Punjab Academy of Forensic Medicine & Toxicology ... - pafmat

Punjab Academy of Forensic Medicine & Toxicology

JOURNAL OF

Volume:21,Number:01JanuarytoJunePublication:HalfYearly

ISSN:0972-5687

2021

APeerReviewedJournalon

ForensicMedicine,Toxicology,AnalyticalToxicology,ForensicScience,EnvironmentalPollution,

ForensicPathology,ClinicalForensicMedicine,Identi�ication,LegalMedicine,StateMedicine,

MedicalJurisprudence,MedicalEthics,ForensicNursing,ForensicOdontology,ForensicAnthropology,

ForensicPsychiatryandotherAlliedbranchesofMedicineandScience

dedicatedtoadministrationofJustice.

• Indexed with Index Copernicus (Poland), Scopus (Elsevier Products), IndMed (ICMR New Delhi), Safetylit, Worldcat Library & WHO Hinari

• Available online at Indian Journals.com, pafmat.org and pafmat.com• UGC Approved (as per UGC care list)

Place of Publication: Bathinda (Punjab) India

• JPAFMAT is also having PubMed/NLM catalogue number (NLM Unique ID: 101232466).

Editor-in-ChiefDr.ParmodKumarGoyal

PUNJAB ACADEMY OF FORENSIC MEDICINE AND TOXICOLOGY

(Registration No. 139 / 1998-99, Chandigarh)

HO: Department of Forensic Medicine, Govt. Medical College Patiala (Punjab) 147001

PresidentDr. D. S. Bhullar

Vice PresidentDr. Rajiv Joshi

General SecretaryDr. Akashdeep Aggarwal

Editor-in-ChiefDr. Parmod Kumar Goyal

Finance SecretaryDr. Shilekh Mittal

Joint EditorDr. Amandeep Singh

Dr. Ashok Chanana

Dr. Ishwar Tayal

Dr. Dasari Harish

Dr. Preetinder S. Chahal

Dr. Puneet Khurana

Dr. Ajay Kumar

Dr. Amit Singla

Dr. Ashwani Kumar

Dr. Deep Rattan Mittal

Dr. O.P. Aggarwal

Dr. S.S. Oberoi

Dr. Balbir Kaur

Dr. Gurmanjit Singh

Dr. K.K. Aggarwal

Dr. R.K. Sharma

Dr. R.K. Gorea

Dr. Vijaypal Khanagwal

Executive Members

Advisors

GOVERNING COUNCIL (2019 - 2021)

Patron

Dr Jagdish Gargi

Advisors

Dr J. S. Dalal

Dr Harish Tuli

Dr Maj. Gen (Rtd.) Ajit Singh

President

Dr. R. K. Gorea

Vice President

Dr. D. S. Bhullar

Secretary

Dr. Sat Pal Garg

Treasurer

Dr. Nirmal Dass

Executive Members

Dr A S Thind,

Dr Jagjiv Sharma,

Dr Kuldeep Kumar,

Dr I. S. Bagga,

Dr Baljit Singh

FOUNDER GOVERNING COUNCIL OF PAFMAT

Special Invitee

Dr. Adish Goyal Dr. Mukul Chopra

Joint SecretaryDr. Didar Singh Walia

J Punjab Acad Forensic Med Toxicol 2021;21 (1) ISSN : 0972-5687

From the Desk of Editor-in-Chief

I am pleased to present the first issue of the year 2021 of Journal of Punjab Academy of Forensic Medicine & Toxicology. First of all

I apologize for delay release of this issue due to covid pandemic. I am thankful to the authors and contributors for the scientific

articles and research papers which are being published in this issue. I am also thankful to the editorial team and the members of the

Academy for supporting me in its publication and my special thanks to Joint Editor Dr Amandeep Singh.

The Journal publishes original research papers, review articles, case reports and review of books on Forensic Medicine and

Toxicology. The Journal highlights the achievements of the academy and its members. This journal is meant for achieving the aims

and goals of the academy to expand the academic activities, spread the knowledge and latest research in the field of Forensic

Medicine and Toxicology.

Any suggestions and advice for further improving the standards and quality of the journal will be highly appreciated and may be sent

to me through email or my whattsapp no. 9876005211.


ISSN Numbers:

ISSN-L: 0972-5687, p-ISSN: 0972-5687, e-ISSN: 0974-083X.

Indexed with:

IndexCopernicushttp://journals.indexcopernicus.com/karta.php?id=4715

Scopus (SCI):

http://www.scimagojr.com/journalsearch.php?q=19900194914&ip=sid&clean=0

Volume of Distribution:

300 copies.

Funding Bodies: Punjab Academy of Forensic Medicine & Toxicology, Donations from Philanthropists and manuscript handling charges

Address for submission of articles Online (Soft Copy):

[email protected], indianjournals.com

Copyright:

No part of this publication may be reprinted or republished without the prior permission of Editor-in-Chief of Journal of Punjab Academy of Forensic Medicine & Toxicology. Submission of all papers to the journal is understood to imply that it is not being considered for publication elsewhere. Submission of multi-authored paper implies that the consent of each author has been taken and there is no dispute among the

sequence of authorship. Researchers/Authors should adhere to publication requirements that submitted work is original, not plagiarized, ethical and has not been published elsewhere.

As per new CPA 2019 Act. confidentiality of the participants shall be maintained.

To expedite the review process, video conferencing with the authors for clarification and verification of the data was done.

All the articles had passed through the plagiarism software.

Every effort has been made not to publish any inaccurate or misleading information. However, the Editor-in-Chief, the Joint Editor or any member of the editorial committee accept no liability in consequences of any such publications. For any further information/query please contact with Editor-in-Chief.

Dr Parmod Kumar GoyalProfessor & Head (Forensic Medicine)

Member Secretary, Ethics Committee,Adesh UniversityController of Examinations, Adesh University, Bathinda

Convener, BOS(PG) Adesh University, BathindaCoordinator, Body Donation Programme

FAIMER 2013, ACME 2015Editor in Chief, Journal of Punjab Academy of Forensic

Medicine and Toxicology (JPAFMAT) Adesh Institute of Medical Sciences & Research, Bathinda

1

*From the Desk of Editor-in-Chief 1

*Contents 2-5

*Editorial :

Guidelines for Cremation/Burial of COVID19 - Need of the Hour 6-9

Kamal Singla, Yatiraj Singi

*Original Research Papers

1. Medical Students Perception on Ethics and Communication Module: 10-13

What It Means to be a Patient

Vikram Palimar, Chandni Gupta

2. Anthropometric Correlation between Stature and Measurements of Hand & Finger Length 14-21

Jaspinder Pratap Singh, Ashok Chanana, Kuldip Kumar, Jatinder Pal Singh, Manpreet Kaul

3. A Clinical Forensic Medicine Study of Mechanical Injuries in Assault Cases 22-28

Aashish Sharma, Kuldip Kumar, Ashok Chanana, Didar Singh Walia,

Jatinderpal Singh, Manpreet Kaul

4. Multifactorial Analysis of Deaths Due To Hanging 29-33

Prasenjit Das, Amandeep Singh, Dasari Harish

5. Age Estimation of Dead Foetus from Anthropology, Radiology of Femur & Humerus Bone 34-38 Piyush Sandhu, Amandeep Singh, Dasari Harish, Mahesh Sharma

6. Perception of relatives towards Medico-legal autopsy 39-43

in a tertiary care centre of Northeast India

Daunipaia Slong, AD Ropmay, Aelifeter R Marak, Anamika Nath,

Rangme B Y Marbaniang, AJ Patowary

7. Evaluation of Morphological Changes in Natural Tooth Exposed to 44-46

Organophosphorous Compounds

Mithra S, Abirami Arthanari, Pratibha Ramani

8. Pattern of Injuries and manner of Death in Alleged Railway Accident Deaths : 47-57

An Autopsy Study

Amarjit Singh, Guriqbal Singh

9. Estimation of Sexual Dimorphism by Osteometric Analysis of Patella 58-67

Kamal Singla, Yatiraj Singi, Rajiv Kumar Sinha, S K Dhattarwal

10. A Retrospective Autopsy Study of Deaths due to Compression of Neck 68-71

Munish Kumar, Kanika Kohli, Harpreet Singh

11. Impact of Covid-19 Pandemic on Suicidal and Homicidal Deaths in Jabalpur, 72-74

Madhya Pradesh, India

Nidhi Sachdeva, Divyam Singh Modi, Mukesh Rai, Vivek Shrivastava

12. Cypermethrin-induced liver toxicity in Balb/c mice 75-82

Dolly Mahna, Sanjeev Puri, Shweta Sharma

13. Estimation of Formaldehyde Contamination In Selected Sea Fish Species Sold 83-90

In Ernakulam District of Kerala State

Nirmal Kumar V, Pillay VV, Ramakrishnan UK, Arathy SL, Renjitha Bhaskaran


JOURNAL OF

ISSN:0972-5687


Contents

2


JOURNAL OF

ISSN:0972-5687

Contents 14. Ameloglyphics : An Adjuvant in Individual Identification 91-96

Aneeta Sajan, Priya Thomas

15. A Comparative Study of Digital Forensic Tools for 97-104

Data Extraction From Electronic Devices

Harshita Tara, Amarnath Mishra

16. Introduction And Evaluation of Effective Image Based Interactive Teaching Learning 105-108

Method In Forensic Medicine Amongst Second MBBS Students

Rohit Zariwala, Krunal Pipaliya, Dimple Patel

17. Epidemiological Profile of Fatal Snakebite Cases in a Tertiary Care Centre in South India 109-113

Sathish.K, Kusa Kumar Shaha, Ambika Prasad Patra, J. Sree Rekha

18. Forensic Examination of Forensic expert's Disguise Handwritings 114-117

Shalvi Upadhyay, Lalit P. Chandravanshi

19. Students' Perception of Emergency Remote Teaching during COVID -19 Pandemic 118-123

Smitha Rani, Vinay J, Aravind GB, Arun M, Chandrakanth HV

20. Association of alcohol and psychoactive substances use with Mental Health Symptoms, 124-128

crime and violence

Gurmeet Kaur Brar, Vineet Jalota

21. Forensic Identification of Mifepristone and Misoprostol by TLC and FT-IR Methods 129-135

Bhuvnesh Yadav, Meena Jha, Lingaraj Sahoo, Sonu Kumar Maurya

22. Profile of Paraquat Poisoning in Bellary District- A Retrospective Study 136-138 Gururaj Biradar, Pavanchand Shetty H, Haneil Larson Dsouza, B Suresh Kumar Shetty,

Prateek Rastogi, Charan Kishor Shetty, V Yogiraj

23. Assessment of Knowledge and Awareness towards Medical Negligence among 139-142

Consultants in a Tertiary Care Teaching Hospital in North India

Siddhartha Taneja, Jaswinder Singh, K.K. Bairagi, Tarun K. Singh

24. Estimation of stature from Percutaneous Length of Tibia in Living Subjects in 143-148

Jhalawar region of Rajasthan

Mukesh Kumar Meena, Sanjaya Kumar Jain, Ramakant Varma

25. Pattern of fatal Injuries in Road Traffic Accidents in & around Jammu region: 149-152

An Autopsy Based Study

Preet Mohinder Singh, Kirandeep Kour Raina, Sandya Arora

26. Comparative Study of Forged Urdu Signatures Done By Persons Not Familiar To 153-155

Language Belongs To Region of Sikkim And Kashmir

Syed Ahmar Ali Hashmi, Shalvi Upadhyay, Rajeev Kumar

27. Forensic Characteristic Identification of Forged Urdu Signature Written By 156-158

Population of Delhi Who Are Stranger To The Language.

Syed Ahmar Ali Hashmi, Shalvi Upadhyay, Rajeev Kumar

28. Clickers in Medical Education – Boon or Bane? 159-164

Latif Rajesh Johnson, Ranjit Immanuel James

3



JOURNAL OF

ISSN:0972-5687

Contents 29. Correlation of Stature With Finger- Length of Native Haryana Population 165-167

Sabina Bashir, Rajender Kumar Saini, Yatiraj Singi

30. Pattern of Thoraco-abdominal Injuries Sustained In Road Traffic Accidents: 168-172

An Autopsy Based Observational Study

B Rupesh Kumar Naik, Siddhartha Das, Kusa Kumar Shaha

31. Reliability of age estimation using periodontal ligament visibility in South Indian Population 173-178

Ayan Bhadra Ray, Kushaggr Rastogi, Srikant N, Shweta Yellapurkar,

Nidhin Philip Jose, Ceena Denny

32. 179-186An Approach Towards Integrated Teaching: Case-Based Learning (CBL) in Physiology

Ashwani Ummat, Sonia Kochhar

33. Study of the Profile of Verbal and Non- verbal Clues of Deception among People of 187-191

South Indian descent.

Vijay Kautilya D, Shruti Prabhat Hegde, Pramika Rajashekaran

34. Knowledge and practice of smart phones and medical related applications in 192-196

learning by medical undergraduates.

Sakshi Singh Chauhan, Arti Ajay Kasulkar

35. Validation of University of Texas (UT) Age Estimation Software in Indian Population 197-202

Abirami Arthanari, Nagabhushana Doggalli, Vidhya A, Karthikeya Patil,

Sushma Rudra Swamy, Sowmya Srinivas

36. A Time Interval Based Forensic Study on Estimation of ABO Blood Group & 203-207

Rh Typing From Dental Pulp: An Aid in Personal Identification

Abirami Arthanari, Usha Hegde, Nagabhushana Doggalli, Priyanka Nithin

*Case Reports

1. Dressler's Syndrome – A Case Report. 208-211

Varun Krishna B, Nirmal Krishnan M, Deepak Nayak M, Vinod C Nayak

2. Decomposition in Drowning Obscures Cause and Manner of Death 212-215

Vivek K. Chouksey, Atul S. Keche, Daideepya C. Bhargava, S. Mahaluxmi

3. Papillary Renal Cell Carcinoma - an Incidental Finding at Autopsy 216-219

Niranjan P. Khadilkar, K.R. Nagesh

4. Development of an analytical method for detection of Imidacloprid Insecticide from 220-225

Biological Matrix using LC-MS/MS

Majji. Sai Sudha Rani, Chintan Singh, Amarnath Mishra

*Review Article

1. Covid-19 Vaccination Hesitancy: Causes, Legislation And Ethics 226-230

Anvita Ahuja, Jasmeen Kaur, Prateek Rastogi

2. Review on Bioremediation of Carbofuran & Different Factors Influencing the Process 231-237

Suryapratap Ray, Shikha Choudhary

3. Switching Gears of DNA Extraction: From Destructive to Non- Destructive 238-244 Ghuge Arun, Verma Pratibha, Sangle Sandeep, Gaiki Shweta, Paikrao Hariprasad

4



JOURNAL OF

ISSN:0972-5687

Contents

5


4. Cadaveric Transplantation- The legal and Ethical issues 245-248

J.S.R.G. Saran, Jagadish Rao Padubidri

5. Developing and building high performance teams to achieve Accreditation 249-253

through different Leadership styles

Vijay Pratap Singh, Bidita Khandelwal, Parmod Kumar Goyal

*Commentary/Scientific Correspondence

1. Estimation of Zinc Concentration in Yamuna River (Delhi) Water Due to Climatic Changes 254-257

Mahipal Singh Sankhla, Rajeev Kumar, Lalit Prasad

2. Differences between Graduate Medical Education Regulations 1997 (GMER 1997) and 258-262

Graduate Medical Education Regulations 2019 (GMER 2019) in respect to teaching and

assessment of subject of Forensic Medicine and Toxicology

Parmod Kumar Goyal, Monika Gupta

*Instructions to Authors 263

*Life Members PAFMAT 264-265

Editorial

Corresponding Author :

Dr. Yatiraj Singi,

Associate Professor,

Department of Forensic Medicine & Toxicology, AIIMS Bilaspur

Contact : +91 99728-28903

Email: [email protected]

KEYWORDS : COVID-19, Cremation, Burial

Article History:Received: 8 June 2020Received in revised form: 8 December 2020Accepted on: 8 December 2020Available online: 31 August 2021

INTRODUCTION:

Coronavirus disease (COVID-19) is an infectious disease

caused by a newly discovered coronavirus.Most people

infected with the COVID-19 virus will experience mild to

moderate respiratory illness and recover without requiring

special treatment. Older people, and those with underlying

medical problems like cardiovascular disease, diabetes,

chronic respiratory disease, and cancer are more likely to 1develop serious illness . Infection can be transmitted from

droplets of different sizes or contact routes or by airborne

transmission in special cirumstances i.e. endotracheal

intubation, b r o n c h o s c o p y, o p e n s u c t i o n i n g ,

administration of nebulized treatment, manual ventilation

before intubation, turning the patient to the prone position,

disconnecting the patient from the ventilator, non-invasive

posi t ive-pressure vent i la t ion, t racheostomy, and 2cardiopulmonary resuscitation . There is some evidence that

COVID-19 infection may lead to intestinal infection and be

present in faeces. However, to date only one study has cultured 3the COVID-19 virus from a single stool specimen .

Indian Stand:

Being a new disease there is knowledge gap on how to dispose

of dead body of a suspect or confirmed case of COVID-19.

The main driver of transmission of COVID-19 is through

droplets. There is unlikely to be an increased risk of COVID

infection from a dead body to health workers or family

members who follow standard precautions while handling 4body . However MOHFW, India issued guidelines on

4management of COVID-19 dead bodies .4As per the MOHFW, India guidelines , the crematorium/

burial ground staff should be sensitized that COVID 19 does

not pose additional risk.The staff will practice standard

precautions of hand hygiene, use of masks and gloves.

Viewing of the dead body by unzipping the face end of the

body bag (by the staff using standard precautions) may be

allowed, for the relatives to see the body for one last time.

ABSTRACT:

Coronavirus disease (COVID-19) is an infectious disease caused by a newly discovered coronavirus.Most people infected with the

COVID-19 virus will experience mild to moderate respiratory illness and recover without requiring special treatment. People in

extremes of age and those having pre-existing disease are more prone to the infection. Transmission is by droplet/contact route or by

airborne transmission in special circumstances i.e endotracheal intubation, bronchoscopy, tracheostomy, cardiopulmonary

resuscitation etc.

Not only the treatment of living infected subjects, handling of COVID-19 dead bodies is also having utmost importance to prevent

the transmission of deadly virus to the body handlers (hospital staff/cremation staff/family members) in the hospital or at the

cremation/burial site. Here in this review paper, we have discussed about the pros and cons of the cremation and burial of the body

keeping in mind that no further spread of the virus could occur to the community. However for eg China and Sri Lankan authorities

made cremation compulsory by official order while WHO, India and many other did not objected to either of them. In our opinion,

cremation should be preferred for complete elimination of chances of infection. However keeping in mind the religious views

of the family, if the burial of the body is requested, then it should be assured that the body is buried in a thick, air tight coffin and

placed at normal depth of about 2 meter. It is recommended that the area above and adjacent to the grave should be cemented

immediately as an additional precautionary to avoid scavenging by animal.

1. Kamal Singla, Assistant Professor, Department of Forensic Medicine & Toxicology, Faculty of Medicine & Health Sciences,

SGT University, Gurugram, Haryana 122505

2. Yatiraj Singi, Associate Professor, Department of Forensic Medicine & Toxicology, AIIMS Bilaspur

J Punjab Acad Forensic Med Toxicol 2021;21(1) ISSN : 0972-5687 DOI:10.5958/0974-083X.2021.00001.7

Guidelines for Cremation/Burial of COVID19 - Need of the Hour

6

Religious rituals such as reading from religious scripts,

sprinkling holy water and any other last rites that does not

require touching of the body can be allowed. Bathing, kissing,

hugging, etc. of the dead body should not be allowed. The

funeral/ burial staff and family members should perform hand

hygiene after cremation/ burial. The ash does not pose any risk

and can be collected to perform the last rites. Large gathering at

the crematorium/ burial ground should be avoided as a social

distancing measure as it is possible that close family contacts

may be symptomatic and/ or shedding the virus.5As per the protocol of dignified management of the COVID-

19 dead bodies released by Dept of Forensic Medicine &

Toxicology, AIIMS, New Delhi, cremation should be

preferred for complete elimination of chances of infection in

either electric or gas crematorium in situ in zipped body bag.

However keeping in mind the religious views of the family, if

the burial of the body is requested, then it should be assured

that the body is buried in a thick, air tight coffin and placed at

normal depth of burial (4 to 6 feet). It is recommended that the

area above and adjacent to the grave should be cemented

immediately as an additional precautionary measure and the

space should be marked and required precautions should be

taken to avoid scavenging by animals. As a precautionary

measure large gathering at the crematorium/ burial ground

should be avoided to maintain a healthy distancing. The

remains of the last rites like ashes do not pose any risk of

infection and can be collected for religious immersion.

Remove personal protective equipment after handling of the

dead body. Then, perform hand hygiene immediately.

WHO Stand:

Transmission of COVID-19 pathogen is through droplets,

fomites and close contact, with possible spread through faeces. 2It is not airborne .

Except in cases of hemorrhagic fevers (such as Ebola,

Marburg) and cholera, dead bodies are generally not

infectious. Only the lungs of patients with pandemic influenza,

if handled improperly during an autopsy, can be infectious.

Otherwise, cadavers do not transmit disease. It is a common

myth that persons who have died of a communicable disease

should be cremated, but this is not true. Cremation is a matter

of cultural choice and available resources. To date there is no

evidence of persons having become infected from exposure to

the bodies of persons who died from COVID-19. The dignity

of the dead, their cultural and religious traditions, and their

families should be respected and protected throughout. Hasty

disposal of a dead from COVID-19 should be avoided.

Authorities should manage each situation on a case-by-case

basis, balancing the rights of the family, the need to investigate 6the cause of death, and the risks of exposure to infection .

People who have died from COVID-19 can be buried or

cremated. Confirm national and local requirements that may

dictate the handling and disposition of the remains. Family and

friends may view the body after it has been prepared for burial,

in accordance with customs. They should not touch or kiss the

body and should wash hands thoroughly with soap and water

after the viewing; Those tasked with placing the body in the

grave, on the funeral pyre, etc., should wear gloves and wash

hands with soap and water after removal of the gloves once the 6burial is complete .

6Burial by family members or for deaths at home : In contexts

where mortuary services are not standard or reliably available,

or where it is usual for ill people to die at home, families and

traditional burial attendants can be equipped and educated to

bury people under supervision. Any person (e.g. family

member, religious leader) preparing the deceased (e.g.

washing, cleaning or dressing body, dying hair, trimming nails

or shaving) in a community setting should wear gloves for any

contact with the body. For any activity that may involve

splashing of bodily fluids, eye and mouth protection (face

shield or goggles and medical mask) should be worn. Clothing

worn to prepare the body should be immediately removed and

washed after the procedure or an apron or gown should be

worn. The person preparing the body should not kiss the

deceased. Anyone who has assisted in preparing the body

should thoroughly wash their hands with soap and water when

finished. Apply principles of cultural sensitivity and ensure

that family members reduce their exposure as much as

possible. Children, older people (>60 years old), and anyone

with underlying illnesses (such as respiratory illness, heart

disease, diabetes, or compromised immune systems) should

not be involved in preparing the body. A minimum number of

people should be involved in preparations. Others may observe

without touching the body at a minimum distance of 1 meter.

Family and friends may view the body after it has been

prepared for burial, in accordance with customs. They should

not touch or kiss the body and should wash their hands

thoroughly with soap and water following the viewing.

Physical distancing measures should be strictly applied (at

least 1 meter between people). People with respiratory

symptoms should not participate in the viewing or at least wear

a medical mask to prevent contamination of the place and

further transmission of the disease to others. Those tasked with

placing the body in the grave, on the funeral pyre, etc. should

wear gloves and wash hands with soap and water once the

burial is complete.

Cleaning of reusable PPE should be conducted in accordance

with manufacturer's instructions for all cleaning and

disinfection products (e.g. concentration, application method

7


paper we will discusss about the pros and cons of various

practices of last rites in current scenario of COVID-19

pandemic irrespective of his/her religion faith keeping in mind

that no further spread of the virus could occur to the

community.

In the case of COVID-19, the pathogen is highly infectious

and transmits from one person to another through droplets or

contact. This means it requires body fluid to keep finding new

victims. So theoretically, novel coronavirus can be transmitted

during preparing the body for burial to body handlers. 10Secondly, body inside the earth usually takes 8x times to

decompose in comparision if body is in the open air posing risk

of animal scavanging and tranmission. However, cementing

the grave immediately can be done as an additional

precautionary measure to prevent animal scavanging.11 While cremation invloves 1400 to 1800 degree fahrenheits of

temperature to cremate the body. At this high temperature,

chances of infection from viable virus particles in the ashes is

not questionable. However transmission can occur while

preparing the body for cremation from bodiely secretions as

while preparing for burial. In addition, there will no danger for

animal scavanging activity after cremation.

Suggestions:

We propose to suggest following measures, in addition to the

COVID-19 guidelines on dead body management4, published

by the MOHFW, GOI.

1) Instead of handing over the body (confirmed/suspected

COVID-19) to the relatives in cases of hospital deaths, we

suggest the body should be transferred directly to the place

of cremation/burial by the designated health worker

person who is involved primarily in packing of the body to

ensure minimal exposure to others including family

members.

2) In case of death at home with suspicion of having

COVID-19, it should be mandatory to inform the local

authorities which will ensure transportation and packing

of the body to the cremation/ burial site as per the

guidelines. This will also help the local authorities in

contact tracing.

3) Personell from the local authorities and staff of

cremation/burial site should be well trained in infection

prevention control practices.

4) Cremation/burial staff should be duty bound to complete

the last rite process (cremation/burial) without involving

family members or relatives.

5) Proper treatment and handling instructions of the

belongings and clothing of the deceased should be given

to the family members by the staff involved in packing of

and contact time, etc.). Children, adults > 60 years, and

immunosuppressed persons should not directly interact with

the body. Although burials should take place in a timely

manner, in accordance with local practices, funeral ceremonies

not involving the burial should be postponed, as much as

possible, until the end of the epidemic. If a ceremony is held,

the number of participants should be limited. Participants

should observe physical distancing at all times, plus

respiratory etiquette and hand hygiene.

The belongings of the deceased person do not need to be

burned or otherwise disposed of. However, they should be

handled with gloves and cleaned with a detergent followed by

disinfection with a solution of at least 70% ethanol or 0.1%

(1000 ppm) bleach. Clothing and other fabric belonging to the

deceased should be machine washed with warm water at

60−90°C (140−194°F) and laundry detergent. If machine

washing is not possible, linens can be soaked in hot water and

soap in a large drum using a stick to stir and being careful to

avoid splashing. The drum should then be emptied, and the

linens soaked in 0.05% chlorine for approximately 30 minutes.

Finally, the laundry should be rinsed with clean water and the 7linens allowed to dry fully in sunlight

Global Stand:

China, where novel Coronavirus outbreak took place first in

December, decided to cremate the bodies. In many cases,

bodies of COVID-19 were cremated immediately after the

death and even in the absence of family members without

giving any consideration if the religious belief of the

coronavirus victim and released a formal order directing the

local authorities to immediately cremate bodies of COVID-19 8victims and laid out procedure on how to do it .

In neighbouring Sri Lanka too, the government made

cremation of body mandatary if the deceased is a COVID-19

patient or suspected to have novel coronavirus infection. The

order has been resented by Muslims in Sri Lanka. But the

government has cited the highly infectious nature of novel 9coronavirus to dismiss the objections on account of health .

Pros and Cons in relation to Burial/Cremation:

As of today (19/05/2020), total confirmed cases of COVID are 12 134618821 worldwide and 97975 in India & the number of

12 13deaths are 311847 worldwide and 3163 in India . There is

currently a disproportionate focus on the living instead of the

dead. India is the largest democracy in the world and having

about 1.4 billion population and accomodating people of

almost all religions with different cultural practices while

performing the last rites of the individual/family member.

Hindu practices cremation while Christians and Muslims

perform burial as per religious belief and practices. In this

8


Management of COVID-19 Dead bodies available at

https://aiims.edu/images/pdf/notice/CoVID%2019.pdf

accessed on 20/04/2020.

6. WHO International: Infection Prevention and Control for

the safe management of a dead body in the context of

COVID-19 - Interim guidance Published on 24/03/2020

available at :

h t t p s : / / a p p s . w h o . i n t / i r i s / b i t s t r e a m / h a n d l e

/10665/331538/WHO-COVID-19-lPC_DBMgmt-

2020.1-eng.pdf accessed on 30/03/2020.

7. World Health Organization. (2020). Water, sanitation,

hygiene, and waste management for the COVID-19 virus.

I n t e r i m g u i d a n c e : 1 9 M a r c h 2 0 2 0 .

https://apps.who.int/iris/bitstream/handle/10665/33

1499 / W H O -2019-nCoV- I P C _ WA S H -2020 .2 -

eng.pdf?sequence=1&isAllowed=y (Accessed March 22,

2020).

8. National Health Commission, Ministry of Civil Affairs,

PRC, Notice regarding the issuance of guildlines for the

managment of the remains of pneumonia patients infected

with new coronavirus (for trial implementation) published

on 1/2/2020 available at :

h t t p : / /www.nhc .gov. cn /yzyg j / s7659 /202002 /

163c26a24057489dbf64dba359c59a5f.shtml accessed on

20/04/2020.

9. Prabash K Dutta, Burial or Cremation: What is a safer

funeral if someone dies of Covid-19?, Published on

1 8 / 0 4 / 2 0 2 0 I n d i a To d a y a v a i l a b l e f r o m

https://www.indiatoday.in/india/story/burial-or-

cremation-what-is-a-safer-funeral-if-someone-dies-of-

covid19-1668257-2020-04-18 accessed on 20/04/2020.

10. KSN Reddy & OP Murthy, Essentials of Forensic

Medicine & Toxicology, 34th Edn, Jaypee Brothers, Pg.

161.

11. https://www.cremationresource.org/cremation/how-is-a-

body-cremated.html accessed on 21/04/2020.

12. WHO International: Situation Report - 119 Published on

18/05/2020 available at :

https://www.who.int/emergencies/ diseases/novel-

coronavirus-2019/situation-reports accessed on

19/05/2020.

13. MOHFW, GOI: COVID-19 DATA, published

19/05/2020 available at https://www.mohfw.gov.in/

accessed on 19/05/2020.

body, if willing to take these items with them.

6) Mandatory presence of police and a health care

worker/worker from local authorities to be present at the

time of cremation/burial to ensure proper adherence to the

guidelines. This will ensure smooth implementation of the

guidelines without any delay, deviation or any violence at

the cremation or burial site.

7) Specify the number of mourners permitted to be present at

the crematorium/burial ground instead of mentioning the

word “Large gathering should be avoided”. We suggest

the number to be limited to maximum 10.

Opinion:

In our opinion, cremation should be preferred for complete

elimination of chances of infection. However keeping in mind

the religious views of the family, if the burial of the body is

requested, then it should be assured that the body is buried in a

thick, air tight coffin and placed at normal depth of burial

(about 2 meter). It is recommended that the area above and

adjacent to the grave should be cemented immediately as an

additional precautionary measure to avoid scavenging by

animals. As a precautionary measure large gathering at the

crematorium/ burial ground should be avoided to maintain a

healthy distancing. The remains of the last rites like ashes do

not pose any risk of infection and can be collected for religious

immersion. The number of mourners should be limited as less

as possible subject to maximum of 10.

REFERENCES:

1. https:// www.who.in / health-topics / coronavirus # tab =

tab_1 accessed on 20/04/2020.

2. WHO International: Modes of transmission of virus

causing COVID-19: implications for IPC precaution

Recommendations-Scientific brief, Published 29/03/2020

a v a i l a b l e a t h t t p s : / / w w w. w h o . i n t / n e w s -

room/commentaries/detail/modes-of-transmission-of-

virus-causing-covid-19-implications-for -ipc-precaution-

recommendations accessed on 20/04/2020.

3. Zhang Y, Chen C, Zhu S et al. [Isolation of 2019-nCoV

from a stool specimen of a laboratory-confirmed case of

the coronavirus disease 2019 (COVID-19)]. China CDC

Weekly. 2020;2(8):123–4. (In Chinese).

4. MOHFW, GOI: COVID-19: GUIDELINES ON

DEAD BODY MANAGEMENT, published 15/03/2020

available at :

https://www.mohfw.gov.in/pdf/1584423700568_COVI

D19GuidelinesonDeadbodymanagement.pdf accessed

on 18/03/2020.

5. Deptt. of FMT, AIIMS, Delhi: Protocol on Dignified

9


10

Original Research Paper

J Punjab Acad Forensic Med Toxicol 2021;21(1) ISSN : 0972-5687 DOI: 10.5958/0974-083X.2021.00002.9

1. Vikram Palimar, Professor & Head, Department of Forensic Medicine, Kasturba Medical College, Manipal, Manipal

Academy of Higher Education, Manipal, India, 576104

2. Chandni Gupta, Additional Professor, Department of Anatomy, Kasturba Medical College, Manipal, Manipal Academy of

Higher Education, Manipal, India, 576104

Key words: Patient care, Empathy, Curriculum, Students.

Corresponding Author:

Dr. Chandni Gupta,

Additional Professor,

Department of Anatomy, Kasturba Medical College, Manipal,

Manipal Academy of Higher Education, Manipal, India,

Contact : +91 98867-38555

Email :[email protected]

Article History :

Received : 18 August 2020

Received in revised form : 18 September 2020

Accepted on : 7 November 2020

Available online : 15 August 2021

INTRODUCTION :

Ethics is the study of morality careful and systematic scrutiny

of moral judgments and behaviors and practicing those

decisions. Medical ethics emphasizes mainly on problems [1]arising out of the practice of medicine.

Till now, medical program and training courses were designed

around specific educational or learning objectives which were roamingaround three main territories: Cognitive, psychomotor

and affective. And medical education in India mainly deals

with the head, sparsely with the hand, and almost they have

neglected the heart, consequently they fail to produce a

clinician who would realize and deliver complete care which

should include preventive, promotive, curative and palliative [2, 3]care with empathy.

Nowadays, there is an increased level of mistrust of the general

population on medical specialists due to carelessness,

misbehavior, and immoral practices that have led to violence

and legal problems. These all point to the fact that there is a

terrible requirement for modification of the current medical [4-6]curriculum.

Because of all these reasons MCI (Medical Council of India)

has taken a step forward in this connection and they have

proposed a new organized longitudinal program on attitude,

ethics and communication which is known as the AETCOM. It

Medical Students Perception on Ethics and Communication Module: What It Means to be a Patient

ABSTRACT :

Introduction: Student insights about their importance towards the patient begin to play an important role as their clinical

experiences advance. Doctors should provide health care which should be tailored for each patient, care which is given to the

patient should be coordinated, family and friends on whom the patient trusts should be involved, and care should deliver physical stwell-being and emotional support. So, in our college, we conducted the module what it means to be a patient for our 1 -year medical

undergraduate students and took their views regarding the module.

Material and Methods: A study was conducted on 198 undergraduate students from Kasturba Medical College, Manipal. They

were told to fill the questionnaire containing six questions regarding the module after the module was over. The survey was made

on Google form and the link was sent on their e-mail ids. Later the results were analyzed.

Results: 77.2% of students mentioned that the module had a positive impact on them. 89.9% of students feel that empathy and

compassion are required for the doctor while dealing with patients. 76.2% of students think that this module helps them to become

better doctors. 76.3% of the student feel this module should be taught to students. 82.8% feel that role play is the best method to

teach this module.

Conclusion: From our study, it is clear the even students feel that this module is essential in their profession. So, it is vital to

implement these types of modules in their regular curriculum.

11

has an outline of competency-based learning in the attitude,

ethics and communication domains that a medical professional

should have at the time of graduation so that they should

successfully fulfill the criteria of Indian medical graduate as an

excellent clinician, a perfect leader and an efficient member of

health-care team and system. They will also become an

excellent communicator, a lifelong learner, and a well-[7]developed professional.

Student insights about their importance towards the patient

begin to play an important role as their clinical experiences

advance. Doctors should provide health care which should be

tailored for each patient, care which is given to the patient

should be coordinated, family and friends on whom the patient

trusts should be involved, and care should deliver physical

well-being and emotional support.

So, keeping that in mind we also have incorporated a structured

program on ethics and communication consisting of 26

modules in our medical college. One such module was what it stmeans to be a patient which was done for our 1 -year

undergraduate medical students and we took their views

regarding the module. The objective of our study was to know

the student's views regarding the module.

MATERIAL AND METHODS:

The study was conducted on 198 undergraduate students from

Kasturba Medical College, Manipal who attended the module.

The study was exempt from review by the institutional ethics

committee as per the ICMR (Indian Council of Medical

Research) guidelines.

It was a qualitative study. Students were told to fill the

questionnaire containing six questions regarding the module

after the module was over which was based on the likert scale.

The questionnaire was made on Google form and the link was

sent on their e-mail ids.

Later the results were analyzed in percentage based on the

student's responses.

RESULTS :

77.2% of students mentioned that the module had a positive

impact on them. 89.9% of students feel that empathy and

compassion are required for a doctor while dealing with

patients. 76.2% of students think that this module helps them to

become better doctors. 76.3% of the student feel this module

should be taught to students. 82.8% said that role play is the

best method to teach such types of modules.

We had also asked them that according to them which are the

best method to teach such types of modules. The result of their

responses is shown in Table 1.

Student's perceptions on various questions that were asked

regarding the module are shown in Chart 1-5.

Table 1. Students responses regarding best methods to teach such types of modules.

Method

Role play

Videos

Case Discussion

Actual patient visits

Games

Book

Number od Students n=198 (%)

164 (82.8%)

13 (6.56%)

12 (6.06%)

7 (3.53%)

1 (0.5%)

1 (0.5%)


12

DISCUSSION :

“What it means to be a patient” in this module what we

generally look is the experience of students when once they

were patient. How do they feel? What were their expectations

from the doctors, family and society? By doing so they will feel

the importance of patient and family in the treatment of

patients and they will incorporate all these in their daily

practice when they become a full-fledged doctor.

Wilcox MV suggested that patient-centric care should be

taught to the medical students in their curriculum and it should

be focussed on their attitudes and behaviors towards the [8]patients.

Calleo V had done an unofficial survey with third-year medical

students who were participating in their emergency medicine

(EM) clerkship. Students replied that introducing an official

patient-centered care module in their EM clerkship can help

them by increasing their awareness of patient-centered care. It

will also benefit them in improving their communication skills

and lay the foundation for a career centered around patient- [9]centric care.

Boggiano VL et al had done a study on students in which

students discover that it is challenging to communicate with

patients in a patient-centered manner and they also told that

there is a need for enhanced medical education regarding

patient-centered care so that students will be well trained to

implement that in a variety of psychosocial and therapeutic [10]situations.

Tanwani R et al conducted a study to assess the perception and

attitude of medical students towards the Communication Skills

Lab (CSL) and teaching module in Central India. They found

that the majority of the students (96.43%) opined that the

training had improved their communication with the patients.

They also felt that such training should be integrated into the [11] regular teaching curriculum of our country. In our study also

76.3% of the student feel this module 'What it means to be a

patient' should be taught to students.

Jagzape TB et al had done a study to know about the perception

of medical students about the use of communication skills lab.

They found that 61.53% of the students said that more

emphasis should be given on communication between doctor

and patient. In their study, 78.46% of students also said that [12]CSL posting should be compulsory to the medical students .

In our study also 76.3% of the student feel this module should

be taught to students.

From our research also it is clear the even students feel that this

module is essential in their profession. So, it is vital to

implement these types of modules in their regular curriculum.

CONCLUSION :

From our study, it is clear that such types of modules have a

positive impact on students. Students feel that empathy and

compassion are required for a doctor while dealing with

patients. Students also feel that such type of module helps them

to become a better doctor and provide patient-centric care.

They also feel that such types of modules should be

incorporated in their regular curriculum.

REFERENCES :

1. Mahajan R, Aruldhas BW, Sharma M, Badyal DK, Singh

T. Professionalism and ethics: A proposed curriculum for

undergraduates. Int J Appl Basic Med Res. 2016 ; 6(3):

157-163

2. Dash S. Why it's Important to Educate a Doctor's Heart.

Available from:

http://www.dailyo.in/lifestyle/medicinesuicide-mental-

health-affective-domain-emotions-stresseducation-

doctors-psychology/story/1/7309.html. [Last accessed on

2020 May 31].

3. Modi JN, Gupta P, Singh T. Competency-based medical

education, entrustment and assessment. Indian Pediatr

2015; 52:413-20

4. Sood R, Adkoli BV. Medical education in India Problems

and prospects. J Indian Acad Clin Med 2000; 1:210-2.

