Purification, characterization and amino acid sequencing of divergicin M35: a novel class IIa bacteriocin produced by Carnobacterium divergens M35

www.elsevier.com/locate/ijfoodmicro

International Journal of Food Microbiology 97 (2004) 123–136

Purification, characterization and amino acid sequencing of

divergicin M35: a novel class IIa bacteriocin produced by

Carnobacterium divergens M35

I. Tahiria, M. Desbiensb, R. Benecha, E. Kheadra,c, C. Lacroixd, S. Thibaultb,D. Ouelletb, I. Flissa,*

aDairy Research Center STELA, Universite Laval, Pavillon Paul Comtois, Quebec, PQ, Canada G1K 7P4bCentre Technologique des Produits aquatiques, Ministere de l’Agriculture des Pecheries et de l’Alimentation, Gaspe,

Quebec, PQ, Canada G4X 2V6cDepartment of Dairy Science and Technology, Faculty of Agriculture, University of Alexandria, Alexandria, Egypt

d Institute of Food Science and Nutrition, Swiss Federal Institute of Technology, ETH Zentrum, LFO F18 CH-8092 Zurich, Switzerland

Received 9 December 2003; received in revised form 30 March 2004; accepted 26 April 2004

Abstract

Carnobacterium divergens M35, isolated from a commercial sample of frozen smoked mussels, produces a new bacteriocin,

divergicin M35, a class IIa bacteriocin. Divergicin M35 is sensitive to pronase-E, a-chymotrypsin and proteinase K, but not to

trypsin and withstands thermal treatments up to 121 jC for 30 min. Divergicin M35 was extracted from the culture supernatant

of C. divergens M35 using an SP-Sepharose cation-exchange column, desalted and purified on a C18 Sep-Pack column and

further purified by reverse phase-high pressure liquid chromatography. This procedure allowed the recovery of 10% of the

bacteriocin present in the culture supernatant with purity higher than 99%. Divergicin M35 had a molecular mass of 4518.75 Da

as determined by mass spectrometry, a pI value of 8.3 and positive net charge ( + 3). The amino acid sequence of divergicin

M35 was found to consist of 43 amino acid with four cysteine residues (Cys10, 15, 25, 43) and showed 80.5% homology with

divercin V41 (80.5%) and 80.0% with bavaricin MN. Divergicin M35 showed powerful antilisterial activity, especially against

Listeria monocytogenes and was also active against carnobacteria but not against strains of Lactococcus, Lactobacillus,

Enterococcus, Bifidobacteria and Escherichia. Divergicin M35 production began in late exponential phase and reached a

maximum activity of 65,000 AU/ml in early stationary phase. Initial broth pH, Tween 80 and acetate did not affect C. divergens

M35 growth or divergicin production. This bacteriocin may be a potential tool for inhibiting L. monocytogenes in seafood

products that do not usually undergo an adequate heat treatment.

D 2004 Elsevier B.V. All rights reserved.

Keywords: Bacteriocin; Carnobacterium; Seafood; Preservationz

0168-1605/$ - see front matter D 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.ijfoodmicro.2004.04.013

* Corresponding author. Tel.: +1-418-656-2131x6825; fax: +1-

418-656-3353.

E-mail address: [email protected] (I. Fliss).

1. Introduction

Lactic acid bacteria (LAB) are used for the pro-

duction of a wide variety of fermented food products,

Table 1

Bacterial reference strains used in this study and their sensitivity to divergicin M35

Organism Strain Sensitivity to

divergicin M35

Diameter of inhibition

zone (mm)

Listeria monocytogenes LSDa 15 � NA

L. monocytogenes LSD 332 + 18.5F 1

L. monocytogenes LSD 336 + 16.5F 0.5







L. monocytogenes LSD 523 + 10F 1b

L. monocytogenes LSD 524 + 22.0F 1b

L. monocytogenes LSD 525 � NA





L. monocytogenes LSD 532 + 20.0F 0.5b



L. monocytogenes ATCCb 19111 + ND

L. monocytogenes ATCC 19112 + ND




Listeria seeligeri LSD 11 + 13.5F 1

Listeria welshimeri LSD 12 + 20F 0.5

Listeria grayi LSD 13 + 15.0F 1

Listeria murayi LSD 14 + 17.5F 1

Listeria ivanovii ATCC 19119 � NA

Listeria ivanovii HPBc28 + ND

Listeria innocua HPB13 + 21F 0.5

Carnobacterium divergens ATCC 385 + 15.0F 1

Carnobacterium piscicola ATCC 386 + 17.5F 1

Lactococcus lactis subsp. lactis Rd 0058 � NA

Lactococcus lactis subsp. lactis

biovar. diacetylactis

R 0100 � NA

Lactococcus lactis subsp. lactis

biovar. diacetylactis

ULe 719 � NA

Pediococcus acidilactici UL 5 � NA

Pediococcus acidilactici R 1001 � NA

Pediococcus pentosaceus R 1044 � NA

Lactobacillus salivarius R 0078 � NA

Lactobacillus delbrueckii subsp. lactis R 0187 � NA

Lactobacillus acidophilus R 0052 � NA

Lactobacillus plantarum R 1012 � NA

Lactobacillus casei R R0256 � NA

Lactobacillus rhamnosus R 0011 � NA

Streptococcus thermophilus R 0083 � NA

Propionibacterium spp. P5 � NA

Propionibacterium freudenreichii R 0501 � NA

Bifidobacterium breve ATCC 15700 � NA

Escherichia coli ATCC 11775 � NA

Escherichia coli ATCC 13883 � NA

I. Tahiri et al. / International Journal of Food Microbiology 97 (2004) 123–136124

I. Tahiri et al. / International Journal of Food Microbiology 97 (2004) 123–136 125

in which they contribute to the improvement of flavor,

texture and shelf-life. These microorganisms suppress

many food spoilage and pathogenic bacteria by pro-

ducing a variety of antibacterial compounds including

organic acids, diacetyl, hydrogen peroxide and pro-

teinaceous molecules known as bacteriocins (Ray and

Daeschel, 1992; O’Sullivan et al., 2002) and thus

provide a good example of food biopreservation. This

approach to food preservation has gained increasing

attention and holds promise in view of the increasing

popularity of chemical preservative-free and ready-to-

eat products as well as those that receive minimal

thermal treatment during production. Such products

may develop dangerous levels of pathogenic bacteria

such as Listeria monocytogenes, which has been

shown to cause serious or even fatal illness, numerous

outbreaks of which have occurred worldwide (Gahan

and Collins, 1991). The ability of this pathogen to

survive for long periods at refrigerated temperatures

(Gill and Reichel, 1989) and at sodium chloride

concentrations of up to 10% (Farber and Peterkin,

1991) makes it a serious health threat, particularly in

lightly preserved seafood. In cold-smoked salmon, for

example, the frequency of contamination by L. mono-

cytogenes may be 10% to 30% and may reach 75%

(Rørvik, 2000; Food and Drug Administration, 2001).

A wide range of LAB is associated with poultry,

meat and fish and represents the major flora in low-

temperature-stored products (Leroi et al., 1998; Stohr

et al., 2001). Among these bacteria, Carnobacterium

spp. are particularly interesting since they are able to

grow and produce bacteriocins with high antilisterial

activity at low temperatures and high sodium chloride

concentration (Buchanan and Bagi, 1997). In addition,

Carnobacterium spp. possess the ability to grow in

foods with limited carbohydrate content, such as fish

products, and have a low acidifying capacity (Leroi et

al., 1998; Stohr et al., 2001) unlike other bacteriocin-

producing LAB (Stiles, 1996). Several bacteriocins

Notes to Table 1:

+, inhibition; � , no inhibition.

