and intracellular receptors such as nucleotide-binding oligomerization domain
containing 1(NOD1CARD4) (47 48 49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses (50)
3 Th2-mediated cell response
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies and as one might expect SNPs in many of these genes have been
associated with asthma and other allergic phenotypes Genes important for Th1
versus Th2 T cell polarization like IL4 (51)
IL4RA (52)
and STAT6 (53)
have
been implicated with asthma and allergy The genes encoding IL-13 and the beta-
chain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility (50 54)
4 Tissue response
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility Genes important for tissue response include a disintegrin and
metalloprotease(39)
leukotriene C4 synthase (LTC4S) (55)
glutathione-S-
transferase (GSTP1 GSTM1) (56)
arachidonate 5-lipoxygenase (ALOX-5) and
nitric oxide synthase 1 (NOS1) (57)
115 Inflammatory cells in asthma
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease but some cells predominate in asthmatic
inflammation (58)
Figure (11) Inflammatory cells in asthma ( 58)
116Pathophysiology
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles vascular congestion edema of
the bronchial wall and thick tenacious secretions(59)
Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis (60)
extracellular matrix (ECM) deposition smooth muscle hypertrophy and goblet
cell hyperplasia in the airways (6162)
Inflammatory cells such as T cells
eosinophils and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors
(63) Th2 cell-mediated immune response against innocuouslsquo environmental
allergens in the immune-pathogenesis of allergic asthma is an established factTh2
polarization is mainly because of the early production of IL-4 during the primary
response(64)
IL-4 could be produced by the naive T helper cell itself(65)
Cytokines
and chemokines produced by Th2 cells including GM-colony stimulatory factors
IL-4 IL-5 IL-9 IL-13 and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders such as production of IgE
antibodies recruitment and activation of mast cells basophils and eosinophils
granulocytes mucus hyper secretion subepithelial fibrosis and tissue remodeling
(66)
Figure (12) Inflammatory pathways in asthma ( 67)
12 Haptoglobin (Hp)
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940(68)
Three major phenotypes
named Hp1-1 Hp2-1 and Hp2-2 have been identified so far (6970)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses Hp2-1 has a more
moderate role and Hp2-2 has the least (71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1 IL-6 IL-
8 and tumor necrosis factor (TNF) (72)
and as one of the innate immune protection
markers has different biological roles (7374)
Hp is present in the serum of all
mammals but polymorphism is found only in humans(7)
In addition to the liver
Hp is produced in other tissues including lung skin spleen brain intestine arterial
vessels and kidney but to a lesser extent(75 76)
Also Hp gene is expressed in lung
skin spleen kidney and adipose tissue in mice (77 78)
121 Haptoglobin (Hp) phenotypes
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22 a common polymorphism of the haptoglobin gene
characterized by alleles Hp 1 and Hp 2 give rise to structurally and functionally
distinct haptoglobin protein phenotypes known as Hp 1-1 Hp 2-1 and Hp 2-2(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis (80)
Hp 1-1 is the smallest haptoglobin and has a molecular weight
of about 86 kd In contrast Hp 2-2 is the largest haptoglobin with a molecular
weight of 170 to 900 kd The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd(81)
Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination (82)
Figure (13) The structure of the different haptoglobin phenotype (83)
122 Haptoglobin as a Diagnostic Marker
1221 Conditions Associated With an Elevated Plasma Hp Level
An elevated plasma haptoglobin level is found in inflammation trauma burns and
with tumors (8485)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent(86)
The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high but later owing to hemolysis the plasma level decreases
temporarily(87)
1222 Conditions Associated With Decreased plasma Hp Level
The plasma haptoglobin level is decreased in hemolysis malnutrition ineffective
erythropoiesis hepatocellular disorders late pregnancy and newborn infants (86 88)
In addition the plasma haptoglobin level is lower in people with positive skin tests
for pollens high levels of IgE and specific IgE for pollens and house dust mites
rhinitis and allergic asthma (89)
123Physiology and Functions of Haptoglobin
In healthy adults the haptoglobin concentration in plasma is between 38 and 208
mgdL (038 and 208 gL)(80)
People with Hp 1-1 have the highest plasma
concentrations those with Hp 2-2 the lowest plasma concentrations and those with
Hp 2-1 have concentrations in the middle(8084)
The half-life of haptoglobin is 35
days and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes(90)
Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to cells Hp also exerts direct angiogenic anti-inflammatory and
immunomodulatory properties in extravascular tissues and body fluids It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli (91)
Hp can also be released from neutrophil granulocytes (92)
at sites
of injury or inflammation and dampens tissue damage locally(93)
Hp receptors
include CD163 expressed on the monocyte-macrophage system (94)
and CD11b
(CR3) found on granulocytes natural killer cells and small subpopulations of
lymphocytes Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes (80)
directly inhibiting their proliferation and modifying the
Th1Th2 balance (95)
1231The role of Hp in regulation of the immune system
Haptoglobin functions as an immune system modulator Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections allergies and autoimmune disorders By enhancing
the Th1 cellular response haptoglobin establishes Th1-Th2 balance in vitro (95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation (96)
Also it inhibits monocyte and
macrophage functions (97 98)
Haptoglobin binds to different immunologic cells by
specific receptors It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses (99)
Also haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation (100)
In populations with Hp 2-2 the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1 People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1 (101)
1232 Inhibition of Prostaglandins
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body (102)
Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body(103 104)
1233 Antibacterial Activity
Iron is one of the essential elements for bacterial growth The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms Once bound to haptoglobin hemoglobin and iron are no longer
available to bacteria that require iron (105)
In the lungs haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection (91)
1234 Antioxidant Activity
In plasma free Hb binds Hp with extremely high affinity but low dissociation
speed in a ratio of 1Hp1Hb to form the Hp-Hb complexes These complexes are
rapidly cleared and degraded by macrophages Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes The heme fraction is converted
by heme oxygenase into bilirubin carbon monoxide and iron(106)
So Hp prevents
the oxidative damage caused by free Hb which is highly toxic(107)
Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide(108)
The
capacity of Hp to prevent oxidative stress is directly related to its phenotype Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2 The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass (109)
1235Activation of neutrophils
During exercise injury trauma or infection the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils The
activated neutrophils which are first in the line of defense aid in the recruitment
of other inflammatory cells following extravasation (110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells
particularly monocytes and macrophages Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated (111)
1236 The role of Hp in angiogenesis
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels (112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring(112113)
In chronic systemic
vasculitis and chronic inflammatory disorders haptoglobin has an important role in
improving the development of collateral vessels and tissue repair Among the
haptoglobin phenotypes Hp 2-2 has more angiogenic ability than the others (113)
1237 Hp is required to induce mucosal tolerance
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact This condition is known as
immune tolerance (114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins such as food
components harmless environmental inhaled antigens and symbiotic
microorganisms Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including arthritis diabetes uveitis
and experimental autoimmune encephalomyelitis(115)
The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naiumlve animals(117)
Importantly Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant(118)
124 Hp and asthma
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli and may act as a natural antagonist for receptor-ligand
activation of the immune system(119)
A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells
Haptoglobin can be expressed by eosinophils and variable serum levels have been
reported in asthma where both elevated (120)
and reduced (121)
serum haptoglobin
levels were described Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders(123)
Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma andor rhinitis Consistent with its roles in modulating immune responses
(124) Haptoglobin has also been correlated with FEV1
(120) Wheezing was reported
to be significantly related to low levels of Hp and bronchial hyper-responsiveness
related to high level (120)
As part of its tissue repair function haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts (125)
and
angiogenesis (112)
Bronchial asthma was correlated with Hp1-1 (80)
13 A disintegrin and metalloprotease (ADAM) 33
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34) ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum They have an active site in the
metalloprotease domain containing a zinc-binding catalytic site (126 127)
The active
site sequences of ADAM33 like the other protease-type ADAM members
implying that ADAM33 can promote the process of growth factors cytokines
cytokine receptors and various adhesion molecules (128)
ADAM33 mRNA is
preferentially expressed in smooth muscle fibroblasts and myofibroblasts but not
in the bronchial epithelium or in inflammatory or immune cells (39 129)
The ADAM
protein has been detected in lung tissue smooth muscle cells and fibroblasts (130)
It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma
(39)
131Physiological functions of ADAM33
ADAM33 consists of 22 exons that encode a signal sequence and different
domains structure From a functional standpoint these different domains translate
into different functions of ADAM33 which include activation proteolysis
adhesion fusion and intracellular signaling(131)
Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development
(131) Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme (132)
1311 ADAM 33 as a morphogenetic gene
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development (133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles fetal lung also expressed a unique small 25-kD variant
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud (134)
Polymorphic variation in ADAM33 could influence lung function in infancy (135)
132 ADAM 33 as a biomarker of severe asthma
Lee and colleagues (136)
recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33) The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid levels increased significantly in
proportion to asthma severity with ADAM33 protein levels correlating inversely
with the predicted FEV1 These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis (134)
133 ADAM 33 gene polymorphisms and asthma
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene (128)
located on chromosome 20p13
(134) It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population (39)
A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly associated with asthma using case-control transmission
disequilibrium and haplotype analyses (39)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American Hispanic and white populations(137)
Simpson et al (135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma being present in early childhood before asthma
becomes clinically expressed The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 237ndash30 mlyear(138)
These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure14)(139)
Another study conducted on infants born
of allergicasthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance with the strongest effect seen in the
homozygotes(140)
These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence increasing the risk of asthma development The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling resulting in increased
fibroblast and smooth muscle cells proliferation(141)
Some of the significant SNPs
were located in noncoding regions within introns and the 3untranslated region
(UTR) and may affect alternative splicing splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes(142)
Figure (14) Key cells influenced by ADAM33 in airway remodelling in
asthma (143)
134 Role of the gene-environment interaction and ADAM33 in development
of asthma
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma(144)
Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines(145146)
Possible exposure to environmental factors such
as pollutants microbes allergens and oxidant stimuli reactivates the EMTU
which is involved in morphogenesis during fetal lung development (145147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis (148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2 (149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1 which act as
mitogens for smooth muscles and endothelial cells (149 150)
14 Interleukins and asthma
141 Interleukin-4 (IL 4)
It is a potent lymphoid cell growth factor which can stimulate the growth
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes mast cells monocytes and
macrophages) and non-hematopoietic (eg vascular endothelial cells and certain
tumor cells) origin (151)
Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc) (152)
1411 Physiological functions of IL4
IL-4 a pleiotropic cytokine produced by Th2 cells and mast cells is a central
mediator of allergic inflammation Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy (153)
IL-4 acts on
Th0 cells to promote their differentiation into Th2 cells (154)
It decreases the
production of Th1 cells macrophages IFN-gamma and dendritic cell IL-12
Overproduction of IL-4 is associated with allergies (155)
IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes monocytes basophils and eosinophils to the
