-
Research ArticlePurification and Characterization of Glutathione
BindingProtein GsiB from Escherichia coli
ZhongshanWang ,1 Xiaokun Xia,2 Meixian Zhang,3 Jiawei Fang,3
Yanqiang Li,1 andMeng Zhang 2
1 Jiangsu Province Key Laboratory of Anesthesiology, Xuzhou
Medical University, Xuzhou, China2Department of Gynecology, Central
Hospital of Xuzhou, Affiliated Hospital of Southeast University,
Xuzhou, China3Xuzhou Medical University, China
Correspondence should be addressed to Zhongshan Wang;
[email protected] and Meng Zhang; [email protected]
Received 28 July 2018; Revised 15 October 2018; Accepted 22
October 2018; Published 1 November 2018
Academic Editor: Ernesto S. Nakayasu
Copyright © 2018 Zhongshan Wang et al. This is an open access
article distributed under the Creative Commons AttributionLicense,
which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properlycited.
Objectives. Topurify and characterize the glutathione binding
proteinGsiB of glutathione importer (GSI) in Escherichia coli (E.
coli).Results.The coding sequence of GsiB was cloned from E.
coliMG1655 and expressed in BL21(DE3). GsiB protein was expressed
andpurified to homogeneity using Ni-affinity and gel filtration
chromatography. SDS-PAGE of purified GsiB showed a single
proteinband of molecular mass 56 kDa, while native gel showed two
bands around 56 kDa and 110 kDa. Gene knockout showed that GsiBwas
essential for GSI mediated glutathione import. Interactions of
GsiA, B, C, and D were determined using bacterial two-hybridmethod.
Without glutathione, GsiB showed no direct interaction with the
other three proteins. However, GsiB could interact withGsiC and
GsiD when using glutathione as sole sulfur source. Conclusions.
GsiB functions in E. coli was characterized which couldhelp
elucidate the glutathione import mechanism in gram-negative
bacteria.
1. Introduction
Glutathione (𝛾-L-glutamyl-L-cysteinyl-glycine; GSH) is themost
important endogenous antioxidant across all kingdomsof life. GSH is
a tripeptide consisting of glutamate, cysteine,and glycine amino
acids. GSH is distributed ubiquitouslyand usually attains mM
concentrations in human body.It plays an important role in
maintaining the intracellularredox homeostasis [1], as well as in
the detoxification ofxenobiotics and their metabolites [2, 3]. GSH
also functionsin salvage of cysteine [4] and cell signaling [5, 6].
In cell,glutathione manifests predominantly in thiol-reduced
form(GSH) [7]. A small quantity of glutathione is in oxidationform,
such as glutathione disulfide (GSSG) or disulfideswith target
proteins [8]. The intracellular GSH homeostasiscan be maintained by
different pathways, including de-novosynthesis, GSH redox cycling,
and direct uptake [9]. GSHimport by bacteria may serve as organic
sulfur resource [10–12]. However, the mechanisms that underpin
glutathioneuptake still need further investigation.
The specific glutathione importer (GSI) in bacteria
wasidentified in 2005 [10]. This importer consists of GsiA, -B, -C,
and-D, which encodes ATP binding protein, glutathionebinding
protein, and two inner-membrane components [13].The specific
glutathione recognition is mediated by GsiB andimport is ATP
dependent [10, 14].
Herein, the spectrum of expression, purification
andcharacterization of GsiB from E. coli was described. Thein vitro
and in vivo functions of GisB were investigated.Studies of GsiB
will help to clarify the mechanism of specificglutathione import in
bacteria.
2. Materials and Methods
2.1. Strains, Plasmids and Chemicals. The E. coli strainsMG1655,
BL21 (DE3), DH5𝛼, and plasmid plou3 werepreserved in our
laboratory. Vectors pET11a-link-NGFP,pMRBAD-link-CGFP, pN-Z, and
pC-Z were gifts presentedby Professor Lynne Regan of Yale
University. Pfu polymeraseand T4 DNA ligase and restriction enzymes
were purchased
HindawiBioMed Research InternationalVolume 2018, Article ID
3429569, 7 pageshttps://doi.org/10.1155/2018/3429569
http://orcid.org/0000-0002-1321-3916http://orcid.org/0000-0002-5824-9701https://creativecommons.org/licenses/by/4.0/https://creativecommons.org/licenses/by/4.0/https://doi.org/10.1155/2018/3429569
-
2 BioMed Research International
Table 1: Primers for gene expression, protein interaction and
gene deletion.