NA, not applicable.

ND, not determined.aLSD: Laboratory Services Division Canadian Food Inspection AgencbATCC: American Type Culture Collection (Rockville, MD, USA).cHPB: Health Protection Branch (Health and Welfare Canada, OttawadR: Rosell Institute (Montreal, PQ, Canada).eUL: STELA Dairy Research Center Culture Collection (Universite L

produced by Carnobacterium spp. have been isolated

and characterized, such as carnobacteriocins BM1 and

B2 produced by Carnobacterium piscicola LV17B

(Quadri et al., 1994), divergicin A produced by

Carnobacterium divergens NCIMB 702855 (Worobo

et al., 1995), divercin V41 from C. divergens V41

(Metivier et al., 1998), divergicin 750 produced by C.

divergens 750 (Holck et al., 1996), piscicocin V1a

produced by C. piscicola V1 (Bhugaloo-Vial et al.,

1996) and carnocin CP5 from C. piscicola CP5

(Herbin et al., 1997). However, only a few studies

have provide characterization of bacteriocins pro-

duced by carnobacteria isolated from fish (Stoffels

et al., 1992; Pilet et al., 1995; Buchanan and Bagi,

1997; Metivier et al., 1998).

For the exploitation of bacteriocins and their pro-

ducer strains in fish products, new bacteriocins pro-

duced by fish-acclimatized species must be isolated

and characterized. This could provide powerful tools

for inhibiting pathogenic organisms such as L. mono-

cytogenes in seafood products. In the present study,

we isolated and characterized LAB with potential

antilisterial activity from frozen seafoods, screened

the isolates for bacteriocin production, and purified

and characterized a novel bacteriocin produced by

C. divergens.

2. Materials and methods

2.1. Bacterial strains and growth media

Reference strains used in this study and their

origins are listed in Table 1. All strains were main-

tained in 20% glycerol at � 80 jC. Carnobacteriumspp. and Lactococcus spp. were grown in de Man,

Rogosa and Sharpe (MRS) broth (De Man et al.,

1960) obtained from Rosell Institute (Montreal, PQ,

Canada) containing 0.1% (v/v) Tween 80 and incu-

y (Ottawa, ON, Canada).

, ON, Canada).

aval, Quebec, PQ, Canada).


bated aerobically at 30 jC. L. monocytogenes and

Escherichia coli were grown in tryptic soy broth

(TSB; Difco Laboratories, Sparks, MD) supplemented

with 0.6% (w/v) yeast extract and incubated aerobi-

cally at 37 jC. Listeria innocua and Listeria ivanovii

were grown in TSB with yeast extract and incubated

aerobically at 30 jC. Streptococcus thermophilus,

Propionibacterium spp. and pediococci were grown

in MRS broth at 37 jC under aerobic conditions. All

lactobacilli and bifidobacteria were grown in MRS

broth supplemented with 0.05% (w/v) L-cysteine-hy-

drochloride (Sigma, St. Louis, MO, USA) and incu-

bated anaerobically under an atmosphere generated

using the Oxoid AnaeroGenTM system (Oxoid,

Basingstoke, Hampshire, England) at 37 jC. Beforethe experiments, strains were sub-cultured at least

three times, in their respective media at 24-h intervals.

2.2. Isolation of bacteriocin-producing LAB from

seafood

Commercial packages of frozen smoked mussels,

smoked salmon and brined shrimp (20 samples for

each product) were obtained from local supermarkets

in the coastal town of Gaspe (Quebec, Canada) from

June through September 2000. Samples were thawed

at 5 jC and held at this temperature for 2–8 weeks.

They were processed by adding 10 times their mass of

refrigerated 0.1% (w/v) peptone water and homoge-

nizing for 3 min in type 80 stomacher (Seward

Medical, London, England). Appropriate dilutions

were plated on MRS agar and incubated anaerobically

at 30 jC for 48 h. Well-developed individual colonies

on these plates were selected and grown in 3 ml

volumes of APT broth (Difco) at 30 jC for 18 h.

Isolates were screened for antilisterial activity

using the agar spot method of Tagg et al. (1976) with

some modifications. Briefly, 2 Al volumes of over-

night culture were spotted onto five plates of APT

agar supplemented with 0.6% (w/v) yeast extract

(APT-YE). The plates were kept at room temperature

for 30 min to dry, and were incubated anaerobically at

30 jC for 18 h to avoid hydrogen peroxide produc-

tion. The plates were then overlaid with 10 ml of

molten brain–heart infusion broth (Difco) containing

0.75% (w/v) agar, 500 IU/ml catalase (Sigma) and 2%

(w/v) glycerophosphate (Sigma) and seeded with a

single L. monocytogenes strain (ATCC 19111, 19112,

19114, 19115 or 35152) at a concentration of 105–106

CFU/ml. After incubation at 30 jC under aerobic

conditions for 24 h, plates were examined for clear

zones surrounding the isolate spots. Isolates which

gave a clear zone of diameter larger than 10 mm with

one or more of the test organisms were selected for

further examination.

To confirm the proteinaceous nature of the inhibi-

tory substances, the assay was repeatedwith proteolytic

enzymes (proteinase-K, EC 3.4.21.14; a-chymo-

trypsin, EC 3.4.21.1; pronase-E, EC 3.4.24.31 and

trypsin, EC 3.4.21.4, all from Sigma). Enzymes were

dissolved in 0.01 M phosphate buffer saline (Sigma) at

pH 7.5 at a concentration of 10 mg/ml and 2 Al wasspotted on APT-YE plates 2 mm from the edge of the

isolate spots previously incubated at 30 jC for 18

h before overlaying with brain heart infusion as de-

scribed above.

2.3. Characterization of bacteriocin-producing

isolates

Bacteriocin-producing isolates having high antilis-

terial activity were characterized morphologically and

tested for production of H2O2, oxidase, and gas from

glucose in APT broth for up to 10 days, as previously

described (Dicks and van Vuuren, 1987); arginine

degradation on Moeller Decarboxylase Agar with

0.5% and 2.0% (w/v) glucose; growth at 45 jC, andin the presence of 10% (w/v) sodium chloride; and

carbohydrate fermentation, using API 50CH galleries

(BioMerieux, Montreal, PQ, Canada) according to the

manufacturer’s instructions. Lactic acid configuration

was determined enzymatically using a D/L-lactic acid

enzymatic bioanalysis kit (Boehringer Mannheim,

Mannheim, Germany). The presence of meso-diami-

nopimelic acid in the cell wall was tested by the

method of Bousfield et al. (1985). The ability of the

isolates to grow at 5 jC was determined from counts

on tryptic soy agar (Difco) of APT-YE broth cultures

maintained at 5 jC.

2.4. Polymerase chain reaction (PCR)

Based on biochemical characterization, a bacterio-

cin-producing strain coded M35, isolated from frozen

smoked mussels was assigned to the genus Carno-

bacterium. PCR analyses were performed to confirm


this identification using genus-specific primers Cb1-f

and Cb2-r, previously designed for the genotypic

characterization of Carnobacterium spp. by DNA

amplification (Yost and Nattress, 2000). These pri-

mers were used to amplify a 340-bp target region of

16S rDNA from isolate M35.

