Supplementary information Synthetic antimicrobial peptides delocalize membrane bound proteins thereby inducing a cell envelope stress response Soraya Omardien, Jan W. Drijfhout, Henk van Veen, Soraya Schachtschabel, Martijn Riool, Leendert W. Hamoen, Stanley Brul and Sebastian A. J. Zaat Index Supplementary methods Supplementary Fig 1 Time kill curve depicting the CFU/ml over time after the removal of previously treated cells Supplementary Fig 2 Scatterplots highlighting the key regulons of genes differentially expressed by B. subtilis in response to sub-lethal concentrations of TC19, TC84 and BP2 that elucidates the mode of action Supplementary Fig 3 Venn diagrams of the number of genes shared between regulators SigB, M, W and X that are differentially expressed by B. subtilis in response to the peptides Supplementary Fig 4 Localization of B. subtilis strain TNVS175 producing MurG fused to the green fluorescent protein (MurG-GFP) cultured in minimal medium (CMM) and rich medium (LB) Supplementary Fig 5 Microscopy images of B. subtilis mutants, that have various proteins fused to the green
30
Embed
pure.uva.nl · Web viewB. subtilis UG-10 (amyE::spc Pxyl-recA-mgfp) was constructed by amplifying the recA gene with the primers UG03a and UG04a. The amplified recA gene was cloned
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Soraya Omardien, Jan W. Drijfhout, Henk van Veen, Soraya Schachtschabel, Martijn Riool,
Leendert W. Hamoen, Stanley Brul and Sebastian A. J. Zaat
Index
Supplementary methods
Supplementary Fig 1 Time kill curve depicting the CFU/ml over time after the removal of previously treated cells
Supplementary Fig 2 Scatterplots highlighting the key regulons of genes differentially expressed by B. subtilis in response to sub-lethal concentrations of TC19, TC84 and BP2 that elucidates the mode of action
Supplementary Fig 3 Venn diagrams of the number of genes shared between regulators SigB, M, W and X that are differentially expressed by B. subtilis in response to the peptides
Supplementary Fig 4 Localization of B. subtilis strain TNVS175 producing MurG fused to the green fluorescent protein (MurG-GFP) cultured in minimal medium (CMM) and rich medium (LB)
Supplementary Fig 5 Microscopy images of B. subtilis mutants, that have various proteins fused to the green fluorescent protein (GFP), after treatment with LL-37
Supplementary Table 1 Strains used in the study and additional information
Supplementary Table 2 Genes differentially expressed by B. subtilis associated with the two-component systems, and their functions
Supplementary Table 3 Downregulated genes regulated by SigB in response to 120 min of treatment with TC19
Supplementary Table 4 Associated genes of SigM, W, V and X regulons, the Xpf regulon and the Xre regulon, and their functions
Supplementary Table 5 Summary of genes differentially expressed, in response to the AMPs, involved in resistance antimicrobials
Supplementary Table 6 Minimal inhibitory concentration (MIC) of the TC19, TC84 and BP2 against mutants with a loss of function of genes involved in resistance against other compounds
Supplementary Table 7 The expression of genes associated with the proteins used to observe protein delocalization.
References
Supplementary methods
Time-kill assay to observe the killing effect of the AMP on B. subtilis at concentrations close
to the MIC values
To determine whether the AMPs are bound or available in the medium after treatment for 120
min, the survival assay was extended by removing the previously exposed cells and re-
inoculating the medium containing the AMP (supernatant) with previously untreated cells.
The method was similar to the survival assay reported prior, but after the 120 minutes of
incubation with the AMP the B. subtilis cells were removed using centrifugation at 14 000
rpm. The supernatant, containing the CMM and AMP, was re-inoculated with previously
unexposed exponentially growing cells at a final OD600 of 0.2. Aliquots of the cultures were
taken at 0, 5, 30, 60 and 120 minutes. After the 120 minutes, the cells were removed and the
supernatant re-inoculation with previously untreated cells. Aliquots of the new treatment
suspension were taken at 5, 30 and 60 minutes, but are shown at S5, S30 and S60. Graphs
were generated using SigmaPlot 13.0.