Primer Sequence 5‘ - 3’GsiB-F CATG CC ATGG
CAAGAGCTGTACACCGTAGGsiB-R CCC AAGCTT ATTGCAAATCCGCGTCTTCN-GsiA-F
CCATCTCGAGGCCACACAGTGATGAACTTGATGN-GsiA-R CGTCGGATCC
TTATCTACGCATGAATGCGTATTCTN-GsiB-F
CCATCTCGAGGGCAAGAGCTGTACACCGTAGTGN-GsiB-R CCATCTCGAG
TTATTGCAAATCCGCGTCTTCN-GsiC-F
CCATCTCGAGGCTTAATTACGTTATCAAACGCTTAN-GsiC-R CGTCGGATCC
TTACTTGTACCTGATAGCCGGGTTAC-GsiA-F CATG CCATGG
TGCCACACAGTGATGAACTTGATGC-GsiA-R CATGGACGTC CC
TCTACGCATGAATGCGTATTCTGC-GsiB-F CATG CCATGG
CAAGAGCTGTACACCGTAGTGC-GsiB-R CATGGACGTC CC
TTGCAAATCCGCGTCTTCAAAGC-GsiC-F CATG CCATGG
TGCTTAATTACGTTATCAAACGCTC-GsiC-R CATGGACGTC CC
CTTGTACCTGATAGCCGGGTTAC-GsiD-F CATG CCATGG TG
CGACTATTTAACTGGCGACGC-GsiD-R CATG CCATGG CC
TCCTTTAATTTTCGGATCCAGC
GsiB-Del-F
GCATTACGTCGCACAACCACAATCAGAATACGCATTCATGCGTAGATAACATTCAGGCGTGTAGGCTGGAGCTGCTTC
GsiB-Del-R
AACAGCGTCGGAATCAACCCCAGTAAGCGTTTGATAACGTAATTAAGCATTCCACTCCCATATGAATATCCTCCTTAG
GGT-Del-F
CGATGATTAATTCAGAGTTATATACCAGGCTTAGCTGGGGTTGCCCCTTAATCTCTGGAGGTGTAGGCTGGAGCTGCTTC
GGT-Del-R
AGGCTACCTTCGGCTTGCCCTGACAAAATAGCCCTCTTCCCACGAAGAGGGCCGCTAACCCATATGAATATCCTCCTTAGDel-F
GTGTAGGCTGGAGCTGCTTCGsiB-Del-R ACACCAGCACCGAGACGAGGT-Del-R
GAACGGCAAAACCGCTGGAGsiB-6His-R CCC AAGCTT
ACATCACCATCACCATCACTTGCAAATCCGCGTCTTCA
from NEB. Other chemicals were purchased from SangonBiotech.
2.2. Heterologous Expression of GisB Protein. GsiB gene
(ac-cession number: HM217135) was amplified from genomicDNA of E.
coli MG1655 using primers GsiB-F and GsiB-R (Table 1). The gene was
cloned into expression plasmidplou3 and transformed into BL21
(DE3). MBP (Maltosebinding protein) was used as fusion prtoein.
BL21 (DE3) wasgrown in Luria-Bertani (LB) medium (containing
ampicillin100 𝜇g/ml) at 37∘C till OD
600reach about 0.5-0.6. Protein
expressionwas induced by adding 0.1mM IPTG and grown at22∘C for
20 h. Cells were harvested by centrifugation at 5000g for 15 min at
4∘C.
2.3. Purification of GsiB Protein. The cell pellet was
resus-pended in 50mM Tris/HCl buffer (pH 7.5) containing 100mM
NaCl, 1 mM phenylmethanesulfonyl fluoride (PMSF),1 𝜇M lysozyme
lysozyme, and 1 𝜇M DNaseI. The cell wasdisrupted by using
homogenizer FB-110X (LiTu, China) with800 MPa. The sample was
centrifuged at 8,000 g for 15 minand supernatant was loaded onto
Ni2+ affinity column (GEHealthcare). The protein was washed with 50
mM Tris/HCl
pH 7.5, 300 mM NaCl, and 30 mM imidazole. GsiB-MBPwas eluted
with 50 mM Tris/HCl pH 7.5, 300 mM NaCl, and300mM imidazole.