inflammation site (156)
In asthma IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus (157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin(158)
Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines (159)
1412 Interleukin-4 gene and asthma
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked (160)
The human IL-4 promoter exists in multiple allelic forms one of
which confers high transcriptional activity causing over-expression of the IL-4
gene (161)
Basehore et al (162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes although ethnical differences have been reported The IL4 (590
CT) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q233- 312) (163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans
The derivative allele T has been related to elevated serum levels of IgE and
asthma High frequencies of this allele may be the result of positive selection
(164)Walley et al
(165) reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele
The ndash590CT polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes(166)
142 IL4 Receptor
This receptor exists in different complexes throughout the body IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4 IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium (167)
These
type II receptors have the ability to bind both IL-4 and IL-13 two cytokines with
closely related biological functions(168 169)
The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site (170)
In the case of IL-4 this
sequence of events is reversed where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit (156)
1421 Physiological functions of IL4Rα
Receptors for both interleukin 4 and interleukin 13 couple to the JAK123-STAT6
pathway(168169)
The IL4 response is involved in promoting Th2 differentiation
(156)The IL4IL13 responses are involved in regulating IgE production chemokine
and mucus production at sites of allergic inflammation(156)
In certain cell types
IL4Rα can signal through activation of insulin receptor substrates IRS1IRS2
(171)The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses particularly with regards to helminth infections (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains In vitro sIL-4R blocks B cell binding of IL-4 B cell proliferation and
IgE and IgG1 secretion (173)
In vivo sIL-4R inhibits IgE production by up to 85
in anti-IgD-treated mice (174)
and reduces airway inflammation suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma (175 176)
One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13 because in asthma the effects of allergic
inflammation are mediated by both IL-4 and IL-13(156)
143 Interleukin 4 receptor (IL-4Rα) gene and asthma
The IL-4 receptor alpha (IL-4Rα also called CD124) gene encodes a single-pass
transmembrane subunit protein This gene is located on chromosome 16p
(16p121) (177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma (178 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma but other investigators found conflicting results
(179) Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites (181)
few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population(162 182)
Genendashgene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations (183 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations especially severe asthma this allele is
overrepresented in the African-American population (70 allele frequency in
African Americans vs 20 in Caucasians (185186187)
The Q576R (AG) is gain-of-
function mutation also enhancing signal transduction which results in glutamine
being substituted by arginine(188)
143 Interleukin 13
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα IL-13 and IL-4
exhibit a 30 of sequence similarity and have a similar structure (189)
produced by
CD4+
T cells NK T cells mast cells basophils eosinophils(190)
It is implicated as a
central regulator in IgE synthesis mucus hypersecretion airway
hyperresponsiveness (AHR) and fibrosis(191)
1431 Physiological functions of IL13
In vitro studies have demonstrated that IL-13 has a broad range of activities
including switching of immunoglobulin isotype from IgM to IgE (192)
increase
adhesion of eosinophils to the vascular endothelium (193)
and augmentation of cell
survival(194)
Proliferation and activation and of mast cells(195)
Increased epithelial
permeability(196)
Induction of goblet cell differentiation and growth
(197)Transformation of fibroblasts into myofibroblasts and production of
collagen(198)
Diminished relaxation in response to B-agonists (199)
and augmentation
of contractility in response to acetylcholine in smooth muscles (200)
14311 IL-13 role in mucus production
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging a
pathologic feature of fatal asthma (201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion (202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia
Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1(203204)
Human bronchial epithelial cells (HBEs) stimulated by IL-4 and IL-13 can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes (205 206)
14312 IL-13 in airway hyperresponsiveness
Inflammation remodeling and AHR in asthma are induced by IL-13 over
expression (207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles(208)
Saha SK et al(209)
reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics(209)
14313 Interleukin-13 in pulmonary fibrosis
Experimental models identify IL-13 to be an important profibrotic mediator (210211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis IL-4 and IL-13 are important in alternatively activated
macrophage induction which is believed to regulate fibrosis (211)
1432 IL 13 and inflammatory pathways in asthma
Munitz et al (191)
demonstrated that key pathogenic molecules associated with
asthma severity such as chitinase are entirely dependent on IL-13 signaling
through IL-13Rα1 a component of the type II receptor Rhinovirus (RV) the virus
responsible for the common cold in children is a distinct risk factor for asthma
exacerbations (212)
Among the cytokines studied IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group (213)
1433 Anti-interleukin-13 antibody therapy for asthma
Piper et al (214)
reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement Analysis of patients with elevated sputum IL-13 (gt10
pgmL-1
) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response These data
bear much in common with recently published findings from a trial of
lebrikizumab another anti-IL-13 monoclonal antibody in patients with asthma
(215)The treatment group who received lebrikizumab had a significant improvement
in FEV1 55 higher than that in patients receiving placebo (215)
15 Glutathione S-transferases (GSTs)
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds
(216) GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and in a few instances activation of a wide variety of
chemicals (217)
Conklin et al (218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution (219)
151 Functions of GSTs
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol glutathione (GSH) (220)
The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins
including chemotherapeutic agents and other drugs pesticides herbicides
carcinogens and variably-derived epoxides(216)
GSTs are responsible for a reactive
intermediate formed from aflatoxin B1 which is a crucial means of protection
against the toxin in rodents (216)
1531 The detoxication functions of GSTs
As enzymes GSTs are involved in many different detoxication reactions The
substrates mentioned below are some of the physiologically interesting substrates
GST P1-1 GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α β unsaturated carbonyls One example of α β unsaturated carbonyls
is acrolein a cytotoxic compound present in tobacco smoke Exposure of cells to
acrolein produce single strand DNA breaks (221)
Another class of α β unsaturated
carbonyls are propenals which are generated by oxidative damage to DNA (222)
1532 The metabolic function of GSTs
GSTs are involved in the biosynthesis of prostaglandins (PGs) Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex (223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not(224)
The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2 PGD2 PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors These receptors in turn regulate other hormones and neurotransmittors
(224)
1533 The regulatory function of GSTs
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity (225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2) (226)
GST P1-1 does not elicit the
same protection against UV-induced apoptosis (225)
In contrast to GST P1-1
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death (227)
154 GSTs and asthma
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms (228)
The
damage caused by oxidative injury leads to an increase in airway reactivity andor
secretions and influences the production of chemoattractants and increases
vascular permeability(229)
All these factors exacerbate inflammation which is the
hallmark of asthma Phase II detoxification enzymes particularly classes of
glutathione S-transferases (GSTs) play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds (230)
Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma (231)
In particular GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases (230)
There are several explanations for the role of GSTs in
disease pathogenesis the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes and may trigger mast cell
degranulation (216)
Secondly it is known that leukotrienes released by mast cells
and eosinophils important compounds in bronchial constriction are inactivated by
GSTs (232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles (233)
155 Glutathione S-transferase Theta 1 (GSTT1)
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress (216)
It has lower glutathione binding activity along with increased
catalytic efficiency They utilize as substrates a wide variety of products of
oxidative stress (234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GSTlsquos enzymes family Human GST genes are
polymorphic either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions(235)
Total gene deletion or null polymorphism leads to no
functional enzymatic activity (236)
Enzymes of this group have a wide range of
substrates including carcinogens in food air or medications tobacco smoke
combustion products (237)
Frequency of GSTT1 null polymorphism differs largely
among different populations It has highest frequency in Asians (50) followed by
African Americans (25) and Caucasians (20) (238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults (229 239 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein resulting in complete loss of functionality (241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems possibly potentiating the pathogenesis of asthma (242)
156Glutathione S-transferase Pi 1(GSTP1)
In human GST-Pi was first detected in placenta (243)
GSTP1 is the predominant
cytosolic GST expressed in lung epithelium (244)
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7 8-diol-9 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons (245)
GSTP1 is a gene located on chromosome
11q13 a known ―hot spot for asthma-related genes(246)
A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (AgtG) (247)
The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity (248)
This GSTP1
variant has been associated with asthma in some studies (249250 251)
but not all
studies( 252253)
This variant has been reported to be both protective (254 255 256)
and a
risk factor(250 257 258)
for asthma The inconsistency may have several explanations
including differences in asthma pathogenesis in young children and adults as well
as the effects of other common variants in GSTP1 coding and promoter regions
(250 257)
16 Diagnosis
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise viral infections allergens or air pollution(8)
Spirometry is
then used to confirm the diagnosis(8)
In children under the age of six the diagnosis
is more difficult as they are too young for spirometry (10)
17 Classification and severity
According to guidelines evaluation of severity is necessary for appropriate and
adequate treatment especially the selection and dosing of medications(259 260)
Based on symptoms and signs of severity asthma can be classified into four
clinical stages intermittent mild persistent moderate persistent and severe
persistent(259260)
Certain medications are indicated for each clinical stage(261) It is
clinically classified according to the frequency of symptoms forced expiratory
volume in one second (FEV1) and peak expiratory flow rate(262)
Peak flow meter
is necessary to be able to assess the severity of asthma at different times measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA) (259)
The international union against tuberculosis
and lung disease (263)
estimates the severity of the symptoms as follows
Intermittent symptoms disappear for long periods When they return they occur
less than once a week (lt weekly) The periods of attacks last only a few hours or a
few days When there are nocturnal symptoms they occur less than twice a
month
Persistent symptoms never disappear for more than one week When symptoms
occur more than once a week they are called persistent
Mild persistent symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month
Moderate persistent symptoms are daily and attacks affect activity and sleep
patterns more than once a week
Severe persistent symptoms are continuous with frequent attacks limiting
physical activity and often occurring at night
Table (12) Clinical classification (ge 12 years old) (262)
Severity Symptom
frequency
Night time
symptoms
FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent le 2week le 2month ge 80 lt20 le
2daysweek
Mild
persistent
gt2week 3ndash4month ge 80 20ndash30 gt
2daysweek
Moderate
persistent
Daily gt 1week 60ndash80 gt 30 daily
Severe
persistent
Continuously Frequent
(7timesweek)
lt 60 gt 30 ge twiceday
18 Prevention and management
Early pet exposure may be useful(264)
Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective(265)
Plan for proactively monitoring and managing symptoms should be created This
plan should include the reduction of exposure to allergens testing to assess the
severity of symptoms and the usage of medications The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down(10)
The most effective treatment for asthma is identifying triggers
such as cigarette smoke pets and aspirin and eliminating exposure to them If
trigger avoidance is insufficient the use of medication is recommended
Pharmaceutical drugs are selected based on among other things the severity of
illness and the frequency of symptoms Specific medications for asthma are
broadly classified into fast-acting and long-acting categories (8)
19 Justification
Currently there is no cure for asthma however people who have asthma can still
lead productive lives if they control their asthma Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients including daily symptom scores and use of inhaled asthma medication