5. Vinod Kumar CS, Kalasuramath S, Kumar CS, Jayasimha


13

VL, Shashikala P. The need of attitude and

communication competencies in medical education in

India. J Educ Res Med Teacher 2015; 3:1-4.

6. Kumar R. Medical education in India: An introspection.

Indian J Public Adm 2014; 60:146-54.

7. Attitude and Communication (AT-COM) Competencies

for the Indian Medical Graduate. Reconciliation Board.

Academic Committee of Medical Council of India. July

2015. Available from: www.mciindia.org.

8. Wilcox MV, Orlando MS, Rand CS, Record J, Christmas

C, Ziegelstein RC, and Hanyok LA. Medical students'

perceptions of the patient-centredness of the learning

environment. Perspect Med Educ. 2017; 6(1): 44-50.

9. Calleo V. The Patient Experience: Increasing Medical

Student Awareness of Patient-Centered Care. Annals of

Emergency Medicine. 2017; 70 (4): S148.

10. Boggiano VL, Yufan W, Janine B, Sylvia B, Erika S.

Patient-Centered Care Challenges and Surprises: Through

the Clerkship Students' Eyes. Family Medicine. 2017; 49:

57-61.

11. Tanwani R, Chandki R, Joshi A, Arora VK, Nyati P, Sutay

S. Perception and Attitude of Medical Students towards

Communication Skills Lab and Teaching Module. J Clin

Diagn Res. 2017 Jun; 11(6): JC12-JC14.

12. Jagzape TB, Jagzape AT, Vagha JD, Chalak A, Meshram

RJ. Perception of medical students about Communication

Skills Laboratory (CSL) in a rural medical college of

central India. Journal of Clinical and Diagnostic

Research. 2015; 9(12):JC01-JC04.



INTRODUCTION :

Human stature estimation is one of the essential aspects of

forensic anthropological investigation which is defined as the

maximum height a t ta ined during one 's l i fespan.

Anthropometry is a science that deals with methods and

techniques of measurement of living and skeletons of 1individuals.

The scope of forensic anthropology is to identify the human 2skeleton remains. With the increasing frequency of mass

disasters, it is essential to find out correlations between stature,

age, and sex of an individual with variable information

collected from different systems, organs, or its part, which is of 3immense importance. The condition is worsened when only

mutilated and fragmentary remains are available for the

examination, which is not uncommon in today's world due to

mass disasters both natural and human-made, e.g.,

earthquakes, cyclones, tsunamis, floods, terror attacks, bomb

blasts, rail accidents, wars, and plane crashes, etc. Estimating a

person's stature from such fragmented remains forms an 4essential tool of identification in such circumstances. Stature

estimation occupies a relatively central position both in

anthropological research and in identification necessitated by 5medical jurisprudence or medico-legal experts.

The hand may be available for the analysis and also that part

may not be having sufficient ridge characteristic to establish

identity. Many time impressions of any of the phalanges or

only outline of the palm may available. In these cases, only

possibility to use that information is to measure the available

path to determine the stature estimation to identify the missing 6person.


Dr Kuldip Kumar,


Department of Forensic Medicine and Toxicology, Government

Medical College, Amritsar.

Contact : +91 98146-39916

Email : [email protected]

KEYWORDS : Anthropometry, Hand length, Finger length, Stature Estimation

Article History:Received: 5 December 2020Received in revised form: 13 December 2020Accepted on: 13 December 2020Available online: 15 August 2021

rd1. Jaspinder Pratap Singh, Junior Resident 3 year*2. Ashok Chanana, Professor and Head*3. Kuldip Kumar, Associate Professor*4. Jatinder Pal Singh, Assistant Professor*5. Manpreet Kaul, Lecturer* *Department of Forensic Medicine and Toxicology, Government Medical College, Amritsar.

Anthropometric Correlation between Stature and Measurements of

Hand & Finger Length


14

ABSTRACT :

Introduction: Stature is defined as the maximum height attained during one's lifespan. Human stature estimation is one of the

essential aspects of Forensic anthropological investigation which helps in the identification of a person or a body in different civil

and criminal matters.

Material and Method:The present prospective cross-sectional study was carried out in the Department of Forensic Medicine and

Toxicology, Government Medical College, Amritsar on 200 healthy undergraduate Punjabi students (100 males and 100 females)

to find out the bilateral and bisexual variations from the percutaneous measurement of length and breadth of hand and fingers except

thumb to reconstruct the stature for identification purposes.

Results: The mean height in males was 174.3690±6.18 cm, in females were 159.50±6.22 cm and in all the subject (N=200), the

mean height calculated was 166.94±9.68 cm. coefficient, 't' test and ANOVA test and regression equation for height is formulated.

The regression equation for all the subjects (n=200) is Y = 36.734 + (4.994 * LHL) + (2.683 * RHW) + (5.023 * RMFL) – (3.489 *

LRFL).

Conclusion: Stature is observed significantly related to hand length, width and length of fingers. Linear regression equations for

estimation of stature would be of immense value for medical professionals and can be used for identification of a person from stature

for civil and criminal purpose wherever required.

MATERIAL AND METHOD

The present prospective cross-sectional study was carried out

in the Department of Forensic Medicine and Toxicology,

Government Medical College, Amritsar to find out the bilateral

and bisexual variations from the percutaneous measurement of

length and breadth of hand and fingers except thumb to

reconstruct the stature for identification purposes.

INCLUSION CRITERIA: 200 healthy undergraduate

students (100 males and 100 females) were taken up for the

study with age group 18 years to 25 years with valid age proof

(Birth certificate/High school Certificate/Ration card/Bank

passbook/Voter ID/ Driving license). Before the procedure,

written informed consent was obtained from the students.

EXCLUSION CRITERIA: Cases with any pathology,

congenital anomaly/amputation (surgical or accidental) of the

hand or any finger are excluded from the study.

MATERIALS AND METHODS :

The stature was measured by a stadiometer. (Figure 1-2) The

hand length, breadth, and finger length were measured by

measuring scale and vernier calipers. Thumb measurements

were not taken in the present study for the reason of its variable

flexibility as compared to other fingers. The parameter were

measured as follow:

Stature:

Measured as vertical distance from the vertex to the foot.

Measurement was taken by making the subject to stand erect

on stadiometer on its horizontal resting plane, barefooted.

Palms of hands turned inward and fingers horizontally pointing

downwards and head oriented in eye-ear-eye plane (Frankfurt

Plane). Movable rod of the stadiometer was brought in contact

with vertex in the midsagittal plane. (Figure 1-2)

Hand Length:

Hand Length is measured as the straight distance from the wrist

crease to the middle finger's most forwardly projecting point.

Measuring scale was used to measure the hand length. (Figure

3)

Hand Width is measured as

shown in Figure 4

Finger Length:

Finger length is measured distance from the midpoint of the

proximal finger crease to the tip of the finger. Vernier calipers

was used to measure the finger length, based on the plane

surface with palm facing upwards.(Figure 5-8)

15

Fig 1 Fig 2

Fig 4

Fig 3

5 6


RESULTS :

The mean height in males was 174.3690±6.18 cm and females

were 159.50±6.22 cm while, in all the subject (N=200) the

mean height was calculated as 166.94±9.68 cm. (Table 1)

The mean value of right hand length in males was 19.74±0.87

cm while in females, it was 17.92±0.84 cm and in total number

of subjects was 18.83±1.25 cm. The mean width of the right

hand in males was 8.84±0.77 cm and females were 7.69±0.44

cm, while the total number of subjects was 8.26±0.85 cm. The

mean length of right index finger length in males was

7.50±0.45 cm and females were 7.05±0.48 cm, while the total

number of subjects was 7.28±0.52 cm. The mean length of

right middle finger length in males was 8.32±0.45 cm and

females were 7.81±0.50 cm, while the total number of subjects

was 8.07±0.54 cm. The mean length of right ring finger length

in males was 7.77±0.46 cm and females were 7.32±0.48 cm,

while the total number of subjects was 7.54±0.52 cm. The

mean length of right little finger length in males was 6.38±0.43

cm and females were 6.04±0.53 cm, while the total number of

subjects was 6.21±0.51 cm. (Table 2)

The mean value of left hand length in males was 19.65±0.83

cm while in females, it was 17.83±0.88 cm and in total number

of subjects was 18.74±1.25 cm. The mean width of left hand in

males was 8.66±0.74 cm and females were 7.58±0.44 cm,


mean length of left index finger length in males was 7.51±0.49


subjects was 7.29±0.52 cm. The mean length of left middle

finger length in males was 8.28±0.49 cm and females were

7.80±0.46 cm, while the total number of subjects was

8.04±0.53 cm. The mean length of left ring finger length in

males was 7.73±0.47 cm and females were 7.22±0.48 cm,


mean length of left little finger length in males were 6.27±0.52


subjects was 6.10±0.51 cm. (Table 3)

16

7

8

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Table 2 : Bisexual Variation of Right Hand Length, Width And Finger Lengths

Lengths N

100

100

200

100

100

200

100

100

200

100

100

200

100

100

200

100

100

200

Mean±S.D. (in cm)

19.74±0.87

17.92±0.84

18.83±1.25

8.84±0.77

7.69±0.44

8.26±0.85

7.50±0.45

7.05±0.48

7.28±0.52

8.32±0.45

7.81±0.50

8.07±0.54

7.77±0.46

7.32±0.48

7.54±0.52

6.38±0.43

6.04±0.53

6.21±0.51

Std. Error

0.09

0.08

0.09

0.08

0.04

0.06

0.05

0.05

0.04

0.05

0.05

0.04

0.05

0.05

0.04

0.04

0.05

0.04

Right Hand Length

Right Hand Width

Right Index Finger Length

Right Middle Finger Length

Right Ring Finger Length

Right Little Finger Length

Male

Female

Total

Mean±S.D.(in cms)

174.37±6.18

159.50±6.22

166.94±9.68

N

100

100

200

Std. Error

0.62

0.62

0.68

p<0.001 (Highly Significant)

Table 1 : Bisexual Variation of Height of All Subjects


In the paired sample test, the mean value of right hand length

and left hand length was 0.09±0.36 with standard error of mean

was 0.04. The mean width of the right hand and the left hand of

males was 0.18±0.28 with a standard error of mean of 0.03.

The mean value of index finger length of left hand and right

hand of males was 0.00±0.23 cm with standard error of mean

was 0.02. The mean value of middle finger length of right hand

and left hand of males was 0.04±0.26 cm with standard error of

mean was 0.26. The mean value of ring finger length of right

hand and left hand of males was 0.03±0.22 cm with standard

error of mean was 0.02. The mean value of little finger length of

right hand and left hand of males was 0.11±0.32 cm with

standard error of mean was 0.03. (Table 4)

In the paired sample test, the mean value of right hand length

and left hand length of females was 0.09±0.35 cm with

standard error of mean was 0.04. The mean width of right hand

and left hand of females was 0. 0.11±0.20 cm with standard

error of mean was 0.02. The mean value of index finger length

of left hand and right hand of females was -0.02±0.22 cm with

17

Paired Differences

0.09±0.36

0.18±0.28

0.00±0.23

0.04±0.26

0.03±0.22

0.11±0.32

0.04

0.03

0.02

0.26

0.02

0.03

2.49

6.27

-0.21

1.65

1.58

3.62

0.14

0.00

-0.84

0.10

0.12

0.00

Mean±S.D (in cms) Std Error Mean

Table 4: Paired Sample Test Right Hand Versus Left Hand Among Males

Lengths in Male

Right Hand Length-Left Hand Length

Right Hand Width-Left Hand Width

't' test 'p' value

Right Index Finger Length-Left Index Finger Length

Right Middle Finger Length-Left Middle Finger Length

Right Ring Finger Length-Left Middle Finger Length

Right Little Finger Length-Left Middle Finger Length

Mean±S,D.(in cms)

19.65±0.83

17.83±0.88

18.74±1.25

8.66±0.74

7.58±0.44

8.12±0.82

7.51±0.49

7.06±0.46

7.29±0.52

8.28±0.49

7.80±0.46

8.04±0.53

7.73±0.47

7.22±0.48

7.47±0.54

6.27±0.52

5.93±0.44

6.10±0.51

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Table 3 : Bisexual Variation of Left Hand Length, Width And Finger Lengths

Lengths N

100

100

200

100

100

200

100

100

200

100

100

200

100

100

200

100

100

200

Std. Error

0.08

0.09

0.09

0.07

0.04

0.06

0.05

0.05

0.04

0.05

0.05

0.04

0.05

0.05

0.04

0.05

0.04

0.04

Left Hand Length

Left Hand Width

Left Index Finger Length

Left Middle Finger Length

Left Ring Finger Length

Left Little Finger Length


standard error of mean was 0.02. The mean value of middle

finger length of right hand and left hand of females was

0.01±0.24 cm with standard error of mean was 0.02. The mean

value of ring finger length of right hand and left hand of

females was 0.10±0.21 cm with standard error of mean was

0.02. The mean value of little finger length of right hand and

females' left hand was 0.11±0.36 cm with standard error of

mean was 0.04. (Table 5)

Height of an individual from different significant lengths was

calculated. The significant lengths are determined using

Pearson's correlation coefficient, 't' test and ANOVA test and

regression equation for height was formulated. The correlation

coefficient was found significant between the height of all the

subjects with left hand length, right hand width, right middle

finger length and left ring finger length which are further

confirmed with the values of 't' test, p- value, R square, adjusted

R square and ANOVA test. The regression equation for all the

subjects (n=200) was Y = 36.734 + (4.994 * LHL) + (2.683 *

RHW) + (5.023 * RMFL) – (3.489 * LRFL).

The correlation coefficient was significant between the height

of males with left hand length, right hand width, length of right

middle finger and right little finger. The regression equation

for males (n=100) was Y = 57.158 + (7.883 * RMFL) - (5.413 *

RLFL) + (1.322 * RHW) + (3.788 * LHL). The correlation

coefficient was found significant between females' height with

length of left hand and right middle finger. The regression

equation for females (n=100) is Y = 78.715 + (3.543 * RMFL)

+ (2.980 * LHL). (Table 6)

DISCUSSION :

Height : The present study correlates with the study conducted 7 8by Patel et al (2014) , Pandit et al (2018) and Jasuja et al

6(2004) who concluded that the mean height of men exceeds

the mean height of women. This present study correlates with

the study of Chawla et al (2013) where the male subjects were

taken and the mean height is 171.3 cm. This study was also 9 conducted in the subjects of Northern India. This present study

10is different from the study conducted by Sunil et al (2005) , 11 12Sushil et al (2010) , Pal et al (2016) , due to the different

region in which the study has been conducted. Another study,

was conducted by Kavyashree et al (2015) to compare the

height variation among South Indian and North Indian medical

students aged between 20 to 22 years. Where the mean height

in males was 169.04±5.49 cm and females was 1.58.42±5.20 13cm, similar to the present study.

Palimar V et al (2018) conducted a study for the prediction of

stature from the hand length in the South Indian population and

18

Regression Equation

Y = 36.734 + (4.994 * LHL) + (2.683 * RHW) + (5.023 * RMFL) – (3.489 * LRFL)

Y = 57.158 + (7.883 * RMFL) - (5.413 * RLFL) + (1.322 * RHW) + (3.788 * LHL)

Y = 78.715 + (3.543 * RMFL) + (2.980 * LHL)

Overall

Males

Females

Table 6 : Regression Equation To Estimate Height In All The Subjects

Paired Differences

0.09±0.35

0.11±0.20

-0.02±0.22

0.01±0.24

0.10±0.21

0.11±0.36

0.04

0.02

0.02

0.02

0.02

0.04

2.67

5.83

-7.13

0.25

4.83

3.38

0.01

0.00

0.48

0.80

0.00

0.00

Mean±S.D (in cms) Std Error Mean

Table 4: Paired Sample Test Right Hand Versus Left Hand Among Female

Lengths in Female

Right Hand Length-Left Hand Length

Right Hand Width-Left Hand Width

't' test 'p' value

Right Index Finger Length-Left Index Finger Length

Right Middle Finger Length-Left Middle Finger Length

Right Ring Finger Length-Left Middle Finger Length

Right Little Finger Length-Left Middle Finger Length

p<0.05 (Significant)


mean height was 165.67±6.46cm in males and 157.97±6.5 cm 14in females. In Another study by Pournima et al (2019) where

the mean height was 162cm, which is less as compared to the

subjects of the present study as the region of study is different.

The studies conducted in South Indian population indicated

that the mean height in both males and females is less as 15compared to the mean height in the North Indian population.

Hand Length : The present study correlates with the study of 3Tandon et al (2016) which investigated the association of hand

length with height. The present study correlates with the study 16of Rastogi et al (2009) where the mean height in right hand of

males is 18.89 cm and in females was 17.01 cm while in left

hand of males is 18.87 and in females is 17.01 cm and it was

observed that mean hand length in females was less as compared to the present study. Jasuja et al (2004) in his study

concluded that the mean hand length in males is 19.8 on right

side while 19.79cm in left hand while in females is 17.51 cm of

right hand and 17.47 cm of left hand. Similarity of results was 6observed because the study was conducted in the same region.

Another study, was conducted by Kavyashree et al (2015) to

compare the hand length variation among south Indian and

North Indian medical students aged between 20 to 22 years.

Where the mean hand length in males was 18.70±2.13 cm in

males and 17.31±1.05 cm in females, the mean hand width was

found 8.10±0.33 cm in males which was found similar to the

present study where the mean hand width in males was 138.84±0.77 cm.

This present study differs from the studies carried out by

Krishan et al(2014) conducted in North India between the age

group of 17 years to 20 years where the mean hand length was

found 16.80±0.80 cm in females. The mean hand width was

7.30±0.40 cm which is less as compared to the present study.

Probable reason is the age group was different as compared to 17the present study.

Another study conducted by Pal et al (2016) conducted in

Bengalee population, West Bengal was different from the

present study perhaps due to the different region in which the

study has been conducted as the mean hand length in Bengalee

population was found out to be 16.30±0.86 cm. The mean hand

length in Bengalee population is found less as compared to the

mean hand length in the present study conducted in Punjabi 12population.

Regression Equation Males : (Table 7)

Regression Equation Females : (Table 8)

CONCLUSION :

The mean values of the stature in males are statistically higher

than that of females (p<0.001; Highly Significant). The mean

values of the right side of hand show approximately no

bilateral variation than the left hand. The corelation of mean

height with other studies is mainly because of area of study is

similar geographical region while difference in observations

can be due to the different geographical area, difference in

dietary habits and hereditary factors in growth of an individual.

19

Authors Regression Equation

Males

Right Hand Left Hand

Height = 127.97 +2.06 (HLR) Height = 141.64 +4.40 (HLL)18Bhatnagar et al (1984)

19Thakur et al (1987)

20Abdel- Malek(1990)

6Jasuja OP et al (2004)

10Sunil et al (2005)

21Ilayperuma (2009)

22Krishan et al (2012)

9Chawla et al (2013)

7Patel (2014)

23Khanpurkar S & Radke A (2012)

Present Study

Height = 51.388 + 5.988 (HLR) Height = 158.91 + 0.440 (HLL)

H=34.5+ 5.77HL+2.7HB+5.1

Height = 69.51 + 5.22 (HLR) Height = 84.74 + 4.5 (HLR)

Height= 86.93+ 4.25 (HLR) Height= 85.84+ 4.32 (HLL)

Height = 103.70 + 3.49 HL

Height = 87.33 +4.45 (HLL)


Height= 125.15+ 2.69(HLR) Height= 125.67+ 2.67(HLL)

Height = 92.1 + 4.2 HL

Y = 57.158 + (7.883 * RMFL) - (5.413 * RLFL) + (1.322 * RHW) + (3.788 * LHL)

Table 7 : Regression Equation Males


A significant correlation of height with hand length has been

observed in both the sexes in the present study. Stature is

observed significantly related to hand length, width and length

of fingers. Both left- and right-hand measurements in both

sexes have been given due consideration. Linear regression

equations for estimation of stature would be of immense value

for medical professionals and can be used for identification of a

person from stature for civil and criminal purpose wherever

required. The present study further suggests that the equations

derived for a population group gives better applicability when

applied to the similar population group. The research work on

anthropometric relationship should be encouraged among

different population and among the different age groups of

country.

REFERENCES :

1. Singh IP, Bhasin MK. Anthropometry- A laboratory

manual of biological anthropology. Delhi: Kamal Raj

Enterprises; 1968.

2. Jaiswal A, Selvan ET. Estimation of stature from the

Facial and Upper Limb Measurements among the

kattunayakan Tribes of District Madurai, Tamil Nadu.

IJRSA. 2016; 2(2):34-42.

3. Rati Tandon, Syed Mobashir Yunus, Nafis Ahamed

Faruqi, Adil Asghar Measurements of hand and foot A

Predictor of stature in adult human population of Uttar

Pradesh International Journal of Anatomy , Radiology and

Surgery. 2016;(5):12-15.

4. Raju GM, Shahina, DubeyS and Vijayanath V estimation

of stature from index and ring finger in Devangere district

Int J Clin Trials. 2014; 1:18-21.

5. Rani M, Tyagi AK, Ranga VK, Rani Y, Murari A, Stature

e s t i m a t e s f r o m f o o t d i m e n s i o n s . F o o t .

2011;19(26.500):23-348.

6. Jasuja OP, Singh G. Estimation of stature from hand and

phalange length. Journal of indian academy of forensic

medicine. 2004;26(3):100-6.

7. Patel JP, Patel BG, Shah RK, Bhojak NR and Desai JN.

Estimation of stature from hand length in Gujrat region

NHL Journal of medical science. 2014;3(1):1-5.

8. Pandit R, Sharma N. Prediction of stature from hand

length in undergraduate students of College of Medical

Science and Teaching Hospital, Chitwan. Int J Anat Res.

2018;6(1.1):4866-4870.

9. Chawla M. The relationship between hand breadth and

height in adult males of North Indian Punjabi population.

Journal of Evolution of Medical and Dental Sciences

2013;2(12):1880–87.

10. Dikshit PC, Aggrawal A, Rani M. Estimation of stature

from hand length. Journal of Indian Academy of Forensic

Medicine. 2005;27(4):219-21.

11. Sushil K, Srivastava AK, Sahai MKB. Estimation of

stature by anthropometric examination of forearm and

hand. J Indian Acad Forensic Med. 2010;32(1):89-92

12. Pal A, De S, Sengupta P, Maity P, Dhara PC. Estimation of

stature from hand dimensions in Bengalee population,

West Bengal, India. Egyptian Journal of Forensic

Sciences. 2016 Jun 1;6(2):90-8.

20

Authors

18Bhatnagar et al (1984)

20Adel Malek et al (1990)

6Jasuja et al (2004)

10Sunil et al (2005)

21Ilayperuma (2009)

22Krishan et al (2012)

7Patel et al (2014)

23Khanpurkar S & Radke A (2012)

Present Study

Regression Equation

Females

Right Hand Left Hand

Height = 127.97 +2.06 (HLR) Height = 141.64 +4.40 (HLL)

H=34.5+ 5.77HL+2.7HB+5.1

Height = 130.95+ 1.61 (HLR) Height = 130.04+ 1.66 (HLR)


Height = 93.70 + 3.63 HL

Height = 84.539 +4.238 (HLL)

Height= 110.64+ 2.95 (HLR)

Height = 84.9 + 4.3 HL Height= 110.69+ 2.95(HLL)

Y = 78.715 + (3.543 * RMFL)+(2.980 * LHL)

Table 8 : Regression Equation Females


13. K a v y a s h r e e A N , B i n d u r a n i M K , A s h a K R .

Determination of stature from hand dimensions in Indian

population, Journal of International Medicine and

Dentistry. 2015;2(3):209-214.

14. Palimar V, Gupta C, Guru P. Prediction of stature from the

hand length of an individual in South Indian population.

Journal of Punjab Academy of Forensic Medicine &

Toxicology. 2018;18(2):12-4.

15. Pournima, Rajesh JJ, Kumar KM, Reddy BS, Feula A.

Stature estimation from length of fingers in South Indian

population – A cross sectional study, J Indian Acad

Forensic Med. 2019 Oct-Dec; 41(4): 226-228.

16. Rastogi P, Kanchan T, Menezes RG, Yoganarasimha.

Middle finger length- a predictor of stature in the Indian

population. Med Sci Law. 2009;49(2):123-126.

17. Krishan K. Determination of stature from foot and its seg-

ments in a north Indian population. Am J Forensic Med

Pathol. 2008;29(4):297–303.

18. Bhatnagar DP, Thapar SP, Batish MK. Identification of

personal height from somatometery of hands in the

Punjabi males, Forensic science international.

1984;24:137-141.

19. Thakur SD, Rai KS. Determination of Stature from hand

measurement. Medicine Science and Law. 1987;78:25-8.

20. Abdul-Malek AK, Ahmed AM, EL-Sharkawi SA and EL-

Hamid N A. Predic t ion of s ta ture f rom hand

measurements. Forensic Science International.

1990;46:181–7.

21. Ilayperuma I, Nanayakkara G, Palahepitiya N. Prediction

of personal stature based on the hand length. Galle Med J.

2009;14 (1):15–8.

22. Krishan K. Determination of stature from foot and its seg-

ments in a north Indian population. Am J Forensic Med

Pathol. 2008;29(4):297–303.

23. Khanpurkar S, Radke A. Estimation of stature from foot

length, hand length and head length in Maharashtra

region. Indian Journal of Basic and applied Medical

Research 2012;1(2):77-85

21



INTRODUCTION :

Medicolegal cases are imperative part of medical practice and

is an important constituent of emergencies of tertiary care

center . Violence in any form is a social and health problem for

all who experience and witness it. Intentional injury, including

interpersonal violence and self-harm is found to be one of the

leading causes of preventable injury in the world. Clinically an

injury or wound means disruption of the anatomical or natural 1continuity of any of the tissues of the body. As per Sec. 44,

IPC – An injury is defined as any harm whatsoever illegally 2caused to any person in body, mind, reputation or property.

According to Sec. 351, IPC 'assault' is defined as every attack

or threat or attempt to apply force on the body of another in a 3 hostile manner. The incidence of assaults are rising up

significantly with most probable factors contributing to this

hike are unemployment, illiteracy, low wages, decreased

capacity to cope up with prevailing situation and stress, drug

addiction, prevalent economic, social and political

environment, easy availability of weapon and long delays in

the delivery of justice to the victims. Assessment and

interpretation of injury depends upon a good medicolegal

history, an appropriate physical examination and recording the

findings clearly, accurately and unambiguously. Such

documentation in the form of medicolegal reports etc. may be

reviewed by other doctors, legal advisors and in the court of

law as an important documentary evidence.

MATERIAL AND METHODS:

Present prospective study of 500 medico-legal assault cases,


Dr Kuldip Kumar,


Department of Forensic Medicine and Toxicology, Government

Medical College, Amritsar.

Contact : +91 98146-39916


KEYWORDS : Medicolegal Cases, Assault, Mechanical Injuries, Fracture .

Article History:Received: 8 December 2020Received in revised form: 30 May 2021Accepted on: 30 May 2021Available online: 15 August 2021

1. Aashish Sharma, Junior Resident 3rd year*2. Kuldip Kumar, Associate Professor*3. Ashok Chanana, Professor & Head*4. Didar Singh Walia, Associate Professor* 5. Jatinderpal Singh, Assistant Professor*6. Manpreet Kaul, Lecturer* *Department of Forensic Medicine & Toxicology , Government Medical College, Amritsar

A Clinical Forensic Medicine Study of Mechanical Injuries in Assault Cases


22

ABSTRACT :

Introduction: Medicolegal cases are imperative part of medical practice and is an important constituent of emergencies of tertiary

care centers and the doctor on duty prepares medicolegal reports of such cases. The pattern of mechanical injuries due to assault

differ between countries and communities due to their specific traditional , cultural and social factors prevalent in their areas. The

major chunk of these medicolegal cases are of injuries caused as result of violence in this part of India.

Materials & Methods: The present study of 500 medicolegal cases of mechanical injuries of assault was conducted of those

patients, who were admitted to Emergency department of Guru Nanak Dev Hospital attached to Government Medical College,

Amritsar noting down their demographic details and injury details both clinically as well as radiologically.

Results: In this study it was observed that majority of medicolegal cases were seen among males (89%) of age group of 21-40

years (61%). Majority of the cases belonged to rural background (77%) and most commonly involved occupational group was the

labourers (35.4%) . Also, the majority of injuries were simple in nature(79.8%) and were predominantly inflicted by blunt

weapon(67.6%) however the reverse trend was seen in injuries with grievous nature where the most common weapon was sharp

edged weapon(55.1%) .

Conclusions: Since the assault related injury cases were higher among males, in young age group and in a rural population so for

prevention of assault related activities, the main focus should be on encouraging the young age group, the concept of tolerance and

rationalism.

for mechanical injuries, who attended the emergency &

causality department of Guru Nanak Dev Hospital attached to

Government Medical College, Amritsar was conducted with

effect from 01/11/2018 to 18/04/2020. All the details related to

patient and detailed history of violence were mentioned in the

attached pre designed proforma. The detailed examination of

assault cases was done after taking written informed consent

from the patient and of one witness mostly his or her relative or

friend. The injuries were examined and documented in detail

with respect to its location, size, nature, causative factor,

probable weapon and it was correlated with the history with

specific attention to its age, nature of injury. Radiological

findings and hospital record findings were incorporated for

proper evaluation of injuries. The data collected from this

study had been organized by presenting it in the form of

appropriate tables and graphs, which is statistically analysed

for percentage and inferences.

RESULTS:

Gender wise distribution of cases

In the present study it was observed that majority of the cases

i.e. 445 (89%) of the victims were males & only 55 (11%) were

females out of total 500 medico-legal cases.

Age & gender wise distribution of medicolegal cases

Majority of male victims were in the age group of 21 to 30

years with 178 cases (35.6%) and in females, maximum

number of cases were found in the age group of 31 to 40 years

with 21 cases (4.2%). Least number of cases in males were

found in age group of 0 to 10 years i.e. 3 cases (0.6%).

However, no female cases were reported in age group of 0 to10

years. This study also showed that in both males and females

21 to 40 years of age group were most commonly involved in

scuffle. (Table1)

Occupation wise distribution of cases

As far as occupation wise distribution of medicolegal cases

was concerned labourers were more commonly involved

occupational group with 177 cases (35.4%) followed by

victims engaged in private jobs with 132 cases (26.4%) and

farmers with 103 medicolegal cases (20.6%). Least number of

medcolegal cases were found in student group with 38(7.6%).

(Table 2)

Religion wise distribution of cases

In the present study majority of assault cases 408(81.6%); were

from Sikh community while Hindu community constituted

only 64 cases (12.8%) further followed by Christians with 23

(4.6%) medicolegal cases. Least number of cases 5(1%) were

reported in Muslim community with mechanical injuries

Distribution of cases according to type of mechanical

injury

In the present study the most common type of mechanical

injuries recorded among medicolegal cases were Incised

wound in 243 cases (48.6%) followed by Lacerated wound in

157 cases (31.4%), Bruises in 82 cases (16.4%) and Abrasions

in 16 cases(3.2%). Only 2 cases of Stab wound injury were

recorded in this study. Out of 243 cases of Incised wounds,

92.5% males had suffered from Incised wounds as compared to

only 7.5% females. For 157 cases of Lacerated wounds, 90.4%

cases were of males and only 9.6% are of females. Of 82 cases

of Bruises, 72.6% cases were of males and 24.4% were of

females. For 16 cases of Abrasions, 87.5% were of males and

12.5% were of females. Stab wounds were present only in

males. This study clearly depicted that the most common type

of injury inflicted among males were Incised wounds whereas

in case of females predominance of Bruises were seen. Incised

wounds (7.5%) being the least common type of mechanical

injury recorded among females. Moreover no case of Stab

wound injury was noticed in females. (Table 3)

Area wise distribution of cases

Majority of medicolegal cases in the present study were from

rural background with 385 (77%) cases as compared to urban

areas which constituted only 115 (23%) of the total cases.

23

Table 2 : Occupation wise distribution of cases

Occupation

Labour

Private job

Farmer

Unemployed

Student

Total

No.

177

132

103

50

38

500

%

35.4

26.4

20.6

10

7.6

100

Table 1 : Age & gender wise distribution of cases

Age Range

(Years)

0-10

11-20

21-30

31-40

41-50

51-60

61-70

>70

TOTAL

No

3

43

178

98

62

28

24

9

445

No

0

3

8

21

10

2

9

2

55

No

3

46

186

119

72

30

33

11

500

%

0.6

8.6

35.6

19.6

12.4

5.6

4.8

1.8

89

%

0

0.6

1.6

4.2

2

0.4

1.8

0.4

11

%

0.6

9.2

37.2

23.8

1434

6

6.6

2.2

100

Male Female Total


Type of mechanical injury in relation to total no of injuries

in victims

Out of the total 1362 mechanical injuries inflicted to 500

patients the most common type of mechanical injuries were

Incised wounds in 480 (35.2%) injuries followed by Bruises

with 423 (31.1%) injuries further followed by Lacerated

wound with 286 (20.9%) injuries, Abrasion with 170 (12.5%)

injuries and Stab wound with only 3 (0.2%) injuries.

Gender wise distribution of mechanical injuries according

to the anatomical sites of the body

The most common site of infliction of injuries in case of males

as well females was head and neck region with 289 (57.8%)

cases for males as compared to only 29 (5.8%) cases for

females followed by upper limbs with 106 (21.2%) cases for

males and 11(2.2%) cases for females and in lower limbs with

26 (5.2%) cases for males and 9 (1.8%) cases for female. Least

number of cases in males was seen over chest i.e. 5 (1%) cases

followed by abdomen 3 (0.6%) cases. However least number

of cases in females was seen over abdomen with 2 (0.4%) and

back with only 1 (0.2%) case with no injury over the chest was

noted.

Relationship between body part involved & type of

mechanical injury

The most commonly encountered injury over the head and

neck region of the body in the present study were Incised

wounds with 217 (36.5%) injuries, Lacerated wounds with 202

(33.8%) injuries followed by Bruises with 132 (22.2%)

injuries. Abrasions (7.5%) were least common type of

mechanical injury present over the head and neck region. The

commonest type of injury in upper limb region was similar to

that found in head and neck area which were incised wounds

with 197(47.8%) injuries. However, the second most

commonly encountered injury in upper limb area were Bruises

with 116 (28.1%) injuries followed by Lacerated wound and

Abrasions with 50(12.8%) and 49(11.8%) injuries

respectively. A different scenario was seen in lower limb area

with respect to type of injury inflicted with predominance of

Bruises i.e. 57(33.3%) injuries followed by Abrasions with

43(25.1%) injuries, Incised wound with 41(23.9%) injuries

and least number of injuries over lower limb area were of

Lacerated wound i.e. 30(17.5%) injuries.

Trunk region was least commonly involved anatomical site in

relation to infliction of Incised and Lacerated wounds.

However Bruises were inflicted more commonly over head &

neck region, upper limbs followed by trunk region in contrast

to findings observed in case of other mechanical injuries in this

study.

Duration of mechanical injuries

In maximum number of injuries 1135 (83.1%); the time

interval between the incidence of assault and medicolegal

cases was less than 6 hours. In this study, 95.9% of the injuries

were examined within 24 hours of the occurrence of the scuffle

and only 1.1% of the injuries were examined after 48 hours.

Direction of mechanical injuries

Most of the victims of the assault in the present study sustained

injuries in oblique direction 686 (83.9%) injuries followed by

vertical direction in 102 (12.4%) injuries. Horizontal cuts were

least commonly sustained over the body with only 88 (10.7%)

injuries.

Weapon of offence in mechanical injuries

The most commonly used weapon of offence for infliction of

injuries were blunt inflicting 846 (63.4%) injuries followed by

sharp edged weapons inflicting 480 (35.2%) injuries. Least

number of injuries 18 (1.3%) were inflicted by sharp pointed

weapon.

Kind of weapon used in relation to body parts affected

The most commonly used weapon of offence over the head and

neck region of the body was blunt weapon inflicting 376

(63.9%) injuries, as compared to sharp edged weapons

inflicting 211 (35.9%) injuries. Only a single injury was caused

by sharp pointed weapon over the head and neck region. The

commonest type of weapon used in upper limb region was

similar to that found in head and neck area which was blunt

weapon inflicting 208(50.5%) injuries closely followed by

sharp edged weapons inflicting 199 (48.3%) injuries. Sharp

pointed weapon resulted in 5 (1.2%) injuries over the upper

limb region. Similarly in case of lower limbs predominance of

blunt weapon inflicted injuries i.e. 135 (77.1%) was seen

followed by sharp edged weapons inflicting 40 (22.9%)

injuries. However no injury by sharp pointed weapon was

inflicted over the lower limbs. On the abdomen, 10 (52.6%)

injuries were inflicted by blunt weapon, followed by only 8

(42.2%) injuries which were caused by sharp edged weapon

and least number of injuries were inflicted by sharp pointed

weapon amounting to 1 (5.2%) injury.

24

Table 3 : Distribution of cases according to type of injury

Type of Injury

Incised Wound

Lacerated Wound

Bruise

Abrasion

Stab wound

Total

No.of

Cases

225

142

62

14

2

445

No.of

Cases

18

15

20

2

0

55

%

92.5

90.4

75.6

87.5

1.00

89

%

7.5

9.6

24.4

12.5

0

11

243

157

82

16

2

500

Male FemaleTotal

Victims


Nature of mechanical injuries

In majority of cases i.e. 346 cases with 1088 (79.8%) injuries

were declared as simple in nature followed by 135 cases with

234 (17.1%) injuries were declared as grievous in nature which

also included fabricated or self-inflicted injuries. Only 1 case

(0.07%) was declared dangerous to life in this study. Out of

total 500 medicolegal cases examined for mechanical injuries

in only 63 (12.6 %) cases with 94 injuries were declared as

fabricated or self inflicted injuries while 87.4 % injuries were

genuine injuries .The nature of 39 injuries of 18 cases was not

declared either because of the noncompliance of patient for

getting medicolegal X-ray done or because of unavailability of

circumstantial evidences as asked from the investigating

officer.

Gender wise distribution of nature of mechanical injuries

The incidence of simple injuries in males were 301 (70.5%)

cases of the total male victims whereas in case of females

simple injuries were 45 (81.9%) in number. Incidence of

injuries declared grievous in nature in case of males was found

in 125 (29.3%) cases out of total male cases while in case of

females only 10 (18.1%) cases were reported with grievous

nature injuries. Only a single (0.2%) case of injury with

dangerous to life was noted in male victim. In this study no

injury with dangerous to life was found in female victims.

Kind of weapon used and relationship with nature of

injuries

This study showed that majority of injuries with simple nature

were predominantly inflicted by blunt weapon i.e 736 (67.6%)

out of total 1088 simple injuries followed by those inflicted

with sharp edged weapons with 336 (30.9%) injuries. However

on the other hand reverse trend was seen in injuries with

grievous nature where the most common weapon of offence for

inflicting injuries with grievous nature was sharp edged

weapon with 129 (55.1%) injuries followed by injuries

inflicted with blunt weapon with 105 (44.9%) injuries out of

total 234 grievous injuries. In this study no injury with

grievous nature was inflicted by sharp pointed weapon. This

study also showed that the single injury with dangerous to life

was inflicted by a sharp pointed weapon.

Relationship between mechanical injuries & grievous hurt

The present study depicted that out of total 234 injuries

declared as grievous in nature, majority were incised wounds

with 130 (55.5%) injuries, followed by bruises with 55

(23.5%) injuries, lacerated wounds with 41 (17.6%) injuries

and abrasions with only 8 (3.4%) injuries. This study showed

that sharp edged weapons are most commonly used as

compared to blunt weapons in inflicting injuries with grievous

nature.

Relationship of injuries with grievous nature and site of

infliction

The present study showed that the most common anatomical

site for injury with grievous nature was upper limb with 108

(46.1%) injuries and head & neck region with 89 (38.1%)

injuries. The other anatomical site for injuries with grievous

nature included lower limb with 28 (12.1%) injuries. This

study observed that the limbs (58.2%) were the commonest site

for injuries with grievous hurt followed by head & neck region

(38.1%). The least commonly involved body parts in this study

were chest, back and shoulder region with 3 (1.2%) injuries

each. No injury with grievous nature was found over the

abdominal region.