A universal forward primer, 27f, and a species-

specific forward primer, Cga, were used in combina-

tion with three species-specific reverse primers, Cdi,

Cmo and Cpg (Barakat et al., 2000). Forward primer

Cga was designed for C. gallinarum and reverse

primers Cdi, Cmo and Cpg were designed for C.

divergens, C. mobile and C. piscicola or C. gallina-

rum, respectively. Forward 27f and reverse primers

Cdi, Cmo and Cpg were used to amplify specific

198–199-bp target regions, while primers Cga and

Cpg were used to amplify a 128-bp region of the 16S

rDNA. Lactobacillus farciminis rDNA was used as

negative control. All primers used for PCR analyses

were obtained from Invitrogenk (Frederick, MD,

USA). Table 2 shows the sequences, orientations

and specificities of the PCR primers used in the study.

For DNA extraction, the Qiagen DNA purification

kit (Qiagen, Mississauga, ON, Canada) was used

according to the manufacturer’s instructions. Cells of

1 ml of an overnight MRS culture of isolate M35 were

sedimented by centrifugation, washed and resus-

pended in sterile water. PCR amplification was per-

formed in a 25-Al reaction volume containing the

following reagents: 1� Taq buffer, 0.5 unit of Taq

DNA polymerase (New England Biolab, Beverly,

MA, USA), 25 ng of each primer, 0.5 Al of bacterialsuspension and 0.1 mM of dNTP (Amersham Bio-

sciences, Baie d’Urfe, PQ, Canada). An automated

DNA thermal cycler Perkin Elmer Gene Amp PCR

system 2400 was used to provide the temperature

cycles recommended previously (Barakat et al., 2000).

Table 2

Primers used for the identification of C. divergens M35 by PCR

Primers Sequence (5V to 3V) Posit

Cb1f CCGTCAGGGGATGAGCAGTTAC 499–

Cb2r ACATTCGGAAACGGATGCTAAT 174–

27f AGAGTTTGATCMTGGCTCAG 8–

Cdi GCGACCATGCGGTCACTTGAA 185–

Cmo TCCACCAGGAGGTGGTTGGAGT 184–

Cpg GAATCATGCGATTCCTGAAAC 184–

Cga GGAAAGCTTNCTTTCTAACC 77–

The reaction mixture was then visualized on a 3% (w/

v) agarose electrophoresis gel stained with 0.5 g/ml

ethidium bromide (Sigma). A 100-bp ladder was used

as a size marker.

2.5. Purification of divergicin M35

Purification of divergicin M35 was performed

using a three-step method adapted from Guyonnet et

al. (2000). An overnight MRS culture of C. divergens

M35 was centrifuged at 7000� g for 15 min at 4 jCand the supernatant was heated in a water bath at 100

jC for 10 min. The supernatant (500 ml) was injected

into a SP-Sepharose Fast Flow Cation-exchange Col-

umn (Amersham, Pharmacia Biotech, Uppsala, Swe-

den) at flow rate of 3 ml/min. The column was washed

and equilibrated with 1 l of ammonium acetate buffer

(5 mM, pH 5) and bacteriocin was eluted with 250 ml

of 1.5% (w/v) sodium chloride in ammonium acetate

buffer. The eluted bacteriocin was loaded onto a Sep-

PackR C18 Cartridge micro-column (Waters, Milford,

MA, USA) previously equilibrated with 5 mM of HCl

in HPLC-grade water. Bacteriocin was eluted from the

Sep-Pack using 60 ml of 50% (v/v) acetonitrile in

water. Acetonitrile was removed using a rotary evap-

orator. Bacteriocin was concentrated under vacuum

with a Speed-Vac concentrator (Thermo Savant Instru-

ments, NY, USA) and kept at � 80 jC.The concentrated bacteriocin was further purified

by Reverse-Phase Liquid Chromatography (RP-

HPLC) using a Beckman Gold System (Beckman

Coulter Canada, Mississauga, ON, Canada). Briefly,

100 Al of concentrated bacteriocin was injected into

an analytic C18 reverse-phase column (Luna 5 Am,

4.6� 250 mm, Phenomenex, CA, USA). Elution was

performed at a flow rate of 1 ml/min using a linear

gradient from 90% solvent A (0.1% (w/v) trifluoro-

ion Orientation Specificity

477 Forward Genus Carnobacterium

155 Reverse Genus Carnobacterium

27 Forward Universal

206 Reverse Carnobacterium divergens

206 Reverse Carnobacterium mobile

205 Reverse Carnobacterium pisicola

97 Forward Carnobacterium gallinarum


acetic acid (TFA) in 5% (v/v) acetonitrile in water)

and 10% solvent B (0.1% TFA in 100% acetonitrile)

to 42% and 58% of solvents A and B, respectively,

within 46 min. Peptide fractions were detected spec-

trophotometrically by measuring the absorbance at

214 nm and collected manually. The fractions were

concentrated using a Speed-Vac concentrator, dis-

solved in acetate buffer (5 mM, pH 4.0) and assayed

for bacteriocin activity by the critical-dilution micro-

method and protein concentration was determined

using the DC protein assay (BioRad Laboratories,

Mississauga, ON, Canada) with bovine serum albu-

min (Sigma) as a standard (Lowry et al., 1951).

2.6. Growth of C. divergens M35

Growth and bacteriocin production by C. divergens

M35 in MRS broth (initial pH 6.3) with Tween 80

(0.1%, v/v) were followed during 24 h of incubation

at 30 jC under aerobic conditions using an inoculation

level of 1% (v/v). Viable bacterial counts, bacteriocin

activity and pH were determined at 2-h intervals.

Appropriate dilutions of M35 culture were made in

0.1%(w/v) peptone water, plated on MRS agar and

incubated aerobically at 30 jC for 24 h. For bacteriocin

activity determination, 5 ml of culture supernatant was

separated by centrifugation and heated to 100 jC prior

to assay by the critical-dilution micromethod described

below.

Growth and bacteriocin production by C. divergens

M35 were also evaluated in MRS broth without Tween

80, in M-17 broth (BDH-Merck, Darmstadt, Germany)

and in MRS broth with the initial pH adjusted to 7.0

using the same procedures as described above.

2.7. Divergicin M35 spectrum of activity

The antibacterial activity of the C. divergens M35

bacteriocin against the species of Listeria, Lactoba-

cillus, Streptococcus, Lactococcus, Propionibacte-

rium and Escherichia listed in Table 1 was

evaluated using the agar diffusion method (Tagg et

al., 1976).

2.8. Heat stability of divergicin M35

Late exponential phase MRS culture of C. diver-

gens M35 was centrifuged at 7000� g for 20 min.

The supernatant was heated at 100 jC for 30 and 60

min or at 121 jC for 20, 30 and 60 min before

testing for bacteriocin activity by the agar diffusion

method using L. innocua HPB13 as an indicator

organism.

2.9. Critical-dilution micromethod

Two-fold serial dilutions of 125 Al of tested sample

were added to wells of a flat bottomed microtestkpolystyrene microplate (96-well microtest, Becton

Dickinson Labware, Franklin Lakes, NJ, USA). Each

well contained 125 Al of tryptic soy broth supple-

mented with 0.6% yeast extract (w/v) (Meghrous et

al., 1997). Each well was inoculated with 50 Al ofdiluted 1000-fold L. innocua HPB13 overnight culture

(final concentration of approximately 106 CFU/ml).

