Question: How do we know where a particular protein is located in the cell? Principle of Fluorescence Cell with fluorescent molecule Experimental Approaches for Protein Localization 1. Small Molecule Dyes (e.g. DAPI) 2. Immunostaining (dye-conjugated antibodies) 3. Green Fluorescent Protein (GFP) Tagging Aequorea victoria Green Fluorescent Protein (GFP) Excitation Wavelength (e.g. 490 nm) Emission Wavelength (e.g. 510 nm) GFP Gene Expression DNA (Gene X) mRNA Protein X Transcription Translation GFP Tagging Approach mRNA DNA (Gene X -GFP Fusion) Protein X-GFP Fusion Transcription Translation GFP Tagging Experiments Nuclei Mitotic Spindle Histone-GFP Tubulin-GFP Light Microscope Question: Where is the Cdc10 protein located in a yeast cell? Saccharomyces cerevisiae (Yeast) Eukaryotic cell 15 million bp DNA ~ 6000 genes Complete genome sequence known! * Model for Septin Ring Formation GFP Tagging Approach mRNA DNA (CDC10 -GFP Fusion) Cdc10-GFP Fusion Transcription Translation Project Overview Isolation of CDC10 gene Open Reading Frame Purification of Genomic DNA from yeast Polymerase Chain Reaction (PCR) Construction of CDC10-GFP fusion gene Restriction endonuclease/Ligase Cloning DNA in E. coli Introduction of CDC10-GFP fusion gene into yeast cells Observe Cdc10 protein localization in living cells with fluorescence microscopy GFP Tagging Approach mRNA DNA (CDC10 -GFP Fusion) Cdc10-GFP Fusion Transcription Translation Copies of CDC10 Gene Open Reading Frame Pg. 350 Purify genomic DNA ~ 6000 genes Lab #1 & 2 15 million bp PCR Copies of CDC10 Gene Open Reading Frame Pg. 350 Purify genomic DNA ~ 6000 genes Lab #1 & 2 15 million bp PCR CDC10-For 5 GTGGTGAAGCTTATGTCCATCGAAGAACCTAG 3 CDC10-Rev 5 GTGGTGAAGCTTCTAGCAGCAGCAGTACCTGT 3 CDC10 Gene Primers First Cycle of PCR Pg. 349 (94 o C.) (52 o C.) (72 o C.) CDC10 For Rev 5 3 5 Three Cycles of PCR Pg. 349 Three Cycles of PCR Pg. 349 Copies of CDC10 Gene Open Reading Frame Pg. 350 Purify genomic DNA ~ 6000 genes Lab #1 & 2 15 million bp PCR CDC10 Gene Sequence Ethidium Bromide Copies of CDC10 Gene Open Reading Frame Pg. 350 Purify genomic DNA ~ 6500 genes Lab #1 15 million bp PCR 2000 bp 500 bp Wells + 2000 bp 500 bp Wells + Restriction Endonuclease Reaction HindIII (37 o C.) 5 3 5 3 5 Ligation Reaction Compatible ends DNA Ligase + ATP (15 o C.) HindIII recognition site is reconstituted 5 3 5 3 5 1. Annealing 2. Phosphodiester bond formation Pg. 344 Construction of a Recombinant DNA Plasmid (insert) CDC10-For 5 GTGGTGAAGCTTATGTCCATCGAAGAACCTAG 3 CDC10-Rev 5 GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT 3 CDC10 Gene Primers GTGGTG AAGCTT ATGTCCATCGAAGAA CACCAC TTCGAA TACAGGTAGCTTCTT ACTGCTGCTGCTAGA AAGCTT CACCAC TGACGACGACGATCT TTCGAA GTGGTG 5 3 5 3 CDC10 ORF DNA from PCR GTGGTG AAGCTT ATGTCCATCGAAGAA CACCAC TTCGAA TACAGGTAGCTTCTT ACTGCTGCTGCTAGA AAGCTT CACCAC TGACGACGACGATCT TTCGAA GTGGTG 5 3 5 3 AGCTT ATGTCCATCGAAGAA A TACAGGTAGCTTCTT ACTGCTGCTGCTAGA A TGACGACGACGATCT TTCGA 5 3 5 3 CDC10 ORF DNA from PCR HindIII Ori Amp R pGFP Plasmid HindIII ACT GCT GCT GCT AGA AAG CTT ATG TCT AAA GGT HindIII Site - Thr - Ala - Ala - Ala - Arg - Lys - Leu - Met - Ser - Lys - Gly - Cdc10 GFP 53 pCDC10-GFP Plasmid CDC10 orfGFP