Radiological & hospital findings in association with

grievous injuries

The present study showed a mixed pattern of radiological and

hospital findings in association with grievous injuries. In

general; majority of fractures i.e 46.2% were seen in upper

limb bones followed by 33.4% of fracture are inflicted over

skull bones. Incidence of fractures were also seen in lower

limbs bones accounting for 16.6% of the total grievous

injuries. Only 1.4% fracture were observed in case of ribs. This

study showed that maximum number of injuries 98.4% with

grievous nature were covered under the clause 7 of Sec. 320

IPC involving mostly fracture of limb bones & skull bones.

Least number of injuries declared as grievous in nature were

either due to amputation of finger (0.8%), fracture tooth

(0.8%), permanent scar leading to disfiguration of face (0.4%)

and tendon injury (0.4%) leading to loss of power of member or

joint.

DISCUSSION :

In the present study it was observed that majority of cases, 89%

(445) of the victims were males and only 11% (55) were

females. Results of present study are more or less similar to the 4 studies conducted by Zargar et al (2004) , Tajammul et al

5, 6.(2005) Thube et al (2015) However, in contrast to present

study increase in trend in relation to occurrence of assault in

female victims is observed in the studies conducted by Hofner 7 8 9et al (2009) , Ranney et al (2009) , Kruise et al (2010) ,

10 11Kjaeruff et al (1989) , Fothergill and Hashemi (1990) , 12 13Chalmers et al (1995) , Wright and Kariya (1997) and Howe

14and Crilly (2002) . This can be explained by the reason that

the pattern of assault is different in developing countries like

India as compared to the western countries where the above

said studies were conducted with different cultural and

socioeconomic factors. Mostly Indian women are housewives

and more often involved at home leading to less involvement in

assault cases. It is also inferenced from the studies conducted

by above mentioned authors that male patients, in general,

25


admitted as a result of assault related injuries were more

frequent than female suggesting that being a male is a strong

demographic risk factor. These findings can be explained by

the fact that males are, in general, more violent by nature as

compared to females and are more prone to get involved in

violence

As far as most common age group is concerned in the present

study out of total medicolegal 500 cases, young age people of

21-40 years (61%) were the most common group involved in

assault cases in this study. The cases of assault were least

common in the age group of 0-10 years with only 3 cases

(0.6%) followed by the age group of more than 70 years with 15 511 cases (2.2%). Mittal et al (2005) , Tajammul et al (2005) ,

16 17Bhullar and Aggarwal (2007) , Akdur et al (2008) , Oberoi et 18 19 20al (2012) , Rao (2014) , Trangadia et al (2014) , Thube et

6 21al(2015) and Sharma et al (2020) have observed that

maximum number of victims involved in assault are of young

age group of 21-30 years which is more or less similar with the

findings observed in the present study. This could be attributed

to the fact that young age group is the most active phase of

one's life which is more commonly involved in outdoor

activities. This phase is also characterized by aggressive and

short tempered behavior which leads to increase incidence of

assault among this age group. Another finding observed in the

study is that extremes of age group were less commonly

involved in the scuffle which is similar to the findings of most

of the authors. The possible reason for this finding could be

explained by the fact that the age group of 0-10 years is tender

and age of innocence while people of older age group are senile

and prone to chronic diseases.

As far as area wise distribution is concerned rural area

predominance with 385 cases (77%) was seen in this study as

compared to urban areas which constitutes only 115 (23%) of

the total cases. This is more or less comparable to the study 21conducted by Sharma et al (2020) .However in the study

18conducted by Oberoi et al (2012) , though rural predominance

was again seen with 57% cases and urban cases amounting to

only 43% of the total, the values of rural area predominance is

comparatively lower than the present study. The population of

Majha region were more frequently involved in assault related 26crimes as compared to Malwa region. The disparity in the

incidence of assault cases in urban and rural area can be due to

the fact that majority of population in Punjab is residing in rural

areas.

In the present study, majority of medicolegal assault cases 408

(81.6%) were from Sikh community while Hindu community

constituted only 64 cases (12.8%) further followed by

Christians with 23 (4.6%) medicolegal cases. Least number of

cases, 5 (1%) were reported from Muslim community with

20mechanical injuries. However, Trangadia et al (2014) , in

their study reported that Hindus constituted 79.6% of the total

medicolegal cases followed by Muslims who constituted, 19%

of the total. The least involved religion in this study was of

Sikhs with 0.3% of total cases. The only reason for higher

incidence of occurrence of assault among Sikhs in the present

study is due to the fact that Punjab is a Sikh majority state.

In the present study, labourers were more commonly involved

occupational group with 177 cases (35.4%) followed by

victims engaged in private jobs with 132 cases (26.4%) and

farmers with 103 medicolegal cases (20.6%). Least number of

medicolegal cases were found in student group with 38 (7.6%) 18cases only. In study conducted by Oberoi et al (2012) , same

trend was observed. The rising trend in the incidence of assault

in labourers as compared to farmers can be explained by the

fact that in recent times there has been increased employment

of migrant labourers on daily wages by the Zamindars for

farming on their lands.

In Maximum 27% (137)cases in this study were reported with

only single injury over the body and 24.8% (124) cases

reported with two injuries, closely followed by 21.4% (107)

cases who were having three injuries over the body out of the

total medicolegal cases. This is in concurrence with study 22conducted by Subba et al (2010) .

The most common type of mechanical injuries recorded

among medicolegal cases were Incised wound in 48.6% (243)

cases followed by lacerated wound in 31.4% (157) cases,

bruise in 16.4% (82) cases and abrasion in 3.2% (16) cases.

Only 0.4% (2) cases of stab wound injury were recorded in this

study. However individually, the most common type of

mechanical injury among females were bruise (24.4%) in

contrast to males where incised wound (92.5%) was the

commonly encountered injuries sustained on the body. The

present study is in contrast to the findings observed by 11Fothergill and Hashemi (1990) . Another study conducted by

23Shephard et al (1990) noted that men suffer more laceration

(45.01%) than women who on other hand had suffer more

contusions (53.3%).These findings are alike of the current 13study. Wright and Kariya (1997) in contrast to our study

reported that bruise and abrasion were the most frequently

recorded mechanical injury sustained. Another study 4conducted by Zargar et al (2004) was inconsistent with the

present study where the most common type of mechanical

injury frequently suffered by men were the penetrating trauma 22with 57.8% of total cases. Subba et al (2010) in their study

interpreted that contusion (28.7%) was the most commonest

type of injury inflicted followed by incised wound (25.7%)

which is inconsistent with the findings of present study. The

reason for incidence of this parameter could be that other

26


studies were conducted in different geographical regions.

The present study showed that the most common site of

infliction of mechanical injuries was head and neck region of

the body with 43.7% injuries. Least number of cases were

found in chest and abdomen area with 2.5% & 1.3% injuries

respectively. These findings are more or less consistent with 24the findings of study conducted by Raj et al (2018) and

25 Chalya and Gilyoma (2012) . The proportion of head and

neck injuries in the studies conducted by Kjaeruff et al 10 12 13(1989) , Chalmers et al(1995) , Wright and Kariya (1997) ,

17 18Akdur et al (2008) and Oberoi et al (2012) was higher as

compared to the present study. The reason for higher incidence

of involvement of head in above mentioned studies including

the present study could be the head being the presenting part of

the body is more prone to violence as assailant knows that it is

the most vital part of human system which could cause severe

damage to his enemy. Upper limb involvement is higher in the 16studies conducted by Bhullar and Aggarwal (2007) , Chalya

25 19and Gilyoma (2012) and Rao (2014) in contrast to the

present study with only 30.2% injuries on the upper limbs. The

possible reason for this variation could be due to difference in

the socio-demographic profile

As far as weapon of offence for inflicting mechanical injury is

concerned, the most common weapon used was blunt,

inflicting 63.4% injuries followed by sharp edged weapons

inflicting 35.2% injuries. In this study, least number of injuries

1.3% were inflicted by sharp pointed weapon. These findings

are more or less comparable with the study conducted by 18Oberoi et al (2012) These values were more or less raised in

14the studies conducted by Howe and Crilly (2002) , Zargar et 4 15 19al (2004) , Mittal et al (2005) , Rao (2014) , Thube HR et al

6(2015) , which are more or less comparable with the present

study. The most probable reason for the use of blunt weapon in

infliction of injuries is due to easy availability of the weapon.

As far as nature of mechanical injuries is concerned in majority

of cases, 79.8% injuries were declared as simple in nature

followed by 17.1% injuries, which were declared as grievous

in nature. Only one injury was declared dangerous to life in this

study. The present study also showed that majority of simple in

nature injuries were predominantly inflicted by blunt weapon

with 67.6% simple injuries followed by those inflicted with

sharp edged weapons with 30.9% injuries out of total 1088

injuries. However on the other hand reverse trend was seen in

injuries with grievous nature where the most common weapon

of offence for inflicting injuries with grievous hurt was sharp

edged weapon with 55.5% injuries followed by injuries

inflicted with blunt weapon with 44.5% injuries out of total 234

grievous injuries in 135 victims. These findings are in line with 16the studies conducted by Bhullar and Aggarwal (2007) .

However in this study the incidence of injury being declared as

Dangerous to life was on higher trend contributing to 3% of the 6total injuries. Another study conducted by Thube et al (2015)

was in concurrence with the present study where the 73%

injuries were declared as simple in nature and 24.7% injuries

were declared as Grievous in nature and no injury was declared

Dangerous to life. This trend in regard to grievous hurt was on

higher side as compared to the present study. The findings of 21the study of Sharma et al (2020) were in slight variance with

the present study In this study also no injury was declared

dangerous to life. This variation could be because of difference

in regional conditions that is political, social as well as other

law and order problems.

Out of the total fractures encountered in the present study,

46.2% fractures were of upper limb bones followed by fracture

of skull bones and lower limb bones which were 33.4% and

16.6% respectively. These findings were more or less similar to 6the study conducted by Thube et al (2015) . This could be

explained by the fact that the limbs are the most common site of

defense injuries during a scuffle.

CONCLUSION :

The present study was conducted with the aim to evaluate socio

demographic distribution of mechanical injuries in assault

cases. Since the assault related injury cases were higher among

males, in the young age group and in a rural population so for

prevention of assault related activities the main focus should be

on encouraging the young age group the concept of tolerance

and rationalism. The casualty & emergency department of any

hospital not only caters to the needs of the patients who reports

in emergencies but also carry out important legal

responsibilities to examine, document and certify medico legal

cases, which puts a lot of burden on casualty department. Also

the doctors who are involved in handling medico legal cases

need to be more trained regarding various aspects of

mechanical injuries. Due to increase in violence Law should be

suitably amended to punish those involved in self-harm against

the spirit of the constitution.

Funding : None

Ethical clearance : From the institutional ethical committee ,

Govt. Medical College , Amritsar

Conflict of interest : None

REFERENCES :

1. Reddy NK, Murty OP. Mechanical Injuries. The

Essentials of Forensic Medicine and Toxicology. 34th

edition. Jaypee Brothers Medical Publishers; 2014, pp.

170-97.

2. Law Publishers (India) Pvt. Ltd. The Indian Penal

Code,1860 (Act no. 45 OF 1860); 2005, pp.11.

27


3. Law Publishers (India) Pvt. Ltd. The Indian Penal

Code,1860 (Act no. 45 OF 1860); 2005, pp.199.

4. Zargar M, Karbakhsh M, Zareei M, Moez AK. Patterns of

assault: experience from an urban hospital-based study in

a developing country. Mjih. 2004;6(2):50–4.

5. Tajammul N, Chaudhry TH, Hanif S, Bhatti MA. Profile

of Medicolegal Cases At Jinnah Hospital Lahore. Annals

Kemu 2005;11(3):1-5.

6. Thube HR, Chikhalkar BG, Nanandkar SD. A

Prospective Study Of Injury Pattern In Victim Of Assault

Attended In South Mumbai Government Hospital. J

Indian Acad Forensic Med. 2015;37(1):37-40.

7. Hofner MC, Burquier R, Huissoud T, Romain N, Graz B,

Mangin P. Characteristics Of Victims Of Violence

Admitted To A Specialized Medico-Legal Unit In

Switzerland. Journal Of Forensic And Legal Medicine.

2009;16(5):269–72.

8. Ranney ML, Odero W, Mello MJ, Waxman M, Fife RS.

Injuries From Interpersonal Violence Presenting To A

Rural Health Center In Western Kenya: Characteristics

And Correlates. Inj Prev. 2009;15(1):36–40.

9. Kruse M, Sørensen J, Brønnum-Hansen H, Helweg-

Larsen K. Identifying Victims of Violence Using Register-

Based Data. Scandinavian Journal of Public Health.

2010;38:611–7.

10. Kjaerulff H, Jacobsen J, Aalund O, Albrektsen SB,

Breiting VB, Danielsen L, Helweg-Larsen K, Staugaard

H, Thomsen Jl. Injuries Due To Deliberate Violence In

Areas Of Denmark. Iii. Lesions. The Copenhagen Study

Group. Forensic Sci Int. 1989;41(1-2):169-80.

11. Fothergill NJ, Hashemi K. A Prospective Study of Assault

Victims Attending A Suburban A & E Department. Arch

Emerg Med. 1990;7(3):172–7.

12. Chalmers DJ, Fanslow JL, Langley JD. Injury From

Assault In New Zealand: An Increasing Public Health

Problem. Aust J Public Health. 1995;19(2):149–54.

13. Wright J, Kariya A. Assault Patients Attending A Scottish

Accident And Emergency Department. J R Soc Med.

1997;90(6):322–6.

14. Howe A, Crilly M. Identification and Characteristics of

Victims of Violence Identified by Emergency Physicians,

Triage Nurses, and The Police. Inj Prev. 2002;8(4):321–3.

15. Mittal S, Chanana A, Rai H, Dalal JS. Medicolegal study

of mechanical injuries in culpable homicides (excluding

deaths due to rash and negligent act). Journal of Indian

Academy of Forensic Medicine. 2005;27(4):226-30.

16. Bhullar DS, Aggarwal KK. Medico Legal Diagnosis &

Pattern of injuries with sharp weapons. Journal of Indian

Academy of Forensic Medicine. 2007;29(4):112-4.

17. Akdur O, Durukan P, Ozkan S, Avsarogullari L, Salt O,

Ikizceli I. Interpersonal Violence Related Injuries In

Central Anatolia, Turkey. The Internet Journal Of

Emergency Medicine 2008;6(1):1-3.

18. Oberoi SS, Aggarwal KK, Bhullar DS, Aggarwal A,

Walia DS, Singh S. Profile Of Assault Cases In Patiala.

Journal Of Punjab Academy Of Forensic Medicine And

Toxicology. 2012;12:17–21.

19. Rao D. A study of pattern of non fatal injuries due to

assault. Journal of Punjab Academy of Forensic Medicine

& Toxicology. 2014;14(2):82-5.

20. Trangadia M, Mehta R, Rada N, Gupta B. Profile Of

Medico-Legal Cases In Tertiary Care Hospital In

Jamnagar, Gujarat: Retrospective Study Of One Year. J

Res Med Den Sci. 2014;2(4):57–62.

21. Sharma A, Tellewar S, Gupta B, Singh V, Singh G. A One

Year Epidemiological Study of Mechanical Injury Cases

Brought To Sims Hospital, Western Uttar Pradesh. Indian

Journal of Forensic Medicine & Toxicology. 2020 Jan

16;14(1):1–4.

22. Subba SH, Binu VS, Menezes RG, Kumar V, Rana MS.

Physical Assault Related Injuries In Western Nepal – A

Hospital Based Retrospective Study.Journal of Forensic

And Legal Medicine. 2010 May 1;17(4):203–8.

23. Shepherd JP, Shapland M, Pearce NX, Scully C. Pattern,

Severity And Aetiology Of Injuries In Victims Of

Assault. J R Soc Med. 1990;83(2):75–8.

24. Raj D, Kumar V, Venkatesha V, Pawar G, Maddileti B.

Pattern Of Injuries In Homicidal Victims In South

Bangalore. Journal Of Indian Academy Of Forensic

Medicine. 2018;40:392.

25. Chalya Pl, vGilyoma Jm. The Burden of Intentional

Injuries In Mwanza City, North-Western Tanzania: A

Tertiary Hospital Survey. Tanzan J Health Res.

2012;14(3):204–11.

26. Crime Statistics of Punjab. 2013. Available from:

http://www.neighbourhoodinfo.co.in/crime/Punjab

28




Dr. Amandeep Singh,

Professor,

Department of Forensic Medicine & Toxicology, Government

Medical College & Hospital, Chandigarh Karnataka – 570015

Contact : +91 96461-21610


KEYWORDS : Hanging, Ligature material, Ligature mark, Complete hanging, Hyoid bone.

Article History:Received: 23 September 2020Received in revised form: 23 December 2020Accepted on: 23 March 2021Available online: 15 August 2021

INTRODUCTION:

Suicide is the deliberate act of taking one's own life. It is the

result of the complex interaction of biological, genetic, 1psychological, sociological and environmental factors. In

India, deaths because of hanging is one of the common ways of

committing suicide in conjunction with poisoning, burning 2and drowning. Among the asphyxia death encountered in day

to day practice by forensic expert hanging is one of the 3commonest. Hanging is a form of ligature strangulation in

which the force applied to the neck is derived from the 4gravitational drag of the weight of the body or part of the body.

Almost all hanging deaths are suicidal, accidental hangings are

uncommon and homicidal hanging is rare. In homicidal cases

it is seen that a victim is killed and after that dead body is

suspended to avert the suspicion. While giving the final

opinion regarding the antemortem hanging, it is necessary to

give special attention to the details of the place of incidence,

the posture of the body and the manner in which the clothes are disarranged, etc. in addition to routine finding.Although most

of the cases are suicidal, they always cause suspicion among

relatives and the investigating officers, as well as at times, to

5the autopsy surgeon.

The term typical hanging means when the point of suspension

is placed centrally over the occiput i.e. the knot is at the nape of

neck on the back. The term atypical hanging is often applied if

the point of suspension is at any other position. Complete

hanging means when the feet do not touch the ground or any

other material so that the body is completely suspended; the

constricting force here is the weight of the entire body.

Whereas if any part of the body touches the ground or any other

material the term used is incomplete or partial hanging e.g.

hanging in a sitting, kneeling or even lying position. Here only 6a part of the body weight acts as the constricting force. The

ligature mark is usually situated above the thyroid cartilage

and going obliquely upwards following the line of mandible

and it may be interrupted due to presence of knot. In some

cases, like partial hanging the ligature mark may be present at

the thyroid cartilage or below it. The ligature mark is like a

groove, its base is pale, hard, and leathery and parchment like.

The ligature mark is deepest at the place opposite to the knot

and the colour of the ligature mark is usually reddish brown .7

In this study we analyzed death due to hanging occurring in

ABSTRACT:

Objective: The objective of this study was to analyze hanging deaths occurring in Punjab, Haryana, Chandigarh in relation to

several factors associated with such deaths.

Materials and Methods: This study was performed on 50 cases of hanging deaths brought for an autopsy to the mortuary of

Government Medical College, Chandigarh. Factors associated with these deaths and post-mortem findings were recorded and

statistically analyzed.

Results: It was observed that the most vulnerable age group was 20 - 29 years. Among all the victims, 54% were married; 70% of the

victims were from urban area. In 30% cases motive of hanging was not known. 92% of suicides by hanging occurred indoors and

most of the incidence occurred at evening time, in 56% cases. Complete hanging was found in 68% cases and partial hanging in 32%

cases. The commonly used ligature materials were means which were easily available to the victim viz. dupatta, nylon rope, saree

etc. and in 68% cases ligature mark were above the level of thyroid cartilage. Fracture of Hyoid bone was found in 6% cases.

Conclusion: The findings of the present study will help in highlighting the prevailing scenario of hanging deaths in this region.

1. Prasenjit Das, PG JR 3years*

2. Amandeep Singh, Professor*

3. Dasari Harish, Professor & Head*

*Department of Forensic Medicine & Toxicology, Government Medical College & Hospital, Chandigarh

Multifactorial Analysis of Deaths Due To Hanging

29


Punjab, Haryana, Chandigarh in relation to several factors

associated with such deaths and noted variation in various

finding including finding at crime scene as well as at autopsy.


The study was performed in the mortuary of GMCH, sector-32

Chandigarh on 50 cases of hanging deaths brought for autopsy.

After recording the history and findings of crime scene from

the police, relatives and eye witnesses, a meticulous post-

mortem examination was conducted. Factors associated with

these deaths and post-mortem findings were recorded and

statistically analyzed. Decomposed bodies, Cases with

survival of more than 7 days and Unknown bodies were

excluded.

RESULTS:

A total of 50 cases were taken in this study. Most of the

incidence occurred at closed places, in 92% cases and 8% cases

victims were found in open area.

As seen in figure 1, out of the 50 cases, the highest number of

cases belonged to the age group of 20 to 29 years, in 36% cases

followed by 10 to 19 years in 24% cases and in 20% cases

victims belong to age group of 40 to 49 years; no cases

occurred below the age of 10 years and above 70 yrs.

Among all the victims 56% were male and rest of them were

female.

According to marital status of the victims, 54% were married.

Victims from rural area were 30% and 70% from urban area.

Majority of the victims were from Hindu family, in 88% cases

followed by Sikh in 10% cases and Muslim in 2% cases.

30

Distribution of Total Number of Cases According To Age

Figure 2: Distribution of Total Number of Cases According to Gender

Figure 4: Distribution of Total Number of Cases According

To Urban/rural Area

Figure 5: Distribution of Total Number of Cases According

To Religion

Figure 3 : Distribution of Total Number of Cases According To Marital Status

Figure 7 : Occupation Wise Distribution of Total Number of Cases

Figure 6 : Distribution of Cases According To Type of Family

Most of the time cause was not known, among the known

causes 26% cases mental illness is one of the leading cause

followed by marital disharmony in 20% cases, love failure in

10% cases and in 4% cases exam failure.

Dupatta was the commonest ligature material used by the

victims in 58% cases followed by nylon rope in 12% cases, in

22% cases others soft material like dhoti, saree were used. In

2% cases belt and in another 2% cases electric wire were used

among others hard ligature materials.

As per the placement of ligature mark, in 68% cases ligature

mark was present above the level of thyroid cartilage followed

by overriding the thyroid cartilage in 28% cases and in 4%

cases it was present below the level of thyroid cartilage.

In 58% cases victims were from joint family and 42% cases

victims were the member of nuclear family.

Among the victims 24% were housewives followed by 16%

were self employed, 14% were student and 12% were laborers.

Most of the incidence occcur during evening time (12 PM to 8

PM), in 56% cases followed by morning (4 AM to 12 AM) in

30% cases and in 14% cases were recorded during night(8 PM

to 4 AM) time.

31

Figure 8 : Distribution of Total Number of Cases According To Time of Incidence

Figure 9 : Motive of Hanging

Figure 10: Distribution of Total Number of Cases

According To Type of Ligature Material


According To Placement of Ligature Mark

[8, 9]and Udhayabanu R et al (76.77%) in their studies.

In our study we found that most of the incidence occurred

during the evening time (12 pm – 8 pm), in 56% cases.

Vijayakumari N. in her study found that most of the victims

(50.8%) hanged themselves during the early hours of the day around 3.00 am 12.00 noon. Whereas Udhayabanu R. Et al

studies showed that most of the case took place around 2 pm – [8, 9]11 pm (52.9%).

In most of the cases motive of hanging were not known.

Among the known causes mental illness/depression in 26%

cases followed by marital problem in 20% cases were the

commonest motive for hanging found in this study. Marital

problem was the leading cause as also found by N

Vijayakumari (33.8%) and Udhayabanu R et al studies [8, 9](52.25%) in their studies.

Among the ligature materials Dupatta / chunni is the most

commonly used ligature material in 58% cases followed nylon

rope in 12% cases. SH Bhosle et al in their study found that

most of the victims used rope, nylon rope (53.01%) whereas

Udhayabanu R et al found that most common ligature material

used was synthetic saree (47.74%), Mohit Shrivastava et al in

their study found that most common ligature material used was [8, 10, 11]nylon rope (15.7%) and jute rope (10.3%).

In 68% cases ligature mark was present above the level of the

thyroid cartilage followed by overriding the thyroid cartilage

in 28% cases and in 4% cases it was situated below the level of

thyroid cartilage.

Complete hangings were 68% and 32% were partial hanging.

Almost similar findings were found by Ambade VN et al in

their study where 67.7% cases of hangings were complete [3]hanging.

Hyoid bone fracture was found in 6% cases. Hyoid bone [10]fracture was not found by Mohit Shrivastava et al.

We found that most of the victims hanged at closed place

mostly at bedroom and only four cases found where victims

hanged at open area. Similar trend also seen by Vijayakumari

N (95.5%),Udhayabanu R et al (93.54%) and Mohit [8, 9, 10]Shrivastava et al in their studies (95.5%).

CONCLUSION:

Hanging is a common means of suicide among younger people

and is usually committed in familiar surroundings with ligature

materials easily available to the victim.

Marital disharmony is a common predisposing factor of

suicide in women. From this study it was found that hanging

trends not only limited to the rural area but it is also gaining

popularity in urban area also as painless death.

As prevalence of mental illness & depression was one of the

Among all the hanging cases, 68% were complete hanging and

32% were partial.

In 6% cases fracture of hyoid bone were found.

DISCUSSION :

Maximum number of cases recorded in this study comes under

the age group of 20–29 yrs (36.00%). Similar observation

found by Udhayabanu R et al (32.25 %), N. Vijayakumari

(84.7%) and Mohit Shrivastava et al in male age group of 21– [8, 9, 10]30 yrs (24.1%) while in female it was 11–20 yrs (12.3%).

Most of the victims are male (56%). Mohit Shrivastava et al

and SH Bhosle et al found similar findings (67.5%) with male:

Female ratio 2:1. and (78.57%) with male: Female ratio 1:0.27 [10, 11]respectively.

Occupation wise this study shows that the most of the victims

are house wife (24%) followed by self employed (16%).

Whereas SH Bhosle et al study shows that hanging was more [ 11]common in farmers (30.12%) and labourers (24.10%).

In 70% cases victims were from urban area. Similar finding

was found in Mohit Shrivastava et al study, in their observation

it was found that most of the victims were from urban area [10](69.5%).

Among all the victims, 54% of the victims were married.

Similar observation was also seen by N. Vijayakumari (69.2%)

32

Figure 12: Distribution of Total Number of Cases According To Type of Hanging


According To Fracture of Hyoid Bone

common factors seen in such cases, proper counseling and

timely treatment of vulnerable populations with such risk

factors for suicide is one of the important ways of prevention of

such incidents.

Mostly preferable places chosen by the victims were closed

places especially at their home, thus patients having suicidal

tendencies should not be left alone unattended even at their

home.

REFERENCES :

1. Rane A, Nadkarni A. Suicide in India: a systemic

review. Shanghai Arch Psychiatry. 2014; 26(2):69-80.

2. Ambade VN, Keoliya AN, Wankhede AG. Availability

of means of suicides. Int J Med Toxicol Leg Med. 2012;

14(3):83-89.

3. Ambade VN, Tumran N, Meshram S, Borkar J. Ligature

material in hanging deaths: The neglected area in forensic

examination. Egypt J Forensic Sci. 2015; 5(3):109-113.

4. Saukko P and Knight B. Knight's forensic pathology. 3rd

ed. London: Edward Arnold, 2004: pp 319-331

5. Dimaio VJ, Dimaio D. Forensic pathology. 2nd ed. Boca

Raton: CRC Press; 2001: p 258-75.

6. Krishan V. Textbook of Forensic Medicine and thToxicology. 5 edition. Gurgaon. Elsevier; 2011:p120-9.

7. Sharma RK. Concise Textbook of Forensic medicine and r d Toxicology. 3 Edn. Noida. Global Education

Consultants; 2011:p55-6.

8. Udhayabanu R, Senti Toshi, Baskar R. Study of hanging

cases in Pondicherry Region. IOSR Journal of Dental and

Medical Sciences (IOSR-JDMS). 2015; 4(7):41-44

9. Vijayakumari N. Suicidal hanging: a prospective study. J

Indian Acad Forensic Med. 2011; 33(4):353- 355

10. Mohit Shrivastava, P.S. Thakur, Devesh Pateria, B.K.

Singh, Sunil K. Soni. Autopsy based on one year

prospective study of deaths due to hanging. Indian Journal

of Forensic and Community Medicine. 2018;5(4):240-

244

11. Dr. SH Bhosle, Dr. AK Batra, Dr. SV Kuchewar. Violent

asphyxia deaths due to hanging: A prospective study. J

Forensic Med Sci Law. 2014; 23(1):1-8

33



Dr. Amandeep Singh,

Professor,

Department of Forensic Medicine & Toxicology, Government

Medical College & Hospital, Chandigarh Karnataka – 570015

Contact : +91 96461-21610


KEYWORDS : Fetus, Age Estimation, Gestational Age, Anthropology, Radiology

Article History:Received: 16 April 2021Received in revised form: 16 May 2021 Accepted on: 18 May 2021Available online: 15 August 2021

INTRODUCTION :

Identification is the determination of the individuality or

personality of a person based on certain physical 1characteristics . Various components in combination help in

identifying individual dead or alive; of which age forms an

important component. Age can be determined from teeth,

ossification of bones, secondary sex characters and general

development, in case of children. Accurate age estimation of

dead fetuses can be very important to medicolegal authorities,

particularly to determine if it is a full-term neonate or a pre-

term fetus. It is often the only means of identification for

fetuses and neonates since they do not usually have any other 2,3type of identification with them. Determination of fetal age,

specifically if the fetus reached full-term, can have legal 4importance in forensic cases, particularly whether the baby

5was liveborn or stillborn is significant . In cases of criminal

abortion or infanticide, the age of the fetus is integral to the

prosecution. Fetal age estimation is still a difficult task as the

soft tissue of fetal remains are often so deteriorated that

accurate estimations of size and age can only be made after 6they are processed into clean, dry bones.

Foetal age estimation can be done by foetal biometry which is

measurement of several parts of foetal anatomy and their

growth. Foetal measurements include biparietal diameter,

crown -rump length, crown-heel length, foot length, hand

length ,abdominal circumference, chest circumference, head

circumference, intercanthal distance, outer canthal distance,

philtrum, arm length, thigh length etc. The two main criteria

used for fetal age estimation are dental mineralization and

skeletal data, such as long bone diaphyseal length. Although

dental age is more reliable than skeletal age, in many forensic

instances, the human remains do not include dentition thus

diaphyseal length evaluation becomes important for the 7purpose of age evaluation.

A study on use of radial diaphyseal length in estimating fetal

body length showed that measurements from the radius

ABSTRACT :

Introduction: The estimation of gestational age (GA) of fetal remains can be an important forensic issue. Forensic specialists

usually use reference tables and regression equations derived from reference collections, which are quite rare, when fetuses are

concerned. There is a strong correlation between the longitudinal length of studied bones and GA.

Aims and objectives: This study is aimed at estimation of the age of the dead fetuses in Indian population on the basis of diaphyseal

bone length measurements (femur and humerus) of 25 fetuses of known GA, measured ultrasonographically, using radiographs

along with measurements done anthropologically, after dissection of foetal long bones.

Methods: The regression equation for the humerus and the femur bone were GA = MX + C. Here, GA is the gestational Age, X is

the length of the long bone in mm, M is the regression curve and C is the constant.

Results: The anthropological/ radiological GA coincided with ultrasonographic GA in 11 cases (44%) and with an error of ±

1week. GA of all the 25 cases lay within 95% confidence interval limit by both radiological and anthropological methods.

Conclusion: It was concluded on analysis that radiological measurements are less significant as compared to anthropological

measurements of both humerus and femur bones.

1. Piyush Sandhu, PG JR III*

2. Amandeep Singh, Professor*

3. Dasari Harish, Profesor & Head, Department of Forensic Medicine & Toxicology*

4. Mahesh Sharma, Professor, Department of Anatomy*

*Government Medical College & Hospital, Chandigarh

Age Estimation of Dead Foetus from Anthropology, Radiology of Femur & Humerus Bone

34


estimated an average stature 12-13cm taller than the ulna, tibia,

and fibula and age estimated was two and a half lunar months 8older than that derived by the ulna, tibia, and fibula.

Due to different morphology, lack of development, incomplete

fetal remains age estimation is difficult along with cases where

when only a few bones are present in skeletal remains.

Ossification occurs at specific points called ossification centers

which in long bones begin in the center of the diaphysis 9progressing towards the ends of the bones . The long bones are

chosen as they have primary centres of ossification and the

process of development of the bones is according to the age of

the foetus. It is in this context that we intend to determine the

age of the foetus from the morphological features and the

radiology of long bones.

MATERIAL AND METHODS :

On receiving approval from the Institutional Ethics and

Research Committe, this prospective study was done in the

Department of Forensic Medicine and Toxicology, in

collaboration with Department of Anatomy and Department of

Radio diagnosis, Government Medical College & Hospital,

Chandigarh.

This study was done on a total of 25 consecutive aborted

fetuses which came to Department of Anatomy. Fetuses were

taken to Department of Forensic Medicine and Toxicology for

pathological/medicolegal autopsy and consent from the legal

heirs of the fetus was taken on a proforma to conduct the study.

Inclusion Criteria Fetuses of known Gestational Age beyond

14 weeks, Medicolegal autopsy of fetus with known

gestational age, Twin pregnancies will be included only when

there are no signs of discordant growth.

Exclusion Criteria Fetuses having external malformation,

Fetuses with incomplete history, Presence of maternal

pathology/pathological alterations which could compromise

normal skeletal growth (e.g. Intra Uterine Growth Restriction)

Medicolegal autopsy of fetus with unknown gestational age,

Fetuses of IUD of more than 1 week

History: The complete facts regarding each case were

collected from different sources, which included:

The Treatment record/ procedures done on mother/fetuses

Interviewing the relatives which accompanied the fetuses Old

treatment record / case files of mother of aborted fetus Inquest

papers and autopsy report of the fetus

Procedure: The autopsy of the fetuses was done in the

Department of Forensic Medicine & Toxicology. All the

morphometric measurements were done in the department of

Anatomy. After recording the measurements of the fetus it was

taken to the Department of Radiology for x rays. The length of

the femur and humerus was measured by scale on Digital

Radiography (DR) and Computerized Radiography (DR)

system Figure 1.

The fetus was then taken to the Department of Forensic

Medicine where autopsy was done to note measurements of

bones (Figure 2 and 3) and fetus was then handed over to

relatives after proper stitching and wrapping. The data thus

obtained was subjected to detailed statistical analysis by

entering the data in a pretested specifically designed proforma.

Diaphyseal length is measurement of the longest point from

the proximal end to the distal end of the long bone.

Measurements of bones were done with digital Vernier

callipers with graduated scale of 0.1 mm.

RESULTS :

In this study 25 foetuses were included. Out of 25, 12 were

males (48%) and 13 were females (52%). The mean gestational

age of foetuses is 23.44 ± 3.78 weeks ranging from 14 weeks

and 1 day to 26 weeks and 5 days.

The mean of femur length morphologically right and left are

35

Figure1 : X ray of Foetus with Radiological Measurements of Femur and Humerus

Measuring humerus

andfemur

length using

Figure 2 & 3 : Anthropological measurement of femur and humerus by vernier calipers

of ± 4 weeks in 1 cases (4 %), difference of >± 4 weeks in 4 case

(16 %).

Formula was applied to each of the cases and it was observed

that predicted gestational age was comparable with known

gestational age in 11 cases with difference of ± 1 week (44 %

cases), difference of ±2 weeks was observed in 8 cases (32%),

and difference of ±3 weeks was seen in 1 case (4 %), difference

of ± 4 weeks in 1 cases (4 %), difference of >± 4 weeks in 4

case (16 %)

DISCUSSION :

In our study, the sample size was 25 (Table 1). In some studies

like by Trotter M et al, Mehta L et al and Scheuer JL et al, the 10,13,14sample size was less than 100, while in other studies like

by that by Quinlan RW et al, Goldstein RB et al, and others, it 15-19was more than 100.

25The study by Carneiro et al on Portuguese population

involved greater number of cases (100) as our study (25), while

also recruiting nearly larger number of male and female

foetuses, (55 male,45 females in comparison to 12 male,13

female in our study) as our study. The foetal osteometry by

radiography yielded performed by them yielded comparable

results to our study i.e. femur length as a reliable indicator of

gestational age, besides involving same inclusion and

exclusion criteria as our study. The mean age at death is 23.44

weeks (SD = 3.78) in Portuguese study in comparison to 21.42

± 3.77 weeks in our study. (Table 1)

In our study, the gestational age of samples ranged from 14

weeks and 1 day to 26 weeks and 5 days, while studies by

Goldstein et al, Jeanty et al, Hadlock et al and Bareggi et al

included fetuses of gestational age ranging from 14 to 36

weeks, 12 to 40 weeks, 14 to 22 weeks and 4 lunar months to 16-19,23newborns, respectively. (Table 1)

In consonance with our methodology, studies by Scheuer JL et

43.65 ± 14.5 mm (21-63.49) and 43.51 ± 14.60 mm (21-63.5)

respectively. The mean of femur length radiologically right

and left are 25.50 ± 10.90 (2.2-42.7) and 25.86 ± 10.98mm (2-

43) respectively as shown in Table1.

The mean of humerus length morphologically right and left are

39.26±12.44 (20-56.70) and 39.39±12.42 (20-56.71)

respectively. The mean of humerus length radiologically right

and left are 26.33±12.33 (3.4-44.9) and 26.60±12.19 (3.4-

44.9) respectively as shown in Table 2.

Anthropological gestational age for male and female fetuses

showed significant positive correlation with gestational age (p

value less than 0.05), as depicted in Table 3.

All regression formulae for radiological and anthropological

lengths of bones were derived in terms of y=mx + c where y is

derived gestational age, m is slope or gradient, m is variable or

bone length and c is constant. Value of m and c for regression

formulae based on anthropological and radiological lengths of

femur and humerus are shown in Table 4.

Formula was applied to each of the cases and it was observed

that predicted gestational age was comparable with known

gestational age in 11 cases with difference of ± 1 week (44 %

cases), difference of ±2 weeks was observed in 8 cases (32%),

and difference of ±3 weeks was seen in 1 case (4 %), difference

36

Pearson CoeffP Value

.530

.042.541.037

.536

.040.553.033

.701

.004.685.005

.676

.006.689.004

Table 3: Correlation analysis

Femur Length Humerus Length Femur Length Humerus Length

Radiological Radiological Morphological Morphological

Femur Length Morphological Right

Femur Length Morphological Left

Femur Length Radiological Right

Femur Length Radiological Left

Humerus Length Morphological Right

Humerus Length Morphological Left

Humerus Length Radiological Right

Humerus Length Radiological Left

.183

.177

.184

.187

.205

.210

.164

.172

13.459

13.718

16.746

16.616

13.375

13.167

17.113

16.877

Table 4: Regression formulae

Table 1: Statistical mean, standard deviation, range of anthropological and radiological parameters of femur

Mean

SD

Min

Max

Weeks

23.4381

3.78214

14.14

26.71

Right

43.6520

14.4958

21.00

63.49

Left

43.506

14.6066

21.0

63.5

Right

25.494

10.8927

2.2

42.7

Left

25.86

10.977

2

43

Morphological Radiological

Mean

SD

Min

Max

Right

39.258

12.4432

20.0

56.7

Left

39.3893

12.41549

20.00

56.71

Right

26.325

12.3339

3.4

44.9

Left

26.594

12.1899

3.4

44.9

Morphological Radiological

Table 2: Statistical mean, standard deviation, range of anthropological and radiological parameters of humerus

and logarithmic regression. Am J Hum Biol.1980;7:257-

65

4. Scheuer L. Application of osteology to forensic medicine.

ClinAnat 2002;15:297-312

5. Piercecchi-Marti, Adalian P, Bourliere-Najean B,

Gouvernet J, Maczel M, Dutour O et al. Validation of a

radiographic method to establish new fetal growth

standards: radio-anatomical correlation. J Forensic Sci

2002;47:328-31

6. Cunha E, Baccino E, Martrille L, Ramsthaler F, Prieto J,

Schuliar Y et al. The problem of aging human remains and

living individuals: a review. Forensic Sci Int.2009;193: 1-

3

7. Carneiro C, Curate F, Borralho P, Cunha E. Radiographic

fetal osteometry: Approach on age estimation for the

portuguese population. Forensic Sci Int.2013;231(1-

3):397-e1.