Plates were incubated at 30 jC for 18 h and absor-

bances at 650 nm were then measured using a

Thermo-max molecular device spectrophotometer

(OPTI-Resources, Quebec, PQ, Canada). Bacteriocin

activity, expressed in arbitrary units per milliliter (AU/

ml), was defined as the highest bacteriocin dilution

showing complete inhibition of the indicator strain

(absorbances equal to that in uninoculated medium),

calculated as AU/ml = 2n� (1000/125) where n is the

number of wells showing inhibition of the indicator

strain.

2.10. Amino acid sequencing and molecular weight

determination of divergicin M35

Amino acid sequencing was performed by Edman

degradation on an automated sequencer (model 492;

Applied Biosystems, Foster city, CA, USA). Mass

measurement was performed using a Voyager De

MALDI-TOF (matrix assisted laser desorption ion-

isation-time of flight) mass spectrometer (Perkin

Elmer Life and Analytical Sciences, Boston, MA,

USA) with an accuracy of F 0.02% for peptide mass

determination. The HPLC-purified peptide was

mixed (1:1, v/v) with the MALDI-TOF matrix on

the gold plated probe. The matrix consisted of a

saturated solution of ~-cyano-4-hydroxycinnaminic

acid (Aldrich Chemical, Mississauga, ON, Canada)

with 50% acetonitrile and 0.1% TFA. Protein homol-

ogy search (SWALL and SWISS-PROT) and se-

quence analysis were performed with the ExPASy


proteomics tolls sequence analysis software package

(protein/peptide MW calculation tool, version 8.03,

Agillemt Technologies Canada, Saint Laurent, PQ,

Canada).

3. Results

3.1. Characterization and identification of C. diver-

gens M35

On the basis of clear zones obtained by the agar

spot test, several LAB strains were selected for

potential inhibitory activity against L. monocytogenes,

including an isolate from frozen smoked mussels

designated M35, which produced a clearing over 12

mm wide. The inhibitory activity of this isolate

appeared to be due to the production of a proteina-

ceous compound, since the inhibitory activity disap-

peared in the presence of pronase-E, a-chymotrypsin

and proteinase K, although trypsin had no effect.

The M35 isolate was identified as C. divergens,

based on the identification scheme proposed previ-

ously (Mauguin and Novel, 1994) and its carbohy-

drate fermentation profile. The isolate was a Gram

positive short rod, catalase and oxidase negative,

which produced only L-lactic acid with very little

gas. It grew at 5 jC but not at 45 jC, tolerated up

to 10% salt, metabolized arginine at a glucose con-

centration of 0.5% but not 2.0%, and contains meso-

diaminopimelic type peptidoglycan. The API identi-

fication procedure strongly indicated C. divergens,

except for a doubtful melezitose reaction.

Fig. 1. Agarose-gel electrophoresis of PCR products from C. divergens M

specific primers. (a) Lanes 1, 2 and 3 are size markers DNA ladder, negat

genus-specific (Cb1-f/CB2-r) primer pair, respectively. (b) Lanes 1, 2 and 3

199 bp using the C. divergens species-specific (27f/Cdi) primer pair, resp

For genus identification, PCR amplification of a

specific 340-bp fragment from 16S rDNA was suc-

cessful using Carnobacterium genus-specific primers

Cb1f and Cb2r (Fig. 1a). The results of PCR ampli-

fications using universal and species-specific primers

are shown in Fig. 1b. The 199-bp PCR product

expected for C. divergens was amplified from 16S

rDNA using the 27f-Cdi primer pair. The PCR am-

plification results confirmed the morphological and

biochemical tests.

3.2. Purification of divergicin M35

Results of the various purification steps are given

in Table 3. Fig. 2 shows the activity of divergicin M35

obtained at the different steps of the purification

procedure.

Based on activity measurement, only 25% of the

bacteriocin activity present in the cell-free superna-

tant was eluted from the SP-Sepharose cation-ex-

change column, although the specific activity in

units per mg of protein increased by three-fold (Table

3). Divergicin M35 eluted from SP-Sepharose col-

umn was further purified on a Sep-Pack C18 column.

It bound tightly to the column matrix but could be

easily eluted with 50% (v/v) acetonitrile. The Sep-

Pack C18 restored 96%, of the initial supernatant

divergicin M35 activity, bringing the calculated spe-

cific activity to 5074-fold higher than in the crude

culture supernatant.

Final purification of divergicin M35 by reverse-

phase HPLC revealed the presence of a distinct peak

eluted at 38.6%, corresponding to retention times of

35 obtained using 16S rDNA-targeted (a) genus- and (b) species-

ive control (water) and 340-bp amplicon using the Carnobacterium

are size markers DNA ladder, negative control (water) and amplicon

ectively.

Table 3

Purification of class IIa bacteriocin, divergicin M35, produced by C. divergens M35

Purification stage Volume

(ml)

Total protein

(mg)

Total activitya

(AU)

Specific activityb

(AU/mg)

Increase in specific

activity (fold)

Yield

(%)

Culture supernatant 500 7558 32.8� 106 4.3� 103 – 100

Sp-Sepharose eluate 250 625 8.2� 106 13.1�103 3 25

Sep-Pack C18 eluate 60 1.43 31.5� 106 22.0� 106 5074 96

RP-HPLC eluate 0.8 8.2� 10� 2 3.3� 106 40.9� 106 9438 10

a Activity (AU/ml) determined by microtiter plate assay using L. innocua HPB13 as indicator microorganism and multiplied by the volume

in milliliters.b Activity (AU/ml) divided by total protein (mg).


28.6 min (Fig. 3). This peak was shown to be active

against L. innocua HPB13. The active peak was

collected and re-injected onto the HPLC to verify

purity and analyzed for mass and amino acid se-

quence. The HPLC separation increased the specific

activity of divergicin M35 by 9500-fold relative to the

supernatant activity and the amount recovered was

10% of that present in the crude supernatant.

3.3. Mass and amino acid sequence of divergicin M35

The HPLC-purified peptide was found to have a

molecular mass of approximately 4518.75 Da (Fig. 4).

Fig. 2. Agar-well diffusion showing the inhibition of L. innocua

HPB13 by divergicin M35 from C. divergens M35 culture

supernatant (A), 1.5% sodium chloride eluate from SP-Sepharose

column (B), eluate from Sep-Pack C18 column with 50% acetonitrile

(C) and reverse-phase-high pressure chromatography purified

divergicin M35 (D), respectively.

Amino acid sequencing revealed that this mass cor-

responded to peptide consisting of 43 amino acids and

containing four cysteine residues (Cys10, 15, 25, 43; Fig.