Imidazole was removed by desalting. Theprotein was then digested
with TEV protease and MBP wasremoved by MBP column. GsiB was
further purified usingSuperdex 200 column (GE Healthcare) (buffer
contains 50mM Tris/HCl pH 7.5, 300 mMNaCl, and 5 % (v/v)
glycerol).The purity of GisB was determined by SDS-PAGE. Nativegel
was performed to analyze protein conformations. Theprotein was
concentrated to 5 mg/ml, which was measuredby Nanodrop 2000 (Thermo
Scientific).
2.4. Western Blot Analysis. Westerrn blot was carried outwith
anti-6×His monoclonal antibody (Abcam, anti-His, 400𝜇g/ml, 1:1000
(v/v)) [15] and horseradish peroxidase labeledantibody (Abcam, goat
antimouse, 0.8 mg/ml, 1:5000 (v/v)).
2.5. GsiB Interacts with Other Components. GFP
fragmentsreassembly protocol was used to determine interaction
ofGsiB with other GSI components [16, 17]. GsiA, GsiB,GsiC, and
GsiD were cloned into pMRBAD-link-CGFP andpET11a-link-NGFP (With
primers in Table 1). Any tworecombinant plasmids carrying N- and
C-fragment of GFP
-
BioMed Research International 3
were simultaneously transformed into BL21(DE3) with 10
ngofDNA.The recombinant cellswere plated onto selective agarmedium,
containing kanamycin (35 𝜇g/ml) and ampicillin(100𝜇g/ml). Single
colonies were selected and incubated withappropriate antibiotic.
Fresh overnight culture was diluted(1:1000 (v/v)) and 100 𝜇l medium
was plated onto screeningmedium, containing 0.2% arabinose and 10
𝜇M IPTG. Theplates were incubated at 20∘C for 2 days to induce
proteinexpression and interacion.
The M9 medium plate [18] was also made with MgSO4
replaced by MgCl2. Reduced glutathione (1 mM, ≥98%) was
added as only sulfur source to characterize the interaction.
2.6. Characterization of Glutathione Binding Activity of
GsiB.The glutathione binding activity of GsiB was determined
bynative gel. Purified GsiB was incubated with 5 mM GSH orGSSG and
separated on 12% Native-PAGE. The native gelelectrophoresis was
performed basing on theoretical pI 8.22of GsiB.The protein samples
incubated with glutathione werealso analyzed by 12% SDS-PAGE.
2.7. GsiB In-Vivo Function Assay. It was supposed that
gram-negative bacteria uptake glutathione mainly through
𝛾-glutamyltranspeptidase (GGT) pathway or GSI complex [10].The GsiB
and ggt gene of E. coli MG1655 were deleted with𝜆Red recombination
system [19, 20].The kanamycin resistantDNAwas amplified from pKD4
with primers GsiB del-F andGsiB del-R (Table 1). The PCR product
had 58 bp upstreamand 58 bp downstream homologous to adjacent
sequence ofGsiB, which was digested with DpnI and gel-purified.
pKD46was transformed into E. coli MG1655 by CaCl
2method. The
cell with pKD46 was grown in SOB medium at 30∘C toan OD
600of around 0.5. 2 mM L-arabinose was added 1 h
before cell collection. Competent cell was made by washingwith
10% glycerol. 50 ng of PCR product was mixed with 50𝜇l of competent
cell. Electroporation was performed usingMicroPulser (Bio-Rad) with
a 0.1 cm chamber.
ggt gene was deleted as above. The chloramphenicolfragment was
amplified with 60 bp upstream and 60 bpdownstream homologous to
adjacent regions of ggt (primerGGT del-F and GGT del-R) (Table 1).
GsiB and ggt genedeletion was verified by PCR with primers Del-F
and GsiB-Del-R or GGT-Del-R (Table 1).
The cell growth and glutathione uptake curves of mutantstrains
were measured. M9 minimal medium [18] was usedwith MgSO
4replaced by MgCl
2. Glutathione (1 mM, ≥98%)
was served as the only sulfur source. GsiB was cloned intopBAD24
(primers GsiB-F and GsiB-R) and transformed intomutant strains to
compensate for gene defection.
3. Results
3.1. Expression and Purification of GsiB. The GsiB gene
wasamplified from E. coli MG1655 genome and cloned into plou3vector
which was derived from pMAL-c2X. A 6×His tag anda TEV protease
cleavage site were added before and behindMBP to facilitate protein
purification. The resultant plasmidwas denominated plou3-gsiB
(Figure 1(a)). The insertion ofGsiB gene was confirmed by DNA
sequencing.