8. Huxley A, and Jimenez S. 1996. Technical Note: Error in

Olivier and Pineau's regression formulae for calculation

of stature and lunar age from radial diaphyseal length in

forensic fetal femains. Am J PhysAnthropol 100:435-37

9. Deter RL, Rossavik IK, Cortissoz C, Hill RM, Hadlocks

FP. Longitudinal studies of femur growth in normal

fetuses. J clin ultrasound 1987;15:299-305

10. Scheuer JL, Musgrave JH, Evans SP. The estimation of

late fetal and perinatal age from limb bone length by linear

and logarithmic regression. Am J Hum Biol.1980;7:257-

65

11. Kanchan T, Krishan K. Personal identification in forensic

examinations. Anthropol.2013;2:1-2

12. Fazekas I GY, Kosa F. Forensic Fetal Osteology.

Budapest:Akademiai Kaido;1978:p.37-57

13. Trotter M, Peterson RR. Weight of bone in the fetus: a

preliminary report. Growth.1968;32:83-90

14. Mehta L, Singh HM. Determination of crown-rump

length from fetal long bones: humerus and femur. Am J

Phys Anth.1972;36:165-8

15. Quinlan RW, Brumfield C, Martin M, Cruz A. Ultrasonic

measurement of femur length as a predictor of fetal

gestational age. J Reprod Med.1982;27:392-4

16. Goldstein RB, Filly RA, Simpson G. Pitfalls in femur

length measurements. J Ultrasound Med.1987;6:203-7

17. Jeanty P, Rodesch F, Delbeke D, Dumont JE. Estimation

of gestational age from measurements of fetal long bones.

J Ultrasound Med.1984;3:75-9

18. Hadlock FP, Harrist RB, Shah YP, King DE, Park SK,

al, Falkner F et al ,Huxley AK et al, and others employed plain 10,20-23radiographs for foetal measurements in dead foetuses. In

contrast to our analysis, studies by Quinlan RW et al, Goldstein

RB et al, Jeanty P et al, and others employed ultra-sonograms 15-19for foetal measurements in intrauterine life.

Study by Quinlan RW et calculated gestational age of foetus

by measuring femur ultrasonographically and then applying

regression formulae which showed error of ± 1 weeks in akin to 15our results. In our study we were able to predict accurate

gestational age in 44 % cases with difference of ±1week.

In our study, regression formulae were derived based on

morphological as well as radiological length of femur in

contrast to regression formulae by Fazekas and Kosa,

Sherwood et al, which employed morphological femur length

and regression formulae by Chervenak et al., which employed 12,19,24femur length measured ultrasonographically. Fazeka and

kosa formulae measured body length which in turn was used 12to derive gestational age in weeks, Sherwood et al formula 24measured gestational age in weeks, Chervenak et al formula

19measured gestational age in days and our study measured

gestational age in weeks as well as days. Fazekas and Kosa

formula is FL*6.44+4.51,Chervenak formula is 70.62

+21.78*FLansd Sherwood formula is 10.91+0.38*FL where

FL is femur length.(Table 4)

CONCLUSION :

Anthropological gestational age was found to be more

significant than radiological gestational age based on p value

and correlation coefficient. In 11 (44%) out of 25 cases

radiological and anthropological gestational age coincided

with known gestational age done by ultrasound. In 25 out of 25

cases gesational age calculated lay within 95 % confidence

interval limit

It can be concluded that the age estimation of fetus by

anthropological and radiological measurements of long bones

is a feasible and reliable method and can provide priceless

information to narrow down the search in case of identification

of unknown dead new-born or fetus when only skeletal

remains are present.

REFERENCES :

1. Reddy KSN, Murthy OP. The essentials of forensic

medicine and toxicology. In:Identification. 34th ed. New

Delhi: Jaypee Brothers medical publishers(p)

Ltd;2017.p.55-97

2. Hoffman JM. Age estimations from diaphyseal

lengths:two months to twelve year..J Forensic

Sci.1979;24:461-9

3. Scheuer JL, Musgrave JH, Evans SP. The estimation of

late fetal and perinatal age from limb bone length by linear

37

Sharman RS. Estimating fetal age using multiple

parameters: a prospective evaluation in a racially mixed

population. Am J Obstet Gynecol.1987;156:955-7

19. Chervenak FA, Skupski DW, Romero R, Myers MK,

Smith-Levitin M, Rosenwaks Z, Thaler H. How accurate

is fetal biometry in the assessment of fetal age? Am J

Obstet Gynecol.1998;178:678-87

20. Falkner F, Roche AF. Relationship of femoral length to

recumbent length and stature in fetal, neonatal, and early

childhood growth. Hum Biol.1987;59:769-73

21. Huxley AK. Comparability of gestational age values

derived from diaphyseal length and foot length from

known forensic foetal remains. Med Sci Law.1998;38:42-

51

22. Warren MW. Radiographic determination of development

age in fetuses and stillborns. J For Sci.1999;44:708-12

23. Bareggi R, Grill V, Zweyer M, Sandrucci MA, Narducci P,

Forabosco A. The growth of long bones in human

embryological and fetal upper limbs and its relationship to

other developmental pat terns. Anat Embryol .

1994;189:19-24

24. Sherwood R, Meindl RS, Robinson HB, May RL. Fetal

age: Methods of estimation and effects of pathology. Am J

Phys Anthropol.2000;113:305-15

25. Carneiro C, Curate F, Borralho P, Cunha E. Radiographic

fetal osteometry: Approach on age estimation for the

portuguese population. Forensic Sci Int.2013; 231:397-e1

38


INTRODUCTION :

Autopsy is mainly of two types – clinical autopsy and medico-

legal autopsy. The former is carried out with the consent of the

relatives, mainly to find the cause of natural deaths where the

disease condition responsible for the death could not be [1]ascertained during life. It not only helps in determining the

cause of death but also plays an important role for the [2]betterment and advancement of medical science. Yet, over

the years there have been a gradual decline in the number of

clinical autopsy attributed to various factors including [3-5]relatives of the deceased not consenting for the same.

Medico-legal autopsy on the other hand is a statutory

requirement that need to be fulfilled for any unnatural, sudden

and suspicious death in order to ascertain the cause and manner

of death. In such situations, the medico-legal autopsy

conducted is carried out without the consent of the next of kin [6, 7]of the deceased. However, studies conducted on the general

population have shown that many do not wish medico-legal

autopsies to be conducted on their relatives.

There is not much literature on this important aspect,

highlighting the relative's perception towards medico-legal

autopsy in India and to the best of our knowledge no such study

has been previously reported from the North-eastern region of

the country. Therefore, this study aimed at determining the

perception of the relatives of the deceased to medico-legal

autopsy and the reasons for their positive and negative

responses.


This cross-sectional questionnaire based study was conducted

in the Department of Forensic Medicine, NEIGRIHMS, st stShillong over a period of one year from 1 January 2018 to 31

December 2018. The relative (above 18 yrs of age and related

to the deceased by a social bond) of the deceased of

consecutive medico-legal cases brought to the mortuary for

medico-legal autopsy were approached to participate in this

study. All cases of unidentified and unclaimed dead bodies,


Dr AJ Patowary,

Professor and Head

Department of Forensic Medicine

North Eastern Indira Gandhi Regional Institute of Health and

Medical Sciences (NEIGRIHMS) Mawdiangdiang, Shillong

Meghalaya - 793018

Contact : +91 70020-63345


KEYWORDS : Medico-legal autopsy, relatives, perception

Article History:Received: 15 July 2020Received in revised form: 21 August 2020Accepted on: 21 August 2020Available online: 15 August 2021

ABSTRACT :

Introduction : Unlike clinical autopsy, medico-legal autopsy is conducted irrespective of the relative's consent. However, many of

these autopsies are done against their wishes.

Materials and Methods :This one year cross sectional questionnaire based study includes 179 relatives of the deceased person out

of the 195 medico-legal cases brought to the mortuary for medico-legal autopsy.

Results : Out of the 179 cases included in this study, 113 (63.1%) participants had negative attitude towards medico-legal autopsy

and 66 (36.9%) participants had positive attitude. The main reasons for the negative attitude towards the autopsy were fear of

mutilation of the body, delay funeral and the relatives not interested in knowing the cause of death.

Conclusion : Many had a negative perception towards medico-legal autopsy mainly due to fear of mutilation of the body and delay

in funeral.

1. Daunipaia Slong, Assistant Professor*2. AD Ropmay, Associate Professor*3. Aelifeter R Marak, Senior Resident*4. Anamika Nath, Senior Resident*5. Rangme B Y Marbaniang, Technical Assistant*6. AJ Patowary, Professor & Head* *Department of Forensic Medicine, NEIGRIHMS, Shillong

Perception of relatives towards Medico-legal autopsy in a tertiary care centre of Northeast India


39

whereby the relatives of the deceased were not known, and

cases where the relatives were not present at the time of

autopsy were excluded from this study. Before conducting the

interview, a written informed consent was taken from every

participant following which the questionnaire, comprising of

15 questions, was administered to the consenting relatives (one

participant from each medico-legal case) of the deceased by

the investigators.

The relatives were asked about their perception towards

medico-legal autopsy and if the autopsy was done against their

wishes, they were asked about the reasons for this negative

attitude towards autopsy i.e unwilling. For those who desired

autopsy on their kin, they were asked to state their reasons or

expectations for the positive attitude towards autopsy i.e

willing. In both the scenarios, the participants were allowed to

choose more than one reason. During the study period, 195

cases were brought to our mortuary for medico-legal autopsy,

out of which 99 cases underwent autopsy and 96 cases were

exempted by the appropriate authority. However, only 179

cases were included in this study as the relatives, in 8 of the 99

autopsied cases and 8 of the 96 exempted cases, either refused

to participate or none were available at the time of autopsy

(Figure 1). The data were analysed using SPSS version 21.

Pearson's Chi square test and Binomial test were used to

compare proportions where p-value of less than .05 is

considered as significant.

RESULTS :

Out of the 179 cases included in this study, 113 (63.1%)

participants have negative attitude towards medico-legal

autopsy i.e unwilling, including 25 cases where autopsy was

performed, and 66 (36.9%) participants have positive attitude

for medico-legal autopsy, i.e willing. A chi square test of

independence was used to determine if the victim's

demographic profile has any influence on their relative's

perception towards medico-legal autopsy (Table 1).

It was found that the victim's age has no association with their 2relative's perception towards autopsy [X (6) = 8.866, p =

.1812]. Similarly, their gender has no relation to the relative's 2attitude, either positive or negative, towards autopsy [X (1) =

1.281, p = .2587]. As far as their place of residence is

concerned, there was no difference in the attitude of the

relatives, whether residing in urban or rural areas, towards 2medico-legal autopsy [X (1) = .188, p = .664. However, the

manner in which they died (Table 2) did influence the 2perception of their relatives [X (3) = 19.37, p < .001] with

many unwilling for their kin to undergo autopsy in cases when

the deaths were due to alleged natural causes (80%) which

40

Figure 1: Selection of the cases

Total number of medico-legal cases brought to mortuary

195 cases

Number of cases where autopsy was done

99 cases

Number of cases where autopsy was not done

96 cases

No relatives 6 cases

Relatives present 93 cases

Do not want to participate 2 cases

Do not want to participate

8 cases

Number of participants 91 cases

Number of participants 88 cases

Total number of participants 179 cases

Willing autopsy

66 cases

Unwilling autopsy

113 cases

Perceptions of Relatives towards Medico-legal Autopsy

Is the Medico-legal autopsy done with your wishes? Yes

Option

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

No.

6

7

8

9

10

11

No

No

No

No

No

No

No

No

No

No

No

No

Factors Influencing Autopsy Refusal by Relatives of the Deceased

What are the reasons for refusal?

Fear of disfigurement of body

Delay in funeral

Concerns about removal of organs or part of the body

Religious/cultural objections against incisions /dissection on the dead body

Objection expressed by the patient before death.

Autopsy would disturb the peace of the deceased person

Patient is too young or too old.

No use in knowing the cause of death/ nature of death

Involvement of police/court

Lack of adequate information on reason for autopsy given by police/ doctors

Lack of feedback on results of autopsy

1

2

3

4

5

Option

Yes

Yes

Yes

No.

No

No

No

What are your expectations from the Medico-legal autopsy?

1

2

3

Expectation of the relatives who consented to Medico-

legal autopsy

To know the cause of death

To know the manner of death

Need for Criminal investigation


were brought dead to the Institute and accidental deaths

(61.82%).

Among the cases included in this study, 113 (63.1%) relatives

of the deceased person expressed their undesirability for their

kin to undergo medico-legal autopsy. A binomial test (two

tailed) on the reasons for their negative attitude towards

autopsy (Table 3) indicated that the number of relatives who

felt that autopsy will lead to disfigurement of the dead body

(92.04%, p < .001), delay in funeral (72.57%, p < .001) and

there is no use in knowing the cause of death (70.80%, p <

.001) are proportionally higher than expected. However, for

the other reasons which cause the negative attitude towards

autopsy, each showed lesser proportion than expected (p <

001) except for organ removal which the relatives responded

as expected (59%, p = .707).

Out of the 179 cases, 66 (36.9%) relatives had a positive

attitude towards medico-legal autopsy. A binomial test (two

tailed) on the reasons for their positive attitude towards

autopsy (Table 4) indicated that the number of relatives who

wants to know the cause of death (92.42%, p < .001) is

proportionally higher than expected. While the number of

relatives who wants to know the manner of death (30.30%, p =

.002), for their positive attitude, is proportionally lesser than

expected; the proportion of those who want to initiate criminal

investigation (40.91%, p = .176) did not differ from what is

expected.

DISCUSSION :

Medico-legal autopsy is conducted in all medico-legal cases

compulsorily, irrespective of the relative's wishes. However,

88 of the 179 medico-legal cases included in this study are

exempted from autopsy, on the request of the relatives,

41

To know the cause of death

To know the manner of death

Table 4: Reasons for Willingness to Medico-legal autopsy

SlNo.

Reasons for Unwillingness Yes N (%) No N (%)

61 (92.42)

20 (30.30)1

2

05 (7.58)

112 (99.12)

Table 1: Demographic profile of victim and relative's perception towards Medico-legal autopsy

Relative's perception

66 (36.87)

57 (38.78)

09 (28.12)

03 (27.27)

07 (33.33)

15 (34.88)

19 (46.34)

15 (51.72)

04 (22.22)

03 (18.75)

34 (35.40)

32 (38.60)

113 (63.13)

90 (61.22)

23 (71.88)

08 (72.73)

14 (66.67)

28 (65.12)

22 (53.66)

14 (48.28)

14 (77.78)

13 (81.25)

62 (64.60)

51 (61.40)

179

147

32

11

21

43

41

29

18

16

96

83

Gender

Male

Female

Age (Yr.)

0-10

10-20

20-30

30-40

40-50

50-60

>60

Address

Urban

Rural

Victim's

profile

Total

NWilling autopsy

N (%)

Not willing autopsy

N (%)

Table 2: Manner of death and relative's perception towards Medico-legal autopsy

Relative's perception

10 (20.00)

42 (38.18)

11 (84.62)

03 (50.00)

40 (80.00)

68 (61.82)

02 (15.38)

03 (50.00)

50

110

13

6

Natural

Accidental

Homicidal

Suicidal

Manner

of

death

Total

NWilling autopsy

N (%)

Not willing autopsy

N (%)

Table 3: Reasons for Unwillingness to Medico-legal autopsy

SlNo.

Reasons for Unwillingness Yes N (%) No N (%)

Fear of disfigurement of body

Delay in funeral

Concerns about removal of organs or part of the body

R e l i g i o u s / c u l t u r a l objections against incisions / dissection on the dead body

Objection expressed by the patient before death.

Autopsy would disturb the peace of the deceased person

Patient is too young or too old.

No use in knowing the cause of death/ nature of death

Involvement of police/ court

L a c k o f a d e q u a t e information on reason for autopsy given by police/ doctors

Lack of feedback on results of autopsy

104 (92.04)1

2

3

4

5

6

7

8

9

10

11

82 (72.57)

59 (52.21)

03 (2.65)

01 (0.88)

00 (0.00)

16 (14.16)

80 (70.80)

03 (2.65)

00 (0.00)

01 (0.88)

09 (7.96)

31 (27.43)

54 (47.79)

110 (97.35)

112 (99.12)

113 (100)

97 (85.84)

33 (29.20)

110 (97.35)

113 (100)

112 (99.12)


following an order from the appropriate authority; although it

may be noted that majority of these cases are brought dead to

the emergency department with history of chronic illness (38/

88) and alleged Road Traffic Accident (34/88). Altogether,

113 (63.1%) respondents are unwilling for their next of kin to

undergo medico-legal autopsy, a finding similar to Goel S et al [8](69.70%). The main reasons for such negative response

towards autopsy, whether autopsy is done or not, are fear of

disfigurement of the dead body, delay in funeral and no use in

knowing the cause of death; age, gender and place of residence

(Urban or Rural) of the deceased person does not affect the

perception of relatives towards medico-legal autopsy. This

fear of disfigurement of the dead body, which is a concern also [6,8]shared among relatives of the other study population, can be

addressed by proper counseling of the relatives explaining to

them the purposes and procedures for conducting an autopsy

including reconstruction of the body post autopsy. This view is [9,10]supported by earlier studies which demonstrated that prior

explanation of the autopsy procedures will not only bring

about a better understanding of medico-legal autopsy but also

improve its acceptability by the relatives as many people had [11]misconception about medico-legal autopsy. Previous

[6,8]studies, including ours, observed that most of the relatives

felt autopsy will delay funeral. Therefore, efforts should be

made by both the investigating agencies, which have an

unenviable job, and the autopsy surgeons to ensure that

autopsy be conducted as early as possible so that the dead body

can be handed over to the relatives at the earliest. Another

important factor expressed by the relatives as a reason for the

negative perception towards autopsy is their disinterest to

know the cause of death because they believed there is no foul

play involving the death of their kin and that the cause of death

was already known to them. Such responses are given mostly

by relatives whose dear ones died following alleged RTA,

natural death and fall from height. Interestingly, two cases of

alleged homicide also stated that they do not want to know the

cause of death with both being victims of mob violence. This

unwillingness to know the cause of death is also reported by [8]Goel S et al as one of the major reasons expressed by

respondents who give a negative response towards autopsy.

Apart from the above mentioned reasons for the negative [6,8]attitude towards medico-legal autopsy, previous studies

have shown that religious objections, autopsy disturb the peace

of the deceased, the patient is too young or old, objection

expressed by the deceased before death, involvement of the

police or court and lack of information on the reasons and

feedback on the results of autopsy play important roles; even

though this is not the case in our study. [10]A majority of the respondents seen in a study from Japan,

including those in this study, asserted that the main reason for

their consenting to autopsy was to determine the cause of

death. Knowing the cause of death may help the relatives to [8]cope better with the loss of their beloved or help to settle

claims. Another common response among the consenting [10]relatives, seen not only in our study but in Ito T et al as well,

is that autopsy will help initiate criminal investigation into the

death of their kin. This is not at all surprising considering the

fact that a majority of these deaths, where the relatives give this

response, are due to alleged homicide and autopsy findings is

an important factor that may lead to a logical conclusion of the

investigation.

Looking at the various responses given by the relatives in this

study, it may be suggested that virtual autopsy is something

which can be explored in the future in order to address most of

the concerns expressed by them. In virtopsy, the relatives

neither needs to fear of disfigurement of the body as it is not

dissected nor would there be any delay in funeral as the

procedure is less time consuming and moreover it can be done

at any time of day. This will increase the acceptance of medico

legal autopsy among the relatives thereby avoiding

miscarriage of justice which may arise out of exemption to

autopsy.

CONCLUSION :

Even though consent of the relatives is not required for

conducting medico-legal autopsy, many had a negative

perception towards medico-legal autopsy which may

ultimately result in exemption of autopsy. The main reasons are

fear of disfigurement of the dead body, delay in funeral and no

use in knowing the cause of death. Therefore, effort should be

made to address the various issues expressed by the relatives of

the deceased not only to ease their apprehension towards

autopsy but also to deliver justice.

REFERENCES :

1. Aggrawal A. Forensic Medicine and Toxicology for

MBBS. 1st Edition. New Delhi: Avichal Publishing

Company; 2016. p. 93-108.

2. Randall BB, Fierro MF, Froede RC. Practice guideline for

forensic pathology. Archives of Pathology & Laboratory

Medicine. 1998 Dec; 122(12):1056-64.

3. Wood MJ, Guha AK. Declining clinical autopsy rates

versus increasing medicolegal autopsy rates in Halifax,

Nova Scotia: why the difference? A historical perspective.

Archives of Pathology & Laboratory Medicine. 2001 Jul;

125(7):924-30.

4. Blokker BM, Weustink AC, Hunink MM, Oosterhuis JW.

Autopsy rates in the Netherlands: 35 years of decline.

PLoS One. 2017 Jun 15; 12(6):e0178200. [internet].

42


[ c i t e d 2 0 2 0 J u n e 2 9 ] ; A v a i l a b l e f r o m :

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC547226

6/.

5. Park JP, Kim SH, Lee S, Yoo SH. Changes in Clinical and

Legal Autopsy Rates in Korea from 2001 to 2015. Journal

of Korean Medical Science. 2019 Nov 5; 34(47): e301.

[internet]. [cited 2020 June 29]; Available from:


0/

6. Parmar P, Rathod GB. Study of knowledge, attitude and

perception regarding medico-legal autopsy in general

population. International Journal of Medical and

Pharmaceutical Sciences. 2013; 3(6):1-6.

7. Chandran M, Vijayakumari N. Knowledge and Attitude of

General Public in Sub-Urban Chennai to Autopsy.

Medico-Legal Update. 2015 Jul; 15(2):35-39.

8. Goel S, Chikkara P, Chhoker VK, Singh A, Bhardwaj A,

Rajesh DR, Singh NK. Perceptions of Relatives' towards

Medico-Legal Investigation and Forensic Autopsy: A

Survey from Rural Haryana. Journal of Indian Academy

of Forensic Medicine. 2014; 36(4):371-3.

9. Plattner T, Scheurer E, Zollinger U. The response of

relatives to medicolegal investigations and forensic

autopsy. The American journal of forensic medicine and

pathology. 2002 Dec; 23(4):345-8.

10. Ito T, Nobutomo K, Fujimiya T, Yoshida KI. Importance

of explanation before and after forensic autopsy to the

bereaved family: lessons from a questionnaire study.

Journal of medical ethics. 2010 Feb; 36(2):103-5.

11. Pawar MN, Suryawanshi DM, Kumar JP. Myths and

misconceptions about medico-legal autopsies among the

people of Tamil Nadu, India. Journal of forensic and legal

medicine. 2015 Aug; 34:159-63.

43


44


J Punjab Acad Forensic Med Toxicol 2021;21(1) ISSN : 0972-5687 DOI:10.5958/0974-083X.2021.00008.X

1. Mithra. S, *

2. Abirami Arthanari, Senior Lecturer, Department of Forensic Odontology*

3. Pratibha Ramani, Professor and Head, Department of Oral Pathology & Microbiology*

*Saveetha Dental College and Hospitals,Saveetha Institute of Medical and Technical Sciences (SIMATS), Saveetha

University, Chennai-77, Tamilnadu.

Key words: Tooth morphology, Forensic odontology, Toxicology, Organophosphorous, compound, OP compounds


Dr. Abirami Arthanari,

Senior Lecturer,

Department of Forensic Odontology,

Saveetha Dental College and Hospitals, Saveetha Institute of

Medical and Technical Sciences (SIMATS), Saveetha

University, Chennai-77,Tamilnadu.

Contact : +91 63668-11772


Article History :

Received : 16 May 2021

Received in revised from : 16 June 2021

Accepted on : 17 June 2021


INTRODUCTION:

Organophosphorus compounds (OPs) are a wide group of

chemicals which are highly toxic for natural ecosystem. OPs

are mainly a derivative of phosphoric acid or phosphonic acid.

The phosphonic acid derivatives are usually more reactive and (1)more toxic than the phosphoric acid derivatives . OPs are

highly utilized for manufacturing effective pesticides and

insecticides. The chemical pressure on natural environments

has been increased by the industrialization of the agricultural (2)sector . However, their side effects can be a significant

environmental health risk factor due to their documented

potential to cause a large number of negative health and (2)environmental effects . These OPs causes several toxic effects

to human life but in general post organophosphorous exposure,

Salivation, Lacrimation, Urination, Defecation, Gastric

cramps, Emesis (SLUDGE) symptoms occurs acutely within

minutes to hours. Most symptoms occur within minutes or (3)hours following acute exposure . However apart from all

these, due to personal grievances, people themselves have used

OPs as poisons to end their lives (suicide) or to cause harm to

other fellow beings (homicide). In such cases forensic team,

examines the dead body to identify the causative for death. The

Evaluation of Morphological Changes in Natural Tooth Exposed to Organophosphorous Compounds

ABSTRACT :

Introduction: Pesticide poisoning has indeed been recognized as a significant global health problem, and it is the most common

cause of morbidity and mortality. Organophosphorus compounds (OP) are extensively used in agriculture, omestic pest control,

and biological agents. Each year, an estimated 25 million farmers in developing countries are poisoned by pesticides, commonly

OP, which is known to cause serious health ill effects.

Aims & Objectives: To assess the histomorphological alterations in natural tooth due to exposure to different organophosphorus

compounds.

Materials & Methods: This research was carried out with organophosphorus compound - purchased PHOSKILL, insecticide,

from local commercial market. The natural tooth were immersed in the respective solution for an hour and assessed for

morphological & histological alterations through ground sections (200 m). μ

Results: Visually, mild colour changes were noted on the tooth external surface, especially on the root surface. This yellow orange

tint noted of the tooth surface could be because of the concentration of the dye added to the OP compound. The structure and the

morphology of the tooth remain undisturbed. Morphologically, the incremental lines of retzius are brownish bands found due to the

successive apposition of layers of enamel during formation. There are also few hypocalcified structures evident. The dentinal

tubules and interglobular dentin are more prominent in this current ground section and the pulpal tissue was completely lost in OP

compound exposed tooth.

Conclusion: The OP compounds did not prove to show any morphological or histological alterations to natural tooth.

45

natural teeth are most resistant to destruction and they can

persist for long after other skeletal structures have been

destroyed by physical agents. The identification of dental (4)remains is of prime importance when the deceased person .

Also foreign materials subsequently placed inside oral cavity

by dental practitioners, such as fillings, dentures, crowns,

bridges and implants are used as a medium of individual

identification. With passage of time, the role of teeth has

increased and very often teeth and dental restorations are the (5)only means of identification . This study utilizes the teeth as a

newer approach to assess the morphological alterations in

dentin of natural tooth exposed to OP compounds.

Previous literatures reported changes to tooth structures

exposed to different acids in different concentrations. Jadhav (4)K, et al. used hydrochloric acid, nitric acid and sulphuric acid

and identified positive changes in the teeth depending upon the (5)duration of exposure. Seethapathy, et al. analyzed the

morphological changes in the teeth exposed to hydrochloric

acid (HCl) and nitric acid (HNO3) by 48 hrs and 20 hours. No

other studies have been performed to estimate the dentin

changes in natural tooth exposed to different OPs. The aim of

the current study is to assess the morphological alterations in

dentin of natural tooth exposed to OP compounds.

MATERIALS AND METHODS:

10 freshly extracted human natural teeth (free of any defects,

preferably orthodontic tooth extraction and impacted tooth)

used for the study were obtained as per the protocol approved

by the institutional ethics committee of department of Oral

pathology & Microbiology from Saveetha dental college &

hospitals, Chennai. The randomly selected tooth samples were

initially immersed in an organophosphorous compound

purchased from local commercial market [PHOSKILL,

insecticide, Gujarat]. The exposed teeth were retrieved after a

time span of 1 hour and washed with distilled water, dried,

photographed and 200μm ground sections were made using a

hard tissue microtome. The alterations in the dentin of the tooth

exposed were assessed using light microscopy for

morphological alterations. Carious teeth, teeth with pulpal,

periapical or periodontal diseases, teeth with physiological

wear, developmental defects were excluded from the study.

RESULTS:

Visual changes:

After 1-hour, mild color changes were noted on the tooth

external surface, especially on the root surface. The structure

and the morphology of the tooth remain undisturbed. Figure 1

shows mild yellowish-orange tint, especially in the root

surface.

Morphological changes in Enamel:

The incremental lines of retzius are brownish bands found due

to the successive apposition of layers of enamel during

formation. There are also few hypocalcified structures evident.

Figure 2 (10X magnification) shows prominent hypocalcified

enamel structures and prominent incremental lines of retzius.

Figure 3 (40X magnification) shows dentinal tubules and

interglobular dentin are more prominent in ground section .

Pulp: The pulp was completely lost in OP compound exposed

tooth and hence couldn't be assessed.

DISCUSSION:

In developing countries, poisoning is the commonest suicidal

technique with 10.3% - 20.6% suicidal cases reported in India

due to organophosphorous poisoning. Pesticides containing

organophosphorous compounds are among the most (6)commonly used poisons . These OP compounds are proven to

cause SLUDGE (salivation, lacrimation, urination, defecation, (7)gastric cramps and emesis) symptoms . There might be

differences in signs and symptoms observed with each of the

cases but then as observed, cumulatively the most common

oral cavity manifestations are swelling of the lips, thickening

of the oral mucous membranes with mild yellow to whitish

discoloration and moderate to intense white discoloration with

the attached gingival and tongue also displayed yellowish (8)white patches which indicates that the signs and symptoms

are observed in the soft tissue component of the oral cavity. The

precise compound, amount, route of exposure, and rate of

metabolic degradation all influence when and how (9)organophosphate symptoms appear . People may come into

contact with OP through a variety of methods, including (9)ingestion, eating, drinking, inhalation, and dermal contact .

Most OP compounds are highly lipid soluble compounds and

absorbed better through skin, oral mucous membranes, and (9)conjunctiva . This research is an attempt to evaluate any

alterations in the hard tissue component, teeth; exposed to OP

compounds.

The visual changes noticed in the tooth immersed in OP

composed are the change in colour of the tooth. After 1-hour,

mild colour changes were noted on the tooth external surface,

especially on the root surface. This yellow-orange tint noted of

the tooth surface could be because of the concentration of the

dye added to the OP compound. The structure and the

morphology of the tooth remain undisturbed. There are no

much evidences about the dyes used in the OP compounds.

1 2 3


46

There was noticeable increase in the number of hypocalcified

structures, especially the enamel lamellae in tooth immersed in

OP compounds that the tooth not exposed to OP compounds.

The enamel lamellae were more than the enamel tufts and

spindles. The enamel lamellae were proven to be a permeable

pathway that allows caries-causing bacteria to reach the

dentine-enamel junction. Caries may thus grow inside the

tooth without leaving noticeable signs on the surface due to the

presence of lamellae. These are formed when there are

disturbances during enamel formation, also when the external

forces are more at stage of life these lamellae propagates to a (10-11)crack . This OP compound must have induced the lamellae

to crack. There were prominent also prominent incremental

lines of retzius noted. The incremental lines of retzius are

brownish bands found due to the successive apposition of

layers of enamel during formation but not any external force

involved.The dentin showed prominent interglobular dentin.

This is not regressive change due to OP compound. They are (12)the poorly mineralized area during the formation stages . The

outermost structure of tooth is enamel which showed very mild

alterations when exposed to OP compounds, so the

possibilities of alterations in dentin not possible.

There is no evidence of pulp in the ground sections. This could

be the dissolution of the soft tissue, pulp through the apical

foramen or the other possibility could be wear off during

ground sectioning but the procedural error cannot be evident in

all the samples evaluated. There are no literature evidences to

prove this dissolution of pulp due to OP compounds.

Unfortunately, these structures are normal to be anticipated in a

ground section of a natural tooth. No alterations are evident to

conclude positively that OP compounds influenced changes in

natural tooth.

REFERENCES:

1. Inch TD. The biological importance of organophosphorus

compounds containing a carbon- phosphorus bond. Ciba

Found Symp. 1977 Sep 13-15;(57):135-53.

2. Nicolopoulou-Stamati P, Maipas S, Kotampasi C,

Stamatis P, Hens L. Chemical Pesticides and Human

Health: The Urgent Need for a New Concept in

Agriculture. Front Public Health. 2016;4:148.

3. Peter JV, Sudarsan TI, Moran JL. Clinical features of

organophosphate poisoning: A review of different

classification systems and approaches. Indian J Crit Care

Med. 2014; 18(11):735-45.

4. Jadhav K, Nidhi Gupta, et al. Effect of acids on the teeth

and its relevance in postmortem identification. Indian

Journal of Dental Research. 2009; 1(2): 93-8.

5. Thanuja Seethapathy. Effect of Acids on Teeth and

Restorative Materials: An Aid in Forensic Odontology.

J.Hard Tissue Biology 2019;28(1): 21-30.

6. Kar N. Lethality of suicidal organophosphorus poisoning

in an Indian population: exploring preventability. Ann

Gen Psychiatry. 2006;5:17. Published 2006 Nov 21.

7. Peter JV, Sudarsan TI, Moran JL. Clinical features of

organophosphate poisoning: A review of different

classification systems and approaches. Indian J Crit Care

Med. 2014;18(11):735-745. doi:10.4103/0972-

5229.144017

8. Sneha Sethi, et al. Oral Cavity: An insight to forensic

diagnosis. Asian Pac. J. Health Sci., 2015; 2(2): 142-147

9. Abirami Arthanari1, et al. Oral Manifestations of Poisons

in View of Forensic Odontology-A Review. Medico-legal

Update, October-December 2020, Vol. 20, No. 4.

10. B N Walker , O F Makinson, M C Peters, et al. Enamel

cracks. The role of enamel lamellae in caries initiation.

Aust Dent J. 1998 Apr;43(2):110-6

11. C F BODECKER. Enamel lamellae and their origin. J

Dent Res. 1953 Apr;32(2):239-45.

12. Chantha Jayawardena, et al. Regional distribution of

interglobular dentine in human teeth. Arch Oral Biol. 2009

Nov;54(11):1016-21.




Dr. Guriqbal Singh,

Assistant Professor,

Department of Forensic Medicine, Punjab Institute of Medical

Sciences, Jalandhar

Contact : +91 9915044296


KEYWORDS :

Article History:Received: 11 July 2019Received in revised form: 11 August 2019Accepted on: 11 March 2021Available online: 31 August 2021

INTRODUCTION :

Deaths due to railway track injuries remain more or less

constant every year. Incidence of death due to railway injuries

constitute a significant group of transportation related

mortalities. Abrasions and lacerations are characteristics of

railway accident injuries. Primary impact injuries are mainly

caused as a result of striking of the body with the protruding

parts of engine/train and are most commonly present on head

and/or both upper and lower extremities. Whereas secondary

impact injuries i.e. abrasions mainly are present on the trunk as

a result of subsequent fall on the ground. However the type of

injury depends upon the position of the person at the time of

impact and speed of the approaching train. Criteria for

differentiating suicide, homicide and accident was as under :

Suicide : Where history & inquest report favoured suicidal

intent and on autopsy, decapitation and transverse severing of

the trunk without any associated fatal injuries/suicide note was

detected.

Homicide: Included cases of injuries caused by particular type

of weapon on the body, fatal poisoning (excluding cases of

suicides) or passengers who were thrown from trains after

assault on trains or at stations.

Accident: Included bizarre type of injuries which are not [1-5]coinciding the injuries of suicide and homicide.


Present study was carried out on 196 cases at Mortuary wing of

Forensic Medicine Department, Govt. Medical College, st stAmritsar with effect from 1 January 2000 to 31 December

2001 on alleged railway accidental deaths. History of

incidence was taken from the relatives, friends, eyewitnesses

and investigating agency. Detailed examination of the body

and injuries were done to endorse/corroborate or rule out the

alleged manner of death. Railway related deaths were defined

as all deaths that occurred as result of commuting (including

assaults on trains) or occurred on or close to a railway line or

station. All bodies were subjected to a full autopsy

examination. In all those cases of suicides where the history of

alcohol was positive or alcohol consumption (just before

death) by the deceased was mentioned in the inquest report,

viscera was preserved for the detection of intoxicants.

RESULTS :

Incidence of deaths due to railway injuries was 9.66%.

Number of deaths due to railway injuries remained almost

constant each year in the two year study i. e. 9.98% and 9.36%

respectively for the year 2000 & 2001. (Table 1)

Abrasions and lacerated wounds observed in maximum

number (73.97%) of deaths due to railway injuries which

constituted (49.48%) of deaths due to railway accidents and

ABSTRACT :

Introduction : Railway related deaths were defined as all deaths that occurred as result of commuting (including assaults on trains)

or occurred on or close to a railway line or station.

Materials and Methods: Study was carried out at Mortuary wing of Forensic Medicine Department, Govt. Medical College, st stAmritsar with effect from 1 January 2000 to 31 December 2001 on alleged railway accidental deaths.

Results : Most common age group involved in suicidal deaths was 21-30yrs and 41-50 yrs age group. Clothes/body were showing

evidence of grease in 87.76% of cases. Maximum (46.42%) number of cases dying due to railway injuries were unknown followed

by those belonging to urban and rural areas.

1. Amarjit Singh, Medical Officer, Punjab Health System Corporation2. Guriqbal Singh, Assistant Professor, Department of Forensic Medicine, Punjab Institute of Medical Sciences, Jalandhar.

Pattern of Injuries and manner of Death in Alleged Railway Accident Deaths : An Autopsy Study


47

rd1/3 (24.48%) of cases of suicidal injuries. Abrasions were

found in lesser (3.06%) number of cases and bruises were

observed in least (0.51%) number of cases of total railway

fatalities. (Table 2)

Maximum number of abrasions were observed on the chest

(45.91%) in both accidental and suicidal rail associated deaths

followed by upper limbs ( 44.38%) and lower limbs (39.79%)

least abrasions were observed on the neck (2.04%). In contrast

to the above findings the lacerations were maximum (61.22%)

on the head (Figure 1) followed by lower limbs (45.91%) and

limbs ( 40.91%) in case of accidents . (Table 3)

Fracture of the skull was observed in 56.63% of cases and the

accidents alone accounts for fractures of skull in 42.85% cases

(Figure 2). Out of total 23.97% of fractures of cervical

vertebrae, 22.45% were in suicidal cases.

Mutilation/crushing/amputation was observed in 15.94%

cases of suicidal deaths (Figure 3) where as in railway

accidental deaths. It was observed in only 1.6% cases. (Table

4)

48

Table 1 : Incidence of Death Due To Railway Injuries.

Year Total no of cases

Total deaths due to railway injuries

%age

2002

2001

Total

992

1036

2028

99

97

196

9.98

9.36

9.66

Table 2 : Distribution of Different Types of Injuries In Relation To Manner of Death.

S.No Type of injury Manner of death Total %age

Natural Accident Suicide Homicide

Abrasions

Lacerations

Contusions

Abrasions & Lacerations

Abrasions & Contusion

Contusions & Lacerations

Abrasions & Contusions

& lacerations

Abrasions, lacerations

& incised wounds

Total

1

--

--

--

--

--

--

--

1

1

2

3

4

5

6

7

8

5

11

1

97

3

1

6

--

124

--

16

--

48

--

2

3

---

69

--

1

--

--

--

--

--

1

2

6

28

1

145

3

3

9

1

196

3.06

14.28

0.51

73.97

1.53

1.53

4.59

0.51

100

Table 3 : Distrubution of Abrasions And Lacerations In Relaion To Manner of Death

Site of injury

*Out of total abrasions/lacerations.