Construction of strain TNVS30D, TNVS30D, UG-10, EKB40 and EKB154
B. subtilis TNVS30D (amyE::spc-Pxyl-mGFP-pgsA) was constructed by amplifying the pgsA
gene using the primers pgsA-Fw and pgsA-Re. Information about the primers can be found in
the Table below. The amplified pgsA gene was cloned into the pSG1729 plasmid (carrying
monomeric GFP) using restriction sites XhoI and EagI. B. subtilis 168 was transformed
subsequently with the resulting plasmid pTNV13. Refer to the Table below for information
about the primers.
B. subtilis UG-10 (amyE::spc Pxyl-recA-mgfp) was constructed by amplifying the recA gene
with the primers UG03a and UG04a. The amplified recA gene was cloned into the pSG1729
plasmid1 using the XhoI and EcoRI restriction sites. B. subtilis 168 was subsequently
transformed with the resulting plasmid TNVS-recA-4GS-mgfp. Refer to the Table below for
information about the primers.
B. subtilis EKB40 (aprE::emR-PftsW-ftsW-msfGFP) was constructed using a three fragment
Gibson assembly reaction. The ftsW gene was amplified using primers EKP15 and EKP37.
The pTNV9-emR vector was amplified using the primer pairs EKP35 and EKP36, and
TerS145 and TerS146 into two fragments. B. subtilis 168 was subsequently transformed with
the resulting plasmid pEKC11.1. Refer to the Table below for information about the primers.
Table Primers used during the cloning procedurePrimer SequencepgsA-Fw 5'gggCTCGAGggctcaggaagcggctcaggatccTTTAACTTACCAAATAAAATCACACTAGCT3'pgsA-Re 5'cccCGGCCGttaGTTAGATGTTTTTAACGCTTCCCA3'UG03a 5’GCGCGCCTCGAGATGAGTGATCGTCAGGCAGCC3’UG04a 5’CGCGCGGAATTCGGATCCTGAGCCGCTTCCTGAGCCTTCTTCAAATTCGAGTTC3’EKP15 5'CCTGAGCCGCTTCCTGAGCCCAGATAAACAGTTTTTTTGA3'EKP35 5'CTGCAGGGTACCCGGTCAAT3'EKP36 5'GGCTCAGGAAGCGGCTCAGGATCCATGAGCAAAGGAGAAGAACT3'EKP37 5'ATTGACCGGGTACCCTGCAGTATAACCGCTATTTTTCTCT3'TerS145 5'ATAAACAAATAGGGGTTCCGCGCA3'TerS146 5'TGCGCGGAACCCCTATTTGTTTAT3'
Bacterial cytological profiling of mutants treated with LL-37
B. subtilis mutants expressing reporter proteins fused to green fluorescent protein (GFP),
were used to determine whether the LL-37 cause delocalization of proteins involved in
various cell wall synthesis. Culturing were in CMM containing the required supplements for
induction (Table S1). The MIC for LL-37 were 2 µM in CMM, thus a two-fold MIC value of
4 µM were selected to observe the effects of LL-37 on the B. subtilis mutants. Treatment with
the LL-37 was for 5 minutes while shaking at 37°C. GFP fused proteins were visualized
using the Nikon Eclipse Ti fluorescent microscope at an excitation wavelength of 395 ± 5 nm
and emission wavelength of 509 ± 5 nm. Microscopy slides were prepared by transferring
0.5µl culture onto a thin 1.5 % w/v agarose pad on a microscopy slide. These experiments
were performed in duplicate.