GsiB was expressed in BL21(DE3) and expression condi-tion was
optimized. Induction with 0.1 mM IPTG at 22∘C for20 h will give
high productivity of soluble GsiB (Figure 1(b)).GsiB-MBP fusion
protein was firstly purified by Ni2+ columnand then digested with
TEV protease.TheMBPwas removedby Ni2+ and MBP column. The protein
was further purifiedby gel filtration. 12% SDS-PAGE analysis showed
that themolecular mass of GsiB was about 56 kDa with purity
inexcess of 90% (Figure 1(c)). The protein was concentratedto 5
mg/ml and used for glutathione binding activity assay.Approximately
0.8 mg of GsiB protein was obtained from perliter of LB medium.
Western blot confirmed the expression of GisB. As therewas a
6×His tag at the N terminal of GsiB-MBP, anti-6×Hisantibody was
used here (Figure 1(d)).
3.2. Characterization of Glutathione Binding Activity of
GsiB.Thepurified GsiB was shown to have two different
conforma-tions in native gel. GsiB proteinmight be present
asmonomerand dimer (Figure 2(a)). GsiB protein was incubated
withreduced (GSH, ≥98%) and oxidized (GSSG, ≥98%) glu-tathione at
25∘C for 2 h. However, after incubation with GSHor GSSG, there was
no protein band that could be detected innative gel (Figure
2(a)).This phenomenonmight be explainedby GsiB conformational
change, caused by binding GSH orGSSG. To confirm if the protein was
degraded in Figure 2(a),SDS-PAGE was performed. The result showed
that GsiBprotein was not degraded (Figure 2(b)). The
conformationalchangemight confer change of surface charge ofGsiB
protein.As reversing of cathode and anode position showed
proteinband in native gel (data not shown). However, the
proteinband run very slow in the gel. This might because of
weaksurface charge.
Incubation at 25∘C would promote GsiB to form anotherband with
molecular weight of about 110 kDa in SDS-PAGE(Figure 2(b)). In the
meantime, binding GSH or GSSG wouldobviously reduce the top band
ratio (Figure 2(b)). The topband might be dimer of GsiB, which was
not separated bydenature at 95∘C for 3 min. To verify this
conjecture, a 6×Histag was added at the C terminal of GsiB (primer
GsiB-F and GsiB-6His-R) (Table 1). Using anti-6×His
antibody,western blot showed both the two bands were GsiB
protein(Figure 2(c)).
The results indicated that GsiB could bind both GSH andGSSG.
Binding with substrate would induce conformationalchange of
GsiB.
3.3. Protein Interaction of GsiB with Other
Components.Interaction of GsiB with other components of GSI was
de-termined. pET11a-link-NGFP carrying GsiA, GsiB, GsiC,and
pMRBAD-link-CGFP carrying GsiA, GsiB, GsiC, andGsiD were pairwise
and simultaneously transformed intoBL21(DE3). 10 𝜇M IPTG and 0.2%
arabinose were added forinducing protein expression, which made GFP
reassemblypossible. The reassembled GFP would show fluorescent
in-vivo, especially under UV light (Figure 3).
The results showed that GsiB could not interact withthe other
three proteins on LB plate. Without bindingglutathione, GsiB might
present in inactive conformation.
-
4 BioMed Research International
M 1
5000 4000 3000
2000
1000
6000 7000
bp
(a)
M 21
97
66
44
kDa
29
(b)
M 197
66
44
kDa
(c)
1 32
135
100
75
kDa
(d)
Figure 1: Expression and purification of GsiB from E.coli. (a)
Recombinant plasmid digestion with restriction enzymes. M: Marker;
Lane 1:plasmid digested with NcoI andHindIII. (b) SDS-PAGE analysis
of GsiB expression. M: Marker; Lanes 1-2: total protein and soluble
fractionof GsiB induced with 0.1 mM IPTG at 22∘C for 20 h. (c)
Purity analysis of GsiB. The protein was separated on 12 % (v/v)
SDS-PAGE andanalyzed with QuantiyOne software. M: Marker; Lane 1:
purified GsiB protein; (d) Western blot analysis. Lanes 1-2: total
protein and solublefraction of GsiB in BL21 (DE3) grown at 22∘C for
20 h induced with 0.1 mM IPTG; Lane 3: total protein of GsiB in
BL21 (DE3) grown at 22∘Cfor 20 h without IPTG.