These measures are prone to inconsistencies due to variations in investigator and
patient assessments They can also be difficult to obtain especially in young
children and most of them imperfectly reflect physiologic alterations involved
with asthma Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity Studies
point to IL4 IL4RA ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy and to investigate
haptoglobin phenotype in asthmatic patients
110 Objectives
General objectives
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics
Specific objectives
The specific objectives of the study are to
1 Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls
2 Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique
3 Determine the frequency of the known alleles of IL4 IL4Rα ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods
4 Correlate between genetic polymorphisms of IL4 (-590)IL4Rα (- 576)
ADAM33 and GSTs (GSTT1 GSTPi) and the severity of asthma among
Sudanese population
Materials and Methods
21 Materials
The following materials were used in this study
211 Electronic Spirometer
- MicroMicro Plus Spirometers CE120 was purchased from Micro Medical
Limited 1998
ndash PO Box 6 Rochester Kent ME 1 2AZ England
It measures magnitude and velocity of air movement out of lungs
The indices measured are-
1 Forced vital capacity (FVC) the volume of gas that can be forcefully
expelled from the lung after maximal inspiration
2 The forced expiratory volume in the first second (FEV1) the
volume of gas expelled in the first second of the FVC maneuver
3 Peak expiratory flow rate (PEFR) the maximum air flow rate
achieved in the FVC maneuver
4 Maximum voluntary ventilation (MVV) the maximum volumes of
gas that can be breathed in and out during 1minute
5 Slow vital capacity (SVC) the volume of gas that can be slowly
exhaled after maximal inspiration
6 FEV1FVC values of FEV1 and FVC that are over 80 of predicted are
defined as within the normal range Normally the FEV1 is about 80
of the FVC
Specification of micro and micro-plus spirometers
- Transducer digital volume transducer - Resolution 10ml
- Accuracy +- 3 (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
-Volume range 01 - 999 liters - Flow range 30Lmin ndash 1000Lmin
-Display custom 3digit liquid crystal - power supply 9v PP3
- Storage Temperature 20 to + 70O
C - Storage Humidity10 - 90 RH
Mouth pieces
Disposable mouth pieces Micro Medical CE 120 - cat No SPF 6050
- Spiro safe pulmonary filters - Made in England
Figure (21) Electronic Spirometer and mouth pieces
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
212 Gel electrophoresis cell
- Horizontal gels within a single tank
- Designed for rapid screening of DNA and PCR samples
- CS Cleaver Scientific - www Cleaverscientificcom
Figure (22) Gel electrophoresis cell
(1)
(2)
(3)
(4)
1 Power supply - Model MP -250V
- Serial number 091202016 - 120~ 240V ~ 4760 Hz
2 Casting dams allow gels to be rapidly cast externally
3 Combs (The number of samples can be maximized using high tooth
number combs)
4 Tank
- Stock code MSMINI -Made in the UK
-Max volts 250 VDC - Max current 250 m A
213 PCR machine
Alpha Laboratories Ltd 40 Parham Drive Eastleigh
Hampshire 5050 4NU ndash United Kingdom Tel 023 80 483000
Figure (23) PCR machine
PCR running program
214 Primers
Made in Korea wwwmocrogenecom
Macrogen Inc ndash dong Geumchun ndash gu Seoul Korea 153-781
Tel 82-2-2113-7037 Fax 82-2-2113-7919
Figure (24) Forward and Reverse primers
215 Maxime PCR PreMix Kit ( i-Taq)
- Product Catalog No25025 (for 20microL rxn 96tubes)
- iNtRON biotechnology Inc wwwintronbiocom infointronbiocom
- Korea T (0505)550-5600 F (0505)550- 5660
Figure (25) Maxime PCR PreMix Kit ( i-Taq)
216 UV Transilluminator JY-02S analyzer
- Made in china - Model number JY- 02S - Serial number 0903002D
- Input voltage 220 plusmn 10 - Input frequency 50 Hz - Fuse Φ5times 20 3Atimes2
- It is used to take and analyze the picture after the electrophoresis
Figure (26) UV Transilluminator analyzer
217 Microplate reader
Model RT-2100C - 451403041 FSEP
ac 110 V- 220V 5060Hz 120 WATTS T315 AL 250V
Rayto life and Analytical sciences Co Ltd
CampD4F7th Xinghua industrial Bldg Nanhai Rd
Shanghai International Holding CorpGmbH (Europe)
Eiffestrasse 80 D- 20537 Hamburg Germany
- RT-2100C is a microprocessor ndashcontrolled general purpose photometer system
designed to read and calculate the result of assays including contagion tumorous
mark hemopathy dyshormonism which are read in microtiter plate
Figure (27) Microplate reader
1- Touch panel display program
2- Plastic cover
3- Plate carrier Microplate in plate carrier
(1)(2)
(3)
218 ELIZA kits
Made in MINNEAPOLIS MN USA
- wwwRnDSystemscom
RampD SystemsInc USA amp Canada RampD systems Inc (800)343-7475
Figure (28) ELIZA kits for haptoglobin and IL4
219 Vertical electrophoresis cell
- For routine mini protein electrophoresis
- Model DYC2 ndash 24 DN - Serial number 028 ndash 01
- Umax 600 V - Imax 200mA - Bei jing Liuyi Instrument Factory
- Add No 128 Zaojia Street Fengtai District Beijing china
Tel +86- 10- 63718710 Fax +86- 10- 63719049
Figure (29) Vertical electrophoresis
Power supply
Electrophoresis cell (Tank)
22 Methods
221 Study design It is a cross sectional analytic and descriptive study
222 Study area the study was conducted during (2013-2014) in Khartoum
state
223 Study population
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included Subjects with any
chronic disease or chest deformity or smoking habits were excluded
Sample size
- One hundred and sixteen Sudanese subjects were selected Sixty three were
asthmatic patients and Fifty three were healthy volunteers
224 Ethical considerations
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants
225 Procedures
The study was conducted through the following phases Questionnaire Clinical
examination Body Mass Index (BMI) Lung function tests collection of blood
sample Molecular analysis and Laboratory Analysis
2251 Questionnaire
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data smoking habits Family history age of
onset past medical history drug history triggering factors Major asthma
symptoms such as wheeze cough chest tightness and shortness of breathing The
severity of asthma was assessed in accordance with the international UNION
classification Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2)
Asthma Control Test
There were five questions in total The patient was requested to circle the
appropriate score for each question By adding up the numbers of the
patientrsquos responses the total asthma control score was calculated
2252 Clinical examination
The respiratory rate pulse rate blood pressure and any chest signs were recorded
2253Body Mass Index (BMI)
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer) BMI was calculated by weight in kilograms over
height in meters squared
2254 Lung function tests
Pulmonary function tests were performed by using electronic spirometer
The switch unit was moved to its first position (BLOW)the display unit was
indicated (Blow) and three zeros Measurements started with asking a
subject to stand up take a deep breath put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it and then blow air out
as hard and as fast as possible for at least 5 seconds When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria The best was
taken (266) according to the guidelines of the American Thoracic Society and
European Respiratory Society
2255 Sampling technique
Five mL of venous blood was collected from each subject 25ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction and 25 ml transferred into plain tube for
serum Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C
2256 Molecular analysis
22561 DNA extraction
DNA extraction from human blood
DNA was extracted from the peripheral blood leucocytes using salting out
method
Salting out method for DNA extraction from human blood (267)
I Solutions and buffers
1 PBS (1 mM KH2P04 154mM NaCl 56 mM Na2HP04 pH74)- 1 liter
2 Sucrose Triton X-lysing Buffer
3 T20E5 pH8
4 Proteinase K (stock of 10 mgmL)
5 Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated It was agitated before use and NaCl was left
to precipitate out)
Purification of DNA from blood (25mL sample)
25 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube It was diluted with 2 volumes of PBS mixed by
inverting the tubes and centrifuged at 3000 g for 10 min The supernatant was
poured off The pellet (reddish) is resuspend in 125ml of Sucrose Triton X-100
Lysing Buffer The mixture was vortexed and then placed on ice for 5 minutes
The mixture was spun for 5 minutes at 3000 rpm in TH4 rotor and the
supernatant was poured off The pellet (pinkish or white) was resuspend in 15
mL of T20E5 (06X volume of original blood) 10 SDS was added to a final
concentration of 1 (100 L) then Protienase K was added (10 mgmL) (20 L)
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm A white pellet was formed which consisted of protein precipitated by
salt the supernatant that contained the DNA was transferred to a new tube
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube The DNA was washed in 70 ice-
cold alcohol (1 mL) air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve DNA was detected by
electrophoresis on gel
Figure (210) Precipitation of DNA
visible air bubbles ldquoliftrdquo the DNA outof solution
DNA clumptogether
White LayercontainingDNA
22562 Agarose gel electrophoresis requirements for DNA and PCR
product
- Agarose forms an inert matrix utilized in separation
- Ethidium bromide for fluorescence under ultraviolet light
- TBE stands for Tris Borate EDTA
- Loading buffer 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells
-Agarose gel electrophoresis procedure
- Making the gel (for a 2 gel 100mL volume)
The mixture was heated until the agarose completely dissolved and then cooled
to about 60degC and 4microL of ethidium bromide (10mgmL) added and swirled to
mix The gel slowly poured into the tank Any bubbles were pushed away to the
side using a disposable tip The combs were inserted double check for being
correctly positioned and left to solidify 5microL DNA or PCR product was loaded
on the gel (inside the well) 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel The gel was run at 100V for 20 minutes After that it
was viewed on the ultra- violet radiation system
-Five SNPs were selected for screening (table 21)
22563 Polymerase chain reaction (PCR)
Standard PCR reaction
All components necessary to make new DNA in the PCR process were placed in
20microl total volume The experiment consists of DNA in 05 ml maxime PCR
Premix tube
Primers preparation
10 microL of primer added to 90 microL of sterile water Forward and reverse primers were
prepared in separate eppendorf tube
Preparation of PCR mixture
The mixture prepared by adding 1 microL of forward primer 1 microL of reverse primer
and 16 microL sterile water to PCR Premix tube and finally 2 microL of DNA(appendix
3)
Table (22) The Polymerase chain reaction protocol
PCR cycle Temperature Time Number of cycles
Initial denaturation 94оC 5 min -
Denaturation 94оC 30sec 30
Annealing 57оC 30sec 30
Extension 72оC 30sec 30
Final extension 72оC 5min -
Checking of PCR products
To confirm the presence of amplifiable DNA in the samples by evaluating the
production of the target fragment by gel electrophoresis of 5microL PCR products on
2 agarose gel stained with ethidium bromide
22564Restriction Fragment Length Polymorphism Analysis (RFLPs)
For restriction enzyme analysis the mixture contains 10 μL of the PCR product
05 μL (10 U) of restriction enzyme 25 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) This mixture was incubated according to the enzyme After
the incubation was complete the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer
Table (23) the restriction enzymes incubation protocol
Enzyme Incubation Inactivation
BsmFI (appendix 4) 1 hour at 65оC 20 minutes at 80
оC
BsmAI (appendix 5) 2 hours at 55оC 20 minutes at 80
оC
MspI (appendix 6) 20 minute at 37оC -----
2257 Laboratory Analysis
22571 Polyacrylamide Gel Electrophoresis (PAGE) (268)
Principle of the test
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel The proteins move into the gel when an electric field is
applied The gel minimizes convection currents caused by small temperature
gradients and it minimizes protein movements other than those induced by the
electric field Proteins can be visualized after electrophoresis by treating the gel
with a stain which binds to the proteins but not to the gel itself Each band on the
gel represents a different protein (or a protein subunit) smaller proteins are found
near the bottom of the gel
225711 Preparation of the reagents
- 30 acrylbisacrylamide
30g of acrylamide and 08g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O)
- 8X TrissdotCl pH 88 (15 M TrissdotCl)
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 88 with 1 N HCl
H2O was added to 500 ml total volume
- 10 of ammonium persulphate
1g of ammouniumpersulphate was dissolved in 100ml dH2O
- 4X TrissdotCl pH 68 (05 M TrissdotCl)
605 g Tris base was dissolved in 40 ml H2O and adjusted to pH 68 with 1 N
HCl H2O was added to 100 ml total volume
- Sample buffer
1ml glycerol 1ml distilled H2O and 0001g bromophenol blue were mixed
- 5XElectrophoresis buffer
151g Tris base and 720g glycine were dissolved in 1000 ml H2O
Dilute to 1X for working solution
- Benzidine stain
146 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
4854 ml distilled H2O
1 drop H2O2 (2 = 5 microl200 microl) was added just before use
- Hemoglobin (Hb) solution
1ml of whole blood was washed by 5ml PBS five times 1ml of washed RBCs
added to 9 ml distilled water left at room temperature for 30 minute Then
centrifuged at 15000 for 1hour The supernatant is the standard Hb solution
225712 Separating gel preparation
The phenotypes of Hp was determined using 7 acrylamide gel which was
prepared by mixing 35ml of 30 acrylamidebis-acrylamide 375ml of 15 M
Tris-Cl (pH 88) 70microl of 10 ammonium persulphate and 20microl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 775ml deionized water mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument One ml
of butanol was added just after the addition of the gel to prevent bubbles formation
The gel was left to solidify for 20 min before the addition of the stacking gel
225713 Stacking gel preparation
After the solidification of the separating gel stacking gel was prepared by mixing
065 ml of 30 acrylamidebisacrylamide 125 ml of 05 M Tris-Cl 30microl of 10
ammonium persulphate and 15microl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 305 ml deionized water mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel and immediately a 15mm thick comb was inserted the gel was left
to solidify for 20 min after that the combs were removed
225714 Sample preparation and loading
From the serum 10microl was mixed with 3microl of Hb solution and incubated for 5 min
at room temperature then 10microl of the sample buffer was added and mixed 10 microl of
the sample were loaded into the gel Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs
225714 Protein staining
After the protein has been separated the protein was stained by Benzidin stain
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel
22572 ELISA (enzyme-linked immuno assay)
225721 Quantitative assay for total IgE antibodies
The components of the kit are (appendix 7)
Microplate 96 wells pre-coated with anti-IgE
Reagent 1 buffered protein solution with antimicrobial agent
Reagent 2 wash buffer concentrate
Reagent 3 (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase)
Reagent 4 TMB substrate (Tetramethylbenzidine)
Reagent 5 stop solution
Standards 0 50 150 375 1250IUml of 10mM tris-buffered saline
containing human serum IgE ready to use
Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use
Principle of the test
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells After washing away unbound serum components monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells and
this binds to surface- bound IgE during the second incubation Unbound
conjugate is removed by washing and a solution containing 3 3 5 5 -
tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding Addition to stop solution terminates the reaction and provides
the appropriate pH color development The optical densities of the standards
positive control and samples are measured using microplate reader at 450 nm
Procedure
-100microl of each standard and positive control were dispensed
20microl of each sample and 80microl of sample diluent were dispensed into each sample
well (to make a 15 dilution) The plate was tapped rapidly to mix the well
contents It was then incubated for 60 minutes at room temperature During all
incubations direct sunlight and close proximity of any heat sources were avoided
After 60 minutes the well contents were decanted and washed 3 times using
manual procedure
Manual wash procedure
The wells were emptied by inversion and blotted on absorbent paper The wells
were filled with wash buffer by wash bottle and then emptied again This wash
process was repeated 3 times
After that100microl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer 100microl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser The
plate was incubated for 15 minutes100microl of stop solution was added to each well
To allow equal reaction times the stop solution should be added to the wells in
the same order as the TMB substrate The optical density of each well was read at
450nm by a microplate reader within 10 minutes
225722 Quantitative assay for total Haptoglobin
The components of the kit are (appendix 8)
Microplate 96 well coated with antibody against human Hp
Hp Conjugate antibody against human Hp (horseradish peroxidase)
Standard human Hp in a buffered protein base
Assay diluent RD1-109 buffered protein base
Calibrator diluent RD5-67 buffered protein base
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay
This assay employs the quantitative sandwich enzyme immunoassay technique
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody After washing away any unbound
substances an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells Following a wash to remove any unbound antibody- enzyme
reagent a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step The color development is
stopped and the intensity of the color is measured
Reagent preparation
All reagents and samples were brought to room temperature before use Wash
buffer was mixed gently Color reagent A and B were mixed together in equal
volumes within 15 minutes of use Calibrator diluent was prepared by adding 20microL
of it to 80 20microL distilled water (Appendix 9)
Assay procedure
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal200microL of assay diluents
RD1-109 was added to each well 20 microL of standard control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature After that aspirated and washed and repeated the process
three times for a total four washes Complete removal of liquid at each step is
essential to good performance After the last wash removed any remaining wash
buffer by aspirating or decanting The plate was inverted and plotted against clean
paper towels
After washing 200 microL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature The
aspirationwash as in step 5 was repeated 200 microL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light 50 microL of stop solution was added to each well The optical
density of each well was determined within 30 minutes by a microplate reader set
to 450nm
225723 Quantitative assay for IL4
The components of the kit are (appendix 10)
Microplate 96 well coated with antibody specific for human IL4
Human IL4 standard recombinant human IL4 in a buffered protein base
IL4 Conjugate antibody specific for IL4 (horseradish peroxidase)
Assay diluent RD1- 32 buffered protein base
Calibrator diluent RD6-9 animal serum
Wash buffer concentrate concentrated solution of buffered surfactant
Color reagent A stabilized hydrogen peroxide
Color reagent B stabilized chomogen (tertramethylbenzidine)
Stop solution 2N sulfuric acid
Principle of the assay it is the same principle as for haptoglobin
Reagent preparation
All reagents and samples were brought to room temperature before use
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use Calibrator diluent RD5Lwas
diluted (1-5) by adding 20microL of it to 80microL distilled water (Appendix 11)
Assay procedure
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal 100microL of assay diluents
RD1-32 was added to each well and 50 microL of standard control samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature
Aspirate and wash each well and repeated the process twice for a total three
washes Wash by filling each well with wash buffer (400 microL) using a squirt bottle
Any remaining wash buffer was removed by aspirating or decanting after the last
wash The plate was inverted and plotted against clean paper towels
200 microL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature The aspirationwash
was repeated and 200 microL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light50 microL
of stop solution was added to each well and the color in the well was changed
from blue to yellow The optical density of each well was determined within 30
minutes by using a microplate reader set to 450nm
23 Method of data analysis
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS) Data were expressed as means with the standard deviation
(sd)The correlations were analyzed by Pearson correlations Numerical data were
compared using one way ANOVA for multiple groups Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups
When three groups (two homozygote groups and one heterozygote group) were
compared only the overall p value was generated to determine whether an overall
difference in the three groups existed And a P value equal to or lower than 005
was considered statistically significant
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes
Figure (31) The percentage of females and males in the study group
31 Study group
The participants were distributed as
Test group
63 subjects were selected and classified as Asthmatic
- 35 subjects were females
- 28 subjects were males
Control group
53 subjects were selected and classified as normal
52
48
Male 65
Female 61
- 16 subjects were females
- 37 subjects were males
Figure (32) The total number of females and males
Table (31) Distribution of anthropometric characteristics among female
subjects
Tab
le
(32
)
Dist
rib
utio
n of anthropometric characteristics among male subjects
Means plusmn sd P values
Number Normal (16) Asthmatic (35)
Age (years) 294 plusmn 6 3477 plusmn13 0126
Height (cm) 1635 plusmn 65 1589 plusmn 59 0058
Weight (Kg) 6975 plusmn 838 685 plusmn 158 0836
Body mass index (Kgm2) 263 plusmn 417 2708 plusmn 64 0751
Means plusmn sd P values
Gen
etic
studi
es do
not
influ
enced by age
The asthmatic group was divided according to International UNION classification
(237)We have included 63 cases of asthma of which 10 (16) had intermittent 10
(16) had mild persistent 27(43) had moderate persistent and 16(25) had
severe persistent subgroup of asthma
Figure (33) The classification of asthmatic group
32 Asthma Control Test (ACT)
The ACT test showed decline in asthmatic patients score (table 33)
Table (33) The asthma control test score in asthma patients
Series1
Intermittent
10 10 16
Series1 Mild
10 10 16
Series1
Moderate 27
27 43
Series1
Severe 16
16 25 Intermittent 10
Mild 10
Moderate 27
Severe 16
Number Normal (37) Asthmatic (28) ------------
Age (years) 3005 plusmn 78 4058 plusmn 16 0002
Height (cm) 179 plusmn 79 1699 plusmn 89 0751
Weight (Kg) 76 plusmn 11 691 plusmn 16 0181
Body mass index (Kgm2) 241 plusmn 36 235 plusmn 46 0717
Test Means plusmn Sd
P values Asthmatic score Total score
ACT 158 25 0000
ACT score lt 20- off target indicates that asthma was not controlled
33 lung function tests
All parameters (FEV1 FVC PEFR) were better in normal compared to asthmatic
subjects The difference between normal and asthmatic was highly significant
(table 34)
Table (34) Distribution of lung functions test among the study group
Test Means plusmn Sd P values
Normal (53) Asthmatic (63)
FEV1 316 plusmn 077 201 plusmn 073 0000
FVC 366 plusmn 083 263 plusmn 088 0000
PEFR 484 plusmn 147 3128 plusmn 1125 0000
FVC forced vital capacity FEV1 forced expiratory volume in 1second
PEFR peak expiratory flow rate
34 Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE and IL4 were significantly higher in asthmatics (table 35)
Table (35) Distribution of serum level of IgE and IL4 among the study group
Test Means plusmn sd
P values Normal Asthmatic
IgE (IUml) 334 plusmn 25071 769 plusmn 3776 0000
IL4 (pgmL ) 1027 plusmn11 125 plusmn 21 0000
Figure (34) IgE level in asthmatic and control group
Figure (35) IL4 level in asthmatic and control
Asthmati
c
Asthmati
c 769 Asthmati
c
Control
334
Control Asthmatic 0
Control Control 0
IgE IUmL
Asthmatic Control
341 Serum level of IgE in different classes of asthma
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0867)(table36)
Table (36) Serum IgE in different classes of Asthma
Asthma class Mean (plusmnSd) P Value
Intermittent 7433 plusmn 4053
0867
Mild 855 plusmn 3873
Moderate 7679 plusmn 3628
Severe 722 plusmn 4123
342 Serum level of IL4 in different classes of asthma
Asthmati
c 125 Control
1027
IL4 pgmL
Asthmatic Control
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0536)(table37)
Table (37) Serum IL4 in different classes of Asthma
35
Haptoglobin phenotypes and Level
The high haptoglobin phenotypes frequency of asthmatics was observed in 508
patients with Hp2-1 The Hp2-2 phenotype frequencies were found in 317 and
Hp1-1 in 175 In healthy control group the high haptoglobin phenotype
frequencies were seen in 66 with Hp2-1 whereas 264 for Hp2-2 and 76 for
Hp1-1 were found (table38) Figure (36) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0163)
Table (38) Distribution of Hp phenotype among the study group
Asthma class Mean plusmnSd P Value
Intermittent 119 plusmn 23
0536
Mild 133 plusmn 18
Moderate 126 plusmn 24
Severe 123 plusmn 16
Phenotype of Normal of Asthmatic P values
1-1 76 175
0163 2-1 66 508
2-2 264 317
Figure (36) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel
1-1 2-2 2-1 2-1 2-1 2-1 2-2 2-1 2-1 1-1
Serum Hp level showed significant difference between asthmatic and control
(table39)(figure37)Comparing serum Hp levels between patients and controls in
1 2 3 4 5 6 7 8 9 10
Lanes 1101-1 Hp phenotype(smallest molecular weight)lanes 27 2-2
Hp phenotype(largest molecular weight) Lanes 3 4 5 6 8 92-1 Hp
phenotype
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 310)
Table (39) Distribution of serum level of Hp among the study group
Test Means plusmn sd P values
Normal Asthmatic
Hp (gL ) 272 plusmn14 417 plusmn 17 0001
Figure (37) comparison of Hp level in serum of asthmatic and control
Table (310) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype
Phenotype Group Mean(gL) plusmnSd P Value
Asthmati
c
Asthmati
c 417
Asthmati
c
Control
272
Control Asthmatic 0
Control Control 0
Hp gL
Asthmatic Control
1-1
Patients 39 plusmn 14 0035
Control 19 plusmn 026
2-1 Patients 406 plusmn 17 0008
Control 275 plusmn101
2-2 Patients 448 plusmn18 0391
Control 338 plusmn 324
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table311)
Table (311) Serum Hp in different classes of Asthma
Asthma class Mean (gL) plusmn sd P Value
Intermittent 523 plusmn 15
0034
Mild 359 plusmn 22
Moderate 368 plusmn 13
Severe 479 plusmn14
36 polymorphisms of ADAM33 in chromosome 20
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma The minor allele A of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group The major
allele G was significantly more frequent in the control group than in asthmatics
(P-value = 0000) (table 312) (figure 38)Concerning genotype frequencies Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects The minor AA genotype was more frequent in the
asthmatics (714) than in the control group (P-value = 0000) (table 312) Figure
(39) showed ADAM33 PCR product on 3 agarose and Figure (310) showed
analysis of ADAM33 polymorphism on 38 agarose
Table (312) Allele and genotype frequencies for ADAM33 SNPs
Figure (38) Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
F+1 GgtA
G 19 443
0000 A 81 557
GG 95 245
0000 GA 191 415
AA 714 34
Figure (39) The ADAM33 PCR product on 3 agarose
Figure (310) Analysis of ADAM33 polymorphism on 38 agarose
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
The ADAM33 F+1 PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 1-7 ADAM33 PCR products
Analysis of the ADAM33 F+1 polymorphism on 38 agarose M DNA
Ladder (100pb) Lanes 1 2 3 Allele (GA) heterozygous Lanes 45 Allele
(GG) homozygous Lane 7 Allele (AA) homozygous
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table311) While no significant difference with Homozygous (AA) genotype
(P=0074) (table 313)
Table (313) A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype
ADAM33
genotype
FEV1 mean plusmn Sd
P value Asthmatics Control
GG 203 plusmn 866 300 plusmn 72 0074
GA 1679 plusmn 83 291 plusmn 578 0005
AA 2096 plusmn679 3419 plusmn90 0000
37 Polymorphisms of IL4 (-590 CT) in chromosome 5
Analysis of both allele and genotype frequencies for IL4 promoter (-590CT)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (-
590CT) polymorphism was significantly associated with asthma (table 314) The
minor allele T of IL4 promoter (-590CT) SNPs was significantly more frequent
in asthmatics than in the control group (figure 311) The major allele C was
significantly more frequent in the control group than in asthmatics (Pvalue =
0000) (table 314)Concerning genotype frequencies Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects The minor TT genotype was more frequent in the asthmatics
(651) than in the control group (Pvalue = 0022) (table 314) Figure (312)
showed IL4 (-590CT) PCR product on 3 agarose
Table (314) Allele and genotype frequencies for IL4 (-590CT) SNPs
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Figure (311) Mutant Allelic frequencies of IL4 (-590CT) polymorphism for