orfACT1p HindIII Ori Amp R pGFP Plasmid HindIII AGCTT ATGTCCATCGAAGAA A TACAGGTAGCTTCTT ACTGCTGCTGCTAGA A TGACGACGACGATCT TTCGA 5 3 5 3 CDC10 orf Pg. 344 Construction of a Recombinant DNA Plasmid (insert) Transformation of E. Coli plasmid Transformation of E. Coli plasmid Cold CaCl 2 Pg. 344 (Ampicillin sensitive) (Amp R ) (LB growth medium with ampicillin) DNA Cloning pCDC10-GFP Plasmid Purification (Lab #5) Bacterial Transformation (Lab #4) Pg. 344 (Ampicillin sensitive) (Amp R ) (LB growth medium with ampicillin) DNA Cloning pCDC10-GFP Plasmid Purification (Lab #5) Bacterial Transformation (Lab #4) Pg. 344 (Amp R ) (LB growth medium with ampicillin) DNA Cloning Plasmid Purification (Lab #5) Pg. 344 (Ampicillin sensitive) (Amp R ) DNA Cloning pCDC10-GFP (LB-amp Plate) (LB-amp) E. coli Cell Wall Cell Membrane Cytoplasm (chromosome, plasmids) Restriction Endonuclease Reaction HindIII (37 o C.) 5 3 5 3 5 ACGGGGAATTCACGCGGAGAATTCAATGGGAATCGTGGA TGCCCCTTAAGTGCGCCTCTTAAGTTACCCTTAGCACCT ACGGGG TGCCCCTTAA AATTCACGCGGAG GTGCGCCTCTTAA AATTCAATGGGAATCGTGGA GTTACCCTTAGCACCT 5 3 Ligation Reaction Compatible ends DNA Ligase + ATP (15 o C.) HindIII recognition site is reconstituted 5 3 5 3 5 Pg. 344 (Amp R ) (LB growth medium with ampicillin) DNA Cloning Plasmid Purification (Lab #5) Pg. 344 (Amp R ) (LB growth medium with ampicillin) DNA Cloning Plasmid Purification (Lab #5) pCDCGFP or pGFP? Ori Amp R pCDCGFP Plasmid CDC10GFP HindIII Biol 273 Morning Section Lab #7 Results Biol 273 Afternoon Section Lab #7 Results pCDCGFP Yeast Cells Observe Cdc10-GFP Localization (Lab #7) (Lab #8) GFP Tagging of Cdc10 mRNA DNA (CDC10 -GFP Fusion) Cdc10-GFP Fusion Transcription Translation pCDCGFP Yeast Cells Observe Cdc10-GFP Localization (Lab #7) (Lab #8) Transformation of E. Coli plasmid Transformation of Yeast Linear plasmid Ori Amp R pCDCGFP Plasmid CDC10GFP Selectable Marker Targeting sequence Yeast Chromosome Chromosome Integration Targeting Locus (RPS10) Ori Amp R pCDCGFP Plasmid CDC10GFP StuI URA3 ACT1p-CDC10GFP Linear pCDCGFP Plasmid RPS10 Yeast Chromosome Chromosome Integration URA3 ACT1p-CDC10GFP Linear pCDCGFP Plasmid RPS10 Yeast Chromosome with CDC10-GFP and URA3 Genes! Chromosome Integration URA3 ACT1p-CDC10GFP Uridine Monophosphate Orotidine Monophosphate URA3 Gene Encodes Orotidine Decarboxylase (RNA synthesis) Orotidine Decarboxylase ura3 mutant can NOT make Uridine Monophosphate Orotidine Monophosphate Yeast ura3 Mutant Orotidine Decarboxylase Yeast Transformation Plate Lab #7 URA3 Transformants Cells with the CDC10-GFP fusion Gene ACT1p CDC10GFP mRNA (CDC10-GFP orf) Transcription/RNA Processing (nucleus) Translation (cytosol) Cdc10-GFP Protein G AAAAAA Expression of CDC10-GFP Fusion Gene Integrated in Yeast Chromosome Localization of Cdc10-GFP in the Cell Septin Proteins of Yeast * Lipid Bilayer Binding Domain Model for Septin Polymerization Yeast Cells Yeast Mitotic Cell Cycle ~ 3 Hours G2G2 Septin Dynamics in the Yeast Mitotic Cell Cycle Septins mark site of bud formation Septin ring at the mother/bud neck Septin ring splits into two Septins De-polymerize G2G2 Light Microscope (10X) (10-100X) Excitation Wavelength (e.g. 490 nm) Emission Wavelength (e.g. 510 nm) GFP