321MkDa158
75
43
(a)
1 8765M432kDa
97 66 44
29
(b)
1 2kDa135
100 75
(c)
Figure 2: Native gel and SDS-PAGE analysis of GsiB binding
activity with GSH and GSSG. (a) Native gel analysis of GsiB protein
with GSHand GSSG. M: Marker; Lane 1: purified GsiB protein; Lane 2:
GsiB incubated with GSH; Lane 3: GsiB incubated with GSSG. (b)
SDS-PAGEanalysis of GsiB protein with GSH and GSSG. M: Marker;
Lanes 1-4: GsiB protein incubated at 25∘C for 2 h; Lane 5-7: same
protein aliquotsas Lanes 1-4 incubated with GSH (Lanes 5-6) and
GSSG (Lane 7-8). Lanes 1, 3, 5, and 7 were GsiB stored in -80∘C for
6 months. Lanes 2, 4, 6,and 8 were freshly purified GsiB. (c)
Western blot analysis of purified GsiB. Lane 1: purified GsiB
protein; Lane 2: GsiB protein with GSH.
-
BioMed Research International 5
Figure 3: In vivo analysis of GsiB interaction with other
proteinsof GSI. The GSI genes in pET11a-link-NGFP and
pMRBAD-link-CGFP vectors were refered to as pN- and pC-. pN-Z and
pC-Zwere positive control plasmids.The protein interactionwas
analyzedunder UV light. Numbers 1 to 7 were transformants
harboring:pN-Z and pC-Z, pN-gsiB and pC-gsiC, pN-gsiB and pC-gsiD,
pN-gsiA and pC-gsiC, pN-gsiA and pC-gsiD, pN-gsiC and pC-gsiD,and
pN-gsiC and pC-gsiA on LB plate. To characterize functionof
glutathione in protein interaction, M9 medium plate was usedwith
GSH as sole sulfur source. Number 8 to 11 were
transformantsharboring: pN-Z and pC-Z, pN-gsiB and pC-gsiC, pN-gsiB
and pC-gsiD, and pN-gsiB and pC-A.
It was speculated that glutathione binding might
promoteconformational change, which would facilitate GsiB to
inter-act with other components. To verify this hypothesis,
M9medium plate with glutathione as sole sulfur source wasmade and
the interaction was characterized. As shown inFigure 3, GsiB could
interact with transmembrane pro-teins GsiC and GsiD. However, GsiB
showed no interac-tion with GsiA. It might be associated with their
differ-ent cell locations. GsiA and GsiB were predicted to
belocated in the cytoplasm and periplasm of cell,
respectively[13].
3.4. GsiB Was Essential for GSI Mediated Glutathione Import.The
GsiB and ggt gene in E. coli were replaced by kanamycinand
Chloramphenicol resistant gene. The gene deletionstrains were named
GsiB, ggt, and GsiBggt. The dele-tion was verified by PCR.
The cell growth and glutathione uptake curves weremeasured,
using M9 medium with glutathione as sole sulfursource. The results
suggested that GsiBggt strain grewmuch slower in glutathione
containing M9 medium than inLB medium. The slow growth rate could
be somewhat com-pensated by transformation of pBAD24-gsiB (Figure
4(a)).GsiB grew faster than GsiBggt with or without pBAD24-gsiB.ggt
could uptake glutathione at a lower rate than
wild type and GsiB. However, the glutathione import inGsiBggt
strain was undetectable (Figure 4(b)). The resultsdepicted that GGT
pathway was more effective, which mightmediate more glutathione
uptake than GSI. As GsiB genedeletion could block GSI mediated
glutathione uptake, which
was compensated by pBAD24-gsiB (Figure 4(b)). GsiB wasessential
for GSI mediated glutathione uptake.
4. Discussion
Glutathione is the most abundant small molecular weightthiol
containing antioxidant in living cells and plays aplethora of
cellular roles. GsiB is the glutathione bindingprotein of GSI,
which specifies the transporter. Putting deepinsights into
functions of GsiB will help to elucidate themechanism of specific
glutathione import.
The Ni2+-NTA column could enrich His-tagged GsiB,comprising more
than 90% of total proteins. MBP was usedas fusion protein which can
assist protein folding. The MBPfusion can be removed by MBP column.
MBP used herepromoted solubility of GsiB. By using different tags
andpurification columns, the purification of proteins could
beefficient.
Lower inducing temperature and IPTG concentrationwould
contribute to soluble expression of GsiB. Inducedat 22∘C with 0.1
mM IPTG, GsiB was expressed mainlyin soluble fraction. Protein
expression was confirmed byWestern blot. High yield of pure GsiB
protein will contributeto future biophysical and biochemical
studies.