asthmatic and control ()
Figure (312) The IL4 (-590 CT) PCR product on 3 agarose
Allelic frequencies of IL4 polymorphism for
asthmatic and control ()
-590CgtT
C 302 571
000 T 698 429
CC 254 543
0022 CT 95 57
TT 651 40
The IL4 (-590) CgtT PCR product on 3 agarose M DNA Ladder
(100pb) Lanelsquos 2-7 IL4 PCR products
38 Polymorphisms of IL4Rα (- Q576R) in chromosome 16
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele C and the major allele T in asthmatics and
control group (Pvalue = 0170) (table 315) (figure 313)Concerning genotype
frequencies Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects The minor CC
genotype was (3333)in the asthmatics and (245) in the control group (P-value
= 0402) (table 315) Figure (314) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3 agarose
Table (315) Allele and genotype frequencies for IL4Rα (-576) SNPs
Figure
(313)
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
-Q576R
T gtC
T 429 519
0170 C 571 481
TT 1905 283
0402 TC 4762 472
CC 3333 245
Figure (314) The IL4Rα (-576) PCR product and analysis of polymorphism
on 3 agarose
39 GSTs polymorphisms
391 Polymorphisms of GSTT1 in chromosome 22
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chi-
square calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0001)(table 316) (figure 315) Figure
(316) showed analysis of GSTT1 polymorphism on 3 agarose
Table (316) Genotype distribution of GSTT1 SNPs
Analysis of the IL4Rα T gtC (Q576R) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 5 Allele (CC) homozygous Lanes 6
7 Allele (TT) homozygous Lanes 2 3 4 Allele (TC) heterozygous
Figu
re
(315
)
GSTT1 null genotype frequencies for asthmatic and control ()
Figure (316) Analysis of GSTT1 polymorphism on 3 agarose
SNPs Allele of Asthmatics of Normal P value
Null allele Null 54 245
0001 Present 46 755
Analysis of the GSTT1 Genotype on 3 agarose A350 bp fragment from
the β-globin was coamplified for internal control purposes
M DNA Ladder (100pb) Lanes 1 4 null genotype Lanes 23567
392 Polymorphisms of GSTPi in chromosome 11
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele G and major allele A in
asthmatics and control group (Pvalue = 0358) (table 317) (figure
317)Concerning genotype frequencies Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects The minor GG genotype was (19) in the asthmatics and (1698) in
the control group (P-value = 0669) (table 317) Figure (318) showed GSTPi
Ile105Val PCR product on 3 agarose and Figure (319) showed analysis of
GSTPi Ile105Val polymorphism on 3 agarose
Table (317) Allele and genotype frequencies for GSTPi SNPs
Figure (317) Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control ()
SNPs Allele or
genotype
of
Asthmatics
of
Normal
P value
Ile105Val
313AgtG
A 651 708
0358 G 349 292
AA 508 5849
0669 AG 302 2453
GG 19 1698
Figure (318) The GSTPi Ile105Val PCR product on 3 agarose
Figure (319) Analysis of Ile105Val polymorphism on 3 agarose
The GSTPi AgtG (Ile_Val105) PCR product on 3 agarose
M DNA Ladder (100pb) Lanes 2-7GSTPi PCR product
310 Frequencies of mutant genotypes
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 318) (figure 320)
Table (318) Combination of various risk mutant genotypes
Number of
mutant genotype of Normal of Asthmatic
0 321 79
1 34 79
2 189 381
3 132 333
4 18 111
5 0 16
Figure (320) Combination of various risk mutant genotypes of 5 genes
Analysis of the GSTPi AgtG (Ile_Val105) polymorphism on 3 agarose
M DNA Ladder (100pb) Lanes 1 3 Allele (AA) homozygous Lane2
Allele (GG) homozygous Lanes 4 5 Allele (AG) heterozygous
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls termed airways remodeling The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0000 and P=0000 respectively) and no significant difference between asthma
classes A linkage between total serum IgE and IL4 gene has been shown IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels(162164)
The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table313) and
the IL4 T-590 allele causes hyperproduction of IL-4(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls whereas Hp2-1 was higher in control group Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1(80)
Control 0
mutation
321
Control
1mutation
34 Control 2
mutation
189 Control 3
mutaion
132
Control 4
mutaion
18 Control 5
mutaion 0
Asthmatic
0 mutation
75
Asthmatic
1mutation
75
Asthmatic
2 mutation
381
Asthmatic
3 mutaion
333
Asthmatic
4 mutaion
111 Asthmatic
5 mutaion
16
Control
Asthmatic
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 39) and significantly higher in all asthma
classes (table 311)This is not unexpected since other studies (120120)
showed that
asthma is associated with a higher Hp level Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al (125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma Krasteva et al (269)
reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects This
result is in disagreement with Piessens MF et al (89)
who reported that the Hp level
was decreased in asthmatic subjects Increase in Hp was seen in uncontrolled
asthma (122)
The increased Hp level in this study might be due to the poor control of
asthma The possible explanation for the high level is the especial functions of Hp
as an immune system modulator (95)
Also Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation (100)
Although IgE is measured as
an investigation for some asthmatics Hp has not been used and it could be a useful
marker for asthma control
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 310) The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101)
and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80)
directly inhibiting their proliferation and modifying the Th1Th2 balance (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in African-
American Hispanic and white populations(137)
In this study we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk As expected
significant associations were observed in asthmatic patients We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 312)In previous studies F+1 SNP
polymorphism was reported in Indian adult populations (270)
and UK (39)
and
German populations(271)
and these associations were also found in the study
samples In contrast lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272)
and Australia(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table313) while no significant difference
with Homozygous (AA) genotype (table 313) These results are supported by
previous studies Jongepier H et al (138)
reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1) These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma(139)
Another study conducted in infants of allergicasthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance
with the strongest effect seen in the homozygotes(140)
Thus the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4) The derivative allele T has been related to elevated serum levels of IgE and
asthma (165)
Walley et al (165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table35)Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 35) In this study -590CT IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (651 in asthmatic and 40 in control) (P=
0022) (table 313) Also it was found that the T allele frequencies was
significantly associated with asthma (table 313) (P= 0000) The results of this
study are more in agreement with work reported in different population (51162274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG which happens in response to IL4IL-
13 and allergensantigens In this study it was found that the minor allele C was
more frequently in asthmatics than in control subjects likewise the major allele T
was found more frequently in the control subjects than in asthmatics (table 314)
but statistically not significant (P= 0170) The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 314) but
statistically not significant (P= 0402) Association studies between IL4Rα
polymorphisms and asthma have been reported in several ethnic
groups(180184185)
One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children(275)
IL-4R α
polymorphisms alone may not always influence the susceptibility to disease(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility The consequence of these
findings is that common variants alone cannot account for a given disease
Phase II detoxification enzymes particularly classes of glutathione S-transferases
(GSTs) play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds(203)
Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma (204)
In particular
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases (203)
This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 315) Frequency of GSTT1 null
polymorphism differs largely among different populations It has highest frequency
in Asians (50) followed by African Americans (25) and Caucasians (20)
(211)Total gene deletion or null polymorphism leads to no functional enzymatic
activity (209)
On the other hand genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 316) The mutant GG
genotype was (19) in the asthmatics and (1698) in the control group (P=
0669) in agreement with work reporting that in different populations( 225226)
Some
studies reported association between GSTP1 variant and asthma (222223 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction airway remodeling hyperactivity mucus
hypersecretion and persistent inflammation(276)
Given the complexity of asthma it
could be speculated that in an individual multiple SNPs in several genes could act
in concert or synergy to produce a significant effect The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma Therefore it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes The results showed a significant
association between the IL-4 promoter polymorphism -589CT and asthma
Furthermore this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects Table (317) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma Based on study
findings each candidate gene might modulate an association with asthma
But a combination of more the one gene modulate the different role of
pathogenesis such as IL4 for persistent inflammation ADAM33 for airway
remodeling and hyperactivity
Conclusion ampRecommendations
51Conclusion
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes Hp phenotypes have no role in activation of the
disease while Hp level was higher in asthmatic patients and in all asthma classes
Gene polymorphism of ADAM33 IL4 (-590) and GSTT1 may be associated with
the development of asthma While GSTPi gene appears to play no role in the
occurrence of the disease The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma
A combination of more than one gene may play an important role in the
susceptibility and development of asthma
Chromosome 20p13 chromosome 16p121 and chromosome 22q112 may be
associated with the development of asthma in Sudan
52 Recommendations
Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma and thus become an important target for the
development of therapeutic Therefore the discovery of new cytokine can
afford other opportunity to control the disease
Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms
The Haptoglobin level can be used as a biomarker for asthma control
Further studies on the complete genetic pathway including specific IgE
receptor gene
Functional studies on the IL4 ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed
References
1 Masoli M Fabian D Holt S Beasley R (2004) Global Initiative for Asthma
(GINA) program the global burden of asthma executive summary of the GINA
Dissemination Committee reportAllergy 59 469-478
2 Mukherjee AB Zhang ZA (2011) Allergic Asthma Influence of Genetic and
Environmental Factors J Biol Chem286 32883ndash32889
3 Wenzel S E (2006) Asthma defining of the persistent adult phenotypes Lancet
368 804ndash813
4 NHLBI (National Heart Lung and Blood Institute) (2004) Diseases and
conditionsindexhttpwwwnhlbinihgovhealthdciDiseasesAsthmaAsthma_
WhatIshtml
5 Self Timothy Chrisman Cary Finch Christopher (2009) 22 Asthma In
Mary Anne Koda-Kimble Brian K Alldredge et al Applied therapeutics the
clinical use of drugs (9th ed) Philadelphia Lippincott Williams amp Wilkins
6 Delacourt C (2004) Bronchial changes in untreated asthma Pediatr J 11 71sndash
73s
7 Schiffman George (2009) Chronic obstructive pulmonary disease
MedicineNethttpwwwmedicinenetcomchronic obstructive pulmonary
disease copd
8 NHLBI Guideline (National Heart Lung and Blood Institute) (2007) National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma and Natural History of Asthmapp11-42
9 Patient Information Series (2013) What Is Asthma American Thoracic
Society- Am J Respir Crit Care Med Vol 188 P7-8
httppatientsthoracicorginformation- seriesenresourcesvcdpdf
10 GINA (Global Initiative for Asthma) Global strategy for asthma management
and prevention (2011)P1-56Available from wwwginasthmacom
11 Centers for Disease Control and Prevention Vital Signs (2011) Asthma in the
US growing every year httpwwwcdcgovasthmaactionplanhtml
12 Stephen T Holgate Giorgio Walter Canonica Carlos E Baena-Cagnani
Thomas B Casale Myron Zitt Harold Nelson Pakit Vichyanond (2011)
Asthma WAO white book on allergy World Allergy Organization
wwwworldallergyorg
13 World Health Organization (2007) Global surveillance prevention and control
of chronic respiratory diseases a comprehensive approach
14 Adeloye D Chan K y Igor Rudan I Campbell H (2013) An estimate of
asthma prevalence in Africa a systematic analysis Croat Med J 54(6) 519ndash
531
15 Bush A Menzies-Gow A (2009) Phenotypic differences between pediatric and
adult asthma Proc Am Thorac Soc 6 (8) 712ndash9
16 Magzoub AA Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults (2012) (Thesis
submitted for PhD requirement in Human Physiology) National Ribat
University
17 Ait-Khalid N Odihambo J Pearce N Adjoh KS Maesano IA Benhabyles B
Camara L Catteau C Asma ES Hypolite IE Musa OA Jerray M Khaldi F
Sow O Tijani O Zar HJ Melaku K Kuaban C Voyi K (2007) International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III Prevalence of
symptoms of asthma rhinitis and eczema in 13 to 14 year old children in
Africa Allergy 2007 101111j1398-9995
18 Ahmed A Magzoub A Musa O (2009) Prevalence of asthma symptoms in
children in Atbara Sudan The international journal of tuberculosis and lung
disease volume 13 p s 141
19 Bashir A A (2003) Childhood asthma in Gadarif The international journal of
tuberculosis and lung disease volume7 p s154
20 Bashir A Abdalla A Musa O (2009) Childhood asthma in White Nile state
Sudan The international journal of TB and lung diseases volume 13
supplements 1 p s 144
21 Magzoub A Elsoni A Musa OA (2010) Prevalence of asthma symptoms in
adult university students and workers in Dongola North Sudan The
international journal of tuberculosis and lung disease volume 14 p s 69
22 Martinez FD (2007) Genes environments development and asthma a
reappraisal Eur Respir J 29 (1) 179ndash84
23 Miller RL Ho SM (2008) Environmental epigenetics and asthma current
concepts and call for studies American Journal of Respiratory and Critical Care