5). Based on the peptide sequences of known bacter-

iocins, divergicin M35 showed a variable degree of

homology with other class IIa bacteriocins, including

divercin V41 (80.5%), bavaricin MN (80%), enterocin

A (61%) and mundticin (51.2%). The highest se-

quence similarity with other class IIa bacteriocins

was observed in the N-terminal half, with the pattern

YGNGVXaaCXaaXaaXaaXaaCXaaV(D/N)(W/R)(G/

A/S)XaaA, where amino acid residues of low variabil-

ity are in parentheses, with the alternative residue in

small caps while those of higher variability are repre-

sented by Xaa. Like all class IIa bacteriocins, diver-

gicin M35 was characterized by a high content of non-

polar amino acid residues (32.6%) and small amino

acids such as glycine (23%). The net positive charge

( + 3) of divergicin M35 was due to the presence of

two asparagine residues (Asp18,27) and five lysines

Fig. 3. Reverse-phase chromatography on a C18 Nucleosyl column

of divergicin M35-containing fraction eluted from Sep-Pack C18

using 50% acetonitrile.

Fig. 4. MALDI-TOF Mass spectrometry analysis of the active high

pressure chromatography peak eluted at 28.6 min using a matrix-

assisted laser desorption ionization-time of flight.


(Lys2, 13, 14, 40, 42). Divergicin M35 had a calculated

pI value of 8.6.

3.4. Growth of C. divergens M35 and divergicin

production

Neither Tween 80 nor acetate had a noticeable

effect on growth and divergicin M35 production, nor

did adjusting the initial broth pH to either 6.3 or 7.0

(data not shown). Results obtained with MRS broth

containing Tween 80 are shown in Fig. 6. C. divergens

Fig. 5. Primary sequence of divergicin M35 aligned with the sequences of

least 10 of the sequences shown. Amino acids residues in : boldface are p

M35 grew satisfactorily in MRS broth at 30 jC, themaximum of viable cell count reaching approximately

109 CFU/ml after 12 h, after which counts remained

stable for 12 h. The production of divergicin began

during the late stage of exponential growth. Biologi-

cally active divergicin M35 was first detected after 10

h of growth (approximately 18,000 AU/ml) and

reached a maximum of 65,000 AU/ml after 14 h of

growth which corresponded to the beginning of the

stationary phase. Activity remained stable throughout

the 12-h stationary phase. Only a slight decrease in pH

was observed during exponential growth of C. diver-

gens M35. Acid production appeared to be growth-

associated, since most of it was observed towards the

end of the exponential growth phase, where the pH

dropped from 6.6 to 5.5, and was relatively slow

during the stationary phase.

3.5. Heat stability of divergicin M35

Supernatant of C. divergens M35 MRS culture

retained a considerable portion of its activity after

high temperature treatments, as determined by the

agar diffusion method (data not shown). Compared

to unheated supernatant, the inhibition zone width was

reduced by 50%, 75% and 78.5%, respectively, for

treatments of 121 jC for 10, 20 and 30 min.

3.6. Divergicin M35 spectrum of activity

Of 24 tested strains of L. monocytogenes, 22

appeared to be sensitive to divergicin M35 and

showed inhibition zone diameters varying from 10

to 22 mm (Table 1). Two strains, L. monocytogenes

LSD 15 and 525, were resistant. Divergicin M35 also

other class IIa bacteriocins. Boxes enclose residues conserved in at

ositively charged; cysteine are underlined; � are unknown.

Fig. 6. Growth of C. divergens M35 (x), acid production (n) and

divergicin M35 activity (E) in De Man, Rogosa and Sharpe (MRS)

broth at 30 jC.


inhibited other species of Listeria including L. ivano-

vii, L. innocua, L. seeligeri, L. welshimeri, L. grayi

and L. murayi. In all cases, the antibacterial activity of

divergicin M35, determined as inhibition zone diam-

eter, persisted for at least 36 h of incubation.

Divergicin M35 also inhibited the closely related

bacteria C. divergens and C. piscicola (Table 1).

However, it did not inhibit bacteria belong to the

genera Lactobacillus, Lactococcus, Streptococcus,

Pediococcus, Propionibacterium and Bifidobacte-

rium. Two strains of E. coli were also not affected

by divergicin M35.

4. Discussion

The presence of Carnobacterium spp. in fish and

seafood products has been frequently reported in the

literature (Mauguin and Novel, 1994; Pilet et al.,

1995; Leroi et al., 1998; Ringø and Gatesoupe,

1998), although their usual association is with meat

products (Montel et al., 1991; Quadri et al., 1994).

Carnobacterium species are commonly found in cold-

smoked salmon and brined shrimp and frequently

constitute the dominant microflora of lightly pre-

served seafoods (Leroi et al., 1998; Paludan-Muller

et al., 1998; Duffes et al., 1999a).

Isolate M35 was identified based on characteristics

reported in the literature and shown to be related to

Carnobacterium spp. (Collins et al., 1987; Mauguin

and Novel, 1994). Carnobacteria were previously

included in the genus Lactobacillus but were shown

to have ‘‘atypical’’ LAB characteristics justifying the

creation of the new genus Carnobacterium. These

characteristics include the inability to grow on acetate

agar, exclusive production of L(+)-lactic acid from

glucose and the presence of meso-diaminopimelic

type peptidoglycan in the cell wall (Collins et al.,

1987; De Bruyn et al., 1987). The two most cited

species of Carnobacterium isolated from seafood

products, C. piscicola and C. divergens may be

differentiated from each other by mannitol fermenta-

tion. C. piscicola may ferment mannitol while C.

divergens does not (Montel et al., 1991). C. divergens

M35 demonstrated the overall biochemical character-

istics of the genus Carnobacterium spp. with no

ability to ferment mannitol and a doubtful melezitose

reaction. The biochemical characterization of C.

divergens M35 was confirmed by PCR analysis

(Brooks et al., 1992; Nissen et al., 1994; Barakat et

al., 2000; Yost and Nattress, 2000; Scarpellini et al.,

2002).

The antagonistic activity of C. divergens M35

against L. monocytogenes was shown to be due to the

production of a proteinaceous inhibitory substance.

This suggested production of bacteriocin by C.

divergens M35. Inactivation by proteolytic enzymes,

indifference to catalase, heat-resistance and narrow

spectrum bactericidal effect (Tagg et al., 1976),

including closely related Carnobacterium species,

confirmed the bacteriocin basis of the antagonis-

tic activity shown by C. divergens M35 against

L. monocytogenes.

Purification of divergicin M35 was achieved us-

ing a three-step procedure based on its cationic and

hydrophobic characteristics (Guyonnet et al., 2000).

Several methods have been reported in the literature

describing purification of bacteriocins from bacterial

culture supernatants (Carolissen-Mackay et al.,

1997). Precipitation by ammonium sulfate is the

most commonly used procedure (Carolissen-Mackay

et al., 1997). This strategy was unsatisfactory due to

difficulties encountered while re-dispersing the pel-

let, the requirement for extensive dialysis to remove

ammonium salts and low yields of bacteriocin (Bhu-

nia et al., 1988; Biet et al., 1998). This method is

also time consuming and lacks repeatability even

with the same producing strain and culture condi-

tions. Precipitation of bacteriocin by ammonium

sulfate has been recently replaced by cation-ex-

change chromatography, which is a method of sep-

aration based on the interaction between bacteriocin


cations and resin-bound anionic groups (Guyonnet et

al., 2000). This method has been recently used to

recover pediocin PA-1 produced by Pediococcus

acidilactici UL5 at a yield of 8.3% from cell-free

supernatant, providing a seven-fold increase in spe-

cific activity (Gaussier et al., 2002).