The freshly purified GsiB showed only one band in SDS-PAGE and
two bands in native gel. GsiB might be present asmonomer and dimer
here. However, after incubation at 25∘C,another protein band
appeared in SDS-PAGE. This bandmight be dimer of GsiB, as the
molecular weight was about110 kDa.This top protein band was stable,
whichwould not beseparated by denature at 95∘C. However, the top
band couldbe reduced by incubation with GSH or GSSG. As shown
bycrystal structure (PDB ID: 1UQW), the N-terminal fragmentwas
located at surface of GsiB. Although not included in thestructure,
Cys23 was speculated to locate at the surface offull length GsiB,
which might form disulfide bond betweenproteins. The band could be
disrupted by glutathione. Orthe binding of GSH or GSSG could block
Cys23 site, whichprobably affect disulfide bridge formation. In the
meantime,crystal structure of GsiB was shown to have A and B
chains.Chain A and B both contained a GsiB protein. The twochains
of GsiB protein had different structures, which was inconsistence
with two conformations in native gel.
GsiB didn’t interact with the other three proteins of GSIon LB
plate. However, GsiB could interact with the inner-membrane
proteins GsiC and GsiD when glutathione wasused as sole sulfur
source. It was speculated that GSI hadtwo state: ‘open’ and
‘close’. The state of GSI depends mainlyon GsiB protein
conformation. Without binding glutathione,GsiB would present in
‘inactive’ conformation and will notinteract with GsiC or GsiD. GSI
would be at ‘close’ state.Binding with glutathione would change
GsiB to ‘active’conformation, which facilitate GsiB to interact
with inner-membrane channel. GsiA could hydrolyze ATP to
supportglutathion import and GSI would ‘open’. The ‘open’ state
ofGSI required GsiB binding with glutathione and GsiA, B,C, D to
interact with each other. In summary, binding withGSHorGSSGwould
changeGsiB protein conformation from‘inactive’ to ‘active’. The
activated GsiB interacted with GsiC
-
6 BioMed Research International
3
2.5
2
1.5
1
0.5
0
OD
0 2 4 6 8 10 12
Time (h-)
ΔgsiBΔggt in LBΔgsiBΔgsiBΔggtΔgsiBΔggt; pBAD24-gsiBWild type
(a)
Δggt
Wild type
7
6
5
4
3
2
1
0
GSH
upt
ake (
pmol
/mg-
cell)
0 5 10 15 20 25 30 35
Time (min-)
ΔgsiBΔgsiBΔggtΔgsiBΔggt; pBAD24-gsiB
(b)
Figure 4: Effects of GsiB deletion on cell growth and
glutathione uptake. (a)GsiB and ggt gene deletion strains were
constructed.The growthcurves of mutant and wild type E. coli were
recorded. pBAD24-gsiB was transformed into ΔGsiBΔggt to compensate
for gene defection.(b) The effects of GsiB on glutathione import
was determineted by recording glutathione concentration change in
the medium, which wasmeasured by Glutathione Assay Kit (Sigma). The
glutathione uptake curves of mutant and wild type E. coli were
analyzed.
and GsiD and substrate was then transferred into inner-membrane
channel. The transportation of GSH and GSSGwas powered by GsiA
hydrolyzing ATP. After glutathioneimport, GsiB was released from
the complex and wait foranother transportation.
GisB was deleted in E. coli to determine the in-vivofunction.
The growth of GsiB was not affected when usingglutathione as sole
sulfur source. This is because the straincould uptake glutathione
from themedium by GGT pathway.Figure 4(b) showed that GGT pathway
could mediate muchmore glutathione import than GSI. Glutathione
imported byGGT was then hydrolyzed to glutamic acid and
cysteinyl-glycine [21]. Cysteinylglycine was cleaved into cysteine
andglycine by aminopeptidases A, B, and N and dipeptidaseD. So
glutathione could serve as sulfur source for GsiB tosurvive and
grow. However, the growth of GsiBggt wasaffected with glutathione
as sole sulfur source. As shownin Figure 4(b), the glutathione
uptake by GsiBggt strainwas undetectable. The glutathione import
was compensatedby transformation of pBAD24-gsiB. The results showed
thatGsiB was essential for GSI mediated glutathione import.
Collectively, the glutathione binding protein GsiB fromE. coli
was expressed and characterized. Investigation ofbiological
functions and protein interactions of GsiB wouldhelp to elucidate
the specific glutathione import mechanism.