Medicine 177 (6) 567ndash573
24 Choudhry S Seibold M A Luisa N Borrell L N Tang H Serebrisky D
Chapela R Rodriguez-Santana J R Avila P C Elad Ziv Rodriguez-Cintron W
Risch N J Burchard E G (2007) Dissecting complex diseases in complex
populations asthma in latino americans Proc Am Thorac Soc 4 (3) 226ndash33
25 Dietert RR (2011) Maternal and childhood asthma risk factors interactions
and ramificationsReproductive toxicology (Elmsford NY) 32 (2) 198ndash204
26 Kelly FJ Fussell JC (2011) Air pollution and airway disease Clinical and
experimental allergy journal of the British Society for Allergy and Clinical
Immunology 41 (8) 1059ndash71
27 Ahluwalia SK Matsui EC (2011)The indoor environment and its effects on
childhood asthma Current opinion in allergy and clinical immunology 11
(2)137ndash43
28 Arshad SH (2010) Does exposure to indoor allergens contribute to the
development of asthma and allergy Current allergy and asthma reports 10
(1)49ndash55
29 Custovic A Simpson A (2012) The role of inhalant allergens in allergic
airways disease Journal of investigational allergology amp clinical immunology
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6) 393ndash401
30 Johansen HK (2008) Gotzsche Peter C ed House dust mite control measures
for asthma Cochrane Database Syst Rev (2)
31 McGwin G Lienert J Kennedy JI (2010) Formaldehyde exposure and asthma
in children a systematic review Environmental health perspectives 118 (3)
313ndash7
32 Abdel Razag AE Musa OA (2004) Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma MSc thesis
(2004) Dept of Physiology University of Gezira
33 Elward Graham Douglas Kurtis S (2010) Asthma London Manson Pub
pp27ndash29
34 Sandford A Weir T Pare P (1996) The genetics of asthma Am J Respir Crit
Care Med 1531749-65
35 Pinto LA Stein RT Kabesch M (2008) Impact of genetics in childhood
asthma J Pediatr (Rio J) 84S68-75
36 Ober C Hoffjan S (2006) Asthma genetics the long and winding road to gene
discovery Genes Immun 7 (2) 95ndash100
37 Halapi E Bjornsdottir US (2009) Overview on the current status of asthma
genetics The clinical respiratory journal 3 (1) 2ndash7
38 Denham S Koppelman GH Blakey J Wjst M Ferreira MA Hall IP Sayers I
(2008) Meta-analysis of genome-wide linkage studies of asthma and related
traits Respir Res 938
39 Van Eerdewegh P Little RD Dupuis J Del Mastro RG Falls K Simon J
Torrey D Pandit S McKenny J Braunschweiger K Walsh A Liu Z Hayward
B Folz C Manning SP Bawa A Saracino L Thackston M Benchekroun Y
Capparell N Wang M Adair R Feng Y Dubois J FitzGerald MG Huang H
Gibson R Allen KM Pedan A Danzig MR Umland SP Egan RW Cuss FM
Rorke S Clough JB Holloway JW Holgate ST Keith TP (2002) Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness Nature
418426ndash430
40 Holloway JW Yang IA Holgate ST (2010) Genetics of allergic disease J
Allergy Clin Immunol 125(2)S81-94
41 Swarr DT Hakonarson H (2010) Unraveling the complex genetic
underpinnings of asthma and allergic disorders Curr Opin Allergy Clin
Immunol 10(5)434-442
42 Ying S Meng Q Corrigan CJ Lee TH (2006) Lack of filaggrin expression in
the human bronchial mucosa J Allgery Clin Immunol 118(6)1386-1388
43 Hudson TJ (2006) Skin barrier function and allergic risk Nat Genet
38(4)399-400
44 Laing IA de Klerk NH Turner SW Judge PK Hayden CM Landau LI
Goldblatt J Le Soueumlf PN (2009) Perth Infant Asthma Follow-up Cohort
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort Clin Exp Allergy 39(1)62-71
45 Lee JH Moore JH Park SW Jang AS Uh ST Kim YH Park CS Park BL
Shin HD (2008) Genetic interactions model among Eotaxin gene
polymorphisms in asthma J Hum Genet 53(10)867-875
46 Zhang YG Huang J Zhang J Li XB He C Xiao YL Tian C Wan H Zhao
YL Tsewang YG Fan H (2010) RANTES gene polymorphisms and asthma
risk A meta-analysis Arch Med Res 41(1)50-58
47 Eder W Klimecki W Yu L von Mutius E Riedler J Braun-Fahrlaumlnder C
Nowak D Holst O Martinez FD ALEX Team (2006) Association between
exposure to farming allergies and genetic variation in CARD4NOD1 Allergy
61(9)1117-1124
48 Kormann MS Depner M Hartl D Klopp N Illig T Adamski J Vogelberg C
Weiland SK von Mutius E Kabesch M (2008) Toll-like receptor heterodimer
variants protect from childhood asthma J Allergy Clin Immunol 122(1)86-
92
49 Smit LA Siroux V Bouzigon E Oryszczyn MP Lathrop M Demenais F
Kauffmann F(2009) Epidemiological Study on the Genetics and Environment
of Asthma Bronchial Hyperresponsiveness and Atopy (EGEA) Cooperative
Group CD14 and toll-like receptor gene polymorphisms country living and
asthma in adults Am J Respir Crit Care Med 179(5)363-368
50 Li X Howard TD Zheng SL Haselkorn T Peters SP Meyers DA Bleecker
ER (2010) Genome-wide association study of asthma identifies RAD50-IL13
and HLA DRDQ regions J Allergy Clin Immunol 125(2)328-335e11
51 Haller G Torgerson DG Ober C Thompson EE (2009) Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility J Allergy Clin Immunol 124(6)1204-1209e9
52 Howard TD Koppelman GH Xu J Zheng SL Postma DS Meyers DA
Bleecker ER (2002) Gene-gene interaction in asthma IL4RA and IL13 in a
Dutch population with asthma Am J Hum Genet 70(1)230-236
53 Pykaumllaumlinen M Kinos R Valkonen S Rydman P Kilpelaumlinen M Laitinen LA
Karjalainen J Nieminen M Hurme M Kere J Laitinen T Lahesmaa R (2005)
Association analysis of common variants of STAT6 GATA3 and STAT4 to
asthma and high serum IgE phenotypes J Allergy Clin Immunol 115(1)80-
87
54 Genuneit J Cantelmo JL Weinmayr G Wong GW Cooper PJ Riikjaumlrv MA
Gotua M Kabesch M von Mutius E (2009) A multi-centre study of candidate
genes for wheeze and allergy the International Study of Asthma and Allergies
in Childhood Phase 2 Clin Exp Allergy 39(12)1875-1888
55 Duroudier NP Tulah AS Sayers I (2009) Leukotriene pathway genetics and
pharmacogenetics in allergy Allergy 64(6)823-839
56 Minelli C Granell R Newson R Rose-Zerilli MJ Torrent M Ring SM
Holloway JW Shaheen SO Henderson JA (2010) Glutathione-S-transferase
genes and asthma phenotypes a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data Iny J
Epidemiol 39(2)539-562
57 Hollaacute LI Buckovaacute D Kuhrovaacute V Stejskalovaacute A Francovaacute H Znojil V Vaacutecha
J (2002) Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma Clin Exp Allergy 32(8)1193-1198
58 Barnes PJ (2003) Pathophysiology of asthma Eur Respir Mon 23 84ndash113
59 National asthma Education and Prevention Program (1997) Expert Panel
Report 2 Guidelines for the Diagnosis and Management of Asthma NIH
publication No 97-4051 Bethesda MD US Dept of Health and Human
Services
60 Roche WR Williams JH Beasly R Holgate ST (1989) Subepithelial fibrosis in
the bronchi of asthmatics Lancet 1520ndash524
61 Aikawa T Shimura S Sasaki H Ebina M Takashima T (1992) Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack Chest 101916ndash921
62 Ebina M Takahashi T Chiba T Motomiya M (1973) Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma a 3-D
morphometric study Am Rev Respir Dis 48720ndash726
63 Busse W Elias J Sheppard D Banks-Schlegel S (1999) Airway remodeling
and repair Am J Respir Crit Care Med 1601035ndash1042
64 Parronchi P De Carli M Manetti R Simonelli C Sampognaro S Piccinni MP
(1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones J
Immunol 1492977ndash2983
65 Liotta F Frosali F Querci V Mantei A Filigrave L Maggi L Mazzinghi B Angeli
R Ronconi E Santarlasci V Biagioli T Lasagni L Ballerini C Parronchi P
Scheffold A Cosmi L Maggi E Romagnani S Annunziato F (2008) Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged-
1Notch interaction J Allergy Clin Immunol 121 1000ndash1005
66 Romagnani S (2000) The role of lymphocytes in allergic diseases J Allergy
Clin Immunol105399ndash408
67 Spahn J Covar R Stempel DA (2002) Asthma Addressing consistency in
results from basic science clinical trials and observational experience J
Allergy Clin Immunol 109S492
68 Carter K Worwood M (2007) Haptoglobolin a review of the major allele
frequencies worldwide and their association with diseases Int J Lab Hematol
2992-110
69 Wobeto VPA Zaccariotto TR Sonati MF (2008) Polymorphism of human
haptoglobin and its clinical importance Genet Mol Biol 31602-20
70 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
71 Sadrzadeh SM Bozorgmehr J (2004) Haptoglobin phenotypes in health and
disorders Am J Clin Pathol 121S97-104
72 Raynes JG Eagling S McAdam KP (1991) Acute-phase protein synthesis in
human hepatoma cells Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6 Clin Exp Immunol83488-91
73 Tseng CF Huang HY Yang YT Mao SJ (2004) Purification of human
haptoglobin 1-1 2-1 and 2-2 using monoclonal antibody affinity
chromatography Protein Expr Purif 33265-73
74 Quaye IK (2008) Haptoglobin inflammation and disease Trans R Soc Trop
Med Hyg 102735-42
75 Pelletier N Boudreau F Yu S J Zannoni S Boulanger V Asselin C (1998)
Activation of haptoglobin gene expression by cAMP involves
CCAATenhancerbinding protein isoforms in intestinal epithelial cells FEBS
Lett 439275-280
76 Yang F Ghio A J Herbert D C Weaker FJ Walter C A Coalson J J (2000)
Pulmonary expression of the human haptoglobin gene AmJRespirCell
MolBiol23277- 282
77 Friedrichs WE Navarijo-Ashbaugh AL Bowman BH Yang F (1995)
Expression and inflammatory regulation of haptoglobin gene in adipocytes
Biochem Biophys Res Commun 209250-256
78 Smithies O Connell GE Dixon GH (1962) Chromosomal rearrangements and
the evolution of haptoglobin genes Nature 4851232-236
79 Maeda N Yang F Barnett DR Bowman BH Smithies O (1984) Duplication
within the haptoglobin Hp2 gene Nature 309 131ndash5
80 Langlois MR Delanghe JR (1996) Biological and clinical significance of
haptoglobin polymorphism in humans Clin Chem 421589-600
81 Black JA Dixon GH (1968) Amino-acid sequence of alpha chains of human
haptoglobins Nature218738-741
82 Bias WB Zachary AA (1986) Basic principles of paternity determination In
Rose NR Friedman H Fahey JL eds Manual of Clinical Laboratory
Immunology 3rd ed Washington DC American Society for Microbiology
902-911
83 Georgina Galicia and Jan L Ceuppens (2011) Haptoglobin Function and
Regulation in Autoimmune Diseases Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins Prof Francisco Veas (Ed) ISBN 978-953-
307-252-4 InTech
84 Javid J (1978) Human haptoglobins Curr Top Hematol 1151-192
85 Wang F Huang W Li A (1996) Serum haptoglobin suppresses T lymphocyte
functions following burns Chin Med Sci J11180-183
86 Silverman LN Christenson RH (1999) Protein In Burtis CA Ashwood ER
eds In Tietz Textbook of Clinical Chemistry Philadelphia PA Saunders 494-
497
87 Bernard D R Langlois M R Delanghe J R de Buyzere M L (1997) Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction Eur J Clin Chem Clin Biochem 3585-88
88 Berkova N Lemay A Dresser DW Fontaine JY Kerizit J Goupil S (2001) Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy Mol Hum Reprod7 747- 754
89 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287-293
90 Bowman BH (1993) Haptoglobin In Bowman BH ed Hepatic Plasma
Proteins San Diego CA Academic Press 159-167
91 Yang F Friedrichs WE Navarijo-Ashbaugh AL deGraffenried LA Bowman
BH Coalson JJ (1995) Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung Lab Invest 73433ndash 40
92 Theilgaard-Monch K Jacobsen LC Nielsen MJ Rasmussen T Udby L Gharib
M Arkwright PD (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108353ndash 61
93 Yerbury JJ Rybchyn MS Easterbrook-Smith SB Henriques C Wilson MR
(2005) The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin Biochemistry 4410914 ndash25
94 Kristiansen M Graversen JH Jacobsen CHoffman HJ Law SK Moestrup SK
(2001) Identification of the haemoglobin scavenger receptor Nature (Lond)
409198 ndash201
95 Arredouani M Matthijs P Van H E Kasran A Baumann H Ceuppens J L
Stevens E (2003) Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases Immunology 108144-151
96 Oh S-K Pavlotsky N Tauber AI (1990) Specific binding of haptoglobin to
human neutrophils and its functional consequences J Leukocyte Biol 47142-
148
97 Oh S-K Kim S-H Walker JE (1990) Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin J Natl Cancer
Inst 82934-940
98 Oh SK Leung MF Knee T Williams JM (1987) Biological properties of
suppressive E-receptor factor on lymphokine function Eur J Immunol 171403-
1409
99 Hanasaki K Powell LD Varki A (1995) Binding of human plasma
sialoglycoproteins by the B cellndashspecific lectin CD22 J Biol Chem 2707543-
7550
100 El-Ghmati SM Arredouani M Van Hoeyveld EM Ceuppens JL
Stevens EA (2002) Haptoglobin interacts with the human mast cell line HMC-
1 and inhibits its spontaneous proliferation Scand J Immunol 55352-358
101 Langlois M Delanghe J Philippe J Ouyang J Bernard D De Buyzere M
Van Nooten G Leroux-Roels G (1997) Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type binding
of haptoglobin to the B-cell lectin CD22 Eur J Clin Chem Clin Biochem
35199-205
102 Funk CD (1996) The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice Biochim
Biophys Acta 130465-84
103 Jue DM Shim BS Kang YS (1983) Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin Mol
Cell Biochem 51141-147
104 Komoriya K Hoshina K Ohtsu A (1980) Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation Jpn
J Pharmacol 30899-904
105 Eaton JW Brandt P Mahoney JR Lee JT (1982) Haptoglobin a natural
bacteriostat Science 215691-693
106 Buehler P W Abraham B Vallelian F Linnemayr C Pereira C P Cipollo J
F Jia Y Mikolajczyk M Boretti F S Schoedon G Alayash A I Schaer D J
(2009) Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification Blood 1132578-2586
107 Lim S K Ferraro B Moore K Halliwell B (2001) Role of haptoglobin in
free hemoglobin metabolism RedoxRep 6219-227
108 Tseng C F Lin C C Huang H Y Liu H C Mao S J (2004) Antioxidant role
of human haptoglobin Proteomics 42221-2228
109 Melamed-Frank M Lache O Enav B I Szafranek T Levy N S Ricklis R
M Levy A P (2001) Structure-function analysis of the antioxidant properties of
haptoglobin Blood 983693-3698
110 Kushner I (1993) Regulation of the acute phase response by cytokines
Perspect Biol Med 36 611mdash622
111 Theilgaard-Monch K Jacobsen L C Nielsen M J Rasmussen T Udby L
Gharib M Arkwright P D Gombart A F Calafat J Moestrup S K Porse B T
Borregaard N (2006) Haptoglobin is synthesized during granulocyte
differentiation stored in specific granules and released by neutrophils in
response to activation Blood 108 353mdash361
112 De Kleijn DP Smeets MB Kemmeren PP Lim SK Van Middelaar BJ
Velema E Schoneveld A Pasterkamp G and Borst C (2002) Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring
FASEB J 161123-1125
113 Cid MC Grant DS Hoffman GS Auerbach R Fauci AS Kleinman HK
(1993) Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis J Clin Invest 91977-985
114 Kyewski B Klein L (2006) A central role for central tolerance Annu Rev
Immunol24571-606
115 Faria A M Weiner H L (2006) Oral tolerance therapeutic implications for
autoimmune diseases ClinDevImmunol 13143-157
116 Wikstrom M E Stumbles PA (2007) Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens ImmunolCell Biol
85182-188
117 Unger W W Hauet-Broere F Jansen W van Berkel L A Kraal G Samsom
J N (2003) Early events in peripheral regulatory T cell induction via the nasal