Abrasions Lacerated Wounds

Head

Neck

Upper Limbs

Lower limbs

Chest

Abdomen

Mixed

Accident*

10

3

65

57

64

32

36

Accident*

83

9

54

71

18

13

64

Suicide*

8

1

21

21

26

8

14

Suicide*

36

42

26

19

4

10

3

Homicide*

--

--

1

--

--

--

--

Homicide*

1

--

--

--

--

--

--

%age

9.18

2.04

44.38

39.79

45.91

20.40

25.51

%age

61.22

26.02

40.81

45.91

11.22

11.73

34.18

Total

120

51

80

90

22

23

67

Total

18

4

87

78

9

40

50

Figure 1 : Showing lacerated wound on head in death due to accidental railway injury


Collectively maximum number of injuries in the form of

abrasions, lacerations and fractures were observed in lower

limbs and upper limbs i.e. 85.71% and 85.20% respectively

followed by head (70.41%). (Table 5)

Alleged method of suicide was as per the information gathered

from the investigation agencies explaining the circumstances

leading to death either from the scene of crime (at or near

railway track) or from the statement of the witness present at

the time & place of incidence of railway fatality where as the

observed cause and manner of death as suicide was classified

depending ( in addition to above findings ) upon the injuries

involving the different body parts i.e. pattern of injuries . In

maximum ( 72.27%) number of alleged suicide cases , method

of committing suicide remained unknown, whereas 20.27%

cases committed suicide by placing neck on the track before

running train and a minimum of 6.75% committed suicide by

jumping before the running train as mentioned in the inquest

reports.

Death due to suicide was observed in those cases having

severance of neck, trunk (Figure 4) or any other cause in favor

of the suicidal death as observed from the pattern of injuries.

The most selective way of committing suicide by placing neck

over the track leading to severance of neck was observed in

63.76% cases of suicidal deaths. Others (23.18%) were

49

Table 5 : Site of Injury In Railway Related Fatalities In Relation To Manner of Death

93

12

119

128

82

45

100

44

44

47

40

30

18

17

138

56

167

168

112

63

117

70.41

28.57

85.20

85.71

57.14

32.14

59.69

1

--

1

--

--

--

--

Site of injury Total %ageManner of Death

Accident Suicide Homicide

Head

Neck

Upper Limbs

Lower Limbs

Chest

Abdomen

Mixed

Table 4 : Fractures of Different Body Parts in Relation to Manner of Death

84

3

50

87

36

8

41

26

44

23

15

11

6

13

111

47

73

102

47

14

54

56.63

23.97

37.24

52.04

23.97

7.14

27.55

1

--

--

--

--

--

--

Site of Fracture Total %age

Skull

Cervical Vertebrae

Humerus / Radius-Ulna

Femur/Tibia –fibula

Ribs

Lumbar Vertebrae

Mixed i.e Pelvic/Facial /Thoracic

Manner of Death

Suicide Homicide

Figure 3 : Showing multilation/crushing/amputation of body parts in death due to suicidal railway injuries (Probably by jumping before the running train)

Accident

Figure 2


Figure 4 : Showing severance of trunk in death due to suicidal railway injuries

observed as those cases where cause of death was laceration of

any vital organ or hemorrhage and shock in suicidal death

cases. In least (2.90%) number of cases, compression of brain

was the cause of death in suicidal railway injuries.

Severance of neck i.e. decapitation was associated with other

mechanical injuries in major number (68.18%) of cases of

suicides where as decapitation only was observed in lesser

number (6.81%) of suicidal railway injuries. (Table 6)

Death was alleged as railway accident while crossing the

railway track and striking with the running train of fall from the

running train as per police papers. 64.46% were the cases

alleged to have dies of railway accidents, but not clearly

indication the methods by which accidental deaths occurred

i.e. it remained unknown to the investigation agencies or by

way of mere presumption.

Out of total 121 cases of death due to alleged railway accidents,

28 cases (23.14%) died while crossing the railway track, 11

cases (9.09%) were of fall from moving train and the least

(3.3%) number of cased died while walking along the railway

track as per police reports whereas in 124 cases, on

postmortem examination, the manner of death was given as

accident. Laceration of brain was the commonest cause of

death (Figure 2) i.e. 75 cases (60.48%) irrespective of fracture

of skull bones. Hemorrhage and Shock was observed in those

cases (12.90%) where multiple injuries (both external as well

as internal) resulted into the loss of blood sufficient to cause

death. Majority of deaths in observed accidental cases

involved the brain (77.41%) as a cause of death. (Table 7)

Accident, suicide or homicide was described as un-natural

manner of death whereas death due to natural disease not

associated with any un-natural cause was considered as natural

manner of death. Alleged manner of death was obtained from

investigation agencies dealing with the case. Observed manner

of death was described from the pattern of injuries over

different body parts. A simple decapitation was only an

indication of suicide and rarely accident. Traumatic

amputation of the limbs (Figure 5) or trunk was commonly an

indication of accident or rarely can have multiple injuries

instead of one's typically observed in accidents. In both the

manners of death i.e. alleged and observed, the maximum

50

Figure 5 : Showing run over railway injury on right tower of postmortem origin (Body was kept on railway track ro conceal the crime)

Table6:AllegedMethodOfCommittingSuicideAndObservedCauseofDeathInSuicidalRailwaysInjuries

S. No Alleged Observed

Method of committing Suicide

Cause ofSuicide

Severance of neck

Severance of neck

Lacerations ofVital Organs/Haemorhage

Compressionof Brain

Number of cases Number of cases %age %age

15 20.27

6.75

72.97

----

100

44

7

16

2

69

63.76

10.14

23.18

2.90

100

5

54

74

---

By placing neck on the track 1

2

3

4

By jumping before running train

Unknown means

---

Total Total


Figure 6 : a putrefied dead body with multiple incised stab wounds of antemortem origin of the same case in death due to homicide

death cases were of accidental railway injuries i.e. 61.73% &

63.26% respectively whereas the alleged & observed manner

of death as suicide was 37.75% & 35.20% respectively.

Although no case was reported by police as death due to natural

disease, one case was observed as death due to pulmonary

tuberculosis. Only one case of homicide was alleged as per

police investigation, which on postmortem examination, was

found to have one lower limb having railway related injury of

postmortem origin and multiple incised stab wounds of ante

mortem origin on the body of the same deceased (Figure 6).

Only 2 cases of homicide were observed in this study. The

second case was observed to have been killed by blunt trauma

on the head leading to laceration of brain and was found in the

hedges at a considerable distance from the railway track and

none of injuries were suggestive of railway accident, suicide or

even contact with rail track (Table 8)

51

Table 7 : Alleged Method of Accident And Observed Cause of Death In Accidental Railway Injuries

Sr. No Alleged Observed

Number of cases Number of cases %age %age

28 23

9.09

3.30

----

64.46

100

9

75

21

16

3

124

7.26

60.48

16.93

12.90

2.41

100

11

4

78

121

---

1

2

3

4

5

---

Total Total

Method of accident

While crossing the railway track

Fall from running train

Walking along the railway train

Others

Cause of death

Severance of trunk with other injuries

Laceration of brain

Compression of brain

Hemorrhage and shock

Others

Table 8 : Alleged And Observed Manner of Death In Total Railway Injuries

Sr. No Observed

Number of cases %age

124

69

2

1

63.26

35.20

1.02

0.51

1

2

Alleged

Number of cases %age

61.73

37.75

0.5

-----

121

74

1

----

Manner of death

a) Accident

b) Suicide

c) Homicide

Unnatural

Natural Disease


In maximum number (42.34%) of cases, the cause of death was

laceration of brain followed by severance of neck (22.44%)

and compression of brain (11.73%). Both head and neck

involvement lead to death in 76.4% of cases. Severance of

trunk was observed in 8.16% of cases. (Table 9)

Maximum number of male to female ration was reported in the

age group of 31-40 years both in death due to accidents and

suicides i.e. in railway accidents, male to female ratio was 27:1

and in suicidal deaths, male to female ratio was 11:1. Minimum

number of male to female ratio was observed in 21-30 year age

group both in death due to railway accidents (male to female

ratio 2.6:1) and death due to suicides (male to female ratio

3.9:1). The largest percentage of male death was from suicides

(87.95%) out of total 69 cases of suicides. In the present study

109 cases (87.90%) of males died due to accident where as

females died only in 15(12.09%) cases of accidental injuries.

Similar is the pattern in suicide cases where 60 (86.95%) males

and 9 (13.04%) females committed suicide. Homicidal deaths

on railway tracks were reported in males only.

Non vulnerable age for railway injury was below 10yrs. 41-50

yr age group was involved in majority of cases of deaths

(27.04%) out of total railway fatalities followed by 21-30yr

age group (21.42%) and 31-40yr age group (20.91%). Least

number of cases were observed in extremities of age i.e. 10.2%

in age group 11-20yrs and 9.18% in age group above 60yrs.

There was remarkable difference in the ratio of two sexes i.e.

7.1:1. (Table 10)

Condition of the clothes/body in respect to the presence of

black soot (carbon from the rail tracks) was in one way

conclusive to the extent that the body came in contact with the

railway track, which was observed in cases of accidents and

suicides, but absence of these findings on the clothing's or body

of the deceased may raise a reasonable suspicion of homicide.

Soiling of clothes or body with grease were resulted from the

primary impacts only. In maximum number of cases (87.75%)

of deaths due to railway injuries, soiling of clothes/body with

grease was observed irrespective of manner of death (Table

11)

Area wise distribution was detected as rural (21.42%) or urban

(32.14%) depending upon the residential belongings of the

deceased dies as a result of railway fatalities. Unknown cases

(46.42%) were those whose identity including the residence

was not known to the investigation agencies till the conduction

of the postmortem examination. (Table 12)

Month wise incidence of railway related deaths was divided

into first four months, middle four months and last four months

to know whether there was any effect of fog, overcrowding or

various other activities on railway fatalities due to any seasonal

52

Sr.No

1

2

3

4

5

6

7

Cause of death

Laceration of brain

Severance of neck

Compression of brain

Severance of trunk

Hemorrhage and shock

Laceration of other

vital organs

Disease

Total

No. of cases

83

44

23

16

17

11

1

196

%age

42.34

22.44

11.73

8.16

8.67

5.61

0.51

100

Table 9 : Distributions of cases as per Causes of Death In Total Railway Injuries

Manner of Death Age groups (yrs) Natural

Male Male Male MaleFemale Female Female Female

Accident Sucide Homicide

Total %age Male/Female

ratio

Table 10 : Age And Sex wise Distribution of Cases in Relation to Manner of Death.

11-20

21-30

31-40

41-50

51-60

>60

Total

---

---

---

---

1

---

1

---

---

---

---

---

---

---

9

16

27

31

13

13

109

3

6

1

3

---

---

15

7

15

11

16

8

---

60

1

4

1

3

---

---

9

---

1

1

---

---

---

2

---

---

---

---

---

---

---

20

42

41

53

22

18

198

10.20

21.42

20.19

27.04

11.22

9.18

100

4:1

3.2:1

19.5:1

7.8:1

----

8:1

7.1:1

Sr. No

1

2

3

4

5

6

Table 12 : Area Wise Distribution of Death Due To Railway Injuries

Sr. No

1

2

3

Area

Rural

Urban

Unknown

Total

No of Cases

42

63

91

196

Percentage

21.42

32.16

46.42

100


variations. The number of deaths during the last four months of

the year was maximum (35.71%) followed by middle four

months (34.69%) and least in first four months (29.59%) of the

year. (Table 13)

96.42% victims died with in few hours of sustaining injuries on

the rail tracks which included instantaneous deaths (29.59%)

and immediate (32.65%) deaths i.e. deaths within 3-5 minutes

of sustaining railway injuries. The deceased as survived 1-2

days or more than that were hospital admitted cases which

were accidentally injured. Only case was of suicide amongst

the person seeking admission. (Table 14)

53

Manner of Death

Natural Accident Sucide HomicideTotal %age

109

15

63

9

---

2

---

1

172

196

87.75

100

Table 11 : Incidence of Soiling of Clothes/body With Grease In Relation To Manner of Death.

Sr. No

1

2

Soiling of cloths

With grease

Without greases

January

February

March

April

May

June

July

August

September

October

November

December

Total

Manner of Death

NaturalAccident Sucide Homicide

Total noof deaths

%age

8

9

9

11

10

14

9

12

10

10

6

16

124

5

5

4

6

8

4

4

6

5

7

11

4

69

---

---

---

---

---

---

1

---

---

1

---

---

2

1

---

---

---

---

---

---

---

---

---

---

---

1

14

14

13

17

18

18

14

18

15

18

17

20

196

7.14

7.14

6.63

8.67

9.18

9.18

7.14

9.18

7.65

9.18

8.67

10.20

100

Table 13 : MonthWiseIncidenceofRailwayTrackDeathCasesInRelationToMannerofDeath

Sr. No

1

2

3

4

5

6

7

8

9

10

11

12

Month

Manner of Death

Natural Accident Suicide HomicideTotal %age

---

---

---

---

---

1

1

9

53

56

1

4

---

123

49

11

9

1

---

---

70

---

---

2

---

---

---

2

58

64

67

2

4

1

196

29.59

32.65

34.18

1.02

2.04

0.51

100

Table 14 : Details of case as per time between injury and death in relation to manner of death.

Sr. No

1

2

3

4

5

6

Time between injury and death

Instantaneous

Immediate

With in few minutes

to few hours

About 1-2 days

More than 2 days

Not determined

Total


DISCUSSION :

The incidence of death due to railway injuries Table-1 in the

present study is 9.66% which is higher than 5.41% as reported [7]in the study conducted by Gargi et al (1990) , perhaps the

increase in railway injuries is because of addition of more

trains on the rail tracks, increasing population of the cities,

unmanned crossings. Increasing intolerance in the society

gives rise to more suicides adding to the problems of railway

injuries. In the present study, there was no major accident and

all the cases were as a result of individual mishap similar to the

study conducted by Gargi et al (1990). All the other studies

published so far includes, in majority head on collisions and [8] [9]derailments (Tedeschi, 1977 and Huq, 1982 ) Out of total

transportation related mortalities (38.26%), railway injury

deaths in the present study is 25.25% (i.e. more than 1/4” of

transport related fatalities). Whereas in the study conducted by [10]Lerer et al 1997 in the Cape Town, South Africa, railway

fatalities constituted 14% of transport related mortalities. The

reason for this variation of the study might be due to the fact

that as compared to the Cape Town of South Africa, here at

Amritsar, commuters run across the track more so to board

incoming trains in addition to trespassing and unmanned

crossings. Although trespassing is an offence under section

147 of Indian Railway Act punishable with a fine of Rs.1,000/-

or imprisonment for six months.

In the study conducted by Gargi et al (1990), abrasions bruises

and lacerations were the commonest injuries as were expected

in blunt trauma and combination of abrasions and lacerations

formed a single largest group (45.57%) where as in the present

study, although pattern of distribution of of abrasions injuries

(Table 2) is the same but the proportion and lacerations is

higher (73.97%), which is highly suggestive of characteristics

of accidents similar to above mentioned study.

Irrespective of the manner of death the maximum (45.91%)

number of abrasion were found on the chest (Table-3)

followed by upper limbs (44.38%) and lower limbs (39.79%).

Minimal (9.18%) abrasions were found on the head where as

maximum (61.22%) lacerations were found on head followed

by lower limbs (45.91%) Upper and minimal (11.22%)

lacerations were found on the chest. Similarly (Table - 4)

maximum (56 63%) fractures were of the skull followed by

fractures of femur/ tibia-fibula (52 04%) of both sides and

humerus/radius and ulna (37.24%) of both sides. Maximum

number of lacerations over the head and both upper and lower

limbs are due to the fact that the result of primary impact

injuries is mostly on those parts of the body which comes first

in contact with the protruding parts of the approaching train

whereas maximum number of abrasions over the chest and

both upper and lower limbs in all probabilities are due to the

secondary impact injuries which are not directly in contact

with the moving train. Since no such comparative data about

the type of injuries i.e. abrasions, lacerations and fractures in

relation to manner of death due to railway injuries is reported

till date to the best of our knowledge, so no comparison can be

drawn.

In the inquest reports of present study, in maximum (72.97%)

number of cases, the alleged method of suicide was not known

(Table -6) and in 20.27% cases, the eye witness/circumstantial

evidence' favored/stated that the deceased died by placing neck

on the track. 6.75% cases died by jumping before the running

train. Autopsy examination in the present study revealed

severance of neck and trunk in 67.76% and 10.14% cases

which is more or less similar to the study conducted Gargi et al

(1990) where 60% and 12% committed suicide by placing

neck and trunk on the track respectively. In the present study,

2.90% cases tried to commit suicide were rescued and

hospitalized who later on succumbed to their injuries and were

declared to have died as a result of compression of brain. No

such comparison of alleged method of suicide with observed

cause of death is reported by any author. The findings of

decapitation and rarely severance of trunk not associated with

other injuries, goes highly in favour of suicidal railway deaths.

Very rarely the victims who jump in front of the moving trains

have pattern of injuries which is similar to that of accidental [11-13]injuries. In the study conducted by Gargi et al ( 1 9 9 0 ) ,

mutilation/crushing/amputation was observed in 72.15%

cases where as in the present study these features were

observed in 17%cases only . This single feature of

mutilation/crushing/amputation is rather diagnostic of railway

injuries when taken in combination' with finding of [14]grease/blackish material on the body or clothes. This finding

of grease/blackish material on the body or clothes was seen in

73.41% cases in the study conducted by Gargi et al (1990),

whereas in the present study, 87.76% cases show evidence of

soiling of clothes/body with grease.

Though in the present study, alleged method of accident and

observed cause of death in the accidental deaths due to railway

injuries are more or less similar (Table-7) but the alleged

accidental deaths remained unwitnessed in maximum

(64.46%) number of cases and in the inquest reports these were

reported as deaths due to railway accidents. Whereas in

observed railway accidental deaths, laceration of brain was the

cause of death in 60.48% of cases. No similar study is available

for comparison and it was observed that a person while

walking along the side of the track may be struck by the

protruding parts of the passing train on the side of the body

usually on the head leading to laceration of brain due to

primary impact injuries or both upper and/or lower extremities

54


may be struck. A person hit while crossing the line receives

primary impact injuries on the side of the approaching train

and secondary impact injuries as a result of subsequent fall on

the ground. Amputation of different body parts while walking

along or crossing the track also go in favour of railway

accidental injuriés and rarely gross mutilation of the body parts

may occur while crossing the track and hit by moving train

causing bizarre type of injuries in favour of accidental

fatalities. Any incised wound on the body which is not usually

as a result of railway injuries or any postmortem injury present

over the body to conceal the crime or simulate it as a case of [15]accident goes in favour of homicide.

In the study conducted by Gargi et al (1990), 25.32% cases of

alleged accidents were actually suicides and homicides

otherwise which would have passed of as accidents. However

in the present study, (Table 8) observed manner of death is

more or less similar to the alleged manner in respect of railway

accidental injuries and suicidal injuries. However homicide

was observed in 2 cases as against one case alleged to have died

with criminal motive. In the study conduct by Sahoo & Kar [16]1998 , maximum number of - cases of railway fatalities were

from accidents (55%)followed by suicides (43. 3%) and

Homicides (1.3%). Similarly in the study conducted by Gargi

et al (1990) maximum number of cases of railway fatalities

were from accidents (64.55%) followed by suicides (32.91%)

and homicides (2.53%).

In the present study similar pattern has been observed i.e.

accidents (63.26%), suicides(35.20%) and homicides (1.02%)

clearly showing that deaths due to railway injuries are mostly

accidental though suicidal injuries are also not uncommon.

Infrequently homicidal cases have also been reported in

railway injuries and low incidence of homicide is in

consonance with above mentioned studies. One case was

alleged to have died due to injuries by sharp edged weapon and

later on the dead body was put on railway track to simulate the

cases of railway accident i.e to conceal the crime. Multiple

incised stab wounds were inflicted on abdomen, front and back

of chest to conceal the crime which clearly indicated the

criminal motive of the assailant. In the study conducted by

Lerer et al (1997), 80.21% of railway injuries were reported as

accidental, 11.34% of cases were homicides and 8.44% of

cases were from suicides whereas in the present study least

(1.02%) number of cases were from homicides. The reason for

high percentage of homicide in the Cape Town, South Africa as

reported by Lerer et al in comparison to this study was the high

prevalence of criminal violence in Cape Town and strict law

enforcement in our country prohibits such concealment of

crime making it difficult to dispose off the body on railway

tracks. In 0.51% (1 case) the manner of death was natural in

which the case was an unidentified body found at railway track

alleged to have died due to railway accident. However on

postmortem examination, no demonstrable injury was found

on the body and on opening the chest, Pulmonary Tuberculosis

was evident in favour of the natural death.

In maximum (42.34%) number of cases, the cause of death was

laceration of brain and in another 11.73% of the cases, it was

compression of brain which, together constituted 54. 07%

followed by severance of neck in 22 44% of cases (Table-9).

Head, the most vulnerable part of body to accidental injuries is

responsible for maximum number of involvement of brain- a [17] vital organ leading to death of deceased. No such parallel

study which may show the incidence of different causes of

death due to railway fatalities has been found.

In the study conducted by Gargi et al (1990), the most common

age group involved in railway fatalities was 21-30yrs (46.83%)

which was also the most common age group (42.14%) in study

conducted by Sahoo & Kar (1998). In the present study (Table

- 10), the most common age group involved in railway

fatalities was 41-50yrs (27.04%) followed by 21-30yrs age

group (21.42%). The reason for the shift of age group from 21-

30yrs in the study conducted by Gargi et (1990) and Sahoo &

Kar (1998) to 41-50yrs age group in this study might be the

daily activities and the factors like responsibilities with

complexities of mind in the age group of 41-50yrs. The

remarkable feature is that no child below age of 10 year was

involved in any mishap in our study and the study conducted by

Gargi et al (1990) and Sahoo and Kar (1998) as the children are

considered gifts of God in India and they are better cared as

compared to the Western Countries eg in Great Britain in which

considerable number of children were killed in railway injuries

during 1969 -71 (Tadeschi, 1997).

In our Study 87.24% of victims were male which is more or

less similar to the study conducted by Sahoo & Kar (1998)

where 82.22% of the victims were males. In the study

conducted by Lerer et al (1997) the deceased were also

predominantly men (85%). The male to female ratio (Table-

10) in all the different age groups is more on account of outdoor

activities among males, that is the reason of its preponderance.

In this study, clothes/body were showing evidence of grease,

(Table-11) in 87.75% of cases. In study conducted by Gargi et

al, blackish material/grease was present over clothes and body

in 73.41% of cases. Evidence of grease highly goes in favour of

both accidental and suicidal railway injuries whereas absence

of grease was more evidently in favour of homicidal cases or

presence of blackish material/grease in cases of homicide is

possible if the body has been disposed of after killing on the rail

track. This evidential material is suggestive of contact of the

body with rail track but in no way conclusive of manner of

55


death.

In the present study maximum (46.42%) number of cases

dying due to railway injuries were unknown (Table 12)

followed by those belonging to urban areas (32.14%) and rural

areas (21.42%). Similar pattern had been reported by Gargi et

al (1990) in which maximum number (69.62%) of victims

were from unknown area just like the present study in which

this figure was also highest (46.42%) and unfortunately very

little information was available about circumstances leading to

death of unknown occurrence. As 46.42% cases of railway

fatalities remained unidentified, so it is quite possible that the

persons might have been the passengers who were traveling in

the train and died due to railway track injuries away from their

areas of residence, so their identification was not established.

Though the study points out that such incidences are meager,

yet one must be aware of it while dealing with such cases. The

role of forensic experts and investigating officers is clearly

reflected in this study.

In the study conducted by Sahoo & Kar (1998), most common

occurrences of railway injuries were in middie four months of

the year where as in this study (Table-13) last four months

period of the year is having maximum number of railway

injuries and maximum number (35.20%) of railway fatalities.

The reason behind it might be the effect of fog leading to the [20-21]decreased visibility in winter in this part of the country.

In the study conducted by Gargi et al (1990) incidence of death

was instantaneous to immediate in 87 3% cases. Death was

instantaneous to immediate in 62.24% cases in the present

study (Table -14) and this is the reason why this mode is

selected to commit suicide and also the reason why most cases

(46 42%) remain unknown because victims do not survive to

tell their tale. It was found that the majority (95.42%) of the

victims died with in few hours after sustaining the railway

injuries which is almost similar to the incidence (94.94%)

reported by Gargi et al (1990) irrespective of whether the

victim dies instantaneously, immediately or with in few

minutes to few hours.

In the study conducted by Gargi et al (1990), alcohol was

detected in one case of accident and three cases of suicides

whereas in the present study viscerae of 7 cases of suicides

were sent to chemical examiner to Govt. of Punjab,Patiala for

Chemical analysis of poison/alcohol if any. Out of these

7cases, 6 cases did not show evidence of any poison alcohol

where as in one case report of analysis was not received till the

completion of this research work. The reason for

poison/alcohol free cases might be that the victims were either

sure of the way of committing suicide on railway tracks or

rarely the victims might adopt this method for the benefit of

compensation for their kins.

CONCLUSIONS:

1. Incidence of death due to railway injuries was 9.66%

which constituted 25.25% of the transport related mortalities.

2. Abrasions and lacerations were maximum (73.97%)

injuries found in accidental (49.48%) and suicidal (24.48%)

death cases.

3. Lacerations were the commonest injuries on the head

(61.22%) and abrasions on the chest (45.91%).

4. Most common fractures were in accidental cases (42 85%)

out of total (56 63%) fractures of skull.

5. Abrasions, lacerations and fractures collectively were

observed maximum (85.71%) in lower limbs followed by

upper limbs (85.20%) and head (70. 41%).

6. Mutilation/crushing/amputation was observed in 15 94%

cases of suicides and in 1.6% cases of accidents. Cause of death

in most (77.41%) of the cases was the laceration (60.48%) of

brain followed by its compression (16.93%).

7. Alleged accidents (61.73%) and suicides (37.75%) by the

investigating agencies were more or less similar to the

observed accidents (63.26%) and suicides (35 20%) in the

present study.

8. 0.51% of the cases were alleged to be homicidal in nature

by investigation authorities however on observation in the

present study,1.02% cases were of homicide nature.

9. 0.51% of cases alleged to be accidental were observed to

have died as a result of natural disease (Pulmonary

Tuberculosis).

10. Males were predominant (87.66%) both in accidental and

suicidal cases.

11. No case below 10 years of age was observed to have died

of any railway related injury.

12. 41-50 years age group was the most common (27.04%)

both in accidental and suicidal cases.

13. Clothes/bodies were observed to have been stained in

most (87.74%) cases of railway injuries suggestive of contact

with rail track, but in no way conclusive manner of death.

14. 42% cases of railway track injuries remained unknown

15. 32.14% cases from urban areas and 21.46% cases from

rural areas were amongst the total deaths due to railway

injuries.

16. Least (29.59%) number of cases of railway related injuries

were in the first four months of the year.

17. Maximum (96.42%) victims died within few hours of

sustaining injuries on the rail tracks which included

instantaneous and immediate.

56


REFERENCES :

1. Burgess AW, Sekula LK, Carretta CM. Homicide-suicide

and duty to warn. Psychodyn Psychiatry. 2015

Mar;43(1):67–90

2. Richards TN, Gillespie LK, Givens EM. Reporting

femicide-suicide in the news: the current utilization of

suicide reporting guidelines and recommendations for the

future. J Fam Violence. 2014;29:453–63.

3. Chaudhary P: Social Welfare, Vol. 32 No. 1, Central

Welfare Board, New Delhi, 1985 pp 29

4. Bardon C., Mishara B.L. Systematic review of the impact

of suicides and other critical incidents on railway

personnel. Suicide Life-Threat. Behav. 2015;45:720–731

5. Cina SJ, Koelpin JL, Nichols CA & Conradi SE: A decade

of train pedestrian fatalities: the Charleston experience. J.

Forensic. Sci. 1994. 39. 668-73.

6. Bardon C, Mishara BL. Systematic Review of the Impact

of Suicides and Other Critical Incidents on Railway

Personnel . Suic ide Li fe Threa t Behav. 2015

Dec;45(6):720-31

7. Gargi J Gorea RK & Chanana Ashok : Death due to

railway injuries, a five year study JFMT ,VOL. VII, No 1

& 2 jan-june 1990 pp71 75

8. Huq Muzahuerul M: Injury patterns in railway accident

observation in 3'4 Indo Pacific Congress Bangladesh, rd congress hand book of 3 Indo Pacific Congress on legal

Medicine and Forensic Sciences, 1982, .pp- 201

9. Tedeschi CJ, Eckert WG & Tedeschi LG: Forensic

Medicine, A Study of Trauma and Environmental hazards

Vol 3, Part Ill WB Saunders Company Philadelphia,

London, Toronto, 1° Edition 1977 pp 1186-1 1911

10. Lerer LB & Matzopoulos RG : Fatal railway injuries in

Cape Town, South Africa. American J Forensic Med

Pathol 1997:18:144-7.Clarke M: Railway suicide in

England and Wales, 1850- 1949. Soc. Sci. Med. 1994,

38.401-8.

11. Andriessen K, Krysinska K. Railway suicide in Belgium

1998–2009: incidence and prevention. Crisis.

2012;33:39–45.

12. Dinis-Oliveira RJ, Carvalho F, Duarte JA,et al. Collection

of biological samples in forensic toxicology. Toxicol

Mech Methods. 2010;20:363–414.

13. Gorrie CA, Brown J, Waite PM. Crash characteristics of

older pedestrian fatalities: dementia pathology may be

related to “at risk” traffic situations. Accid Anal Prev.

2008;40:912–919.

14. Chau N, Gauchard GC, Dehaene D, Benamghar L, Touron

C, Perrin PP, Mur JM. Contributions of occupational

hazards and human factors in occupational injuries and

their associations with job, age and type of injuries in

railway workers. Int Arch Occup Environ Health. 2007

May;80(6):517-25

15. Vadysinghe AN, Thambirajah B. Bizarre use of log

splitter: a case of decapitation. Forensic Sci Med Pathol.

2019 Dec;15(4):607-611

16. Sahoo PC & KarSM: Pattern of injuries in railway deaths :

A retrospective study in MDCG Medical College,

Behrampur. Journal of Indian Academy of Forensic

Medicine, vol. 2, No. 3, 1998, pp 67-68

17. Shao X, Wang Q, Shen J, Liu J, Chen S, Jiang X.

Treatment of Traumatic Depressed Compound Skull

Fractures. J Craniofac Surg. 2019 Oct;30(7):2239-2244.

18. Bommer C, Heesemann E, Sagalova V, Manne-Goehler J,

Atun R, Bärnighausen T, Vollmer S. The global economic

burden of diabetes in adults aged 20-79 years: a cost-of-

illness study. Lancet Diabetes Endocrinol. 2017

Jun;5(6):423-430.

19. Tang X, Lou L, Xu Y, Jin K, Cao J, Shao J, Gao Z, Yao K.

Socioeconomic inequality in the global burden of

refraction disorders: results from the Global Burden of

Diseases Study 2017. Acta Ophthalmol. 2020

20. Chang X, Li H, Qin L, Rong J, Lu Y, Chen X. Evaluation

of cooperative systems on driver behavior in heavy fog

condition based on a driving simulator. Accid Anal Prev.

2019 Jul;128:197-205.

21. Kampczyk A. An Innovative Approach to Surveying the

Geometry of Visibility Triangles at Railway Level

Crossings. Sensors (Basel). 2020 Nov 19;20(22):6623.

57




Dr. Kamal Singla,

Assistant Professor

Department of Forensic Medicine & Toxicology, Faculty of

Medicine & Health Sciences, SGT University, Gurugram,

Haryana, India.

Contact : +91 9991995200, 9718127000


KEYWORDS : Sexual Dimorphism, Patella, India, Haryana, Osteometric Analysis, Anthropology

Article History:Received: 17 April 2020Received in revised form: 5 May 2020Accepted on: 5 May 2020Available online: 31 August 2021

INTRODUCTION:

Identification is the act of establishing the identity. The ethical

and humanitarian need to know about the identification from

anatomical and medical features especially needed for the

information which comprises few major aspects- surviving

relatives to establish the fact of death in respect of that

individual, for official, statistical and legal purposes; to record

the identity for administrative and ceremonial purposes in

respect of burial or cremation; to discharge legal claims and

obligations in relation to property, estate and debts; to prove

claims for life insurance contracts, and other financial matters;

and to allow legal investigations into overtly criminal or

suspicious deaths, as the identity of the deceased person is a 1vital factor in initiating investigations.

The establishment of identity may be required upon in cases of:

intact fresh corpses, decomposed corpses, mutilated &

1 dismembered corpses and skeletonised material. Mutilation of

the dead body is either done by criminal to destroy all traces of 2identity and thus facilitate the disposal of the dead, or it may be

caused by scavengers.

There are four basic categories associated with biological

identity: sex, age-at-death, stature and ethnic origin. Each of

these, taken either in isolation or collectively, allow a

preliminary picture to be built regarding the possible identity

of the deceased and permits targeting of specific aspects of a 3missing persons register. It has been well established within

osteological and paleoanthropological research that sexual

dimorphism has been present throughout human evolution as 4well as in modern populations.

Determination of sex in non-skeletonised bodies is usually

obvious and rarely presents problems. In general, the external

genitalia remain recognizable until a late stage of putrefaction.

ABSTRACT:

Introduction: Identification is the act of establishing the identity. The pelvic bone and skull are the first choices for morphological

sexing if not recovered in fragmentary states and if recovered in a fragmentary state, other bones such as the patella can be used for

sex determination from osteometric analysis.

Materials and Methods: Patella from 400 subjects including male (199) and female (201) from both sides and studied nine

dimentions which showed that there were definite sexual osteometric differences between male and female patella bones from the

population of Haryana.

Results: For both sides, weight had the maximum AUC (0.979 for right and 0.982 for left side), thus indicating it can be used for

differentiation between males and females. For right and left sides, the projected sensitivity of weight was 96.5% and 97%

respectively and value of patella parameters can be used for differentiation in gender. Using these techniques, projected specificity

for right and left side of weight was 89.6% and 91% respectively.

Conclusions:These findings implied that, the determination of sex can be accomplished by comparing the dimension of unknown

patella bone with the cut off value given. The present study produced standard for sex determination from patella and will be useful

for forensic anthropologists.

1. ,Kamal Singla Assistant Professor*

2 Yatiraj Singi, Associate Professor, Department of Forensic Medicine & Toxicology, AIIMS Bilaspur, Himachal Pradesh

3. Rajiv Kumar Sinha, Assistant Professor*

4. S K Dhattarwal, Professor & HOD, Department of Forensic Medicine & Toxicology, Pt BD Sharma, PGIMS, Rohtak, Haryana

*Department of Forensic Medicine & Toxicology, Faculty of Medicine & Health Sciences, SGT University, Gurugram,

Haryana, India.

Estimation of Sexual Dimorphism by Osteometric Analysis of Patella

58


In addition, breasts and general body shape, as well as the

pattern of pubic hair, reveal the sex. Where putrefaction is

advanced, examination of the internal pelvic organs may still

reveal unequivocal evidence of sex. The uterus is the organ in

the body most resistant to decomposition, though the prostate 5is also quite persistent.

It is not easy to determine sex in cases of mutilated or

skeletonised remains. This problem also arises in sexual

crimes where genital mutilation is common phenomenon and

also in cases where dead body is destroyed by scavenging activities.

Obvious sex differences do not become apparent until after

puberty usually in the 15-18-year period, though specialized

measurements on the pelvis can indicate the sex even in foetal 1material. Krogman (1962) comments that he scored 100 per

cent accuracy using the whole skeleton, 95 % on pelvis, 92 %

on skull, 98 % on pelvis plus skull, 80 % on long bones and 98

% on long bones plus pelvis.

In general, adult female skeletal measurements are about 94 %

that of the male of the same race, but different measurements

may vary from 91 to 98 %. The criteria set out above exclude

pre-pubertal and senile persons, and are less valid for those 6outside the 20-55 age groups.

There are two methodological approaches to sexing human

remains: morphological and osteometric. Morphologic

techniques focus on the shape of the bony configurations that

are macroscopically visible and differ between males and 8females. Osteometric analysis, based on bone dimensions, is

the method of choice for skeletal parts like long bones that do

not exhibit clearly definable shape variants. The major

problem with this technique is that standards are temporarily

sensitive and population specific Most of the older studies of 9.

sex differences in the skeleton (skull and pelvis mainly)

centred on morphological traits in a descriptive manner. The

newer studies focus on metric analysis in a largely quantitative 7and statistical sense.

The techniques used in sex determination have been primarily

focused on the pelvis where reproductive difference is best

seen. The pelvis affords the best results and is considered as the

principal bone with most reliable and pronounced

characteristics for distinguishing sex which provides the most 10-12marked and typical sexual differences. Skull is the second

major bone after the pelvic bones by which one can determine

the sex of an individual with high degrees of accuracy. Some

past studies showed that the skull alone can accurately 13-15determine the sex in more than 80% of the individuals.

Recently, long bones became the most actively studied part of

the skeleton. To these, one would add the ribs, vertebrae, 16-23clavicle, and bones of the hand and foot. Determination of

sex, while well established for many populations, is a 24population specific phenomenon. Studies have been done on

establishing the sex from femur, sternum, clavicle, radius, 25-30ulna, scapula and others.

Morphological and metrical features of some bones that 31display sexual differences have been described. These

32 33 34include the pelvis , the cranium , bones of the upper and 35lower limbs . Recently, there has been an increased interest in

the use of metrical methods in sex assignment. The most

commonly used metrical method is discriminant function 35analysis . Nearly every bone has been subjected to

35discriminant function analysis but not much literature has

been found on the usefulness of measurements of the patella in

the determination of sex using this method. If body recovered

in fragmentary or mutilated condition, patella bone can be used 38,40for sex determination by metric analysis.


The present study was undertaken in the Department of

Forensic Medicine & Toxicology, Pt. B D Sharma, PGIMS,

Rohtak, Haryana. A total of 400 subjects including both sexes

were chosen during postmortem examination for retrieving the

sample. Only intact patellae from known sex subjects were

chosen for the study and patellae showing any signs of

pathology and any kind of abnormality (congenital as well as

acquired) were excluded from the study.

MEASUREMENTS :

The following measurements of each patella were taken to

know the sexual dimorphism:-

1. Maximum height (MAXH)—the greatest distance

between the base and apex.

2. Maximum breadth (MAXB)—the greatest distance

between the medial and lateral sides.

3. Maximum thickness (MAXT)—the greatest distance

between the anterior and posterior surface

4. Height of articular facet (HAF)—maximum height of the

articular facet on the posterior aspect of the patella.

5. Medial articular facet breadth (MAFB)—distance

between the medial edge of the patella and the median

ridge of the articular facet.

6. Lateral articular facet breadth (LAFB)—distance

between the lateral edge of the patella and the median

ridge of the articular facet.

7. Weight of patella (Wt)

8. Volume of patella (Vol)

9. Specific gravity of patella (SG) = Density of bone/Density oof water (4 C)

59


males (38.7%) as compared to females (14.4%). Statistically,

this difference was significant (p<0.001) as shown in table 2.

Table 3 shows comparison of different parameters according

Measurements were taken using a vernier caliper. In addition, a

water displacement method was used for measuring volume of

bone. In this, each sample was submerged into a graduated

container containing water and the displacement method was

used to calculate volume of bone. Specific gravity was

measured by using weight & volume of bone and density of

water. Specific gravity is the ratio of density of substance with

the reference sample usually taken as water at specified

temperature and pressure.