In the present study, the SP-Sepharose step led to a

three-fold increase in divergicin M35 specific activity

with a yield of 25%. This low yield may have been

due to changes in physico-chemical properties, par-

ticularly positive net charge. The use of sodium

chloride to elute the bacteriocin from SP-Sepharose

may have interfered with the proportion of key lateral

groups, and thereby reduced its antibacterial activity.

Positively charged amino acids Lys-1, His-42 and

Lys-43 in pediocin AcH are believed to contribute

significantly to its adsorption to the target membrane

(Miller et al., 1998). The Lys-11 residue in pediocin

PA-1 is also significant in pore formation in the target

lipid membrane, which is believed to be the basis of

the antibacterial activity. Its replacement by a Glu

residue results in a significant increase in the antibac-

terial activity (Miller et al., 1998). De-salting the

divergicin M35 solution on a Sep-Pack C18 cartridge

resulted in a 5073-fold increase in specific activity

with a yield of 96%. The yield of 10% obtained for

divergicin M35 after the HPLC purification step was

similar to that reported for other bacteriocins such as

divercin V41 (Guyonnet et al., 2000).

Mass spectrometry analysis showed that the mo-

lecular mass of purified divergicin M35 was 4518.75

Da, which is 6.45 Da lower than calculated by

sequence analysis software. It was previously shown

that molecular masses determined by mass spectrom-

etry for other pediocin-like bacteriocins containing

two disulfide bonds, such as divercin V41, enterocin

A, pediocin PA-1 and coagulin, were lower by 4.0,

4.7, 4.5 and 4.0 Da, respectively, than those calculated

with the sequence analysis software (Eijsink et al.,

1998; Metivier et al., 1998; Le Marrec et al., 2000).

Considering that the error in the MALDI-TOF mass

determinations using our machine is about 1 Da for a

peptide in the 5000 range, these values are consistent

with four cysteine residues being oxidized and in-

volved in disulfide bonds (Eijsink et al., 1998). Thus,

it may be concluded that divergicin M35 contains two

disulfide bonds formed between Cys10 and Cys15 and

between Cys25 and Cys43.

The separation between the two cysteine residues

(Cys10 and Cys15 in divergicin M35) in the N-

terminal domain, (i.e. four amino acid residues) is

conserved in all of the class IIa bacteriocins (Fig. 5).

Moreover, divergicin, pediocin PA-1/AcH, enterocin

A, divercin V41 and coagulin all possess an addi-

tional disulfide bond between a second pair of cys-

teine residues in the C-terminal domain, one of which

is the C-terminal amino acid residue. It has been

commonly reported that there is little sequence sim-

ilarity in the C-terminal portion of class IIa bacter-

iocins (Abee, 1995). As new members emerge,

however, it appears that subgroups may be defined

on the basis of C-terminal sequence similarities

(Ennahar et al., 2000). Divergicin M35, divercin

V41, bavaricin MN and enterocin A are all charac-

terized by the presence of a GXaaLGGXaaIPGK

pattern. On the other hand, divergicin M35 has a

positive net charge and pI value of 8.6, which is

within the range of values for class IIa bacteriocins

(Cintas et al., 1997; Jack et al., 1996).

MRS broth, used for growth of C. divergens M35

and production of divergicin M35, is the medium of

choice for growth and bacteriocin production by

carnobacteria and has been shown to be optimal for

bacteriocin production by C. pisicicola A9b (Stoffels

et al., 1992) and C. divergens V41 (Pilet et al., 1995;

Grajek et al., 1996; Bhugaloo-Vial et al., 1997).

Although the importance of pH adjustment in MRS

broth for growth and bacteriocin production has been

shown in various studies (Mathieu et al., 1993;

Schillinger et al., 1993; Holck et al., 1996), growth

of C. divergens M35 and divergicin production in

MRS broth were not affect by the initial pH.

Some workers have recommended the use of MRS

broth without Tween 80 for growth and bacteriocin

production by Carnobacterium spp. (Schillinger et al.,

1993; Pilet et al., 1995; Holck et al., 1996). However,

Tween 80 has been found essential for bacteriocin

production by C. piscicola A9b (Himelbloom et al.,

2001). The effects of detergents on the aggregation of

divercin, a bacteriocin produced by C. divergens AS7,

were studied by Sip and Grajek (2001), who reported

that the presence of Tween 80 increased divercin

activity, inhibited aggregation and facilitated ultrafil-

tration; and that only Tween 80 was of low enough

toxicity to be introduced directly into C. divergens

AS7 culture.


Although failure to grow in media containing

acetate is a known characteristic of Carnobacterium

species (Collins et al., 1987), no difference was

observed in growth and bacteriocin production by C.

divergens M35 in M-17 and MRS broths. Indeed, it

has been suggested that bacteriocin production is

stimulated by unfavorable conditions and that it may

be the result of the transcription of genes involved in

stress responses (De Vuyst et al., 1996), which sug-

gests an inductive effect of acetate, since Carnobac-

terium does not grow well in such media. Recently, it

has been reported for the first time that acetate acts as

an induction factor in bacteriocin production by C.

piscicola A9b, which showed a dose-dependent rela-

tionship with acetate concentration (Nilsson et al.,

2002).

Carnobacterium species are known to have low

acidification capacities (Collins et al., 1987) likely due

to low proteolytic activity compared to other LAB.

The pH decrease obtained during growth of C. diver-

gens M35 was similar to those reported in studies of

other Carnobacterium strains (Duffes et al., 1999b).

This weakly acidic metabolism is an interesting fea-

ture with regard to the potential use of bacteriocin-

producing species in foods since their effect on

sensorial and organoleptic characteristics may be

minimal.

Like most bacteriocins, divergicin M35 was pro-

duced in the early exponential phase of growth and its

concentration reached a maximum level at the begin-

ning of the stationary phase (Pilet et al., 1995).

The high antilisterial activity displayed by divergi-

cin M35 is characteristic of class IIa bacteriocins

(Klaenhammer, 1993; Ennahar et al., 2000). Divergi-

cin M35 was inactive against Lactococcus lactis

subsp. lactis biovar. diacetylatis UL719 and P. acid-

ilactici UL5, which are producers of nisin Z- and

pediocin PA-1, respectively. This result is promising

in view of recent investigation into the use of combi-

nation of LAB bacteriocins or their producing strains

in order to broaden the spectrum of activity inhibit a

wide variety of pathogens and food spoilage organ-

isms, and avoid the phenomenon of bacteriocin resis-

tance development.

Divergicin M35 has no inhibitory effect against

other lactic acid except Carnobacterium spp., and so

may be useful with foods that have desirable lactic

flora. Due to its powerful antilisterial activity, diver-

gicin M35 may have a potential application as bio-

preservative for lightly preserved seafood where

Listeria could be a serious problem as it could tolerate

refrigerated conditions even in the presence of higher

salt concentrations. Studies on ways to apply this

bacteriocin to seafood, and of its stability and anti-

listerial potency during storage of certain seafood

products are now underway in our laboratory.

Acknowledgements

This research was carried out within the program

of the Canadian Research Network on Lactic Acid

Bacteria supported by The National Science and

Engineering Research Council of Canada, Agriculture

and Agri-Food Canada, Novalait, The Dairy Farmers

of Canada and by the Fond pour les Chercheurs et

l’Avancement de la Recherche from the province of

Quebec. The authors also thank Genevieve Imbeault

and Annie Rate for their helpful technical assistance

during bacteriocin production screening procedures

and identification and characterization of Carnobac-

terium divergens M35.