mucosa JImmunol 1714592-4603
118 Boots A M Verhaert P D tePoele R J Evers S Coenen-deRoo C J Cleven
J Bos E S (2004) Antigens up the nose identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics
JProteome Res31056- 10621535-3893
119 Piessens M F Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14287ndash293
120 Kauffmann FC Frette I Annesi M-F Dore Neukirch F (1991)
Relationships of haptoglobin level to FEV1 wheezing bronchial hyper-
responsiveness and allergy Clin Exp Allergy 21 669-674
121 Piessens MF Marien G Stevens E (1984) Decreased haptoglobin levels in
respiratory allergy Clin Allergy 14 287-293
122 Koh YY Kim YW Park JD Oh JW (1996) A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma
Clin Exp Allergy 101202-9
123 Kim CK Chung CY Koh YY (1998) Changes in serum haptoglobin level
after allergen challenge test in asthmatic children Allergy 53(2)184-9
124 Mukadder CALIKO_LU MDa Ali UumlNLUuml MDb Luumlluumlfer TAMER MDb
_lker CcedilALIKO_LU MDc Guumlrbuumlz POLAT MD (2004) Levels of Serum
Acute-Phase Proteins in Patients with Asthma Turkiye Klinikleri J Med Sci
24440-444
125 Larsen K Macleod D Nihlberg K Gurcan E Bjermer L Marko-Varga G
Westergren-Thorsson G (2006) Specific haptoglobin expression in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma J Proteome Res 51479-1483
126 Black R A White J M (1998) ADAMs focus on the protease domain Curr
Opin Cell Biol 10 654ndash659
127 Becherer J D Blobel C P (2003) Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs) Curr Top
Dev Biol 54 101ndash123
128 Yoshinaka TNishii k Yamada K Sawada H Nishiwaki E Smith K
Yoshino K Ishiguro H Higashiyama S (2002) Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity Gene 282 227ndash236
129 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DE (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
130 Garlisi CG Zou J Devito KE Tian F Zhu FX Liu J Shah H Wan Y
Motasim Billah M Egan RW Umland SP (2003)Human ADAM33 protein
maturation and localization Biochem Biophys Res Commun 301 35ndash 43
131 Holgate ST Davies DE Powell RM Holloway JW (2005) ADAM33 a
newly identified gene in the pathogenesis of asthma Immunol Allergy Clin
North Am 25655ndash668
132 Haitchi H M Powell R M Shaw T J Howarth P H Wilson S J Wilson D I
Holgate S T Davies DE (2005)ADAM33 expression in asthmatic airways and
human embryonic lungs Am J Respir Crit Care Med
133 Powell RM Wicks J Holloway JW Holgate ST Davies DE (2004) The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts
Am J Respir Cell Mol Biol 3113ndash21
134 Holgate ST Yang Y Haitchi HM Powell RM Holloway JW Yoshisue H
Pang YY Cakebread J Davies DE (2006) The genetics of asthma ADAM33
as an example of a susceptibility gene Proc Am Thora c Soc 3440ndash443
135 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S J
(2005) Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function Am J Respir Crit Care Med 17255ndash
60
136 Lee JY Park SW Chang HK Kim HY Rhim T Lee JH Jang AS Koh ES
Park CS (2006) A disintegrin and metalloproteinase 33 protein in asthmatics
relevance to airflow limitation Am J Respir Crit Care Med 173729ndash765
137 Howard TD Postma DS Jongepier H Moore WC Koppelman GH Zheng
SL Xu J Bleecker ER Meyers DA (2003) Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations J Allergy Clin Immunol 112717ndash722
138 Jongepier H Boezen HM Dijkstra A Howard TD Vonk JM Koppelman
GH Zheng SL Meyers DA Bleecker ER Postma DS(2004) Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma Clin Exp Allergy 34757ndash60
139 Bel EH (2004) Clinical phenotypes of asthma Curr Opin Pulm Med
1044ndash50
140 Simpson A Maniatis N Jury F Cakebread JA Lowe LA Holgate ST
Woodcock A Ollier WE Collins A Custovic A Holloway J W John S
J(2004) Manchester Asthma and Allergy Study polymorphisms in ADAM 33
predict lung function at age 5 years J Allergy Clin Immunol 2004 113S340
141 JING WANG JIN WEN MI-HE-RE-GU-LI SI-MA-YI YUAN-BING HE
KE-LI-BIE-NA TU-ER-XUN YU XIA JIAN-LONG ZHANGQI-
MAN-GU-LI WU-SHOU-ER (2013) Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China Biomedical
reports 1 447-453
142 Maquat L E (2001) The power of point mutations Nature Genet 27 5ndash6
143 Mahesh PA (2013) Unravelling the role of ADAM33 in asthma Indian J
Med Res 137 pp 447-450
144 Cleo CD Postma DS Vonk JM Bruinenberg M Schouten JP Boezen HM
(2005) A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population Am J Respir Crit Care Med 172329ndash33
145 Holgate ST (1999) Genetic and environmental interaction in allergy and
asthma J Allergy Clin Immunol 1041139 ndash1146
146 Davies DE Holgate ST (2002) Asthma The importance of epithelial
mesenchymal communication in pathogenesis Inflammation and the airway
epithelium in asthma Int J Biochem Cell Biol 341520 ndash1526
147 Cakebread JA Haitchi HM Holloway JW Powell RM Keith T Davies DE
Holgate ST (2004) The role of ADAM33 in the pathogenesis of asthma Semin
Immunol 25361ndash375
148 Chou KT Huang CC Chen YM Perng DW Chao HS Chan WL Leu HB
(2011) Asthma and risk of erectile dysfunctionmdashA nationwide population-
based study J Sex Med 81754 ndash1760
149 Bucchieri F Puddicombe SM Lordan JL Richter A Buchanan D Wilson
SJ Ward J Zummo G Howarth PH Djukanović R Holgate ST Davies DE
(2002) Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis Am J Respir Cell Mol Biol 27179 ndash185
150 Redington AE Roche WR Holgate ST Howarth PH (1998) Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects J Pathol 186410ndash
415
151 Paul WE (1991) Interleukin-4 a prototypic immunoregulatory lymphokine
The Journal of the American Society of Hematology 77(9)1859-1870
152 Nelms K Keegan AD Zamorano J Ryan JJ Paul WE (1999) The IL-4
receptor signaling mechanisms and biologic functions Annu Rev
Immunol17701-38
153 Mariacutea IG Ignacio D Elena L Esther M Feacutelix L Rogelio G S (2005)
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma
a case control study Clinical and Molecular Allergy 315
154 Le Gros G Ben-Sasson S Z Seder R Finkelman F D Paul W
E(1990)Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells J
Exp Med172921
155 Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA
(1997)The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor N Engl J Med 337 (24) 1720ndash5
156 Allison-Lynn Andrews John W Holloway Stephen T Holgate and Donna
E Davies (2006) IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding Implications for the Development of Therapeutic Targets1 J
Immunol 1767456-7461
157 Dabbagh K Takeyama K Lee H M Ueki I F Lausier J A Nadel J A
(1999) IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo J Immunol 162 6233ndash6237
158 Fukuda T Fukushima Y Numao T Ando N Arima M Nakajima H Sagara
H Adachi T Motojima S Makino S(1996) Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma Am J Respir Cell Mol Biol 14 84ndash92
159 Doucet C Brouty-Boye D Pottin-Clemenceau C Jasmin C Canonica G W
Azzarone B (1998) IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts Int Immunol 10
1421ndash1433
160 Palmer LJ Daniels SE Rye PJ Gibson NA Tay GK Cookson WO
Goldblatt J Burton PR LeSoumluef PN (1999) Linkage of chromosome 5q and
11gene markers to asthma ndashassociated quantitative traits in australian children
Am j Respir Crit care Med 1581825 ndash 1830
161 Song Z Casolaro V chen r georas SN Monos d Ono SJ (1996)
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene J Immunol 156424-9
162 Basehore MJ Howard TD Lange LA Moore WC Hawkins GA Marshik
PL Harkins MS Meyers DA Bleecker ER (2004) A comprehensive
evaluation of IL4 variants in ethnically diverse populations association of total
serum IgE levels and asthma in white subjects J Allergy Clin Immunol 11480-
87
163 Mout R Willenze R Landegent JE (1991) Repeat polymorphism in the
interleukin-4 gene (IL-4) Nucleic Acids Res 19 3763
164 Rockman MV Hahn MW Soranzo N Goldstein DB Wray GA (2003)
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression Current Biology 13 2118-2123
165 Walley AJ Cookson WO (1996) Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy J Med Genet 33689_92
166 Hoey T Sun Y L Williamson K Xu X (1995) Isolation of two new
members of the NF-AT gene family and functional characterization of the NF-
AT proteins Immunity 2461-472
167 Raffi Tachdjian Clinton Mathias Shadi Al Khatib Paul J Bryce Hong S
Kim Frank Blaeser Brian D OConnor Danuta Rzymkiewicz Andrew Chen
Michael J Holtzman Gurjit K Hershey Holger Garn Hani Harb Harald Renz
Hans C Oettgen Talal A Chatila (2009) Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma J Exp Med Vol 206 No
10 2191-2204
168 Maes T Joos GF Brusselle GG (2012) Targeting interleukin-4 in asthma
lost in translation Am J Respir Cell Mol Biol 47 (3) 261ndash70
169 Chatila TA (2004) Interleukin-4 receptor signaling pathways in asthma
pathogenesis Trends Mol Med 10 (10) 493ndash9
170 Andrews A L Holloway J W Puddicombe S M Holgate S T Davies D E
(2002) Kinetic analysis of the interleukin-13 receptor complex J Biol Chem
277 46073ndash46078
171 Keegan AD Nelms K White M Wang L-M Pierce J H Paul W E (1994)
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth Europe PMC Cell
76811-820
172 Tundup S Srivastava L Harn DA (2012) Polarization of host immune
responses by helminth-expressed glycans Ann N Y Acad Sci 1253 E1ndashE13
173 Maliszewski C R Sato T A Vanden Bos T Waugh S Dower S K Slack J
Beckmann M P Grabstein K H(1990) Cytokine receptors and B cell functions
I Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro J Immunol 144 3028ndash3035
174 Sato T A Widmer M B Finkelman F D Madani H Jacobs C A Grabstein
K H Maliszewski C R(1993) Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo J Immunol 1502717ndash2725
175 Borish L C Nelson H S Corren J Bensch G Busse W W Whitmore J B
Agosti J M (2001) Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma J Allergy Clin Immunol 107 963ndash970
176 Borish L C Nelson H S Lanz M J Claussen L Whitmore J B Agosti J M
Garrison L(1999) Interleukin-4 receptor in moderate atopic asthma a phase
III randomized placebo-controlled trial Am J Respir Crit Care Med 160
1816ndash1823
177 Pritchard MA Baker E Whitmore SA Sutherland GR Idzerda RL Park LS
Cosman D Jenkins NA Gilbert DJ Copeland NG (1991) The interleukin-
4receptor gene (IL4R) maps to 16p112 ndash 16p121 in human and to the distal
region of mouse chromosome 7genomics 10801 ndash 806
178 Perkins C Yanase N Smulian G Gildea L Orekov T Potter C Brombacher
F Aronow B Wills-Karp M Finkelman FD (2011) Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice J
Exp Med 208853ndash867
179 Loza MJ Chang BL (2007) Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis J Allergy Clin
Immunol 120578ndash585
180 Michel S Liang L Depner M Klopp N Ruether A Kumar A Schedel M
Vogelberg C von Mutius E Frischer T Genuneit J Gut IG Schreiber S
Lathrop M Illig T Kabesch M (2010) Unifying candidate gene and GWAS
approaches in asthma PLoS One 5e13894
181 Akinbami LJ Schoendorf KC (2002) Trends in childhood asthma
prevalencehealth care utilization and mortality Pediatrics110(2 Pt 1)315ndash
322
182 Donfack J Schneider DH Tan Z Kurz T Dubchak I Frazer A Ober C
(2005) Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy Respir Res 6145
183 Chan A Newman DL Shon AM Schneider DH Kuldanek S Ober C
(2006)Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy Genes Immun 7169ndash178
184 Lee SG Kim BS Kim JH Lee SY Choi SO Shim JY Hong TJ Hong SJ
(2004) Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma Clin Exp Allergy 341202ndash1208
185 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2000) Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations Am J Hum Genet 66517ndash526
186 Ober C Leavitt SA Tsalenko A Howard TD Hoki DM Daniel R Newman
DL Wu X Parry R Lester LA Solway J Blumenthal M King RA Xu J
Meyers DA Bleecker ER Cox NJ (2007) IL4R alpha mutations are associated
with asthma exacerbations and mast cellIgE expression Am J Respir Crit
Care Med 175570ndash576
187 Mannino D M Homa D M Akinbami L J Moorman J E Gwynn C Redd S
C (2002) Surveillance for asthmandashUnited States 1980- 1999 MMWR Surveill
Summ 511ndash13
188 Kruse S Japha T Tedner M Sparholt SH Forster J Kuehr J Deichmann
KA (1999)The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction
Immunology 96365-71
189 Zurawski SM Vega F Juyghe B Zurawski G (1993) Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction EMBO 122663ndash2670
190 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
191 Munitz A Brandt EB Mingler M Finkelman FD Rothenberg (2008)
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis Proceedings of the National Academy of
Sciences 1057240 ndash7245
192 Punnonen J Aversa G Cocks BG (1993) Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells
Proc Natl Acad Sci USA 90 3730ndash3734
193 Horie S Okubo Y Hossain M Sato E Nomura H Koyama S Suzuki J
Isobe M Sekiguchi M (1997) Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis Intern Med 36 179ndash
185
194 Luttmann W Knoechel B Foerster M Matthys HVirchow Jr Kroegel C
(1996) Activation of human eosinophils by IL-13 Induction of CD69 surface
antigen its relationship to messenger RNA expression and promotion of
cellular viability J Immunol 157 1678ndash1683
195 Kaur D Hollins F Woodman L Yang W Monk P May R Bradding P
Brightling CE (2006) Mast cells express IL-13R alpha 1 IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression Allergy 61
1047ndash1053
196 Ahdieh M Vandenbos T Youakim A (2001) Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c Am J Physiol Cell Physiol 281 C2029ndashC2038
197 Kondo M Tamaoki J Takeyama K Isono K Kawatani K Izumo T Nagai
A (2006) Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture Allergol Int 55 329ndash336
198 Richter A Puddicombe SM Lordan JL Bucchieri F Wilson SJ Djukanovic
R Dent G Holgate ST Davies DE (2001)The contribution of interleukin (IL)-
4 and IL-13 to the epithelialndashmesenchymal trophic unit in asthma Am J Respir
Cell Mol Biol 25 385ndash391
199 Laporte JC Moore PE Baraldo S Jouvin MH Church TL Schwartzman
IN Panettieri RA Jr Kinet JP Shore SA (2001)Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells Am J Respir Crit Care Med 164 141ndash148
200 Grunstein M M Hakonarson H Leiter J Chen M Whelan R Grunstein J
S Chuang S (2002) IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle Am J Physiol Lung
Cell Mol Physiol 282 520ndash 528
201 Fahy JV (2002) Goblet cell and mucin gene abnormalities in asthma Chest
122320Sndash326S
202 Zhu Z Homer R J Homer Wang Z Chen Q g P Wang J Zhang Y Elias
J A (1999) Pulmonary expression of interleukin-13 causes inflammation
mucus hypersecretion subepithelial fibrosis physiologic abnormalities and
eotaxin productionJ Clin Invest103779 ndash788
203 Yasuo M Fujimoto K Tanabe T Yaegashi H Tsushima K Takasuna K
Koike T Yamaya M Nikaido T (2006)The relationship between calcium-
activated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells Respiration 73347ndash359
204 Tanabe T Fujimoto K Yasuo M Tsushima K Yoshida K Ise H Yamaya
M (2007) Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium Clin Exp Allergy 38122ndash134
205 Danahay H Atherton H Jones G Bridges RJ Poll CT (2002) Interleukin-