RESULTS :

Out of 400 samples included in the study, a total of 199 (49.8%)

were taken from male and 201 (50.2%) were obtained from

females as shown in table 1. Majority of samples, irrespective

of gender were in the age group 18-40 years, however,

proportion of samples in age group >40 years was higher in

60

Table 1: Gender wise distribution of samples:

SN12

MaleFemale

199201

49.850.2

Gender No. of samples Percentage

Parameter Female (n=201)

Range RangeMean MeanSD SD T P

Male (n=199) Significance

-26.245

-20.891

-19.060

-19.379

-19.952

-19.200

-27.732

-24.367

-0.931

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.353

Right side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

45.7-31.11

40.8-30.03

22.31-14.05

33.62-23.71

23.72-17.11

27.88-21.1

15.99-11.1

13-10

1.9-1.1

35.90

36.13

18.35

26.76

20.67

23.96

12.89

11.09

1.17

2.73

3.00

1.83

2.07

1.12

1.43

0.91

0.81

0.09

50.84-35.33

52.86-34.14

25.75-17.11

41.89-25.73

27.76-20.18

33.8-20.98

20.76-12.91

17-11

1.336-1.102

43.18

42.36

21.74

31.64

23.30

27.55

16.30

13.82

1.18

2.81

2.96

1.72

2.89

1.49

2.23

1.48

1.37

0.04

-26.334

-19.393

-17.448

-18.037

-17.082

-19.257

-27.114

-23.112

-2.785

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.006

Left side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

2.82

3.32

1.74

2.17

1.31

1.49

0.95

1.04

0.05

42.76

41.92

21.19

30.96

22.93

27.21

16.05

13.60

1.18

2.93

2.92

1.76

2.98

1.63

2.21

1.53

1.41

0.04

41.62-30.14

41.61-30.14

22.35-14.1

32.64-21.14

23.42-17.4

26.86-20.33

15.71-11.1

13-10

1.316-1.1

35.19

35.86

18.14

26.26

20.40

23.59

12.59

10.74

1.17

50.31-34.28

52.18-31.37

25.79-18.01

41.79-25.43

27.6-19.98

33.81-23.01

20.81-12.83

18-11

1.308-1.101

Table 3: Comparison of different parameters according to gender:

Table 2: Age and gender wise Comparison of two groups:Age group

<18 Yrs18-40 Yrs-Y. adult40-60 Yrs-M. age>60 Yrs-O. age

182768818

Total Males (n=199)

No.7

1156413

No.11

161245

%3.557.832.26.5

%5.5

80.111.92.5

Females (n=201)

2X =30.284 (df=3); p<0.001


comparison of different parameters according to gender in age

group 18-40 Yrs. In age group 18-40 years, a significant

difference in mean measurements of different parameters was

observed for all the parameters at both the sides except for SG.

Thus the trend was same as for <18 years age group. Table 6

shows comparison of different parameters according to gender

in age group 40-60 Yrs. In age group 40-60 years, a significant

difference in mean measurements of different parameters was

observed for all the parameters at both the sides except for SG

on right side. Table 7 shows comparison of different

parameters according to gender in age group >60 Yrs. In age

group >60 years, a significant difference in mean

measurements of different parameters was observed for all the

parameters at both the sides except for SG.

to gender. Except for SG at right side, for all the parameters at

both the sides, the difference in mean values of males and

females was significant statistically. It was observed that for all

parameters males had higher mean value as compared to

females (p<0.001).

However, in order to reconfirm that age does not change the

nature of difference between males and females for different

parameters, a comparison of different parameters between

males and females was also made for different age groups as

shown in Tables 4 to 7. Table 4 shows comparison of different

parameters according to gender in age group <18 Yrs. In age

group <18 years, a significant difference in mean


parameters at both the sides except for SG. Table 5 shows

61

<0.001

<0.001

0.001

<0.001

0.001

0.004

<0.001

<0.001

0.491

Parameter Male (n=7)

Mean MeanSD SD T P

Female (n=11) Significance

Right side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

Left side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

Table 4: Different parameters according to gender in age group <18 Yrs:

43.44

41.70

22.73

31.27

23.85

27.21

16.52

13.71

1.21

2.83

2.07

1.93

2.20

1.81

1.87

1.15

1.38

0.06

34.94

35.42

18.28

26.69

20.28

23.99

13.11

11.09

1.18

2.00

2.74

2.21

2.16

1.44

1.34

0.77

0.54

0.04

7.49

5.17

4.37

4.36

4.65

4.27

7.55

5.73

1.14

<0.001

<0.001

<0.001

<0.001

<0.001

0.001

<0.001

<0.001

0.273

42.92

41.12

21.89

30.70

23.22

26.43

15.85

13.29

1.19

3.57

2.57

2.29

2.42

1.61

1.79

1.23

1.25

0.04

34.21

35.05

17.93

25.95

19.89

23.84

12.78

10.82

1.18

2.28

2.96

1.59

1.89

1.84

1.42

0.70

0.60

0.04

6.35

4.45

4.34

4.67

3.93

3.41

6.79

5.65

0.70


DISCUSSION:

The present study explored the nine parameters from patella

bone of both sexes fom both sides. Measurements taken on

patella bone showed higher mean values for males as

compared with females (p<0.001) which is consistent with 41previous study except for specific gravity.

For instance with respect to mean MAXH and mean MAXB

our study showed that, the males are having higher values in

comparision to females on both sides with p value <0.001

(statistically significant) which is consistent with the previous 38study conducted by Rathbun and Rathbun who measured the

patellae of 20 living white individuals (10 males and 10

females) and calculated a mean maximum patellar height for

males (50.7mm+3.59SD) and females (46.17mm+2.58SD) &

These evaluations suggested that between genders statistically

significant differences were observed for all the patella

parameters except SG in all age groups. These findings implied

that single values of patella parameters can be used for

differentiation in gender.

Outcome of Receiver Operator Curve analysis for patella

morphometry in prediction of male gender is shown in table 8.

For both sides, weight had the maximum AUC (0.979 for right

and 0.982 for left side), thus indicating it can be used for

differentiation between males and females. For right and left

sides, the projected sensitivity of weight was 96.5% and 97.0%

respectively and projected specificity was 89.6% and 91%

respectively. SG had the minimum AUC (0.614 for right and

0.581 for left side).

62

35.99

36.24

18.44

26.78

20.68

23.95

12.89

11.11

1.17

2.75

3.07

1.75

2.07

1.07

1.46

0.91

0.81

0.09

21.10

16.87

15.65

16.29

17.40

15.78

23.44

20.45

0.42

42.60

41.75

21.24

30.87

22.91

27.21

16.07

13.68

1.18

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.144


Mean MeanSD SD T P


Right side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

Left side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.675

2.76

2.79

1.65

3.00

1.62

2.18

1.53

1.45

0.04

35.31

35.97

18.19

26.28

20.43

23.59

12.60

10.80

1.17

2.83

3.40

1.71

2.20

1.23

1.47

0.95

0.78

0.05

21.35

14.96

14.84

14.66

14.41

16.47

23.25

21.35

1.47

Table 5: Different parameters according to gender in age group 18-40 Yrs:

43.00

42.24

21.72

31.61

23.28

27.45

16.29

13.88

1.18

2.67

2.68

1.68

2.86

1.41

2.23

1.49

1.43

0.04


The mean H A F o f r i gh t s i de was found t o be

26.76mm+2.07SD for females and 31.64mm+2.89SD for

males while the mean HAF of left side was found to be


males. The sexual dimorphism was found to be significant

statistically with a p value <0.001 for both sides. The projected

cut off value on right side was 26.65mm with a projected

sensitivity of 90.5% and projected specificity of 86.1% while

on left side cut off value was 28.415mm with a projected

sensitivity of 84.9% and projected specificity of 87.1%.

With respect to mean MAFB, males are having higher mean

values as compared to females on both sides with a p value

<0.001 (statistically significant). On right side the projected

sensitivity is 90.5% and projected specificity is 79.1% while on

left side projected sensitivity is 79.9% and projected

t h e m e a n m a x i m u m p a t e l l a r b r e a t h f o r m a l e s

(50.3mm+2.58SD) and females (45.12mm+2.16SD).

The mean M A X T of r ight side was found to be


males while the mean MAXT of left side was found to be


males with a p value <0.001 for both sides. The projected cut

off value on right side was 19.81mm with a projected

sensitivity of 87.9% and projected specificity of 82.1% while

on left side cut off value was 19.175mm with a projected

sensitivity of 94% and projected specificity of 80.1% which is

consistent with the study conducted by Introna and co-40workers with mean value of thickness for male is

2.04cm+0.19SD and for females is 1.83cm+0.16SD with a

percentage accuracy of 83.8%.

63

35.65

35.71

17.96

26.64

20.70

23.86

12.78

10.96

1.19

2.90

2.84

1.93

2.26

1.27

1.35

0.98

0.95

0.13

10.35

8.47

8.51

7.31

7.43

7.92

10.47

9.75

-0.06


Mean MeanSD SD T P


Right side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.952

Table 6: Different parameters according to gender in age group 40-60 Yrs:

3.07

3.54

1.74

3.09

1.47

2.17

1.48

1.21

0.04

42.67

42.09

20.96

31.09

22.86

27.24

15.98

13.42

1.19

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

0.012

Left side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

3.15

3.09

1.82

2.99

1.59

2.34

1.51

1.28

0.04

34.81

35.37

18.05

26.28

20.44

23.36

12.50

10.38

1.16

2.91

3.08

1.91

2.33

1.49

1.67

1.05

2.18

0.05

10.63

9.08

6.59

7.10

6.46

7.44

10.39

8.08

2.58

43.14

42.54

21.61

31.71

23.23

27.62

16.20

13.64

1.19


64

<0.001

<0.001

0.002

0.003

0.024

0.014

<0.001

<0.001

0.771

36.27

36.21

17.62

26.97

20.96

24.64

12.85

11.00

1.17

2.99

2.52

3.02

1.35

1.64

1.46

0.96

0.71

0.03

6.36

4.75

3.63

3.55

2.50

2.76

4.90

4.53

0.30


Mean MeanSD SD T P


Right side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

Table 7: Different parameters according to gender in age group >60 Yrs:

2.40

2.72

1.93

2.83

2.14

2.75

1.66

1.55

0.03

44.46

43.01

21.49

31.31

23.27

27.54

16.30

14.00

1.16

0.000

0.001

0.002

0.005

0.011

0.006

0.001

0.001

0.488

Left side

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

2.67

3.28

2.05

3.30

2.03

2.13

1.93

1.73

0.03

35.30

36.19

17.23

26.28

20.23

24.20

12.48

10.60

1.18

3.52

2.86

2.66

1.40

1.91

1.52

1.34

0.89

0.04

5.99

4.09

3.64

3.25

2.89

3.18

4.04

4.13

-0.71

44.84

42.88

21.93

31.72

23.62

28.24

16.76

14.31

1.17

percentage accuracy might be due to large sample size in the

present study.

The mean weight of r ight s ide was found to be

12.89gms+0.91SD for females and 16.30gms+1.48SD for

males while the mean weight of left side was found to be

12.59gms+0.95SD for females and 16.05+1.53SD for males.

The sexual dimorphism was found to be significant statistically

with a p value <0.001 for both sides. The projected cut off value

on right side was 13.915gms with a projected sensitivity of

96.5% and projected specificity of 89.6% while on left side cut

off value was 13.775mm with a projected sensitivity of 97%

and projected specificity of 91% with a percentage accuracy of

98.2%.

The mean volume of right side was found to be

11.09ml+0.81SD for females and 13.82ml+1.37SD for males

while the mean volume of left side was found to be

10.74ml+1.04SD for females and 13.60+1.41SD for males.

specificity is 78.6% which is consistent with the study 40conducted by Introna and co-workers with mean value of

width of internal facies articularis for male is 1.62cm+0.30SD

and for females is 1.46cm+0.29SD with a percentage accuracy

of 62.5% which was quite lower than the present study.

Difference in percentage accuracy might be due to large

sample size in the present study.

Mean LAFB of males is also having higher values in

comparision to females on both sides with a p value <0.001

(statistically significant). The projected sensitivity of right side

is 92% and projected specificity is 79.6% while on left side the

projected sensitivity is 82.4% and projected specificity is

81.1% which is consistent with the study conducted by Introna 40and co-workers with mean value of width of external facies

articularis for male is 2.24cm+0.25SD and for females is

2.05cm+0.24SD with a percentage accuracy of 63.75% which

was quite lower in comparision to our study. Difference in


65

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

39.185

39.105

19.81

26.65

21.315

24.76

13.915

12.50

1.1565

0.971

0.954

0.921

0.932

0.929

0.927

0.979

0.962

0.614

97.0

92.5

87.9

90.5

90.5

92.0

96.5

85.9

75.9

89.1

80.1

82.1

86.1

79.1

79.6

89.6

95.5

50.7

MAXH

MAXB

MAXT

HAF

MAFB

LAFB

Wt(gms)

Vol(ml)

SG

38.32

38.635

19.175

28.415

21.57

25.145

13.775

11.50

1.1675

0.970

0.927

0.906

0.916

0.886

0.920

0.982

0.967

0.581

98.0

93.5

94.0

84.9

79.9

82.4

97.0

97.0

55.8

85.6

80.1

80.1

87.1

78.6

81.1

91.0

80.1

50.2

Parameter AUCProjected Sensitivity

(%)

Projected Specificity

(%)

Projected cut off value

Right side

Left side

Table 8: Outcome of Receiver Operator Curve analysis for Patella morphometry in prediction of male gender:

Table 9: Derivation of Discriminant Equation and Its classifier value:

All the variables expect SG at right side were included from the function. SG at right side did not surpass test of equality of group means.

Function Eigenvalue % of Variance

Cumulative %

Canonical Correlation

1 3.244(a) 100.0 100.0 .874

a First 1 canonical discriminant functions were

used in the analysis.

Discriminant equation obtained:

DF = 0.197*RMAXH - 0.135*RMAXB +

0 . 7 3 7 * R M A X T + 0 . 3 2 9 * R H A F +

0 . 1 4 5 * R M A F B - 0 . 0 9 9 * R L A F B +

0 . 4 5 0 * R W t . ( g m s ) - 0 . 1 5 8 * R v o l m l +

0 . 0 9 4 * L M A X H + 0 . 0 9 6 * L M A X B -

0 . 3 7 3 * L M A X T - 0 . 0 6 8 * L H A F +

0 . 2 3 4 * L M A F B - . 0 2 5 * L L A F B +

0.224*LWt.(gms) -.106*LVol(gms) -.073*LSG

Classifier value for discrimination of males = DF

> 0.009

Sex

Count

%

Predicted Group MembershipTotal

Male

Male 191

13

96.0

6.5

8

188

4.0

93.5

199

201

100.0

100.0

Male

Female

Female

Female

Predicted Classification Results (a)

a 94.8% of original grouped cases correctly classified.

The discriminant function was 96% sensitive and 93.5%

specific in prediction of males, for females the sensitivity

could be stated as 93.5% and specificity as 96%.

found to be significant statistically with a p value 0.006. The

projected cut off value on right side was 1.1565 with a

projected sensitivity of 75.9% and projected specificity of

50.7% while on left side cut off value was 1.1675 with a

projected sensitivity of 55.8% and projected specificity of

50.2%.

To the best of our knowledge, no literature has been published

earlier regarding mean HAF, weight of patella and specific

gravity of patella. However in our study, there is statistically

significant difference between male and female values of both

the dimentions (mean HAF and weight of patella) on both

sides with p value <0.001. Specific gravity of only left side was

The sexual dimorphism was found to be significant statistically

with a p value <0.001 for both sides. The projected cut off value

on right side was 12.50ml with a projected sensitivity of 85.9%

and projected specificity of 95.5% while on left side cut off

value was 11.50ml with a projected sensitivity of 97% and

projected specificity of 80.1% which is consistent with study 36conducted by El Najjar and Mc Williams with volumes of

3 3over 15 cm for males and less than 11cm cm for females, with 37a 3 percent error for both genders and Gunn and McWilliams

assessed sexual dimorphism of patella using volumetric

analysis with correct sex classification of 88% for “Europids.”

The mean specific gravity of right side was found to be

1.17+0.09SD for females and 1.18+0.04SD for males. The

sexual dimorphism was found to be non significant

statistically with a p value 0.353 while the mean specific

gravity of left side was found to be 1.17+0.05SD for females

and 1.18+0.04SD for males. The sexual dimorphism was


officers or physician (who perform autopsy) for determination

of sex; it can be used for the teaching of medical students at the

medical college or hospital level.

CONCLUSION:

To conclude, the present study showed that there are definite

sexual osteometric differences between male and female

patella bones from the population of Haryana and produced

standard for sex determination from patella that will be useful

for forensic experts.

REFERENCES:rd1. Saukko P, Knight B. Knight's Forensic Pathology. 3 ed.

London: A Hodder Arnold Publication; 2004. p. 98-131.

2. Stewart T.D. Identification by skeletal structures. Grahdwohl's ndLegal Medicine. 2 ed. In Camps F.E. (Ed.); 1968. p. 123-54.

3. Dix J, Graham M. Time of death, decomposition and

identification – an atlas. Boca Raton: CRC Press; 2000. p. 81-7.

4. Frayer DW, Wolpoff MH. Sexual dimorphism. Ann Rev

Anthropol. 1985;14:429-73.

5. Mathiharan K, Patnaik AK, editors. Modi's medical

jurisprudence and toxicology. 23rd ed. New Delhi: Lexis Nexis

Butterworths Wadhwa; 2006. p. 264-5.

6. Giles E, Elliot O. Sex determination by discriminant functional

analysis of Crania. Am J Phys Anthropol. 1960;21:53-8.

7. Krogman WM, Iscan MY. The human skeleton in forensic rdmedicine. 3 ed. Springfield: CC Thoma; 1986. p. 112-50, 189-

90.

8. Iscan MY, Loth SR, King CA, Shihai D, Yoshino M. Sexual

dimorphism in the humerus: a comparative analysis of Chinese,

Japanese and Thais. Forensic Sci Int. 1998;98:17-29.

9. Scheur L. Application of osteology in forensic medicine. Clin

Anat; 2002. p. 297-312.

10. Kimura K. Sex difference of the hip bone among several

Japanese populations. Okajima's Folia Anat Jpn. 1982;5:266-73.

11. Wu X, Shao X, Heng W. Sex differences and sex determination

of the innominate bone of modern Han nationality. Acta

Anthropal Sinica. 1982;1:118-31.

12. Singh S, Potturi BR. Greater sciatic notch in sex determination. J

Anat. 1978;5(3):619-24.

13. Wang L. A study of recent human skull from Hongkong

assessment of sex and of regional population. Acta Anthropal

Sinica. 1989;8:222-30.

14. Li C. A study on sex difference of adult skull of the northeast

China by fourier transform. Acta Anthropal Sinica.

1992;11:312.

15. Tanaka T, Hanihara K, Koizumu K. Sex determination of the

modern Japanese skull by means of discriminant function.

Sappora Med J. 1979;48:583-93.

16. Acsadi G, Nemeskeri J, Kiado A. History of human life span and

mortality. Budapest: Springer; 1970.

found to be statistically significant with p value <0.006.

In all (n=400) cases, a significant difference in mean


parameters at both the sides except for SG on right side. In age

group <18 years, 18-40 and >60yrs, a significant difference in

mean measurements of different parameters was observed for

all the parameters at both the sides except for SG. However, in

age group 40-60 years, a significant difference in mean


parameters at both the sides except for SG on right side.

These evaluations suggested that between genders,

statistically significant differences were observed for all the

patella parameters except SG. These findings implied that

single values of patella parameters can be used for

differentiation in gender.

For both sides, weight had the maximum AUC (0.979 for right

and 0.982 for left side) with projected sensitivity of 96.5% and

97.0% for right and left side respectively and projected

specificity of 89.6% and 91% for right and left side

respectively. SG had the minimum AUC (0.614 for right and

0.581 for left side). The discriminant function was 96%

sensitive and 93.5% specific in prediction of males, for females

the sensitivity could be stated as 93.5% and specificity as 96%.

The present study showed that, there are definite sexual

osteometric differences between male and female patella

bones from the population of Haryana. The determination of

sex can be accomplished by comparing the dimension of

unknown patella bone with the cut off value given. The study

produced standard for the population of Haryana for sex

determination and will be useful for forensic experts.

STRENGTHS AND LIMITATIONS:

To best of our knowledge, our study is the first of its kind in the

Indian subcontinent where all the nine dimensions of the

patella bone have been studied. Earlier, studies have either

explored one or two dimensions of the patella bone. We have

also explored specific gravity and volume of the patella bone

along with the physical dimensions like length, breath,

thickness etc. Second, our study was done on a larger sample

of 400 subjects while the earlier studies have been done on

much smaller samples. Third, we have studied the dimensions

of both the left and right patellar bones of same individual

(total 800 patella bones) and thus provided an extensive insight

on the dimensions on both sides while previous studies have

not explored this aspect. The present study does not include

prepubertal subjects which is one of the limitation of the study.

Not including the prepubertal subjects is due to growing age of

the individual which might interfere with the results.

Result of the study can be used by the forensic experts, medical

66


Specificity of Discriminant Function Equations for Sex

Determination Using the Talus of South African Blacks. J.

forensic Sci. 2004;49(6):1-6.

36. El Najjar MY, McWilliams KR. Forensic Anthropology. Charles

C Thomas, Springfield, IL; 1978. p. 89.

37. Gunn MC, McWilliams KR. A Method for estimating Sex of the

Human Skeleton from the Volume of the Patella, Talus, or

Calcaneus. HOMO. 1980;31:189–98.

38. Rathbun TA, Rathbun BC. Human remains recovered from a

shark's stomach in South Carolina. J. Forensic Sci. 1984;29:269-

76.

39. O'Connor WG. The dimorphic sesamoid: differentiating the

patella of females and males by height, width and thickness

measurements. Master's thesis of Arts in the Department of

Anthropology-University of South Carolina; 1996.

40. Introna Jr F, Di Vella G, Campobasso CP. Sex Determination by

Discriminant Function Analysis of Patella Measurements.

Forensic Sci. Int. 1998;95(1):39–45.

41. Dayal MR, Bidmos MA. Discriminating Sex in South African

Blacks Using Patella Dimensions. J. Forensic Sci. 2005;50(6):1-

4.

Units of Measurement:

1. Maximum height (MAXH), Maximum breadth

(MAXB), Maximum thickness (MAXT), Height of

articular facet (HAF), Medial articular facet breadth

(MAFB), Lateral articular facet breadth (LAFB) are

measured in millimetre (mm).

2. Weight of patella (Wt) is measured in gram (gm).

3. Volume of patella (Vol) is measured in millilitre (ml).

Abbreviations:

HAF : Height of articular facet - maximum height of the

articular facet on the posterior aspect of the patella.

LAFB : Lateral articular facet breath - distance between the

lateral edge of the patella and the median ridge of the articular

facet.

MAFB : Medial articular facet breath - distance between the

medial edge of the patella and the median ridge of the articular

facet.

MAXB : Maximum breath - the greatest distance between the

medial and lateral sides.

MAXH: Maximum height - the greatest distance between the

base and apex.

MAXT : Maximum thickness - the greatest distance between

the anterior and posterior surface

SD : Standard Deviation SG: Specific Gravity

Vol: Volume Wt: Weight

17. Steyn M, Iscan MY. Sex determination from the femur and tibia

in South African whites. Forensic Sci Int. 1997:111–9.

18. Iscan MY, Loth SR, King CA, Ding S, Yoshino M. Sexual

dimorphism in the humerus: a comparative analysis of Chinese,

Japanese and Thais. Forensic Sci Int. 1998:17–29.

19. Iscan MY. Osteometric analysis of sexual dimorphism in the

sternal end of the rib. J Forensic Sci. 1985;30:1090–9.

20. Wiredu EK, Kumoji R, Seshadri R, Biritwum RB. Osteometric

analysis of sexual dimorphism in the sternal end of the rib in a

West African population. J Forensic Sci. 1999;44:921–5.

21. MacLaughlin SM, Oldale KL. Vertebral body diameters and sex

prediction. Ann Hum Biol. 1992;19:285–92.

22. McCormick FW, Stewart JH, Greene H. Sexing of human

clavicles using length and circumference measurements. Am J

Forensic Med Pathol. 1991;12:175–81.

23. Smith SL. Attribution of foot bones to sex and population

groups. J Forensic Sci. 1997;42:186–95.

24. Macho GA. Is sexual dimorphism in the femur a ''population

specific'' phenomenon. Zeitschrift fu¨r Morphologie und

Anthropologie. 1990;78:229–42.

25. Srivastava R, Saini V, Rai RK, Pandey S, Tripathi SK. A study of

sexual dimorphism in the femur among North Indians. J

Forensic Sci. 2012 Jan;57(1):19-23.

26. Singh J, Pathak RK. Sex and age related non-metric variation of

the human sternum in a Northwest Indian post-mortem sample:

A pilot study. Forensic Sci Int. 2013 May 10;228(1-3):181.e1-

e12.

27. Akhlaghi M, Moradi B, Hajibeygi M. Sex determination using

anthropometric dimensions of the clavicle in Iranian population.

J Forensic Leg Med. 2012 Oct;19(7):381-5.

28. Akhlaghi M, Sheikhazadi A, Ebrahimnia A, Hedayati M,

Nazparvar B, Saberi Anary SH. The value of radius bone in

prediction of sex and height in the Iranian population. J Forensic

Leg Med. 2012 May;19(4):219-22.

29. Purkait R. Measurements of ulna--a new method for

determination of sex. J Forensic Sci. 2001 Jul;46(4):924-7.

30. Dabbs G. Sex determination using the scapula in New Kingdom

skeletons from Tell El-Amarna. Homo. 2010 Dec;61(6):413-20.

31. Galdames ICS, Matamala DAZ, Smith RL. Blind Test of

Mandibular Morphology with Sex Indicator in Subadult

Mandibles. Int. J. Morphol. 2008;26(4):845-8.

32. Albanese J. A Metric Method for Sex Determination Using the

Hipbone and the Femur. J Forensic Sci. 2003;48(2):1-11.

33. Sangvichien S, Boonkaew K, Chuncharunee A, Komoltri C,

Udom C, Chande T. Accuracy of Cranial and Mandible

Morphological Traits for Sex Determination in Thais. Siriraj

Med J. 2008;60:240-3.

34. Patil G, Kolagi S, Ramadurg U. Sexual Dimorphism in the

Humerus: A Study on South Indians. Journal of Clinical and

Diagnostic Research. 2011;50(3):538-41.

35. Bidmos MA, Dayal MR. Further Evidence to Show Population

67


68



1. Munish Kumar, Additional Senior Medical Officer, Civil Hospital, Ambala Cantt.

2. Kanika Kohli, Associate Professor, Department of Forensic Medicine and Toxicology, M.M. Institute of Medical Sciences

and Research, Mullana, Ambala

3. Harpreet Singh, Professor, Department of Forensic Medicine and Toxicology, Adesh Medical College & Hospital, Mohri,

Shahbad (M), Distt. Kurukshetra

Key words: Hanging, Ligature mark, Mechanical asphyxia, Strangulation, , Throttling.


Dr. Kanika Kohli,


Department of Forensic Medicine and toxicology, M.M.

Institute of Medical Sciences and Research, Mullana, Ambala

Contact : +91 9728405109


Article History :

Received : 2 July 2020


Accepted on : 7 September 2020


INTRODUCTION:

Asphyxia is a condition caused by interference with respiration

due to lack of oxygen in the respired air that results in

deprivation of O in organs & peripheral tissues resulting in 2

loss of consciousness or death.

Violent asphyxia deaths have significant contribution to

unnatural deaths such as suicides, homicides, and accidental

deaths. Among various violent asphyxia deaths like hanging,

strangulation, smothering, throttling, traumatic asphyxia,

choking and drowning. Hanging is one of the leading manner

of suicide in which there is suspension of the body by a ligature

material compressing the neck externally, the constricting 1 force being the weight of the body. Hanging is always

considered suicidal except accidental hanging in sexual

perverts, homicidal hanging in lynching and justifiable judicial

hanging.

Strangulation is another form of asphyxia death in which there

is compression of neck structures by a constricting force other

than the body's own weight. Strangulation is always presumed

to be homicidal unless proved otherwise. The constricting

mark is usually found at the lower level on the neck and 2 frequently the direct pressure is exerted upon the neck.

There are different psychosocial and psychological factors.

Mental illness is important in young for act of suicide and

homicide, whereas physical illness is main cause of suicide

among old persons.

In many cases of hanging and strangulation ligature mark

creates doubt. So proper assessment of various postmortem

findings is necessary under such circumstances. Therefore

attempt to study external as well as internal features in the neck

in cases of neck compression mainly hanging and 3 strangulation is required.

Transmission of vital structures like major blood vessels,

nerves, oesophagus and wind pipe from head to other parts of

the body is through neck. Ligature and manual strangulation is

A Retrospective Autopsy Study of Deaths due to Compression of Neck

ABSTRACT :

Background: The study was conducted in the Department of Forensic Medicine, MMIMSR, Mullana to analyse the various

demographic variables of the subjects who died due to hanging, manual strangulation, ligature strangulation and had undergone

postmortem examination.

Methods: Out of 363 medico-legal deaths autopsied at MMIMSR, Mullana, details were collected from those medico-legal deaths

identified to be due to compression of neck.

Results: Out of 363 medico-legal autopsies, 77 cases were of death due to neck compression. Combined injuries of all neck

structures were seen in 8.7% cases of strangulation and 4.3% of throttling . Study comprised of 74.1% males & 25.9% females

with maximum deaths in age group of 20-30 years in hanging and 73.9% males and 26.1% females in strangulation. Rope was

ligature material of choice in hanging and strangulation. Frequency of hyoid bone fracture was maximum in strangulation.

4 most commonly responsible for mechanical asphyxia. The

purpose of the study was to see the pattern of injuries in

hanging and strangulation and weather antemortem or

postmortem in nature as majority of the cases coming for the

autopsies are due to violent asphyxia deaths out of which some

are suicidal, some are homicidal and some due to accidental

nature.


Present retrospective study was conducted on cases of death

due to compression of neck irrespective of age and sex in the

department of Forensic Medicine and Toxicology MMIMSR,

Mullana, Ambala. For this study data of postmortem reports of

hanging and strangulation was collected regarding name, age,

sex, alleged cause of death by investigating officer and

external and internal findings. Decomposed bodies were

excluded.

RESULTS:

Maximum number of deaths due to hanging was seen in the age

group of 21-30 years. Out of 54 cases 40 males (74.1%) and 14

females (25.9%) died due to hanging. (Table 1)

Table No. 2 depicts that the maximum 13 cases of

strangulation were seen in the age group of 21-30 years. Out of

23 cases 17 (73.9%) males and 06 (26.1%) females died due to

strangulation.

Table No. 3 depicts total 54 cases of hanging out of which 34

(63%) males and 14 (25.9%) females were from rural area,

whereas 6 (11.1%) males and no females were from urban area.

So 88.9 % were from rural and 11.1% were from urban origin.

Table No. 4 depicts that total 23 cases of strangulation out of

which 14 (60.9%) males and 4 (17.4%) females were from

rural area, whereas 3 (13%) males and 2 (8.7%) females were

from urban area. So 78.3 % were from rural and 21.7% were

from urban origin.

Table No. 5 shows rope was used as a ligature material in

maximum 26 (48.1%) cases of hanging followed by chunni 8

(14.8 %) and cloth 8 (14.8 %) cases. Whereas in strangulation 7

(30.5%) cases were of manual strangulation where ligature

material was not used and then maximum 4 (17.4%) cases

where ligature material used was chunni followed by muffler

in minimum number. Out of 77 cases of hanging and

strangulation rope was used as a ligature material in maximum

number of cases i.e. 29 (37.7%)

69

Age group

0-10

11-20

21-30

31-40

41-50

51-60

>60

Total

Female

0

4

9

1

0

0

0

14

Male

0

7

17

8

6

2

0

40

Total

0

11

26

9

6

2

0

54

%

0

7.4

16.7

1.8

0

0

0

25.9

%

0

13

31.5

14.8

11.1

3.7

0

74.1

%

0

20.4

48.1

16.7

11.1

3.7

0

100

Table No. 1: Age & sex wise distribution of Hanging cases

Table 2: Age wise & sex wise distribution of Strangulation cases

Age group

0-10

11-20

21-30

31-40

41-50

51-60

>60

Total

Male

1

1

4

0

0

0

0

6

Female

0

2

9

5

0

0

1

17

Total

1

3

13

5

0

0

1

23

%

4.3

4.3

17.4

0

0

0

0

26.1

%

0

8.7

39.1

21.8

0

0

4.3

73.9

%

4.3

13.1

56.5

21.8

0

0

4.3

100

Rural/Urban

Rural

Urban

Total

Hanging

Male

No.

34

6

40

No.

14

0

14

No.

48

6

54

%

63

11.1

74.1

%

25.9

0

25.9

%

88.9

11.1

100

Female

Total

Table 3: Sex & area wise distribution of hanging cases

Rural/Urban

Rural

Urban

Total

Hanging

Male

No.

14

3

17

No.

4

2

6

No.

18

5

23

%

60.9

13

73.9

%

17.4

8.7

26.1

%

78.3

21.7

100

Female

Total

Table 4: Sex & area wise distribution of strangulation cases

Total

Type of ligature

material

Rope

Chunni

Parna

Cloth

Shirt

Woolen muffler

Wire

Not Known

Other

No.

26

8

3

8

0

1

4

4

0

No.

3

4

3

0

2

1

0

3

7

No.

29

12

6

8

2

2

4

7

7

%

48.1

14.8

5.6

14.8

0

1.9

7.4

7.4

0

%

13

17.4

13

0

8.7

4.4

0

13

30.5

%

37.7

15.6

7.8

10.3

2.6

2.6

5.2

9.1

9.1

Type of asphyxial death

Hanging Strangulation

Table 5: Type of ligature material in hanging & strangulation cases


Table No. 6 shows out of 54 cases of hanging no case in both

sexes had injuries together to larynx, trachea, hyoid bone and

thyroid cartilage.

Out of 23 cases of strangulation cases, 2 (8.7%) male cases had

combined injuries to larynx, trachea, hyoid bone and thyroid

cartilage in ligature strangulation but no female case had

injuries together to larynx, trachea, hyoid bone and thyroid

cartilage in ligature strangulation.

1 (4.3%) male case had combined injuries to larynx, trachea,

hyoid bone and thyroid cartilage in manual strangulation but

no female case had injuries together to larynx, trachea, hyoid

bone and thyroid cartilage in manual strangulation

DISCUSSION :

The extent of passing because of hanging and strangulation in 5our examination period was seen as very like Momin SG et all .

Hanging cases number is 2.4 occasions that of strangulation

cases which is very like 2.9 occasions as saw in the 6examination by Sheik et all . A lower frequency was accounted

7 8for by Singh RK et al (8.04%), Tirmizi et al (7.08%) and Bhim 9Singh et al (8.83%). In our current investigation the most

extreme number of cases for example 50.6% was noted in age

bunch between 21 to 30 years (Table 1 and 2) Sheik et al 6announced 42.42% cases in 21 to 30 years old group. Joshi R

et al additionally revealed 44.18% cases in 21 to 30 years old 10group. Momin SG et al likewise detailed 40.2% cases in 21 to

530 years old group.

In the hanging cases 74.1% male and 25.9% female cases were

seen in present examination. Sheik et al detailed 71.2% males 6and 28.8% females in hanging cases which is very

comparative with the current investigation Joshi R et al 10detailed 64% males and 36% females in hanging cases

Out of strangulation cases, 73.9% males and 26.1% females

were seen in present investigation which is in dissimilarity to

the examination by Sheik et al who announced no female 6instance of strangulation.

In present investigation 84.2% male were of provincial

inception and 15.8% had a place with urban area.

Correspondingly 90% females were of provincial beginning

and 10% were of urban district (Table 3 and 4). Joshi R females 10had a place with urban areas.

In present examination 88.9% hanging cases were from

country region and 11.1% were from urban region which is

very like Pal SK et al concentrate in which 90.16% hanging

cases were from rustic starting point and 9.83% had a place 11with urban region. In present investigation strangulation

cases female survivor of provincial territory were more 17.4%

Joshi R et al likewise revealed in strangulation cases female 10casualty of urban region were more 38.9%.

In present investigation rope was utilized as a ligature material

in 37.7% cases. Joshi R et al additionally watched rope as 10commonest strategy for ligature material in 32.5% cases.

12David and Marshall likewise noted rope in 51.4% cases.

CONCLUSION :

A retrospective study on deaths due to neck compression

concludes that majority of victims were in the age group of 21

to 30 years and were from rural areas. The most commonly

used ligature material was rope. More injuries to neck

structures were found in case of ligature strangulation.

REFERENCES :

1) Reddy KSN, The Synopsis of Forensic Medicine & thToxicology, 29 Ed, 2017, Jaypee Brothers Medical

Publishers (P) Ltd, New Delhi, Pg. 171

2) Glaister J. Medical jurisprudence and toxicology,

hanging, strangulation. Edinberg, living stone 1962 :165-

84.

3) Shaikh MMM, Chotaliya HJ, Modi AD, Parmar AP,

Kalele SD. A study of gross postmortem findings in cases

of hanging and ligature strangulation. JIAFM 2013; 35

(1):63-5

4) Nadar S, Iqbal M, Raja KS, Rana PA, Khokhar JI. Position

of knot in hanging and strangulation in asphyxia deaths in

medicolegal autopsies in Lahore. Medical Forum 2014;

25(9):32-5.

5) Momin SG, Mangal HM, Kyada HC, Vijapura MT, Bhuva

SD. Pattern of ligature mark in cases of compressed neck

in Rajkot region: A prospective study. JIAFM 2012;

34(1):40-3

6) Sheikh MI, Agarwal SS. Medico-legal implication of

hyoid bone fracture: A study 1999. JIAFM 2000-2001;

26(1-6): 61-3

7) Singh RK, Sonatomba Devi M, Femate L., Analysis of

changing pattern of unnatural deaths in Manipur during

1991-1995. J Forensic Med Toxicol,1997;26: 23-25

70

Total

Type of

Asphyxia

Hanging

Ligature

strangulation

Manual

strangulation

No.

0

2

1

No.

0

0

0

No.

0

2

1

%

0

8.7

4.3

%

0

0

0

%

0

8.7

4.3

Type of asphyxial death

Hanging Strangulation

Table No. 6: Distribution of injuries of larynx, trachea, hyoid bone and thyroid cartilage in hanging and strangulation


8) Tirmizi SZ, Mirza FH, Paryar HA., Medico-legal

investigation of Violent asphyxial deaths-an autopsy

based study. J Dow Uni Health Sci, 2012: 6(3): 86-90

9) Singh B, Ghosh M, Sangal A, Srivastava AK., A post-

mortem medicolegal study of violent asphyxial deaths An

autopsy based study, Int Arch BioMed Clin Res/

2017:3(2):104-107

10) Joshi R, Chanana A, Hakumat R. Incidence and

medicolegal importance of autopsy study of fracture of

neck in hanging and strangulation. Medicolegal update-

An international journal 2007; 7 (4): 105-9

11) Pal SK, Sharma A, Sehgal A, Kaushik N, Rana A. Hanging

suicides in Himachal Pradesh: An analysis of forensic

cases. Int J Forensic Sci Pathol. 2016; 4 (11): 297-304

12) David A and Marshall TK. Hanging in Northern

Ireland- a survey. Med science law 1986; 26 (1):23-8

71

Ligature mark in Hanging




72



1. Nidhi Sachdeva, Associate Professor, Deptartment of Forensic Medicine And Toxicology,N.S.C.B. Jabalpur

2. Divyam Singh Modi, Junior Resident, Deptartment of Forensic Medicine And Toxicology,N.S.C.B. Jabalpur

3. Mukesh Rai, Assistant Professor, Deptartment of Forensic Medicine And Toxicology,N.S.C.B. Jabalpur

4. Vivek Shrivastava, Professor and Head, Department of Forensic Medicine and Toxicology, N.S.C.B. Jabalpur

Key words: Hanging, Ligature mark, Mechanical asphyxia, Strangulation, , Throttling.


Dr. Vivek Shrivastava,

Professor and Head,

Department of Forensic Medicine and Toxicology, N.S.C.B.

Jabalpur

Contact : +91 88713-38541


Article History :

Received : 11 December 2020

Received in revised form : 7 January 2021

Accepted on : 7 January 2021


INTRODUCTION:

The novel coronavirus-2019 (COVID-19) pandemic has

impacted significantly on many sectors globally, and has also (1) impacted mental health of many individuals and in greater

numbers than those who are actually infected with the disease (2) The World Health Organization declared the virus outbreak

as a pandemic in March 2020. Current lockdown scenarios

have led to different behavioural consequences which lead to (3)increase in homicidal cases and suicidal behaviours

At present, various measures such as isolation, social

distancing, quarantine of infected individuals, and lockdown (4)have been implemented worldwide , which has affected the

normal day to day life of people across the world leading to

increase in mental health problems such as depression, anxiety, (5)phobias etc. . India being a developing country with limited

human resources in the field of mental health care, a lot of

psychological problems related to mental health go unnoticed.

A study of data from past pandemics such as influenza and

Severe Acute Respiratory Syndrome (SARS) have showed

that these outbreaks were followed by significant increases in (6)suicidal deaths . It is of interest that suicidal deaths related to

COVID-19 have already been reported in the Asian Journal of (7)Psychiatry

Main aim of our study here is to create and raise awareness

about the importance of mental health to health providers and

general public and how COVID-19 pandemic has contributed

to an increase in suicide and homicides.