Data Availability
The glutathione import related data used to support thefindings
of this study are included within the article. Theinformation of
plasmids used in this study is available fromthe corresponding
author upon request.
Conflicts of Interest
The authors declare that there are no conflicts of
interestregarding the publication of this paper.
Acknowledgments
This research is supported by the National Natural
ScienceFoundation of China (no. 81600969 and 81471124) andthe
Excellent Talents of Xuzhou Medical University (no.D2015007).
References
[1] S. Nishizawa, H. Araki, Y. Ishikawa et al., “Low tumor
glu-tathione level as a sensitivity marker for
glutamate-cysteineligase inhibitors,”Oncology Letters, vol. 15, no.
6, pp. 8735–8743,2018.
[2] V. V. Loi, M. Rossius, and H. Antelmann, “Redox regulationby
reversible protein S-thiolation in bacteria,” Frontiers
inMicrobiology, vol. 6, 2015.
[3] H. Z. Chae, H. Oubrahim, J. W. Park, S. G. Rhee, and P.
B.Chock, “Protein glutathionylation in the regulation of
perox-iredoxins: A family of thiol-specific peroxidases that
functionas antioxidants, molecular chaperones, and signal
modulators,”Antioxidants& Redox Signaling, vol. 16, no. 6, pp.
506–523, 2012.
[4] K. Alkhuder, K. L. Meibom, I. Dubail, M. Dupuis, and
A.Charbit, “Glutathione provides a source of cysteine essentialfor
intracellular multiplication of Francisella tularensis,”
PLoSPathogens, vol. 5, no. 1, Article ID e1000284, 2009.
[5] M. L. Reniere, A. T. Whiteley, K. L. Hamilton et al.,
“Glu-tathione activates virulence gene expression of an
intracellularpathogen,” Nature, vol. 517, no. 7533, pp. 170–173,
2015.
-
BioMed Research International 7
[6] C. Gaucher, A. Boudier, J. Bonetti, I. Clarot, P. Leroy,
andM. Parent, “Glutathione: Antioxidant Properties Dedicated
toNanotechnologies,” Antioxidants, vol. 7, no. 5, p. 62, 2018.
[7] B. Vergauwen, J. Elegheert, A. Dansercoer, B. Devreese, and
S.N. Savvides, “Glutathione import in Haemophilus influenzaeRd is
primed by the periplasmic heme-binding protein HbpA,”Proceedings of
the National Acadamy of Sciences of the UnitedStates of America,
vol. 107, no. 30, pp. 13270–13275, 2010.
[8] I. Dalle-Donne, R. Rossi, G. Colombo, D. Giustarini, and
A.Milzani, “Protein S-glutathionylation: a regulatory device
frombacteria to humans,” Trends in Biochemical Sciences, vol. 34,
no.2, pp. 85–96, 2009.
[9] A. K. Bachhawat and A. Kaur, “Glutathione
Degradation,”Antioxidants & Redox Signaling, vol. 27, no. 15,
pp. 1200–1216,2017.
[10] H. Suzuki, T. Koyanagi, S. Izuka, A. Onishi, and H.
Kumagai,“The yliA, -B, -C, and -D genes of Escherichia coli K-12
encodea novel glutathione importer with an ATP-binding
cassette,”Journal of Bacteriology, vol. 187, no. 17, pp. 5861–5867,
2005.
[11] C. M. Grant, F. H. MacIver, and I. W. Dawes, “Glutathione
is anessential metabolite required for resistance to oxidative
stress inthe yeast Saccharomyces cerevisiae,” Current Genetics,
vol. 29,no. 6, pp. 511–515, 1996.
[12] B. Vergauwen, F. Pauwels, M. Vaneechoutte, and J. J. Van
Beeu-men, “Exogenous glutathione completes the defense
againstoxidative stress in Haemophilus influenzae,” Journal of
Bacte-riology, vol. 185, no. 5, pp. 1572–1581, 2003.
[13] I. M. Keseler, C. Bonavides-Mart́ınez, J. Collado-Vides et
al.,“EcoCyc: a comprehensive view of Escherichia coli
biology,”Nucleic Acids Research, vol. 37, no. 1, pp. D464–D470,
2009.
[14] Z. Wang, M. Zhang, X. Shi, and Q. Xiang, “Purification
andCharacterization of an ATPase GsiA from Salmonella
enterica,”BioMed Research International, vol. 2017, Article ID
3076091, 8pages, 2017.