13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells Am J Physiol Lung Cell Mol Physiol 282L226ndashL236
206 Galietta L J Pagesy P Folli C Caci E Romio L Costes B Nicolis E
Cabrini G Goossens M Ravazzolo R Zegarra-Moran O(2002) IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitroJ
Immunol 168839ndash845
207 Zhao J Maskrey B Balzar S Chibana K Mustovich A Hu H Trudeau J
B ODonnell V Wenze S E (2009) Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells
Am J Respir Crit Care Med 179782ndash790
208 Moynihan B Tolloczko Michoud MC Tamaoka M Ferraro P Martin JG
(2008) MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol
295L171ndashL177
209 Saha SK Berry MA Parker D Siddiqui S Morgan A May R Monk P
Bradding P Wardlaw AJ Pavord ID Brightling CE (2008)Increased sputum
and bronchial biopsy IL-13 expression in severe asthma J Allergy Clin
Immunol121685ndash 691
210 Ramalingam TR Pesce JT Sheikh F Cheever AW Mentink-Kane MM
Wilson MS Stevens S Valenzuela DM Murphy AJ Yancopoulos GD Urban
JF Jr Donnelly RP Wynn TA (2008) Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain Nature Immunol 9(1)25ndash33
211 Wynn TA (2004) Fibrotic disease and the Th1Th2 paradigm Nat Rev
Immunol 4583ndash594
212 Khetsuriani N Kazerouni NN Erdman DD Lu X Redd SC Anderson LJ
Teague WG (2007) Prevalence of viral respiratory tract infections in children
with asthma J Allergy Clin Immunol 119314 ndash321
213 Jartti T Paul-Anttila M Lehtinen P Parikka V Vuorinen T Simell O
Ruuskanen O (2009) Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs respiratory syncytial virus induced early wheezing
an observational study Respir Res 10(1)85ndash95
214 Piper E Brightling C Niven R Oh C Faggioni R Poon K She D Kell C
May RD Geba GP Molfino NA (2013)A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma Eur Respir J 41 330ndash338
215 Corren J Lemanske R F Nicola A Hanania N A Korenblat P E Parsey M
V Arron J R Harris J M Scheerens H Wu L C Su Z Mosesova S Eisner M
D MD Bohen S P Matthews J G (2011) Lebrikizumab treatment in adults
with asthma N Engl J Med 365 1088ndash1098
216 Hayes J Flanagan J Jowsey I Hayes J Flanagan J Jowsey I (2005) Glutathione
transferases Pharmacol Toxicol 4551ndash88
217 Jakoby WB (1978) The glutathione S-transferases a group of
multifunctional detoxification proteins Adv Enzymnol 46383-413
218 Conklin D J Haberzettl P Prough R A Bhatnagar A (2009) Glutathione-S-
transferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke Am JPhysiol Heart Circ Physiol 296 H1586-97
219 Diaz-Sanchez D Riedl M (2005) Diesel effects on human health a question
of stress Am J Physiol Lung Cell Mol Physiol 289 L722-3
220 Hayes J D Pulford D J (1995) The glutathione S-transferase supergene
family regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance Crit Rev Biochem Mol Biol 30 445-600
221 Tim R Crook Robert L Souhami AndrAtilde E M McLean (1986)
Cytotoxicity DNA cross-Linking and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells Cancer research 46
5029-5034
222 Berhane K Widersten M Engstroumlm Aring Kozarich J W Mannervik B (1994)
Detoxication of base propenals and other alpha beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases Proc Natl Acad Sci U S A 91 1480ndash1484
223 Beuckmann CT Fujimori K Urade Y Hayaishi O (2000)Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain Neurochem Res 25(5)733-8
224 Ujihara M Tsuchida S Satoh K Sato K Y Urade Y (1988) Biochemical
and immunological demonstration of prostaglandin D2 E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes
Arch Biochem Biophys 264428-437
225 Mannervik B (1985) The isoenzymes of glutathione transferase Adv
Enzymol Relat Areas Mol Biol 57357-417
226 Adler V Yin Z Fuchs S Y Benezra M Rosario L Tew K D Pincus M R
Sardana M Henderson C J Wolf C R Davis R J Ronai Z (1999) Regulation
of JNK signaling by GSTp EMBO J 18(5)1321-34
227 Yin Z Ivanov VN Habelhah H Tew K Ronai Z(2000) Glutathione S-
transferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases Cancer Res1 604053-7
228 Barnes PJ (1990) Reactive oxygen species and airway inflammation Free
Radic Biol Med 9235ndash-43
229 Hanene C Jihene L Jamel A Kamel H Agnegraves H (2007) Association of
GST genes polymorphisms with asthma in Tunisian children Mediators
Inflamm19564
230 Goodrich GG Goodman PH Budhecha SK Pritsos CA (2009) Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma Mutat Research 67455-61
231 Greene LS (1995) Asthma and oxidant stress nutritional environmental
and genetic risk factors J Am Coll Nutr 14317ndash324
232 Scoggan KA Jacobson PJ and Ford-Hutchinson AW (1997) Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes J Biol Chem 27210182-10187
233 Carmen Silvia Passos Lima Iramaia Angeacutelica Neacuteri1 Gustavo Jacob
LourenccediloIsabel Cristina Jacinto Faria Joseacute Dirceu RibeiroCarmen Silvia
Bertuzzo (2010) Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil Genetics and Molecular Biology 33 3 438-441
234 Hayes JD Strange RC (1995) Potential contribution of the glutathione S-
transferase supergene family to resistance to oxidative stress Free Radic Res
22193ndash197
235 Ekhart C Rodenhuis S Smits PHM Beijnen JH Huitema ADR (2009) An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment Cancer
Treat Rev 35 18-31
236 Arundhati Bag Saloni Upadhyay Lalit M Jeena Princi Pundir Narayan S
Jyala (2013) GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention 14(8)4739-4742
237 Meyer DJ Coles B Pemble SE Gilmore KS Fraser GM Ketterer B (1991)
Theta a new class of glutathione transferases purified from rat and man
Biochem J 274 409-14
238 Landi S (2000) Mammalian class theta GST and differential susceptibility
to carcinogens a review Mutat Res 463 247-83
239 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione- S-transferases on atopic
asthma using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers Hum Mutat 24208ndash14
240 Saadat M Saadat I Saboori Z Emad A (2004) Combination of CC16
GSTM1 and GSTT1 genetic polymorphisms is associated with asthma J
Allergy Clin Immun 113996ndash98
241 London SJ (2007) Gene-air pollution interactions in asthma Proc Am
Thorac Soc 4 217ndash20
242 Siqiao liang xuan wei chen gong jinmei wei zhangrong chen Xiaoli chen
zhibo wang and jingmin deng (2013)Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms An updated meta-
analysis of Casendashcontrol studies Respirology 18 774ndash783
243 Satoh K Kitahara A SomaY Inaba Y Hatayama C Sato K (1985)
Purificaioninduction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis
Proc Natl Acad Sci 823964-3968
244 Fryer A A Hume R Strange R C (1986) The development of glutathione S
transferase and glutathione peroxidase activities in human lung Biochim
Biophys Acta 883 448-53
245 Hengstler J G Arand M Herrero M E Oesch F (1998) Polymorphism of
N-acetyltransferases glutathione S-transferases microsomal epoxide hydrolase
and sulfotransferases influence on cancer susceptibility Recent Results Cancer
Res 154 47ndash85
246 Doull I J Lawrence S Watson M Begishvili T Beasley R W Lampe F
Holgate T Morton N E (1996) Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness Am J
Respir Crit Care Med 153 1280-4
247 Hoskins A Wu P Reiss S Dworski R (2013)Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo Clin Exp Allergy 43(5) 527ndash534
248 Watson M A Stewart R K Smith G B Massey T E Bell D A (1998)
Human glutathione S-transferase P1 polymorphisms relationship to lung tissue
enzyme activityand population frequency distribution Carcinogenesis 19 275-
80
249 Tamer L Calikoglu M Ates N A Yildirim H Ercan B Saritas E Unlu A Atik
U(2004)Glutathione-s-transferase gene polymorphisms (gstt1 gstm1 gstp1) as
increased risk factors for asthma Respirology 9493ndash8
250 Lee Y L Hsiue TR Lee YC Lin YC Guo YL (2005) The association between
glutathione s-transferase p1 m1 polymorphisms and asthma in taiwanese
schoolchildren Chest 1281156ndash62
251 Nickel R Haider A Sengler C Lau S Niggemann B Deichmann KA
Wahn U Heinzmann A (2005) Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations Pediatr Allergy Immunol 16539ndash41
252 Brasch-Andersen C Christiansen L Tan Q Haagerup A Vestbo J Kruse
TA (2004) Possible gene dosage effect of glutathione-s-transferases on atopic
asthma Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers Hum Mutat 24208ndash14
253 Mak JC Ho SP Leung HC Cheung AH Law BK So LK Chan JW Chau
CH Lam WK Ip MS Chan-Yeung M (2007) Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics Clin Exp Allergy 371150ndash7
254 Lee YL Lin YC Lee YC Wang JY Hsiue TR Guo YL (2004)
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma Clin Exp Allergy 341707ndash13
255 Mapp CE Fryer AA De Marzo N Pozzato V Padoan M Boschetto P
Strange RC Hemmingsen A Spiteri MA (2002) Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates J
Allergy Clin Immunol 109867ndash72
256 Aynacioglu AS Nacak M Filiz A Ekinci E Roots I (2004) Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma Br J Clin Pharmacol 57213ndash17
257 Kamada F Mashimo Y Inoue H Shao C Hirota T Doi S Kameda M
Fujiwara H Fujita K Enomoto T Sasaki S Endo H Takayanagi R Nakazawa
C Morikawa T Morikawa M Miyabayashi S Chiba Y Tamura G Shirakawa
T Matsubara Y Hata A Tamari M Suzuki Y (2007) The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene Int Arch Allergy Immunol 144275ndash86
258 Li YF Gauderman WJ Conti DV Lin PC Avol E Gilliland FD (2008)
Glutathione s-transferase p1 maternal smoking and asthma in children A
haplotype-based analysis Environ Health Perspect 116409ndash15
259 GINA (Global Initiative for Asthma) (2007) Global strategy for asthma
management and prevention
260 British Thoracic SocietyScottish Intercollegiate Guidelines Network (2008)
Guidelines on Asthma Management Available on the BTS web site (wwwbrit-
thoracicorguk) and the SIGN web site
261 Pauwels RA Pedersen S Busse WW Tan WC Chen YZ Ohlsson SV
Ullman A Lamm CJ OByrne PM (2003)Early intervention with budesonide
in mild persistent asthma a randomized double-blind trial Lancet 361 1071ndash
6
262 Yawn BP (2008) Factors accounting for asthma variability achieving
optimal symptom control for individual patients Primary Care Respiratory
Journal 17 (3) 138ndash147
263 The international union against tuberculosis and lung disease
(2008)Management of asthma A guide to the essentials of good clinical
practice
264 Lodge CJ Allen KJ Lowe AJ Hill DJ Hosking CS Abramson MJ
Dharmage SC (2012) Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment a systematic review of longitudinal studies
Clinical amp developmental immunology 176484
265 Baur X Aasen TB Burge PS Heederik D Henneberger PK MaestrelliP
Schluumlnssen V Vandenplas O Wilken D (2012) ERS Task Force on the
Management of Work-related Asthma The management of work-related
asthma guidelines a broader perspective European respiratory review an
official journal of the European Respiratory Society 21 (124) 125ndash39
266 Nathan SP Lebowitz MD and Kunson RJ (1979) Spirometric testing
Number of tests required and selection of data Chest 76384-88
267 Miller S A Dykes D D Polesky HF (1988) A simple salting out procedure
for extracting DNA from human nucleated cells Nucleic Acids Research V16
Number 31215
268 Hames BD (1981) Gel electrophoresis of proteins A practical approach
Hames BD and Rickwood D Eds IRL Press Washington DC PP 1-91
269 Krasteva A Perenovska P Ivanova A Altankova I BochevaTKisselova A
(2010)Alteration in Salivary Components of Children with Allergic Asthma
Biotechnology amp Biotechnological Equipment 24(2)1866-1869
270 Tripathi P Awasthi S Prasad R Husain N Ganesh S (2011)Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population J Genet 90 265ndash273
271 Werner M Herbon N Gohlke H Altmuumlller J Knapp M Heinrich J Wjst M
(2004) Asthma is associated with single nucleotide polymorphisms in
ADAM33 Clin Exp Allergy 34 26ndash31
272 Lee JH Park HS Park SW Jang AS Uh ST Rhim T Park CS Hong SJ
Holgate ST Holloway JW Shin HD (2004) ADAM33 polymorphism
association with bronchial hyper-responsiveness in Korean asthmatics Clin
Exp Allergy 34 860ndash865
273 Kedda M A Duffy D L Bradley B OlsquoHehir R E Thompson P J(2006)
ADAM33 haplotypes are associated with asthma in a large Australian
population Eur J Hum Genet 14 1027ndash1036
274 Magdy Zedan Ashraf Bakr Basma Shouman Hosam Zaghloul Mohammad
Al-Haggar Mohamed Zedan Amal Osman (2014)Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes J Allergy Ther
5189
275 Zhang AM Li HL Hao P Chen YH Li JH Mo YX (2006)Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma Zhongguo Dang Dai Er Ke Za Zhi8109-12
276 Chi-Huei Chiang Ming-Wei LinMing-Yi Chung Ueng-Cheng Yang(2012)
The association between the IL-4 ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population Journal of the Chinese Medical
Association 75 635-643
Appendix (1) Questionnaire
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene IL4
amp IL-4R α in Sudanese with asthma
Candidate No helliphelliphelliphelliphelliphelliphelliphellip Date helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Name (optional) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Age helliphelliphelliphelliphelliphelliphelliphellip
Tel No- helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Relative Phone Nohelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Gender Male Female
Tribe helliphelliphelliphelliphelliphelliphelliphelliphelliphellip Residence helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
Occupation helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip Marital status helliphelliphelliphelliphelliphelliphelliphelliphelliphellip
1 Family history of Asthma(chest allergy)
1st degree relative 2
nd degree relatives
2 Duration of asthma (chest allergy) helliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
3 Type of treatment Inhalers Specifyhelliphelliphelliphelliphelliphelliphellip
Oral Specifyhelliphelliphelliphelliphelliphelliphellip
4 History of allergic rhinitis Yes No
5 History of drug allergy Yes No
6 Asthma symptoms trigger factors
Outdoor Specifyhelliphelliphelliphelliphelliphelliphellip
Indoor Specifyhelliphelliphelliphelliphelliphelliphellip
7 Past medical history of
Diabetes Yes No Hypertension Yes No
8 History of smoking
Non-smoker Current smoker ex-smoker
9 Asthma symptoms
10 Wheezing (whistling) Shortness of breath Cough
Chest tightness
11 Asthma symptoms are more
At night (nocturnal) at day time
12 Asthma symptoms frequency (classification of Persistent Asthma)
- lt Weekly = intermittent
- Weekly but not daily = mild
- Daily but not all day = moderate
- Continuous = severe
13 Number of unplanned visits
Emergency room visits Hospital admissions
Weight ---------- Height --------------- BMI ---------------- Lung
function test
Test 1 2 3 Best
FEV1
FVC
PEFR
FEV1FVC
Appendix(2)Asthma control test
Appendix (3)
Appendix (4)
Appendix (5)
Appendix (6)
Appendix (7)
Appendix (8)
Appendix (9)
Appendix (10)
Appendix (11)
CHAPTER ONE
INTRODUCTION
amp
LITERATURE REVIEW
CHAPTER TWO
MATERIALS amp METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION amp
RECOMMENDATIONS
CHAPTER SIX
REFRENCES amp APPENDICES