MATERIALS AND METHOD:

Our study sample comprised all medico legal cases examined

from March to July, 2019 (1260 cases) and from March to July

2020 (979 cases), in the Department of Forensic Medicine and

Toxicology, Netaji Subhash Chandra Bose Medical College,

Jabalpur in total. Only the confirmed cases of suicidal and

Impact of Covid-19 Pandemic on Suicidal and Homicidal Deaths in Jabalpur, Madhya Pradesh, India

ABSTRACT :

Introduction: The novel coronavirus-2019 (COVID-19) pandemic has impacted significantly on many sectors globally, and has

also impacted mental health of many individuals. actually infected with the disease. The World Health Organization declared the

virus outbreak as a pandemic in March 2020. Current lockdown scenarios have led to different behavioural consequences which

lead to increase in homicidal cases and suicidal behaviours.

Aim: To study the effect of COVID-19 pandemic on suicidal and homicidal deaths in Jabalpur district between months' March to

July 2020, to cause awareness among health care professionals about impact of COVID-19 on mental health.

Materials and Methods: Present study was conducted in the department of forensic medicine and toxicology, Netaji Subhash

Chandra Bose Medical College, Jabalpur. Only confirmed cases of suicide and homicide were included in the study based on post

mortem reports and police inquest.

Result: COVID-19 pandemic caused an expected rise in the number of suicide and homicidal cases in the year 2020 in Jabalpur,

when compared with the year 2019.

Conclusion: A need for adequate mental health programs to combat the increase in mental health problems by initiatives along

with tele-mental health care, where mental health providers are expected to play a vital role in promoting psychological and

emotional well-being, strengthening problem-solving and health-promoting habits in service recipients.

homicide based on post mortem examination and police

inquest were included in study.

The data was compiled according to the manner of death, being

suicidal or homicidal, and sex of the individual.

RESULTS:

On analyzing the monthly data reports individually and after

comparing the corresponding months in the years 2019 and

2020, the following data was obtained:

DISCUSSION:

From the data analyzed above, it was clear that COVID-19

pandemic caused an expected rise in the number of suicide and

homicidal cases in the year 2020 in Jabalpur, when compared

with the year 2019.

When compared according to the gender of individual, suicide

cases were found to have increased in females by 3.4% and

decreased in males by 3%

Similarly, murder cases were found to be decreased in females

by 10.2% and increased in males by 10.2%

No autopsy based similar study was found, however NCRB

data was found of year 2017 to 2019, showing homicidal cases

in Jabalpur district:

Based on history provided by police and relatives of deceased

at the time of, Probable Causes of increase in suicide and

homicide rates would include:

1. Covid-19 stress

2. Fear of covid-19 infection

3. Loneliness

4. Missing family due to lockdown

5. Social boycott and pressured to be quarantined

6. Fear of being quarantined

7. Covid-19 related work stress

8. Covid-19 positive

9. Covid-19 isolation ward

10. Depression

11. Postponement exams

12. Unable to return home due to lockdown

13. Unemployment and financial crises

CONCLUSIONS and RECOMMENDATIONS :

Considering the extreme psychological effect of COVID-19

on people, there is a need for adequate mental health programs.

This can be accomplished by initiatives along with tele- mental

health care, where mental health providers are expected to play

a vital role in promoting psychological and emotional well-

being, strengthening problem-solving and health-promoting

habits in service recipients.

In addition, accurate and authentic information on COVID-19

and mental health-care opportunities are required to raise

public understanding of COVID-19. In addition, social media

sites, mainstream media such as televisions, news portals, etc

can take steps to educate general public about the myths

associated with COVID-19 and encourage positive mental

health in the battle against COVID-19.

73

Table 2: Table Showing Variation of Suicide Cases in Years

2019 And 2020 based on Gender.

Gender

Female

Male

Total

Sucide Cases (March-July)

Case in 2019

77

186

263

Case in 2020

82

169

251

3.4

-3

%ageIncrease/Decrease

Table 3: Table Showing Variation of Homicide Cases in

Years 2019 And 2020 based on Gender.

Gender

Female

Male

Total

Homicide Cases (March-July)

Case in 2019

4

19

23

Case in 2020

2

26

28

-10.2

10.2

%ageIncrease/Decrease

Table 1: Percentage Comparison of Number of Suicide and

Homicide Cases in the Months of March-July

between Years 2019 and 2020.

Month

March

April

May

June

July

Sucide (%)

2019

22.4

24.7

25.4

25.1

25.1

2019

2.2

1.5

2.5

1.7

2.4

2020

27.1

30.9

33.5

29.8

30.2

2020

3

3

4.7

6

0.9

Homicide (%)

Table 4: Table Showing Comparative Increase in Suicide

and Homicide Rates in Year 2020

%age Increase inMonth

March

April

May

June

July

Sucide

4.7

6.2

8.1

4.7

5.1

0.8

1.5

2.2

4.3

-1.5

Homicide


REFERENCES:

1. Ahorsu DK, Lin , Imani V, Safari M, Griffiths MD, Amir

H, Pakpour. The fear of COVID-19 scale: Development

and Initial Validation. Int. J. Ment Health Addict. 2020

Mar 27;1-9.

2. Ornell F, Schuch JB, Sordi AO , Kessler FH. Pandemic

fear and COVID-19: Mental Health Burden and

strategies. Braz-J. Psychiatry. 2020;42(3):232-23

3. Ahmed et al. First confirmed detection of SARS-Cov-2 in

untreated wastewater in Australia: A proof of concept for

the wastewater surveillance of COVID-19 in the

community. Science of the total environment. 2020 Aug

1;728:138764.

4. Bodrud-Doza et al. Exploring COVID-19 stress and its

factors in Bangladesh: A perception-based study. Heliyon.

2020 Jul 10;6(7):e04399

5. Brooks et al., the psychological impact of quarantine and

how to reduce it: rapid review of the evidence. The Lancet.

2020 Mar 14;395(10227):912-920

6. Wasserman IM. Impact of Epidemic, War, Prohibition and

media on Suicide: United States ,1910- 1920.Suicide and

life threatening behavior.1992;22(2):240-54.

7. Mamun and Griffiths. COVID-19 Suicidal behavior

among couples and suicide pacts: case study evidence

from press reports. Psychiatry Res.2020 Jul;289:113105.

8. Sahoo et al. Self harm and COVID-19 Pandemic: an

emerging concern- A report of 2 cases from India. Asian J

psychiatr. 2020 Jun;51:102104.

74



INTRODUCTION :

The use of insecticides in the modern times has evidently

improved the socio-economic well- being of people in

developing nations. Whilst, the use of insecticides has

increased food production and has effectively put a check on

vector-borne diseases, on the other side there is an increasing

concern over the possible adverse effects of insecticides on the (1)environment along with human and animal health . The

current scenario of pesticide market is also changing

worldwide. With the introduction of strict rules in many

developed countries, organophosphates and carbamates are

being replaced by their less toxic counterparts such as

pyrethroids. The main reason for the increasing popularity of

pyrethroids over organophosphate and organochlorine (2)pesticides is that they are biodegradable , more effective

(3) (4)against target species and less toxic to mammals . Although,

initially considered as safe pesticides and used all over the

world, pyrethroids are capable of inducing many toxic effects

such as apoptosis, oxidative stress, neurotoxicity and (5-8)hepatotoxicity .

Cypermethrin (CYP), [(RS)-a-cyano-3-phenoxybenzyl

( 1 R S ) - c i s - t r a n s - 3 - ( 2 , 2 - d i c h l o r o - 6 0 v i n y l ) - 2 , 2 -

dimethylcyclopropanecarboxylate], a pyrethroid insecticide,

is commonly used as a pest control. It is a type II pyrethroid

containing an alpha-cyano group which tends to accumulate in (9)organs and tissues due to its lipophilic properties . Owing to

its lipophilic nature, CYP tends to get deposited in body fat and

destroys various organs like liver, kidneys, skin, ovaries and (10)brain .It is a synthetic pyrethroid, classified as a weak

category C-oncogene, considered as relatively less toxic to

mammals making it a preferred insecticide to be used for

domestic, agricultural and veterinary purposes but there are

studies where CYP has resulted in DNA damage and cell (11-12)damage in the target as well as non-target species. Various

studies on cell lines and animal models have shown that CYP

is capable of inducing other toxic effects including oxidative


Dr. Shweta Sharma,

Assistant Professor (Chemistry),

Institute of Forensic Science & Criminology,

Punjab University, Chandigarh, INDIA 160 014

Contact : +91-172-2534121(O) +91-9872688577 (M)


KEYWORDS : Cypermethrin, pyrethroid toxicity, domestic exposure, liver damage, forensic cases, liver enzyme activity

Article History:Received: 15 December 2020Received in revised form: 11 February 2021Accepted on: 11 February 2021 Available online: 15 August 2021

ABSTRACT :

Introduction :Hepatotoxicity of cypermethrin (CYP) has been widely studied. However, the adverse outcomes of sub-chronic

exposure have not been adequately estimated. This study was performed on Balb/c mice to investigate the changes in liver function

enzymes and liver structure after exposure to low dose CYP in mice.

Materials and Methods: Male Balb/c mice were segregated into two groups with Group I serving as the normal control. Group II

mice were given 2.5 mg/kg CYP dose orally once in a week for 56 days. Liver damage was assessed by performing liver function

tests i.e. AST, ALT and ALP along with histological analysis of liver by H&E staining followed by visualization under the

microscope.

Results : The changes in liver enzyme activities and histo-architecture of liver cells show that exposure to CYP leads to time-

dependent changes in the liver. The study reveals that low exposure to cypermethrin for longer periods of time results in liver injury

damaging the normal organization of the tissue. It also induces noteworthy elevation in hepatic markers enzymes viz. ALT, AST,

ALP along with necrosis, extensive vacuolar degeneration and decrease in number of hepatocytes. We found that CYP was able to

generate elevation in the expression of p53 (0.036) and p21 (0.0076) and decrease in CDK4 (p=0.0224) CDK2 (p=0.0458) thus

suggesting a role of cell cycle regulatory genes in the CYP caused liver toxicity.

Conclusions: These findings yield the evidence of sub-chronic CYP-induced toxicity in liver cells by showing changes in liver

enzyme activity, histology and cell cycle regulatory genes in the liver of Balb/c mice.

1. Dolly Mahna, PhD Research Scholar, Institute of Forensic Science & Criminology, Panjab University, Chandigarh2. Sanjeev Puri, Professor, Biotechnology, University Institute of Engineering & Technology, Panjab University, Chandigarh ,

India 160 014 3. Shweta Sharma, Assistant Professor , Institute of Forensic Science & Criminology, Panjab University, Chandigarh

Cypermethrin-induced liver toxicity in Balb/c mice

75


(13-14)stress, apoptosis and developmental neurotoxicity . It can

persist for a long time in air, walls and 71 furniture after any

household treatment which increases the possibility of (15)exposure . It is widely used in developing countries as an

insect-controlling agent. CYP is easily available in the market

which makes it quite accessible to people making way for

accidental, homicidal as well as suicidal acts. In this study, we

have examined p53, CDKN1A, CDK4 and cdk2 as liver

toxicity markers because these genes are known for their roles

in cell cycle regulation. The estimation of adverse effects due

to sub-chronic intoxication which may develop due to CYP

exposure is quite difficult. In addition to this, the information

available on the possible adverse effects due to sub-chronic

exposure of CYP on liver remains limited. To explore the sub-

chronic 80 effects of cypermethrin, we exposed mice to

2.5mg/kg dose for 56 days and to look for its effects on liver

enzymes, liver histopathological structure and cell cycle

perturbation.


Chemicals

Commercially available formulation of cypermethrin

(Cypermethrin 25% EC), ―Cyperbullǁ purchased from local

market of Assandh, Haryana produced by Bharati Minerals

Limited was used. Adequate dilutions were prepared in corn

oil to obtain the required test concentration. The test

concentrations were calculated based upon the percentage of

active ingredient of CYP in the commercially available

formulation. Fresh solutions were made every time before

dosing.

Animal Experiment and treatment

Male Balb/C mice in the weight range of 25-30 g were

purchased from the Central Animal House of Panjab

University, Chandigarh. The animals had free reach to pellet

diet as well as water. All the protocols followed in the study had

a valid approval by the Institutional Animal Ethics Committee

of Panjab University (PU/IAEC/S/15/113). The animals were

segregated into two groups consisting of 6 mice each.

Whereas, the test group received oral dose with an oral feeding

canula for 8 weeks, the control group received corn oil with no

pesticide exposure. The rats were indiscriminately segregated

into two groups namely-Normal control and CYP Group,

where each group had 6 animals each.

Group I animals served as normal control and were given corn

oil weekly.

Group II received 2.5 mg/kg CYP dose orally once in a week

for 56 days.

1/10 LD50 dose of CYP was chosen which was decided by (16)keeping in reference the LD50 of CYP in mice . This dose

doesn't cause immediate death or toxicity symptoms in the test

animals.

Collection of Serum and Tissue sample

Blood was taken out from the orbital sinus of mice under the

effect of mild ether anaesthesia. An approximate volume of 1

mL of blood was saved in test tube and for 30 minutes it was

kept undisturbed at room temperature. It was centrifuged at

2000 g for 10 min to obtain serum. After the collection of

blood, the scarification of animals was done by cervical

dislocation. It was followed by the dissection of liver which

was then rinsed in ice cold isotonic saline. Liver were stored at

-80°C for further investigation. One part of liver was kept for

histological analysis and saved in neutral buffered saline at

room temperature. Every possible effort was done to cut down

animal suffering in each experiment.

Liver Function Tests

The activity assessment of ALT i.e. alanine amino transferase ,

AST i.e. Aspartate amino transferase and ALP i.e. Alkaline

Phosphatase was done by kinetic method utilizing the kits

available commercially.

Histopathological Examination

For histology analysis, liver tissues were kept in 10% buffered

formalin for subsequent processing and histopathological

studies. Washing of formalin-fixed tissues was done

thoroughly in running tap water followed by dehydration in

ascending grades of alcohol.the tissues were cleared in

benzene, and then embedded in paraffin at the temperature of

58°C. Hematoxylin and eosin (H and E) method was employed (17)to stain the 5 μ-thick sections of paraffin-embedded tissues . It

was done under the supervision of expert pathologist at

Medicos centre Sector-22, Chandigarh.

Gene Regulatory Studies

RNA isolation from liver tissue of control as well as test

animals was carried out by Trizol isolation method. The quality

of isolated RNA was assessed by Nanodrop through which

RNA samples with a ratio of 1.8-2.0 at 260/280 nm were

employed for the study. 300 ng of total RNA for each sample

was converted to double-stranded cDNA by using RevertAid

Reverse Transcriptase from Thermo Scientific. KAPA SYBR

FAST qPCR Master Mix (2X) was utilized for carrying out

real time PCR supplied by KAPA BIOSYSTEMS (KK4603).

A 10 μl reaction mixture was made in thin walled PCR tubes

which had 4 μl of 2X SYBR GREEN reaction mixture,1 μM of

each forward and reverse primers, 1 μl of cDNA template and 3

μl of nuclease free water. PCR was carried out in a 20 μL total o omixture volume for 35 cycles at 95 C for 1 minute, 55 C for 1

ominute, 72 C for 1 minute. The reaction was run on the AB

Biosystems Step One Plus Real-Time PCR System (Thermo

76


Fisher Scientific, USA). Results were perused using Step One

software, ver. 2.0 (Applied Biosystems, USA). The

experiments were repeated three times. The expressions of

genes of interest were normalised to the housekeeping gene

(Beta Actin) and calculated employing ΔΔCt method.

Statistical Analysis

The data were expressed as mean ± SEM. The Graphpad prism

software (t-Test analysis) was employed for statistical

analysis. P ≤ 0.05 was set as the marker for statistical

significance.

RESULTS :

In CYP exposed mice, several signs of toxicity could be seen

which included slight nervousness and less activity as

compared to the control group. However, no mortality of mice

was observed in the test group. CYP treatment resulted in a

reduction in the body weights of the treated animals as

compared to the normal control group (27.25 g ±0.9488 versus

27.65 g ±0.900, P =0.0483). (Figure 1)

Effect of cypermethrin on serum biomarkers

Our study revealed that the CYP treatment to animals led to

considerable (p < 0.05) increase in hepatic function parameters

viz. serum glutamic pyruvic transaminase i.e. ALT (p =

0.0437), glutamic oxalacetic transaminase i.e. AST (p =

0.0209), as well as Alkaline Phosphatase i.e. ALP (p < 0.05), as

compared to the normal control group as shown in Figure 2.

ALT enzyme activity in the CYP treated liver was increased to

80.17 U/L, SEM ±11.65 whereas it was 48.30 U/L, SEM ±

7.405 in the control liver. In case of AST, the enzyme activity

was 55.84 U/L SEM ± 5.099 in the control liver which

increased to 82.14 U/L SEM ± 8.138 in the treatment group.

The values of ALP enzyme activity followed the similar trend

as ALT with a considerable (P < 0.05) difference in the control

and test group. Treatment of CYP for 8 weeks led to elevated

ALP enzyme activity (mean 169.9 U/L, SEM ±7.910) (Fig. 2.)

in comparison to the control (mean 88.34 SEM ±6.058).

Sub-chronic CYP administration for 56 days produced about

1.6 times increase in ALT activity as compared to the control

group. For AST, the increase was 1.4 times and it was found to

be around two times in ALP (Figure 2).

Histological analysis

Changes in the histology of mice liver treated with

cypermethrin was observed microscopically after hematoxylin

and eosin staining. The examination of liver of control mice

under light microscope showed regular undisturbed

architecture possessing compact and well organized hepatic

cells (Figure 3 a).

The light microscope examination of the control group liver

slides showed normal hepatic structure (Fig.3a). However, the

CYP treated liver slides showed evident signs of liver

alterations which included congested portal vein with

thickened wall (Fig.3b), inflammatory cell infiltration (Fig.4a,

b) and vacuolated cytoplasm (Fig.4d). Congested blood

vessels were also detected (Fig.3b). Pyknotic nuclei (Fig.4d),

karyolysis (Fig.4a,b), proliferation of kupffer cells (Fig.3c)

were also noticed.

Gene Regulation studies

Next, effect of CYP treatment on the key cell cycle regulatory

77

Figure 1: Change in the body weights of mice of test group exposed to cypermethrin (CYP) for 56 days. Each value is represented as mean ±SEM, n = 6, Significance p≤0.05, in comparison to control.

Figure 2: Effects of CYP exposure on ALT (a), AST (b) and ALP (c) activities in the serum of male Balb/c mice. Male mice were orally administered CYP (2.5 mg kg−1) for 56 days (Test). Values are resented as mean ± SEM (n = 6). Differences were assessed by utilizing one-way ANOVA, and statistical significance was marked at p < 0.05.


genes expressions viz. p53, CDKN1A (p21), CDK4 and cdk2

(0.0458) was analysed using quantitative RT-PCR.

As shown in Figure 3, exposure of CYP to animals showed an

increase in the expression of both cell cycle regulatory genes

i.e. p53 (P=0.0364) and p21(P=0.0076) in comparison to the

control group. We observed an increase in the expression of

p53 gene with 2.184 fold (SEM ±0.522), in the test groups as

compared to the control group (Figure 5). Treatment of CYP

for 56 days resulted in a considerable increase in the

expression of p21 gene (2.781 fold) (SEM ±0.4120), in

comparison to the normal control group (Figure 5).

Next, we examined whether CYP alters the expression of G1

CDKs as these are involved in the cell cycle progression (18).

We saw 0.46 ±0.1232 fold downregulation of CDK4

(p=0.0224) expression in the test group in comparison to the

control group (Figure 5). Along with it, Cdk2 witnessed a

decrease with 0.3865 fold (SEM ±0.1861) in the test group

(p=0.0458).

Together, these results suggest that sub-chronic CYP

administration is able to induce G1 arrest in the treated animals

and point towards association of CYP induced liver injury with

cell cycle regulatory genes.

Primer design

Primers were designed by utilizing known mice sequences

from https://www.ncbi.nlm.nih.gov, employing Primer3

software http://www.frodo.wi.mit.edu. The primer sequences

of genes to be amplified are shown in Table 1.

Statistical Analysis

The data were expressed as mean ± SEM. Statistical analysis

was done with the graph prism software. The results were

analysed using one way analysis of variance (ANOVA) and t-

test. Statistical significance was marked at P ≤ 0.05.

Discussion and Conclusion

The present study demonstrated that the toxicological

mechanism induced by cypermethrin in Balb/c mice involved

78

Figure 3 (a-c): Photomicrographs of sections of mice liver showing (a) control liver with normal hepatic structure and CYP treated liver showing (b) congested portal vein (CB), thickened portal wall (thin arrow), congested blood vessel (thick arrow) (c) increasing Kupffer cells (white thin arrow), congested blood vessel (thick arrow) ; (cypermethrin, 2.5 mg/kg/week, 56 days) (H&E, Scale bar = 50 μm).

Figure 4 (a-d): Photomicrographs of liver sections of mice treated with CYP exhibiting (a) localised cluster of lymphocytes (black arrow), karyolysis (grey arrow) (b) mononuclear lymphocytes (thick arrow), karyolysis (fine arrow) (c) fibrosis (black arrow) (d) p y k n o t i c n u c l e u s ( t h i c k a r r o w ) , vacuolated cytoplasm (thin arrow) H&E, Scale bar = 100 μm (cypermethrin, 2.5 mg/kg 56 days).

Figure 5: Impact of sub-chronic Cypermethrin on the expression of p53, p21, CDK4 and cdk2 in the liver mRNA. The figure is a representative of the repeated experiments (n=4) under similar conditions. Values were normalized against β-actin (used as a housekeeping gene) and show the mean mRNA expression value ± SEM (n = 4) relativity to those of the controls; p ≤ 0.05.


cell cycle regulatory genes. In addition, cypermethrin induced

histological alterations as well as disturbed liver function

enzyme levels. The foreign substances entering the body are

known to cause the most harm to liver as it is the first organ to (19)face the xenobiotics carried through portal circulation . M.J.

Derelanko has earlier reported that a significant decrease in

antioxidant defences of liver occur in case of liver damage by (20)exogenous substances . Our study also portrays that a

significant decrease in body weight in mice exposed to CYP at

the end of the experiment. Change in the body weights of CYP

exposed mice is considered to be an important indicator of

pesticide induced damage. This might be a result of direct

toxicity of CYP and due to the effect of insecticide on

gastrointestinal tract causing reduced appetite and nutrient (21)absorption from gut . Other studies on CYP-induced liver

damage have also reported change in body weight of CYP (22) (23)treated rats and rabbits .

The elevated ALT and AST levels in the test groups definitely

point towards CYP-driven hepatic damage leading to

depletion of cell integrity. These observations are in

accordance with the previous CYP toxicity findings in rabbits (24) (25) (26) (27) and rats . Increase in the activities of these enzymes in

cypermethrin treated mice may be attributed to liver

dysfunction and perturbation in the biosynthesis of these (28)enzymes along with change in the liver permeability . Serum

ALT and AST are considered to be among the most sensitive (29)markers utilized in the diagnosis of hepatotoxicity . Pesticide

exposure induced liver damage causes leakage of cytosolic

enzymes from hepatocytes and various other body organs into (28)blood which causes their elevated levels . Elevation of liver

enzymes may also be caused by hiked gene expression due to (30)long term need of detoxification of pesticides in the body .

The induction of liver damage and elevation of liver function

enzyme activities as observed in our study is in accordance

with the observation of Abdul-Hamid et al in liver cells of

albino rats in response to CYP dose of 30 mg/kg/day for 30 (31)days .

The CYP treatment group showed several histopathological

alterations such as vacuolated cytoplasm, congested blood

vessels, inflammatory cell infilteration and distorted

architecture of hepatocytes in the liver tissue as compared to

the control. Several other degenerative changes such as

Pyknotic nuclei and karyolysis were seen pointing towards

cypermethrin induced liver injury. Sub chronic cypermethrin

administration was able to induce noticeable changes in the

hepatic structure which may be due to the inhibitory effect of

CYP on the adenine triphosphate activity in the liver leading to

disorganization of Na+ , K+ and Ca2+ ions thus causing (32)hepatic injury . The current histological findings are in

accordance with sundry earlier studies which have already

shown that CYP leads to rigorous histological turbulence in a (33) (24)variety of experimental animals namely fish , rabbit ,

(34) (35) (36)broiler chicks , mice and rats . The reported hepatic

histopathological findings in this study are also concurrent (37)with the previous studies by Abdou et al. and Soliman et al.

(38) where the researchers observed degenerative alterations in

the liver such as necrosis, vacuolation, lymphocytic infiltration

and congestion due to CYP dose of 12 mg/kg b.w. for 30 days.

CYP administration for 56 days caused major degeneration in

the liver histological structure including the presence of

inflammatory cells which is again in synchronization with the

study by Bhushan et al. in which liver damage was observed in (39)wistar rats following sub-acute cypermethrin poisoning and

another study where wistar rats were exposed to CYP mixed (15)with their food for 28 days .

The present study suggests the involvement of cell cycle

regulatory genes as contributors of CYP induced liver toxicity

and here we have investigated p53, CDKN1A, CDK4 and 286

cdk2 as hepatotoxicity markers owing to their roles in cell

cycle regulation. Disruption of cell cycle seems to be a major

event involved in the liver damage caused by cypermethrin.

The p53 tumor suppressor protein is significantly involved in a

majority of events such as cell cycle modulations and apoptosis (40). It also shows alterations in its activity in response to several

stress stimuli such as xenobiotics and pesticides. Due to its

activation because of various posttranslational modifications,

79

Gene Name (Mus musculus)

CDKN1A(p21)

p53

CDK4

CDK2

Beta Actin

Primers

Forward: 5'-AAGTGGGATTCCCTGGTCTT-3' Reverse: 5'-GCTTTGACACCCACGGTATT-3'

Forward: 5'-GATGACTGCCATGGAGT 3' Reverse: 5'-CTCGGGTGGCTCATAAGGTA-3'

Forward: 5'-TAAGATCCCCTGCTTCGAGA 3' Reverse: 5'- GGAGGTGCTTTGTCCAGGTA -3'

Forward: 5'- TCTCTCAGGGATACACAACCC-3' Reverse: 5'- GGCGGCAACATTGTTTCAAG-3'

Forward: 5'-AAATCGTGCGTGACATCAAA-3' Reverse : 5'-ACATCTGCTGGAAGGTGGAC-3' 58

Annealingtempera-ture

58°C

58°C

58°C

58°C

58°C

Table 1: List of primers employed in RT-PCR analysis.


it holds potential to influence several other genes which

collectively brings about cell cycle arrest in response to

cellular damage by pesticides. Under stress conditions

activation of p53 takes place affecting several other (41) (40)downstream genes necessitated in cell cycle regulation .

These are known to be well-established events in xenobiotic (42)induced liver damage situations . Our study demonstrated

that CYP induced liver injury occurs via activation of

p53/p21pathway. Several other research studies have

stipulated that xenobiotic caused hepatic toxicity is related to

the activation of p53 gene expression which is important in the (43)liver injury pathogenesis . Further, p53 seems to be an

important regulator of p21 (Cdkn1a) transcription in relation to (44)the toxicogenomic response to liver injury . At the

concentration of 2.5 mg/kg, CYP led to a noteworthy increase

in the CDKN1A [CDK (cyclin-dependent-kinase) inhibitor,

p21] expression, a gene associated to G1/S phase of cell cycle

arrest along with an upregulation of p53 in the test group. The

p53/p21 is involved in the cell cycle regulation and p53 is

swiftly activated in case the cells encounter severe DNA (45)damage .

Contrarily, down-regulation of CDK4 which is a cell cycle

promoting gene is accounting to the opposing roles of p21 and

CDK4 in G1 phase cell cycle progression regulation. The

kinase activity of CDK2 in the normal cell cycle is elevated

particularly at the G0/G1-phase transition and the activity of (46)CDK4 is required during the G1 /S and G2 /M transitions .

Various studies have already reported the involvement of

cyclin-dependent kinase 2 (CDK2) in the G1- phase of cell

cycle and the present PCR data showed that CYP exposure led

to decrease in its expression.

The PCR data showed that CYP promoted the expressions of

p53 and p21 while inhibiting CDK2 and CDK4 expressions

which may be a reason for toxicity caused by G0/G1 arrest in

the cell cycle. The modulation of above mentioned cell cycle

regulatory genes as observed in our study is in line with the (47) (18)previously published reports .

Our findings give a collective evidence of changes in gene

expression of the mentioned genes in CYP-induced liver

damage. Taken together, modulation of cell cycle regulatory

gene activities at implicate the role of above mentioned genes

in the toxicological outcomes of CYP thus suggesting the

utilization of the genes in utilized as biomarkers of CYP

induced toxicity. Additionally, the toxicity and amount of

pesticides must be thoroughly investigated before these are

used in daily use items such as pet shampoos, household

cleaners and residential pest control sprays. Along with acute

toxicity, the potential of sub-chronic toxicity of pesticides

including CYP has to be identified and serious efforts towards

elimination of pesticide residues from the daily lives of human

beings and other non-target organisms have to be made to

improve the overall health and living conditions. The

biochemical as well as histological markers can be utilized in

forensic cases to establishing the cause of death in CYP

mediated toxicity.

Acknowledgements

The authors are grateful to DST, Govt. of India, for providing

financial assistance to IFSC and Centre for SCTE through the

PURSE grant. Financial aid from UGC in the form of JRF

Ref. No.: 5008/ (NET-JUNE 2012) is highly acknowledged.

Conflict of interest

The authors declare no conflicts of interest.

REFERENCES :

1. Kanbur M, Sili Y. The Acute and Chronic Toxic Effect of

Cypermethrin, Propetamphos , and Their Combinations in

Rats. (April 2015):1415–29.

2. Kingdom U. Metabolism and environmental degradation

of pyrethroid insecticides produce compounds with

endocrine activities. 2000;19(4):801–9.

3. Patel S, Pandey AK, Bajpayee M, Parmar D, Dhawan A.

Cypermethrin-induced DNA damage in organs and

tissues of the mouse: Evidence from the comet assay.

Mutat Res Toxicol Environ Mutagen. 2006;607 (2) :

176–83.

4. Caglayan A, Kocer-Gumusel B, Erkekoglu P, Hincal F.

The effects of fenvalerate on hepatic and cerebral

xenobiotic metabolizing enzymes in selenium and/or

iodine deficient rats. Iran J Basic Med Sci. 2016

Oct;19(10):1040–8.

5. Alkahtane AA, Alarifi S, Al-qahtani AA, Ali D, Alomar

SY, Aleissia MS, et al. Cytotoxicity and Genotoxicity of

Cypermethrin in Hepatocarcinoma Cells : A Dose-and

Time-Dependent Study. 2018;(June):1–9.

6. Alavanja MCR. Introduction: pesticides use and exposure

e x t e n s i v e w o r l d w i d e . R e v E n v i r o n H e a l t h .

2009;24(4):303–9.

7. Lidova J, Stara A, Kouba A, Velisek J. The effects of

cypermethrin on oxidative stress 16 and antioxidant

biomarkers in marbled crayfish (Procambarus fallax f.

v i r g i n a l i s ) . N e u r o E n d o c r i n o l L e t t . 2 0 1 6

Dec;37(Suppl1):53–9.

8. El-Tawil OS, Abdel-Rahman MS. The role of enzyme

induction and inhibition on cypermethrin hepatotoxicity.

Pharmacol Res. 2001 Jul;44(1):33–40.

9. Aggarwal P, Jamshed N, Ekka M, Imran A. Suicidal

poisoning with cypermethrin: A clinical dilemma in the

80


emergency department. J Emerg Trauma Shock [Internet].

3 5 8 2 0 1 5 ; 8 ( 2 ) : 1 2 3 – 5 . A v a i l a b l e f r o m :

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4411577

10. Mahna D, Puri S, Sharma S. Cypermethrin Induced Liver

Toxici ty: Altered Gene Expression and D N A

Methylation. FASEB J. 2019 Apr;33 (1_supplement):

621.9-621.9.

11. Mahna D, Puri S, Sharma S. DNA methylation signatures:

Biomarkers of drug and alcohol abuse. Mutation

Research/Reviews in Mutation Research. 2018.

12. Shukla Y, Yadav A, Arora A. Carcinogenic and

cocarcinogenic potential of cypermethrin on mouse skin.

2002;182:33–41.

13. Kusano C, Ferrari B. Free radicals , lipid peroxidation and

antioxidants in apoptosis : implications in cancer ,

cardiovascular and neurological diseases Free radicals ,

lipid peroxidation and antioxidants in apoptosis :

implications in cancer, cardiovascular and neurological

diseases. 2015;(December 2000).

14. Huang F, Liu Q, Xie S, Xu J, Huang B, Wu Y, et al.

Cypermethrin Induces Macrophages Death through Cell

Cycle Arrest and Oxidative Stress-Mediated JNK / ERK

Signaling Regulated Apoptosis. 2016;

15. Yavasoglu A, Sayım F, Uyanıkgil Y, Turgut M, Ülkü

Karabay-Yavasoglu N. The 17 Pyrethroid Cypermethrin-

Induced Biochemical and Histological Alterations in Rat

Liver. J Heal Sci. 2006;52(6):774–80.

16. Macbean EC. The Pesticide Manual.

17. Bancroft JD, Gamble M. Theory and Practice of

Histological Techniques. Churchill Livingstone; 2008.

(ClinicalKey 2012).

18. Huang F, Liu Q, Xie S, Xu J, Huang B, Wu Y, et al.

Cypermethrin Induces 381 Macrophages Death through

Cell Cycle Arrest and Oxidative Stress-Mediated 382

JNK/ERK Signaling Regulated Apoptosis. Int J Mol Sci.

2016 Jun;17(6):885.

19. Mossa A-TH, Swelam ES, Mohafrash SMM. Sub-

chronic exposure to fipronil induced oxidative stress,

biochemical and histopathological changes in the liver

and kidney of male albino rats. Toxicol reports.

2015;2:775–84.

20. Derelanko MJ, Ph D. toxicologist ' s POCKET

HANDBOOK. 2000.

21. Venkateshwarlu P, Sharma BJR, Kalakumar B, Reddy

KS, Ravikumar P. Comparative evaluation of toxicity of

carbaryl, cypermethrin and malathion of testis in mice.

Indian J Toxicol. 1997;4(1):33–7.

22. Sangha GK, Kaur K, Khera KS, Singh B. Toxicological

effects of cypermethrin on female albino rats. Toxicol Int.

2011 Jan;18(1):5—8.

23. Mossa A-TH, Heikal TM, Belaiba M, Raoelison EG,

Ferhout H, Bouajila J. Antioxidant activity and

hepatoprotective potential of Cedrelopsis grevei on

cypermethrin induced oxidative stress and liver damage in

male mice. BMC Complement Altern Med. 2015

Jul;15:251.

24. Yousef MI, El-Demerdash FM, Kamel KI, Al-Salhen KS.

Changes in some hematological and biochemical indices

of rabbits induced by isoflavones and 18 cypermethrin.

Toxicology. 2003;189(3):223–34.

25. Sankar P, Telang AG, Manimaran A. Protective effect of

curcumin on cypermethrin-induced oxidative stress in

Wistar rats. Exp Toxicol Pathol. 2012;64(5):487–93.

26. Hussain S, Khan MZ, Khan A, Javed I, Asi MR. Toxicon

Toxico-pathological effects in rats induced by concurrent

exposure to aflatoxin and cypermethrin. Toxicon.

2009;53(1):33–41.

27. Thapa BR, Walia A. Liver Function Tests and their

Interpretation. 2007;74:67–75.

28. Ikpeme E V, Okonko LE, Udensi OU. Detrimental Effects

of Chlorpyrifos and Reproductive Physiology of Male

Albino Rats Cypermethrin on. Res J Environ Toxicol.

2016;10(1):68–74.

29. Kullak-Ublick GA, Andrade RJ, Merz M, End P, Benesic

A, Gerbes AL, et al. Drug-induced liver injury: recent

advances in diagnosis and risk assessment. Gut. 2017

Jun;66(6):1154 LP – 1164.

30. Roberts JR, Karr CJ, HEALTH CONE. Pesticide

E x p o s u r e i n C h i l d r e n . P e d i a t r i c s . 2 0 1 2

Dec;130(6):e1765–88.

31. Abdul-Hamid M, Moustafa N, Abd Alla Asran AEM,

Mowafy L. Cypermethrin-induced histopathological,

ultrastructural and biochemical changes in liver of albino

rats: The protective role of propolis and curcumin. Beni-

Suef Univ J Basic Appl Sci. 2017;6(2):160–73.

32. Khan A, Faridi HAM, Ali M, Khan MZ, Siddique M,

Hussain I, et al. Effects of cypermethrin on some clinico-

hemato-biochemical and pathological parameters in male

dwarf goats (Capra hircus). Exp Toxicol Pathol.

2009;61(2):151–60.

33. Velmurugan B, Mathews T, Cengiz EI. Histopathological

effects of cypermethrin on 19 gill, liver and kidney of fresh

water fish Clarias gariepinus (Burchell, 1822), and

recovery after exposure. Environ Technol. 2009

81


Dec;30(13):1453–60.

34. Kammon AM, Brar RS, Sodhi S, Banga HS, Singh J,

Nagra NS. Chlorpyrifos chronic toxicity in broilers and

effect of vitamin C. Open Vet J. 2011/02/25.

2011;1(1):21–7.

35. Grewal KK, Sandhu GS, Kaur R, Brar RS, Sandhu HS.

Toxic impacts of cypermethrin on behavior and histology

of certain tissues of albino rats. Toxicol Int.

2010;17(2):94–8.

36. Raj J, Mohineesh, Ray R, Dogra TD, Raina A. Acute oral

toxicity and histopathological study of combination of

endosulfan and cypermethrin in wistar rats. Toxicol Int.

2013;20(1):61–7.

37. Abdou HM, Hussien HM, Yousef MI. Deleterious effects

of cypermethrin on rat liver and kidney: protective role of

sesame oil. J Environ Sci Health B. 2012;47(4):306–14.

38. Soliman MM, Attia HF, El-Ella GAA. Genetic and

histopathological alterations induced by cypermethrin in

rat kidney and liver: Protection by sesame oil. Int J

Immunopathol Pharmacol. 2015;28(4):508–20.

39. Bhushan B, N Saxena P, Saxena N. Biochemical and

Histological Changes in Rat Liver Caused by

Cypermethrin and Beta-Cyfluthrin. Vol. 64, Arhiv za

higijenu rada i toksikologiju. 2013. 57–67 p.

40. Kruiswijk F, Labuschagne CF, Vousden KH. p53 in

survival, death and metabolic health: a lifeguard with a

licence to kill . Nat Rev Mol Cell Biol. 2015

Jul;16(7):393–405.

41. Riley T, Sontag E, Chen P, Levine A. Transcriptional

control of human p53-regulated genes. Nat Rev Mol Cell

Biol. 2008 May;9(5):402–12.

42. Viswanathan P, Sharma Y, Gupta P, Gupta S. Replicative

stress and alterations in cell cycle checkpoint controls

following acetaminophen hepatotoxicity restrict liver

r egenera t ion . Ce l l P ro l i f . 2018/03 /05 . 2018

Jun;51(3):e12445–e12445.

43. Yan M, Huo Y, Yin S, Hu H. Mechanisms of

acetaminophen-induced liver injury and its implications

for therapeutic interventions. Redox Biol. 2018

Apr;17:274–83.

44. Stamper BD, Garcia ML, Nguyen DQ, Beyer RP,

Bammler TK, Farin FM, et al. p53 Contributes to

Differentiating Gene Expression Following Exposure to

Acetaminophen and Its Less Hepatotoxic Regioisomer

Both In Vitro and In Vivo. Gene Regul Syst Bio. 2015

Jun;9:1–14.

45. Antony ML, Kim S-H, Singh S V. Critical role of p53

upregulated modulator of apoptosis in benzyl

isothiocyanate-induced apoptotic cell death. PLoS One.

455 2012;7(2):e32267.

46. Baker SJ, Reddy EP. CDK4 : A Key Player in the Cell

Cycle , Development , and Cancer. 2013;3:658–69.

47. Kavvalakis MP, Tzatzarakis MN, Alegakis AK, Vynias D,

Tsakalof AK, Tsatsakis AM. Development and

application of GC-MS method for monitoring of long-

term exposure to the pesticide cypermethrin. Drug Test

Anal. 2014 Jun;6 Suppl 1:9–16.