References

Abee, T., 1995. Pore-forming bacteriocins of Gram-positive bacte-

ria and self-protection mechanisms of producer organisms.

FEMS Microbiology Letters 129, 1–10.

Barakat, R.K., Griffiths, M.W., Harris, L.J., 2000. Isolation and

characterization of Carnobacterium, Lactococcus, and Entero-

coccus spp. from cooked, modified atmosphere packaged, refrig-

erated, poultry meat. International Journal of Food Microbiology

62, 83–94.

Bhugaloo-Vial, P., Dousset, X., Metivier, A., Sorokine, O., Anglade,

P., Boyaval, P., Marion, D., 1996. Purification and amino acid

sequences of piscicocins V1a and V1b, two class IIa bacteriocins

secreted by Carnobacterium piscicola V1 that display signifi-

cantly different levels of specific inhibitory activity. Applied

and Environmental Microbiology 62, 4410–4416.

Bhugaloo-Vial, P., Grajek, W., Dousset, X., Boyaval, P., 1997.

Continuous bacteriocin production with high cell density bio-

reactors. Enzyme and Microbial Technology 21, 450–457.

Bhunia, A.K., Johnson, M.C., Ray, B., 1988. Purification, charac-

terization and antimicrobial spectrum of a bacteriocin produced

by Pediococcus acidilactici. Journal of Applied Bacteriology

65, 261–268.

Biet, F., Berjeaud, J.M., Worobo, R.W., Cenatiempo, Y., Fremeaux,

C., 1998. Heterologous expression of the expression of the

bacteriocin mesentericin Y105 using the dedicated transport


system and the general secretion pathway. Microbiology 144,

2845–2854.

Bousfield, I.J., Keddie, R.M., Dando, T.R., Shaw, S., 1985. Simple

rapid method of cell wall analysis as an aid in the identification

of aerobic coryneform bacteria. In: Goodfellow, M., Minnikin,

D.E. (Eds.), Chemical Methods in Bacterial Systematics. Aca-

demic Press, London, England, pp. 221–236.

Brooks, J.L., Moore, A.S., Patchett, R.A., Collins, M.D., Kroll,

R.G., 1992. Use of polymerase chain reaction and oligonucleo-

tide probes for the rapid detection and identification of Carno-

bacterium species from meat. Journal of Applied Bacteriology

72, 294–301.

Buchanan, R.L., Bagi, L.K., 1997. Microbial competition: effect of

culture conditions on the suppression of Listeria monocytogenes

Scott A by Carnobacterium piscicola. Journal of Food Protec-

tion 60, 254–261.

Carolissen-Mackay, V., Arendse, G., Hastings, J.W., 1997. Purifi-

cation of bacteriocins of lactic acid bacteria: problems and

pointers. International Journal of Food Microbiology 34, 1–16.

Cintas, L.M., Casaus, P., Havarstein, L.S., Hernandez, P.E., Nes,

I.F., 1997. Biochemical and genetic characterization of enterocin

P, a novel sec-dependent bacteriocin from Enterococcus faecium

P13 with a broad antimicrobial spectrum. Applied and Environ-

mental Microbiology 63, 4321–4330.

Collins, M.D., Farrow, J.A., Philips, B.A., Ferusu, S., Jones, D.,

1987. Classification of Lactobacillus divergens, Lactobacillus

piscicola, and some catalase-negative, asporogenous, rod-

shaped bacteria from poultry in a new genus, Carnobacte-

rium. International Journal of Systematic Bacteriology 37,

310–316.

De Bruyn, I.N., Abraham, A.I., Visser, L., Holzapfel, W.H, 1987.

Lactobacillus divergens is a homofermentative organism. Sys-

tematic and Applied Microbiology 9, 173–175.

De Man, J.C., Rogosa, M., Sharpe, E., 1960. A medium for the

cultivation of Lactobacilli. Journal of Applied Bacteriology 23,

130–135.

De Vuyst, L., Callewaert, R., Crabbe, K., 1996. Primary metabolites

kinetics of bacteriocin biosynthesis by Lactobacillus amylovo-

rus and evidence for stimulation of bacteriocin production under

unfavorable growth conditions. Microbiology 142, 817–827.

Dicks, L.M., van Vuuren, J.J., 1987. A modification of the hot-tube

method for the detection of carbon dioxide produced by hetero-

fermentative Lactobacillus strains. Journal of Microbiological

Methods 6, 273–275.

Duffes, F., Corre, C., Leroi, F., Dousset, X., Boyaval, P., 1999a.

Inhibition of Listeria monocytogenes by in situ produced and

semi-purified bacteriocins of Carnobacterium spp. on vacuum

packed, refrigerated cold smoked salmon. Journal of Food Pro-

tection 62, 1394–1403.

Duffes, F., Leroi, F., Boyaval, P., Dousset, X., 1999b. Inhibition of

Listeria monocytogenes by Carnobacterium ssp. strains in a

simulated cold smoked fish system stored at 4 jC. InternationalJournal of Food Microbiology 47, 33–42.

Eijsink, V.G., Skeie, M., Middelhoven, P.H., Brurberg, M.B., Nes,

I.F., 1998. Comparative studies of class IIa bacteriocins of lactic

acid bacteria. Applied and Environmental Microbiology 64,

3275–3281.

Ennahar, S., Sashihara, T., Sonomoto, K., Ishizaki, A., 2000. Class

IIa bacteriocins: biosynthesis, structure and activity. FEMS Mi-

crobiology Reviews 24, 85–106.

Farber, J.M., Peterkin, P.I., 1991. Listeria monocytogenes, a food-

borne pathogen. Microbiology Review 55, 476–511.

Food and Drug Administration, 2001. Processing parameters

needed to control pathogens in cold smoked fish. Report of

the Institute of Food Technologists for the Food and Drug

Administration of the U.S. Department of Health and Human

Services.

Gahan, C.G., Collins, J.K., 1991. Listeriosis: biology and implication

for the food industry. Trends in Food Science and Technology 2,

89–93.

Gaussier, H., Morency, H., Lavoie, M., Subirade, M., 2002. Re-

placement of trifluoroacetic acid with HCl in the hydrophobic

purification steps of pediocin PA-1: a structural effect. Applied

and Environmental Microbiology 68, 4803–4808.

Gill, C.O., Reichel, M.P., 1989. Growth of the cold-tolerant patho-

gens Yersinia enterocolitica, Aeromonas hydrophila and Listeria

monocytogenes on high pH-beef packaged under vacuum or

carbon dioxide. Journal of Food Microbiology 6, 223–230.

Grajek, W., Bobowicz-Lassocinda, T., Sip, A., 1996. Production of

bacteriocin by Carnobacterium divergens grown in culture me-

dia containing hydrolysates of whey, casein and malt roots.

Polish Journal of Food and Nutrition Science 5/46, 75–84.

Guyonnet, D., Fremeaux, C., Cenatiempo, Y., Berjeaud, J.M.,

2000. Method for rapid purification of class IIa bacteriocins

and comparison of their activities. Applied and Environmental

Microbiology 66, 1744–1748.

Herbin, S., Mathieu, F., Brule, F., Brablant, C., Lefebvre, G., Lebrihi,

A., 1997. Characteristics and genetic determinants of bacteriocin

activities produced by Carnobacterium piscicola CP5 isolated

from cheese. Current Microbiology 35, 319–326.