Legends of Supplementary Figs
Fig S1. Time-kill curves of surviving cells after treatment with various concentrations of
peptide TC19, TC84 and BP2. Aliquots of the cultures were taken at 0, 5, 30, 60 and 120
minutes. After 120 minutes the exposed cells were removed and the supernatant re-inoculated
with previously unexposed cells. Aliquots of the new treatment suspension were taken at 5
(S5), 30 (S30) and 60 (S60) minutes. Numbers of surviving cells were expressed as colony
forming units (CFU) per ml. All three peptides caused a decline in numbers of CFU/ml at an
early time point of 5 minutes, indicating the rapid activity of the peptides. After 5 minutes,
the numbers of CFU/ml increased again indicating growth of unaffected cells. Only for the
lethal concentration of 56 µM TC19 and TC84 a decline was observed, but the decrease in
numbers of CFU/ml in the supernatant was far less in the second cycle than in the first cycle
with the “fresh peptide”. These observations suggest that the peptides were no longer
available in the incubations. The results represent three biological repeats. The initial
inoculum was 10 times higher than the concentration of bacteria used for the MIC assay,
which is ± 1 x 108 CFU/ml (OD600 0.2). Zero values were substituted with one, to allow
display of the values in graphs.
Fig S2. Scatterplots highlighting the key regulons involved in determining the mode of action
of TC19, TC84 and BP2. The genes expressed by B. subtilis are shown, including the genes
that showed a significant difference in log expression ratio with a p > 0.05 (non-significant).
Thus regulons that are not significantly differentially expressed are highlighted in the
scatterplots, but are not mentioned in Table S2.
Fig S3. The Venn diagrams depicting the number of common differentially expressed genes
regulated by Sigma Factors, SigB, M, W or X.
Fig S4. B. subtilis strain TNVS175 producing MurG fused to the green fluorescent protein
(MurG-GFP) cultured in minimal medium (CMM) and rich medium (LB). Differences in
MurG-GFP localization can be observed in the cells in the exponential phase cultured in the
two different media.
Fig S5. The delocalization of proteins involved in cell wall synthesis was evaluated after
treatment with lethal concentrations of LL-37 (4 µM) using B. subtilis mutants. B. subtilis
mutants producing proteins (MurG, MraY, Pbp2B, PonA, MreB and FtsW) fused to the green
fluorescent protein (GFP) showed to be delocalized after treatment with LL-37 when
compared with the normal localization of the proteins in untreated cultures.
Supplementary tables
Table S1. Strains used in this study and additional informationStrains Abbreviation Genetype or description Medium supplement Reference
aBacillus Genetic Stock Center (http://www.bgsc.org/)
Table S2. Differentially expressed genes of the two-component systems and their functions. Positive values represent upregulation and negative values downregulation of the indicated genes.
YvrHb dltA 1.1 0.0006 2.9 0.0003 1.0 0.0029 D-alanylation of teichoic aciddltB 2.9 0.0003 D-alanylation of teichoic aciddltC 2.7 0.0004 D-alanylation of teichoic aciddltD 1.0 0.0007 2.7 0.0003 D-alanylation of teichoic aciddltE 1.0 0.0006 2.8 0.0003 D-alanylation of teichoic acid
wprA 1.5 0.0011 Protein quality controlwapA 1.1 0.0044 1.1 0.0043 Cell wall associated proteinyxxG 1.1 0.0029 1.1 0.0027 Immunity protein against WapAsunA Sublancin lantibioticsunT 2.6 0.0005 Sublancin lantibiotic ABC transporter
bdbA 1.8 0.0009 Thiol-disulfide oxidoreductase for sublacin production
yolJ 1.7 0.0011 Sublancin S-glycosyltransferase
bdbB 1.8 0.0007 Thiol-disulfide oxidoreductase for sublacin production