[15] Z. Wang, G.Wang, Q. Xiang, Y. Zhang, and H. Wang,
“Identifi-cation and characterizationof amulti-domain
sulfurtransferasein Phanerochaete chrysosporium,” Biotechnology
Letters, vol.36, no. 5, pp. 993–999, 2014.
[16] T. J. Magliery, C. G. M. Wilson, W. Pan et al.,
“Detectingprotein-protein interactions with a green fluorescent
proteinfragment reassembly trap: scope andmechanism,” Journal of
theAmerican Chemical Society, vol. 127, no. 1, pp. 146–157,
2005.
[17] C. G. M. Wilson, T. J. Magliery, and L. Regan,
“Detectingprotein-protein interactions with GFP-fragment
reassembly.,”Nature Methods, vol. 1, no. 3, pp. 255–262, 2004.
[18] J. Miller, Cold Spring Harbor Laboratory, Cold Spring
Harbor,NY, USA, 1972.
[19] S. Z. Geng, X. A. Jiao, Z. M. Pan, X. J. Chen, X. M. Zhang,
andX. Chen, “An Improved Method to Knock Out the asd Gene
ofSalmonella enterica Serovar Pullorum,” Journal of Biomedicineand
Biotechnology, vol. 2009, Article ID 646380, 8 pages, 2009.
[20] K. A. Datsenko and B. L. Wanner, “One-step inactivationof
chromosomal genes in Escherichia coli K-12 using
PCRproducts,”Proceedings of the National Acadamy of Sciences of
theUnited States of America, vol. 97, no. 12, pp. 6640–6645,
2000.
[21] H. Suzuki, H. Kumagai, and T. Tochikura, “Isolation,
geneticmapping, and characterizationof Escherichia coli K-12
mutantslacking gamma-glutamyltranspeptidase,” Journal of
Bacteriol-ogy, vol. 169, no. 9, pp. 3926–3931, 1987.
-
Hindawiwww.hindawi.com
International Journal of
Volume 2018
Zoology
Hindawiwww.hindawi.com Volume 2018
Anatomy Research International
PeptidesInternational Journal of
Hindawiwww.hindawi.com Volume 2018
Hindawiwww.hindawi.com Volume 2018
Journal of Parasitology Research
GenomicsInternational Journal of
Hindawiwww.hindawi.com Volume 2018
Hindawi Publishing Corporation http://www.hindawi.com Volume
2013Hindawiwww.hindawi.com
The Scientific World Journal
Volume 2018
Hindawiwww.hindawi.com Volume 2018
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawiwww.hindawi.com Volume 2018
Hindawiwww.hindawi.com Volume 2018
Neuroscience Journal
Hindawiwww.hindawi.com Volume 2018
BioMed Research International
Cell BiologyInternational Journal of
Hindawiwww.hindawi.com Volume 2018
Hindawiwww.hindawi.com Volume 2018
Biochemistry Research International
ArchaeaHindawiwww.hindawi.com Volume 2018
Hindawiwww.hindawi.com Volume 2018
Genetics Research International
Hindawiwww.hindawi.com Volume 2018
Advances in
Virolog y Stem Cells InternationalHindawiwww.hindawi.com Volume
2018
Hindawiwww.hindawi.com Volume 2018
Enzyme Research
Hindawiwww.hindawi.com Volume 2018
International Journal of
MicrobiologyHindawiwww.hindawi.com
Nucleic AcidsJournal of
Volume 2018
Submit your manuscripts atwww.hindawi.com
https://www.hindawi.com/journals/ijz/https://www.hindawi.com/journals/ari/https://www.hindawi.com/journals/ijpep/https://www.hindawi.com/journals/jpr/https://www.hindawi.com/journals/ijg/https://www.hindawi.com/journals/tswj/https://www.hindawi.com/journals/abi/https://www.hindawi.com/journals/jmb/https://www.hindawi.com/journals/neuroscience/https://www.hindawi.com/journals/bmri/https://www.hindawi.com/journals/ijcb/https://www.hindawi.com/journals/bri/https://www.hindawi.com/journals/archaea/https://www.hindawi.com/journals/gri/https://www.hindawi.com/journals/av/https://www.hindawi.com/journals/sci/https://www.hindawi.com/journals/er/https://www.hindawi.com/journals/ijmicro/https://www.hindawi.com/journals/jna/https://www.hindawi.com/https://www.hindawi.com/