Himelbloom, B., Nilsson, L., Gram, L., 2001. Factors affecting

production of an antilisterial bacteriocin by Carnobacterium

piscicola A9b in laboratory media and model fish systems.

Journal of Applied Microbiology 91, 506–513.

Holck, A., Axelsson, L., Schillinger, U., 1996. Divergicin 750, a

novel bacteriocin produced by Carnobacterium divergens 750.

FEMS Microbiology Letters 136, 163–168.

Jack, R.W.,Wan, J., Gordon, J., Harmark, K., Davidson, B.E., Hillier,

R.E., Wettenhall, R.E., Hickey, M.W., Coventry, J.M., 1996.

Characterization of the chemical and antimicrobial properties of

pisicolin 126, a bacteriocin produced by Carnobacterium pisci-

cola JG126. Applied and Environmental Microbiology 62,

2897–2903.

Klaenhammer, T.R., 1993. Genetics of bacteriocins produced by

lactic acid bacteria. FEMS Microbiology Reviews 12, 39–85.

Le Marrec, C., Hyronimus, B., Bressollier, P., Verneuil, B., Urdaci,

M.C., 2000. Biochemical and genetic characterization of coagu-

lin, a new antilisterial bacteriocin in the pediocin family of

bacteriocins, produced by Bacillus coagulans I4. Applied and

Environmental Microbiology 66, 5213–5220.

Leroi, F., Joffraud, J.J., Chevalier, F., Cardinal, M., 1998. Study of

the microbial ecology of cold-smoked salmon during storage at

8 jC. International Journal of Food Microbiology 39, 111–121.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951.


Protein measurement with the Folin phenol reagent. Journal of

Biological Chemistry 193, 265–275.

Mathieu, F., Michel, M., Lefebvre, G., 1993. Properties of a

bacteriocin produced by Carnobacterium piscicola CP5. Bio-

technology Letters 15, 585–590.

Mauguin, S., Novel, G., 1994. Characterization of lactic acid bac-

teria isolated from seafood. Journal of Applied Bacteriology 76,

616–625.

Meghrous, J., Lacroix, C., Bouksaim, M., Lapointe, G., Simard, R.,

1997. Genetic and biochemical characterization of nisin Z pro-

duced by Lactococcus lactis subsp. lactis biovar. diacetylactis

UL719. Journal of Applied Microbiology 83, 133–138.

Metivier, A., Pilet, M.F., Dousset, X., Sorokine, O., Anglade, P.,

Zagorec, M., Piard, J.C., Marion, D., Cenatiempo, Y., Fre-

maux, C., 1998. Divercin V41, a new bacteriocin with two

disulphide bonds produced by Carnobacterium divergens

V41: primary structure and genomic organization. Microbiolo-

gy 144, 2837–2844.

Miller, K.W., Schamber, R., Osmanagaoglu, O., Ray, B., 1998.

Isolation and characterization of pediocin AcH chimeric protein

mutants with altered bactericidal activity. Applied and Environ-

mental Microbiology 64, 1997–2005.

Montel, M.C., Talon, R., Fournaud, J., Champomier, M.C., 1991. A

simplified key for identifying homofermentative Lactobacillus

and Carnobacterium spp. from meat. Journal of Applied Bac-

teriology 70, 469–472.

Nilsson, L., Nielsen, M.K., Ng, Y., Gram, L., 2002. Role of acetate

in production of an autoinducible class IIa bacteriocin in Car-

nobacterium piscicola A9b. Applied and Environmental Micro-

biology 68, 2251–2260.

Nissen, H., Holck, A., Dainty, R.H., 1994. Identification of Car-

nobacterium spp. and Leuconostoc spp. in meat by genus-spe-

cific 16S rRNA probes. Letters in Applied Microbiology 19,

165–168.

O’Sullivan, L., Ross, R.P., Hill, C., 2002. Potential of bacteriocin-

producing lactic acid bacteria for improvements in food safety

and quality. Biochimie 84, 593–604.

Paludan-Muller, C., Dalgaard, P., Huss, H.H., Gram, L., 1998. Eval-

uation of the role of Carnobacterium piscicola in spoilage of

vacuum- and modified-atmosphere-packed cold-smoked salmon

stored at 5 jC. International Journal of Food Microbiology 39,

155–166.

Pilet, M.F, Dousset, X., Barre, R., Novel, G., Desmazeaud, M.,

Piard, J.C., 1995. Evidence for two bacteriocins produced by

Carnobacterium piscicola and Carnobacterium divergens iso-

lated from fish and active against Listeria monocytogenes. Jour-

nal of Food Protection 58, 256–262.

Quadri, L.E., Sailer, M., Roy, K.L., Vederas, J.C., Stiles, M.E.,

1994. Chemical and genetic characterization of bacteriocins pro-

duced by Carnobacterium piscicola LV17B. The Journal of

Biological Chemistry 269, 12204–12211.

Ray, B., Daeschel, M., 1992. In: Ray, B., Daeschel, M. (Eds.), Food

Biopreservatives of Microbial Origin. CRC Press, Corporate

Blvd, N.W., Boca Raton, Florida, pp. 103–207.

Ringø, E., Gatesoupe, F.J., 1998. Lactic acid bacteria in fish: a

review. Aquaculture 160, 177–203.

Rørvik, L.M., 2000. Listeria monocytogenes in the smoked

salmon industry. International Journal of Food Microbiology

62, 183–190.

Scarpellini, M., Mora, D., Colombo, S., Franzetti, L., 2002.

Development of genus/species PCR analysis for identification

of Carnobacterium strains. Current Microbiology 45, 24–29.

Schillinger, U., Stiles, M.E., Holzapfel, W.H., 1993. Bacteriocin

production by Carnobacterium piscicola LV 61. International

Journal of Food Microbiology 20, 131–147.

Sip, A., Grajek, W., 2001. Influence of alcohols and detergents on

divercin aggregation. Zywnosc 8, 5–14.

Stiles, M.E., 1996. Biopreservation by lactic acid bacteria. Antonie

Van Leeuwenhoek 70, 331–345.

Stoffels, G., Nes, I.F., Gudmundsdottir, A., 1992. Isolation and prop-

erties of a bacteriocin-producing Carnobacterium piscicola iso-

lated from fish. Journal of Applied Bacteriology 73, 309–316.

Stohr, V., Joffraud, J.J., Cardinal, M., Leroi, F., 2001. Spoilage

potential and sensory profile associated with bacteria isolated

from cold-smoked salmon. Food Research International 34,

797–806.

Tagg, J.R., Adnan, A.S., Wanna-Maker, L.W., 1976. Bacteriocins of

Gram-positive bacteria. Bacteriology Review 40, 722–756.

Worobo, R.W., Belkum, J.V., Sailer, M., Roy, K., Vederas, J.C.,

Stiles, M.E., 1995. A signal peptide secretion-dependent bacte-

riocin from Carnobacterium divergens. Journal of Bacteriology

177, 3143–3149.

Yost, C.K., Nattress, F.M., 2000. The use of multiplex PCR reac-

tions to characterize populations of lactic acid bacteria associ-

ated with meat spoilage. Letters in Applied Microbiology 31,

129–133.

Purification, characterization and amino acid sequencing of divergicin M35: a novel class IIa bacteriocin produced by Carnobacterium divergens M35

Documents