yvrI -1.1 0.0022 RNA polymerase sigma factoryvrHa -1.2 0.0013 RNA polymerase sigma factorsigX 1.3 0.0005 1.2 0.0029 RNA polymerase sigma factorrsiX 1.3 0.0005 control of SigX activitylytA -1.2 0.0006 secretion of major autolysin LytClytB -1.1 0.0006 modifier protein of major autolysin LytClytC -1.1 0.0005 -1.0 0.0029 N-acetylmuramoyl-L-alanine amidase
*References for functions can be found in the online database SubtiWiki (http://subtiwiki.uni-goettingen.de/)
Table S3. Downregulated genes associated with SigB after 120 min of treatment with TC19
Gene ID
Expression level (logFC)
Function*TC19 (120 min)LogFC adj. p-value
bmr -1.0 0.002 multidrug resistancebmrU -1.3 0.001 multidrug resistancecorA -1.8 0.001 unknowncsbA -1.0 0.004 protection against paraquat stresscsbC -1.6 0.001 protection against paraquat stresscsbD -1.2 0.008 survival of salt stress and at low temperaturescsbX -1.3 0.001 unknownctsR -1.3 0.001 regulation of protein degradationcypC -1.3 0.002 biosynthesis of beta-hydroxy fatty acid for lipopeptidesgspA -1.7 0.001 unknownguaD -2.7 0.004 deamination of guanine to xanthine, purine salvage and interconversionkatE -1.0 0.004 detoxification (degradation) of hydrogen peroxidemcsA -1.1 0.002 control of CtsR activitymcsB -1.0 0.001 control of CtsR activitymgsR -1.0 0.006 controls a subset of general stress genesnhaX -1.3 0.002 unknownohrB -1.1 0.003 organic peroxide resistance
rpmEB -1.0 0.002 survival of salt stressspx -1.1 0.003 negative and positive regulator of many genesyaaI -1.5 0.002 survival of ethanol stressycbP -2.1 0.000 unknownycdF -1.3 0.002 survival of ethanol stress and low temperaturesycdG -1.1 0.005 unknownydaD -1.1 0.004 unknown
ydaS -1.1 0.003 unknownydaT -1.1 0.006 survival of ethanol stress and low temperaturesydeC -1.8 0.000 unknownyerD -1.5 0.002 protection against paraquat stressyfhE -1.3 0.001 survival of stress conditions and low temperaturesyfhF -1.5 0.001 survival of ethonol stress and at low temperaturesyfkM -1.1 0.003 detoxification of methylglyoxalyflA -1.5 0.001 protection against paraquat stressyflT -1.3 0.002 survival of ethanol stress
yhcM -1.2 0.003 unknownyhdF -1.4 0.001 unknownyhdN -1.4 0.001 detoxification of methylglyoxalyjgB -1.0 0.007 survival of ethanol stressyjgC -1.1 0.005 unknownykgA -1.6 0.001 survival of salt and ethanol stressesykzI -1.5 0.001 unknownyoaA -1.0 0.003 unknownyoxC -1.5 0.002 survival of ethanol stressyqhB -1.5 0.002 protection against stress conditionsyqhP -1.3 0.001 unknownyqhQ -1.1 0.001 survival of stress conditionsysnF -1.1 0.005 survival of ethanol stressytaB -1.3 0.001 survival of ethanol and salt stressesyuzA -1.1 0.009 unknown
yvyD -1.1 0.001dimerization of ribosomes in the stationary phase, protection against paraquat stress
ywmE -1.7 0.001 survival of ethanol stressywsB -1.1 0.003 survival of ethanol and salt stressesywtG -2.0 0.001 unknownywzA -1.4 0.002 unknown
yxaB -1.2 0.002 biofilm formation, survival of salt and ethanol stressyxbG -1.5 0.002 unknownyxjJ -1.3 0.002 survival of stress conditions
yxnA -1.5 0.002 survival of ethanol stressyxzF -1.2 0.002 unknownyycD -1.5 0.003 survival of ethanol stress
*References for functions can be found in the online database SubtiWiki (http://subtiwiki.uni-goettingen.de/)
Table S4. Differentially expressed genes associated with SigM, W, V and X, the Xpf and Xre regulons, and their functions. Genes are considered to be differentially expressed when the expression ratio exceeds a factor of two and shows a significant different in log expression ratio (p ≤ 0.05). Positive values represent upregulation and negative values downregulation of the indicated genes.
BKE36530 bcrC 7.0 ± 0.0 5.8 ± 1.6 5.8 ± 1.6 cell wall synthesis, resistance to bacitracin and oxidative stress
Table S7. Expression of genes encoding the proteins fused the green fluorescent protein (GFP) in B. subtilis strains used to observe protein delocalization after AMP treatment (see Fig 7)