82


83



1. Nirmal Kumar V, Forensic Medicine Resident, Department of Forensic Medicine and Toxicology, Amrita School of

Medicine, AIMS, Kochi, Kerala

2. Pillay VV, Professor & Head, Department of Forensic Medicine and Toxicology, AIMS, Kochi, Kerala

3. Ramakrishnan UK, Associate Professor, Department of Forensic Medicine and Toxicology, AIMS, Kochi, Kerala

4. Arathy SL, Senior Research Officer, Analytical Toxicology, Poison Control Centre, AIMS, Kochi, Kerala

5. Renjitha Bhaskaran, Lecturer & In-charge, Department of Biostatistics, AIMS, Kochi, Kerala

Key words: Formaldehyde, Formalin, High Performance Liquid Chromatography, Sea Fish


Dr. Ramakrishnan UK,


Department of Forensic Medicine and Toxicology, AIMS,

Kochi, Kerala

Contact : +91 97457-31022


Article History :

Received : 3 December 2020

Received in revised form : 13 December 2020

Accepted on : 13 December 2020


INTRODUCTION :

Fish is an important source of food rich in protein all over the

world. Aquaculture and Indian fisheries play an important role

in production of food, providing nutritional security and

engaging around fourteen million people in various activities.

In agricultural exports of India, fish products have become one

of the biggest groups, with Rs. 33,442 crores in value and 10.51 rdlakh tonnes in terms of quantity. India stands 3 in Fisheries

nd 1and 2 in Aquaculture globally.

In terms of fisher folk population, Kerala stands second among

the coastal states in India. In almost every household in Kerala,

there is a minimum of one meal with fish each day and the

consumption of fish is higher in rural areas when compared to 2the urban areas. The consumption of fish in Kerala is four

3times the national average. With an average per capita fish

consumption of 27-30 kg, Kerala is the highest fish consuming 4state in India.

Fish serves as an important source of animal proteins, omega-3

polyunsaturated fatty acids (PUFAs), and micronutrients.

Estimation of Formaldehyde Contamination In Selected Sea Fish Species Sold In Ernakulam District of Kerala State

ABSTRACT :

Introduction: Fish is an important source of food rich in protein. Fish consumption pattern has seen an upward trend in recent

times owing to wide publicity of health benefits of fish consumption. However, there appears to be rampant adulteration of fresh

fish using unapproved chemicals and additives which are being highlighted in both print and electronic media. Among the added

contaminants, volatile toxic aldehydes such as formaldehyde are quite commonly used, which are classified as Group 1

carcinogenic agents to humans by the International Agency for Research on Cancer (IARC).

Materials and Methods: The present study was undertaken in the Department of Forensic Medicine and Toxicology, Amrita

Institute of Medical Sciences and Research Centre, Kerala state. This is a cross sectional study of commonly consumed sea fish

species sold in Ernakulam district of Kerala State. The selected sea fish samples were collected and qualitatively screened for

contamination with formaldehyde, using a formaldehyde detection kit. Quantitative estimation of formaldehyde was done in those

samples that tested positive during qualitative screening using High Performance Liquid Chromatography (HPLC) and the values

were compared with the standard tolerable level for humans.

Results: Out of 65 fish samples qualitatively screened for formaldehyde, 16 samples tested positive with a percentage prevalence

of 24.62%. The values of formaldehyde concentrations obtained from the quantitative estimation of those samples that tested

positive during qualitative screening were within a range of 1.162-17.341 mg/kg and were found to be within the tolerable levels

for humans

Conclusions: From this study we conclude that even though the formaldehyde values were within the tolerable level for humans,

the issue of adulteration of fish with formaldehyde still exists, though the Food Safety and Standards Authority of India (FSSAI)

completely prohibits its use.

84

Also, fish is a good source of proteins, calcium, selenium, 5phosphorus and vitamin D.

Fish contains water, free amino acids and fat as composition,

which are prone to spoilage by microbial and biochemical

reactions during post-mortem changes. Thus, fish and seafood

are highly perishable and can only be kept fresh in ice for 8 to

14 days depending on the species. Fishermen and fish vendors

tend to use unapproved chemicals as preservative agents in 6 order to preserve the freshness. Among such added

contaminants, volatile toxic aldehydes such as formaldehyde

are commonly used. Formaldehyde is classified as a Group 1

carcinogenic agent to humans by the International Agency for 7Research on Cancer (IARC). As per Food Safety and

Standards Regulation, 2011, the use of formaldehyde in food is

not permitted in India. The situation has been made more

complex because fish itself can contain some amount of

endogenous formaldehyde and it is difficult to assess whether the formaldehyde present has been exogenously added to it.

Trimethylamine oxide (TMAO) constitutes a characteristic

and important part of non-protein nitrogen fraction in marine

fish species which is responsible for osmoregulation and is

found in all marine fish species in quantities from 1% to 5% of

the muscle tissue. Dimethylamine (DMA) and formaldehyde

(FA) originate from some species of fish from the breakdown 8of TMAO. According to studies, the FA production is greatest

9at high frozen storage temperatures.

There have been studies conducted to estimate the presence

and levels of formaldehyde in various food products especially

sea fish, by a variety of methods including Formaldehyde

Detection Kit for fish, Spectrophotometry, Digital Image

Colorimetry, High Performance Liquid Chromatography

(HPLC), and Solid Phase Micro Extraction (SPME)-Gas

Chromatography-Mass Spectrometry (GC-MS). Both HPLC

and GC-MS methodologies have been adopted by researchers

for quantification of formaldehyde with highest degree of 10specificity and precision.

According to the Italian Ministry of Health (1985), the

standard tolerable limit of formaldehyde for humans in fish is 1160 mg/kg. The World Health Organization (WHO) and the

United States Environmental Protection Agency (USEPA)

have fixed a maximum daily reference dose (RfD) of 0.15 and

0.2 mg/kg body weight per day for formaldehyde 12,13respectively. Intake of levels above the permitted values

may cause serious adverse effects on human health. European

Food Safety Authority (EFSA) recommends an oral exposure

to formaldehyde as 100 mg formaldehyde per day, -1corresponding to 1.7 and 1.4 mg kg bw per day for 60 kg and

1470 kg respectively in humans. According to the Malaysian

Food Act (1985) and Malaysian Food Regulations (1985), the

maximum permissible limit of formaldehyde concentration in 15processed fish and fish products is 5 mg/kg. The estimated

-1average dietary exposure is about 11 mg kg per person per day

as per Agence Francaise de Securite Sanitaire des Aliments

(AFSSA). As per Yasuhara & Shibamoto, formaldehyde in the -1rage of 10-20 mg kg in fish cannot be considered as palatable

14for humans.

The Food Safety and Standards Authority of India (FSSAI)

was established under Food Safety and Standards in 2006 in

India. FSSAI has been created for laying down science based

standards for articles of food and to regulate their manufacture,

storage, distribution, sale and import to ensure availability of

safe and wholesome food for human consumption. FSSAI has

not set a fixed limit for formaldehyde in fish in India.

Considering the above, it was felt that estimating the levels of

formaldehyde in some commonly consumed sea fish species

and checking whether they are within the tolerable limit for

human consumption would be of great health importance and

benefit to the common public. Such studies have not been

commonly undertaken in the state of Kerala where fish

consumption is high. Further, this study will be utilizing High

Performance Liquid Chromatography (HPLC) which is a more

sophisticated method for quantitative estimation, than

methods which have been used in some other studies which are

not as accurate.


The present study was undertaken in the Department of

Forensic Medicine and Toxicology, Amrita Institute of

Medical Sciences and Research Centre, Kerala state. This is a

cross sectional study of commonly consumed sea fish species

sold in Ernakulam district of Kerala. The dissertation review

committee of this institute had given scientific, ethical and

financial clearance to conduct the study.

Selection and Description of Participants: As there were no

previous studies on estimation of formaldehyde in sea fish

species using the prevalence of adulterated formaldehyde in

fish, we tested 50 samples for the presence of added

formaldehyde, out of which 30 turned out to be positive for

formaldehyde. Thus the prevalence of fish adulterated with

formaldehyde was found to be 60%. Using this prevalence and

with relative precision of 20% and 95% confidence level, the

calculated sample size worked out to 65. Samples of three

commonly consumed sea fish species were collected from

different wet markets and local vendors in Ernakulam district

of Kerala state at different time points. The selected sea fish

species included Indian oil sardine (Sardinella longiceps),

Indian mackerel (Rastrelliger kanagurta), and Spotted seer fish

(Scomberomorus guttatus). The exclusion criteria included all

other sea fish species. The fish samples were immediately


85

transferred to the laboratory for qualitative screening and kept

under refrigerated storage for further analysis.

Technical Information: The primary objective of the study

was to qualitatively screen some selected sea fish species for

contamination by formaldehyde. Secondary objectives were to

quantitatively estimate the formaldehyde in those samples that

tested positive during qualitative screening, and to check

whether the formaldehyde concentration is within the tolerable

levels for human consumption. Qualitative screening test of

the samples was done using Formaldehyde Detection Kit

developed by Central Institute of Fisheries Technology

(CIFT), Kochi. Positive tests show a colour change of greenish

blue to blue within 1 to 2 minutes, whereas no such colour

change is noticed in negative tests. The quantitative estimation

of formaldehyde in those samples that tested positive in

qualitative screening was done using High Performance

Liquid Chromatography (HPLC) which is a sophisticated

method for quantitative estimation of formaldehyde with high

degree of precision and specificity.

The chemicals used for sample extraction were HPLC grade

methanol, acetonitrile and phosphoric acid, formaldehyde

certified reference material (formaldehyde CRM) and 2,4-

dinitrophenylhydrazine (DNPH) procured from Sigma, and

Millipore water. The HPLC machine specifications are as

follows: Shimadzu prominence i LC2030, Photodiode array

detector. 150 mg of re-crystallized DNPH crystals were

weighed and dissolved in 49.5 ml of acetonitrile and mixed

with 0.5 ml 85% phosphoric acid to prepare the 2,4-

Dinitrophenylhydrazine reagent. The formaldehyde CRM

standard was considered as first stock solution. CRM has a

concentration of 4815 mg /litre, and from that the second stock

solution of reference standard was prepared by diluting 2.6 ml

of first stock solution in 25 ml, and from that, solutions of

subsequent concentrations of working standards were

prepared by progressively diluting. All working standards

were prepared using Millipore water. Stock solutions were

stored at -20°C until analysis, and protected from light.

About 5 g fish samples were taken, and blank and spiked

formalin was added. 5 ml of acetonitrile was added to this and

vortexed. The samples were then sonicated for 30 min at room 0temperature (25-30 C). The samples were shaken for 30 min in

a shaking water bath at room temperature at 150 rpm and then 0centrifuged for 5 min in 6000 rpm at 22 C. The samples were

then filtered through Whatman filter paper (90 mm). The upper

layer of the extract of approximately 5 mL was carefully taken

and 2.5 mL working DNPH solution was added and vortexed 0well. This was then derivatised by shaking at 150 rpm, at 40 C

for 1 hour in a shaking water bath. After incubation the

supernatant was filtered and collected using a syringe micro

filter (0.45 µm).

The sample derivatives were analysed by HPLC and compared

with the standard formaldehyde retention time for qualitative

detection. The peak area of the sample solution was substituted

in the calibration equation of the standard curve to calculate the

formaldehyde concentration.

Indian oil sardine (Sardinella longiceps)

Indian mackerel (Rastrelliger kanagurta)

Spotted seer fish (Scomberomorus guttatus)

High Performance Liquid Chromatography (HPLC)


86

Statistical Analysis: Statistical analysis was performed using

IBM SPSS version 20.0 software. The percentage prevalence

rate of adulterated formaldehyde in fish was computed with

95% confidence interval. Percentage of positive cases within

tolerable levels for human consumption was computed with

95% confidence interval.

RESULTS :

A total of 65 samples of selected sea fish species were collected

from wet markets and local vendors in Ernakulam district of

Kerala State. The selected fish samples consisted of 28 Indian

oil sardine, 28 Indian mackerel, and 9 seer fish. The samples

were subjected to qualitative screening for formaldehyde using

the Formaldehyde Detection Kit developed by Central

Institute of Fisheries Technology (CIFT), Kochi. Out of 65 fish

samples, 16 samples tested positive for formaldehyde during

screening (10 samples of sardine and 6 samples of mackerel)

(Table 1).

Thus the percentage prevalence rate was computed as 24.62%

(Fig 1).

Positive Test Negative Test

Formaldehyde Detection Kit Developed by CIFT

Paper Strips and Reagents

Comparison Chart

Table 1: Number of Positive Tests in Qualitative Screening for Formaldehyde

Fish Species

Indian oil sardine

Indian mackerel

Seer fish

Total

28

28

9

65

10

6

0

16

Number Tested Number Tested Positive

Figure 1: Percentage Prevalence of Formaldehyde in Samples on Qualitative Analysis


87

Those samples that tested positive for formaldehyde during

qualitative screening were subjected to quantitative analysis

using High Performance Liquid Chromatography (HPLC).

HPLC was done for a total of 16 samples including 10 samples

of sardine and 6 samples of mackerel. Formaldehyde values

ranging from 1.162 to 7.92 mg/kg and 1.343 to 17.341 mg/kg

were obtained for sardine and mackerel respectively (Table 2).

These values were compared with the standard tolerable level

of formaldehyde in fish for humans, that is 60 mg/kg fixed by

the Italian Ministry of Health (1985). It was found that all the

16 values of formaldehyde concentration were within the

tolerable level for humans (Table 3). The percentage of

positive cases within the tolerable levels for human

consumption was computed as 100%.

DISCUSSION :

In the present study, formaldehyde tested positive during

qualitative screening in 16 samples out of 65 samples. The

percentage prevalence rate of adulterated formaldehyde in fish

was computed as 24.62%. Formaldehyde tested positive in 10

samples of Indian oil sardine and 6 samples of Indian

mackerel. However all the samples of spotted seer fish tested

negative for formaldehyde during qualitative screening using

the formaldehyde kit. Formaldehyde concentrations obtained

from the positively tested samples were in the range of 1.162 -

17.341 mg/kg. In Indian oil sardine, the formaldehyde

concentration was in the range of 1.162 - 7.92 mg/kg. In Indian

mackerel, the formaldehyde concentration was in the range of

1.343 - 17.341 mg/kg. The highest value of formaldehyde was

seen in Indian mackerel, i.e., 17.341 mg/kg, which is one of the

highest values noted when comparing with other similar

studies on formaldehyde concentration in Indian mackerel. As

per the Italian Ministry of Health (1985), the standard tolerable

level of formaldehyde in fish for humans is 60 mg/kg. Similar

tolerable level has not been specified by the Indian Ministry of

Health. All formaldehyde concentrations in the present study

were found to be within the tolerable level as specified by the

Italian Ministry of Health.16Haque et al (2009) conducted a study in consumable fish in

Dhaka city of Bangladesh to determine the intensity of

formaldehyde contamination, using a Formaldehyde

Detection Kit developed by Bangladesh Council of Scientific

and Industrial Research (BCSIR). They found that a total of 50

formalin treated fish were found among 800 species, which

works out to almost 5% of total consumable fish of Dhaka city 17fish market. Yeasmi et al (2010) conducted a study to detect

the formaldehyde adulteration in local and imported fish sold

in different markets in Bangladesh using the same

Formaldehyde Detection Kit. Their study showed that

formalin was not detected in locally produced fish, but was

detected in 0.5% to 1% of imported ones. The shelf life of the

locally produced fish was much longer than those of imported

fish.18Uddin et al (2011) made an attempt to detect the presence of

formalin on different fish species using the Formalin Detection

Kit developed by BCSIR. They found that 50% of fish samples

tested positive for formaldehyde. This is by far the highest

prevalence of formaldehyde adulteration in fish. Rahman et al 19(2012) conducted a study to determine the quality

characteristics and presence of formaldehyde in fish from wet

markets in Sylhet City of Bangladesh. Detection of formalin

was conducted using the Formalin Detection Kit. They

concluded that 6% to 26% fish were formalin treated. Islam et 20al (2015) conducted a study using a similar kit and found that

22.68% of total samples were directly contaminated with

formalin. It was also clear that the formalin contamination and

the organoleptic characteristics of the imported fish were

greatly different than the local fish.21Paul et al (2014) conducted a study in consumable fish

species in markets of Bangladesh to investigate the intensity of

formaldehyde misuse using the Formalin Detection Kit. They

found presence of formalin in 4.2 % of total sampled fish. The

misuse of formalin was more in marine fish. They also

observed that the fish sellers who handled these formalin

treated fish regularly were affected by various skin diseases,

Table 3: Percentage of Positive Cases within the Tolerable Levels for Humans

Tolerable Limit

<60mg/kg

>60mg/kg

Total

Frequency

16

0

16

Percentage

100

0

100

Table 2: Formaldehyde Concentration in Positively Tested Samples

1

2

3

4

5

6

7

8

9

10

2.934

3.280

1.162

3.281

4.660

3.972

7.920

7.013

1.984

1.984

17.341

3.811

1.960

4.285

1.343

3.365

Formaldehyde Concentration (mg/kg)

Sardine

Sl No. Mackerel


88

inhalation problems, and eye irritation. They concluded that

the consumers are exposed to varying degree of formalin

through consumption of fish which is alarming both for

retailers and consumers.22Saba et al (2015) conducted a qualitative study in Ghana on

32 samples including both imported and local fish using a

ChemSee Formaldehyde and Formalin Detection Kit and

found that there was no presence of formaldehyde in both.

Mackerel was one of the imported species involved in the

study.23Jawahar et al (2017) conducted a study in Kerala, India, on

Indian mackerel (Rastrelliger kanagurta) dip-treated with

different concentrations of formaldehyde (0.2, 0.5 and 1 %)

and stored in ice along with undertreated control fish. The

method used was UV spectrophotometry. They concluded that

marketed fish with fresh appearance having lower microbial

load, higher values of total volatile base nitrogen, and a higher

formaldehyde residue can be considered as clear indications of

formaldehyde treatment.24Chandralekha et al (1992) conducted a study on different fish

species in Sri Lanka. They found that no formaldehyde content

was detected in Indian oil sardine and Indian mackerel, but

detected formaldehyde values ranging from 0.001 to 17.6

mg/kg in other species. The analytical method used for the

formaldehyde analysis in this study was a colorimetric method. 11Bianchi et al (2007) conducted a study on 12 different species

of fish in Italy and detected formaldehyde values ranging from

2.6±0.4 to 24.9±5.4 mg/kg and <1 to 5.93±0.5 mg/kg in

mackerel and sardine respectively. This is the highest value of

formaldehyde reported in mackerel. The overall formaldehyde

concentration in 12 species ranged between 6.4±1.2 mg/kg to

293±26 mg/kg. 14 samples were above the tolerable level of

60mg/kg. The analytical method used in this study was Solid

Phase Micro Extraction coupled with Gas Chromatography

Mass Spectrometry.6Noordiana et al (2011) conducted a study on fish and sea food.

They found formaldehyde level of 1.37 mg/kg in mackerel.

Overall formaldehyde level was in the rage of 0.38 to 15.75

mg/kg. The analytical method used in this study was UV 25Spectrophotometry. Siti et al (2013) conducted a study on

formaldehyde contamination of different fish species. They

found formaldehyde levels of 2.557 mg/kg and 2.946 mg/kg in

mackerel and sardine respectively. Overall formaldehyde was

in the range of 2.38 to 2.95 mg/kg. The analytical method used

in this study was UV Spectrophotometry.26Laly et al (2016) conducted a study in Kerala, India on Indian

mackerel. They found that the formaldehyde concentration

was 1.24±0.02 mg/kg. This value was low compared to the

values obtained in the present study for Indian mackerel. The

analytical method used in their study was UV 27Spectrophotometry. Nayana et al (2018) conducted a study on

seer fish in Kerala, and found that the formaldehyde

concentration was in the range of 0.7±0.03 5.83±1.37 mg/kg.

In the present study seer fish samples tested negative during

qualitative screening for formaldehyde. 8Chung et al (2009) conducted a study on chub mackerel in

Hong Kong, China. They detected formaldehyde

concentration of < 1 mg/kg. The analytical method used in this 28study was UV Spectrophotometry. Bechmann et al (1996)

conducted a study on Alaska pollock in Denmark. They found

out formaldehyde values in the range of 6.7 to 7 mg/kg. The

analytical method used was Flow Injection Analysis.29Wahed et al (2016) conducted a study on different food items

in Bangladesh. They found that the average formaldehyde

concentration in fish was 26.6 mg/kg. The analytical method

used in this study was High Performance Liquid 30Chromatography. Bhowmik et al (2016) conducted a study to

determine the formaldehyde content in marketed fish in Dhaka

city, Bangladesh. They found that the formaldehyde values

were in the range of 9.42±2.68 to 19.23±4.32 mg/kg in fresh

fish. They also observed notable seasonal variation of

formaldehyde in fish. They concluded that the formaldehyde

values were within the tolerable levels. The analytical method

used in this study was UV Spectrophotometry. Bhowmik et al 31(2017) conducted a study on marine finfish species in Dhaka

city, Bangladesh. They found that the formaldehyde

concentrations were within the range of 10.8±1.72 39.68±7.87

mg/kg. The analytical method used in this study was High

Performance Liquid Chromatography.32Sanyal et al (2017) conducted a study on fish samples in

Kolkata and found that formaldehyde concentration was

12.19±0.814 mg/kg for formaldehyde treated samples and

8.10±0.068 mg/kg for treated samples stored in ice. The

analytical method used in this study was Spectrophotometry. 33Putri et al (2018) conducted a study on opa fish. They found

that the formaldehyde concentration was in the range of 4.62

58.1 mg/kg. The analytical method used in this study was UV

Spectrometry.34Donkor et al (2018) conducted a study to determine the

formaldehyde exposure to the Ghanaian population of the

Kumasi Metropolis through the consumable fish. They found

that formaldehyde found in different fish species ranged from

0.174 to 3.710 mg/kg. They concluded that the formaldehyde

levels in the fish were within the tolerable limit for human

consumption. The analytical method used in this study was

Spectrophotometry.35Bhowmik et al (2019) conducted a study on wet fish in


89

Bangladesh. They found that the formaldehyde values were in

the range of 9.39±39 32.57±11.23 mg/kg. The analytical

method used in this study was UV Spectrophotometry.

Strength and Limitations: The quantitative estimation of

formaldehyde in the fish samples that tested positive during

qualitative screening was performed by High Performance

Liquid Chromatography which is a more sophisticated method

for quantitative estimation of formaldehyde with high degree

of precision and specificity. Qualitative and quantitative

studies of formaldehyde contamination of fish were done on a

relatively small sample size of fish in this study, due to cost

constraints. Effects of storing, cooking, and seasonal variation

on formaldehyde contamination of fish have to be determined.

The level of distribution chain at which the formaldehyde

contamination occurs has to be identified clearly.

Conclusions: Out of 65 fish samples qualitatively screened for

formaldehyde, 16 samples tested positive with a percentage

prevalence rate of 24.62%. Formaldehyde adulteration was

only noticed in Indian oil sardine and Indian mackerel, but not

in Spotted seer fish. The values of formaldehyde concentration

obtained from quantitative estimation were found to be within

the tolerable level for humans as per the Italian Ministry of

Health (1985). The percentage of positive cases within the

tolerable level for humans was 100%. Tolerable level for

humans has not been specified by the Indian Ministry of

Health. The highest value of formaldehyde was seen in Indian

mackerel which is one of the highest values noted when

comparing with other similar studies on formaldehyde

concentration in Indian mackerel. Even though the values of

formaldehyde concentration were within the tolerable level for

humans, the issue of adulteration of fish with formaldehyde

still exists when the FSSAI clearly states the complete

prohibition of its use. The government and other agencies need

to take necessary steps to prevent such type of activities by the

fish traders in order to safeguard public health, and proper

washing and cooking techniques to be adopted while preparing

dishes with fish, must be highlighted.

Acknowledgement

I express my sincere gratitude and thanks to Dr Prem Nair,

Medical Director, Dr (Col.) Vishal Marwaha, Principal, Amrita

School of Medicine, Dr Sanjeev K Singh, Medical

Superintendent, Dr D M Vasudevan, Chairman, Dissertation

Review committee for their support and guidance.

REFERENCES :

1. National Fisheries Development Board. About Indian

F i sher ies [ In te rne t ] . Ava i lab le f rom: URL

http://nfdb.gov.in/about-indian-fisheries.htm (Accessed

on 2018 Sep 22).

2. Salim SS. Consumer's willingness to pay more for

shrimps in suburban Mumbai. Agricultural Economics

Research Association. 2012; 25(2): 347-350.

3. Salim SS. Demand and supply paradigms for fish food

security in India. Seafood Export Journal 2013; 43(5): 34-

40.

4. Salim SS, Athira NR, Ratnakaran AP, Safeena PK,

Ramees RM, Fernandez R, et al. Assessing demand

drivers in augmenting fish consumption in Ernakulam.

Indian J Econ Dev 2019; 7(5): 1-8.

5. Tilami SK, Sampels S. Nutritional value of fish: lipids,

proteins, vitamins, and minerals. Rev Fisheries Sci

Aquaculture 2018; 26(2): 243-253.

6. Noordiana N, Fatimah AB, Farhana YC. Formaldehyde

content and quality characteristics of selected fish and

seafood from wet markers. Int Food Res J 2011; 18: 123-

136.

7. International Agency for Research on Cancer (IARC).

Monographs on the evaluation of carcinogenic risks to

humans. Vol 88. Lyon, France. 2004.

8. Chung SW, Chan BT. Trimethylamine oxide,

dimethylamine, trimethylamine and formaldehyde levels

in main traded fish species in Hong Kong. Food Addit

Contam 2009; 2(1): 44-51.

9. Rehbein H, Schubring R, Havemeister W, Sotelo CG,

Nielsen MK, Jorgensen B et al. Relation between TMAO

activity and content of formaldehyde in fillet minces and

bellyflap minces from gadoid fishes. Inf Fischwirtsch

1997; 44(3): 114-118.

10. Mohanty BP, Mohanty A, Parida PK, Parija SC, Das BK.

Formaldehyde adulteration in fish as a public health

concern and need for mass awareness. JIFSI. 2018; 50(1):

71-74.

11. Bianchi F, Careri M, Musci M, Mangia A. Fish and food

safety: determination of formaldehyde in 12 fish species

by SPME extraction and GC-MS analysis. Food Chem

2007; 100: 1049-1053.

12. Zhang X, Hui Y, Cai Y, Huang D. The research progress of

endogenous formaldehyde in aquatic products. World J

Eng Technol 2015; 3(3). 272276.

13. Asare-Donkor NK, Adaagoam RA, Voegborlo RB,

Adimado A. Risk assessment of Kumasi metropolis

population in Ghana through consumption of fish

contaminated with formaldehyde. J Toxicol 2018; 1: 1-7.

14. Laly SJ, Priya ER, Panda SK, Zynudheen AA.

Formaldehyde in seafood: a review. Fish Technol 2018;

55: 87-93.


90

15. Zailina H, Fatimah A. Health risk assessment of adults

consuming commercial fish contaminated with

formaldehyde. Food Public Health 2013; 3 (1): 5258.

16. Haque E, Mohsin ABM. Intensity of formalin use for

consumable fish preservation in Dhaka City, Bangladesh.

J Fish Int 2009; 4(3): 51-53.

17. Yeasmin T, Reza MS, Khan MN, Shikha FH, Kamal M.

Present status of marketing of formaldehyde treated fishes

in domestic markets at Mymensigh District in

Bangladesh. Int J BioRes 2010; 1(4): 21-24.

18. Uddin R, Wahid MI, Jesmeen T, Huda HN, Sutradhar KB.

Detection of formalin in fish samples collected from

Dhaka City, Bangladesh. S J Pharm Sci 2011; 4(1): 49-52.

19. Rahman MM, Ahmed S, Hosen MM, Talukder AK.

Detection of formalin and quality characteristics of

selected fish from wet markets at Sylhet City in

Bangladesh. Bangladesh Res Pub J 2012; 7(2): 161-169.

20. Islam R, Mahmud S, Aziz A, Sarker A, Nasreen M. A

comparative study of present status of marketing of

formalin treated fishes in six districts of Bangladesh. Food

Nutr Sci 2015; 6: 124-134.

21. Paul L, Mondal DK, Paul M, Riar MG, Ali A. Intensity of

formalin misuse for fish preservation in five markets of

Jessore District, Bangladesh. Int J Nat Soc Sci 2014; 1: 77-

81.

22. Saba CK, Atayure SI, Adzitey F. Assessment of

formaldehyde levels in local and imported fresh fish in

Ghana: A case study in the Tamale Metropolis of Ghana. J

Food Prot 2015; 78(3): 624-627.

23. Jawahar LS, John C, Shafeekh M, Anupama TK, Sankar

TV. Retention of residual formaldehyde in treated Indian

Mackerel (Rastrelliger kanagurta) under iced storage and

related food safety concerns. Indian J Fish 2017; 64(4):

87-93.

24. Chandralekha AP, Baranage C. Formaldehyde levels in

fish from the Kandy Market. J National Sci Council Sri

Lanka. 1992; 20(1): 115-121.

25. Siti A, Zalina H, Fatima AB. Health risk assessment of

adults consuming fish contaminated with formaldehyde.

Food Public Health 2013; 3(1): 52-58.

26. Laly SJ, John C, Shafeekh M, Anupama TK, Sankar TV.

Quality and Safety Concerns of Formaldehyde Treated

Indian Mackerel. Fish Tech Rep. 2016; 2(1): 1-2.

27. Nayana A, Sabu S. Incidence of formaldehyde residues in

fresh seer fish (Scomberomorus guttatus) collected from

Ernakulam Fish Market. Indian J Sci Res 2018; 19(2): 56-

61.

28. Bechmann IE. Determination of formaldehyde in frozen

fish with formaldehyde dehydrogene using a flow

injection system with an incorporated gel-filtration

chromatography column. Analytica Chimica Acta 1996;

320: 155-164.

29. Wahed P, Razzaq A, Dharmapuri S, Corrales M.

Determination of formaldehyde in food and feed by an in-

house validated HPLC method. Food Chem 2016;

202:476-483.

30. Bhowmik S, Begum M, Alam AK. Seasonal variation of

formaldehyde and risk assessment of marketed fish

contaminated with formaldehyde: fish and food safety

issue. Asian Food Safety Food Security Assoc 2016; 1: 50-

54.

31. Bowmik S et al. Determination of formaldehyde in wet

marketed fish by HPLC analysis: a negligible concern for

fish and food safety in Bangladesh. 2017. 43(3): 245-248.

32. Sanyal S, Sinha K, Saha S, Banerjee S. Formalin in fish

trading: an inefficient practice for sustaining fish quality.

Arch Pol Fish 31 2017; 25: 43-50.

33. Putri AK, Anissha U, Ariyani F, Wibowo. Probabilistic

health risk assessment due to normal formaldehyde intake

through Opah fish (Lampris guttatus) consumption in

Indonesia. Squalen Bull Mar Fish Postharvest Biotech

2018; 13(2): 69-78.

34. Donkor NK, Adaagoam RA, Voegborlo RB, Adimado

AA. Risk assessment of Kumasi Metropolis population in

Ghana through consumption of fish contaminated with

formaldehyde. J Toxicol 1 2018; 1: 1-7.

35. Bhowmik S, Begum M, Alam AK. Formaldehyde

associated risk assessment of fish sold in local markets of

Bangladesh. Agric Rec 2019; 9(1): 102-108.


91



1. Aneeta Sajan, B.D.S Student*

2. Priya Thomas, M.D.S, PG Dip in Bioethics, Associate Professor*

*Department of Oral Pathology & Microbiology, Annoor Dental College & Hospital, Muvattupuzha

Key words: Ameloglyphics, enamel rod end, tooth prints, forensic odontology, Verifinger, Mass disaster


Dr. Priya Thomas,


Department of Oral Pathology & Microbiology, Annoor

Dental College & Hospital, Muvattupuzha, Kerala-686673

Contact : +91 9544186644


Article History :


Received in revised form : 17 May 2021

Accepted on : 17 May 2021


INTRODUCTION:

Personal identity stands out as an important aspect in a human's

life. Many characteristic features exist in a human being,

unique to an individual, like finger print, retinal scan, facial

recognition, birth marks etc. that are used for personal

identification.

Forensic odontology involves a variety of methods for

identification, utilizing soft and hard tissues of the oral cavity.

Currently employed methods include dental age estimation

using teeth, enamel rod patterns, DNA analysis from dental

pulp, palatoscopy, cheiloscopy, bite mark analysis, ante (1)mortem dental charts comparison etc .

The use of hard tissues overrides the use of oral soft tissues as

the former can preserve information or features better, (2)compared to the latter . Teeth or enamel being the hardest

substance in the body, resist decomposition and can withstand

extreme temperatures. The use of dental evidence stands out as

the method of choice in forensic, to establish identity from

extremely traumatized, decomposed, burnt, skeletonized

remains, for those working in hazardous occupations like fire

Ameloglyphics : An Adjuvant in Individual Identification

ABSTRACT :

Introduction : In today's world, with increasing homicides and mass disasters, advanced identification methods are the need of the

hour. Human identification is easily possible with skeletal remains, especially teeth, when soft tissue analysis is not reliable. The

human tooth is considered as the most reliable evidence in a decomposed body. Enamel formation is a dynamic process. Enamel rods/prisms are deposited in an undulating, intertwining path.These rods reflect as

rod ends on the outer surface of enamel and hence form a specific pattern. These patterns are referred to as rod end patterns or

“Tooth Prints” and the study of enamel rod end patterns as “Ameloglyphics “. These patterns are unique to an individual tooth of

same individual and different individuals and an analogy to fingerprint.

Aims and Objectives: To study and analyze the tooth print patterns of different individuals and to determine if there is any

difference in the rod end patterns in males and females.stMaterials and Methods: 30 maxillary 1 premolars extracted for the purpose of orthodontic treatment were used for the study. A

representative area on the labial aspect was etched using 37% orthophosphoric acid etchant for 1min. A transparent cellophane

tape was applied to the etched site for 20 mins, gently removed and placed on a glass slide. The glass slide was then observed under

microscope and photographed. The images obtained were compared in Verifinger Standard SDK version 6.5 software.

Results: Most predominant pattern observed among the study population was observed to be loop pattern. Among the other

patterns observed were wavy branched and whorl open. 43 % of the population depicted a mixture of two viz: loop and wavy

branched/ whorl open. The tooth prints of males showed a tendency towards loop pattern. The verification with software revealed

that no two patterns were identical.

Conclusions : Tooth being the hardest substance in the body, will be preserved during mass disasters. Enamel rod end patterns are

unique for each tooth in an individual and may be used as an adjunct with other methods for personal identification. This technique

is simple, inexpensive and rapid and can be considered as adjunct ante-mortem dental records in the identification of mass disasters

victims.

92

(3,4)fighters, soldiers, jet pilots, divers etc .

Ameloglyphics is the study of enamel rod end patterns (amelo

meaning enamel and glyphics meaning carvings) and the rod (5)end patterns are termed as “Tooth prints” . These patterns

have been found to be unique to intra-individual (of the same (6)individual) and inter-individual/ different individual's teeth

and this uniqueness of the tooth patterns can be used as a (4)valuable tool in personal identification .

Enamel rod\ prisms form the basic structural unit of enamel.

Deposition of enamel is a highly organized process, in an

incremental manner. The ameloblasts lay down the enamel

rods in an undulated and inter-twining path. This is reflected on

the outer surface of the enamel as patterns of the enamel rods (5,7)ends . Groups of enamel rods run in an unique direction,

differ from adjacent group of enamel rods that result in the

formation of different patterns of enamel rod endings on the (8)tooth surface . The rod patterns are different in different

individuals but not many studies have been conducted to

analyze which patterns prevail or predominates amongst the

genders.

Biometric identification is being commonly used with

fingerprint and iris verification. These identification methods

have limitations and may not be effective during extreme (9)disasters where the soft tissues get destroyed . Automated

biometrics has been useful in reproducing complete and

accurate enamel rod end patterns. Verifinger software readily

matches the enamel rod end patterns with specific (2,7)identification number .

Considering the above factors, the current study has been

conducted to identify the enamel rod patterns of different

individuals and to analyze the difference in the rod pattern

between gender.


The present analytical observational study was done following

Institutional Human Ethical Committee approval (IHEC No.

019-B/04) over a period of two months (July -August 2019).

The study was conducted on 30 premolars (extracted for the

purpose of orthodontic treatment). Teeth with decay, attrition,

abrasion, erosion, hypoplasia, fracture and with restoration

were excluded from the study. Extracted premolar teeth were

collected in two separate bottles based on gender. The teeth

extracted were cleansed with hydrogen peroxide and stored in

the designated bottles. The tooth used for analysis was labeled

as F1-15 and M1-15 respectively indicative of males and

females.

Each tooth was cleaned thoroughly and dried. The labial

surface of the tooth was selected, debris removed from the

surface and then etched with 37% orthophosphoric acid

(Dental Etch etching gel) for 1min, washed with water and

dried with the three-way syringe. A thin strip of cellophane

tape was applied immediately over the etched surface of the

tooth without any finger pressure for 20 minutes [Figure 1].

The tape was then gently peeled, placed on the slide and

observed under the light microscope. A photomicrograph of

the peel was obtained at x400 magnification [Figure 1F].

Images were captured using Digiscope (Amscope 3.7 digital

camera MU500).

The photographs obtained were converted to 1500 * 2000

pixels with adobe photoshop and then subjected to the

automated biometrics (Verifinger standard SDK version 5.0-

NEUROtechnology) software for enamel rod pattern

evaluation. The software works on certain points called

minutiae for identification of each pattern. These points are

used by the software to compare the similarity/variability of

two patterns. Images are processed and patterns are

categorized manually.

RESULTS:

Among the patterns assessed were loop and two sub patterns

(wavy branched & whorl open). Loop pattern was found to be

the most predominant pattern (56.7%) among all the prints

(Fig 2, Table 1). The remaining 43.3% showed a combination

of all the three patterns. Only 3.3% of the teeth had whorl open

pattern and thus it can be considered to be rare. All the 30 prints

obtained were dissimilar and varied from each other. Inter-

individuality was retained. Between genders, the loop pattern

was found to be predominant but with no statistical

Figure : 1A: Marking of tooth surface 1B: Acid etching of labial surface 1C:Adhesion of cellophane tape to tooth print

imprint 1D: Tooth print imprint of the cellophane tape 1E: Print transferred to the slide 1F: Photomicrograph of tooth pattern


93

significance (p= 0.337) between gender and occurrence of

pattern (Fig 3, Table 2).

DISCUSSION:

Personal identification is an important aspect of human life.

Uniqueness to identification maintains one's individuality.

Diversity and multiplicity of criminal activities, man-made or

natural mass disasters are on the rise in today's society and

precise identification has become a prime requisite for forensic (10)application to aid in the detection .

To date, the AADHAAR card uses finger print and retinal scans

for the unique identification. Such a data is stored with the

Government of India. A totally mutilated body will lose such

soft tissue data failing for one's identification.

Dental profiling or the use of dental records (prosthesis, teeth)

could be considered as a reliable method for the identification

of an individual. Unlike all the other soft tissues of the body,

teeth are readily available and can even serve as an adjunct to

substantiate one's identification along with fingerprints.

The choice of our study depended on the fact that tooth

(enamel) being the hardest substance in the body, can

withstand high temperatures and survive the worst disasters.

This makes the human dentition a promising tool for individual (10,11)identification . Based on this fact, we decided to use teeth

as our study tool, as it can withstand all calamities when

compared to other parts of the human body.

Enamel rods form the basic structural unit of enamel. The tooth

prints are created by groups of enamel rods that run in a

distinctive direction, differing from the adjacent group of

enamel rods resulting in different patterns on the tooth (8)surface . These patterns are an analog to finger prints and hold

all characteristics as those of the latter in its uniqueness and (9,10)individuality . Premolars and molars retain more

characteristics on their buccal and lingual surfaces even with (12)age and therefore we chose the buccal surfaces for acid

etching.

There are many methods available in literature for duplication

Figure 2: Pie chart depicting the distribution of patterns

Table 1: Frequency distribution of tooth print patterns

Wavy Branched

Whorl open

Loop

Wavy Branched,

Whorl Open

Wavy Branched,

Loop

Loop, Whorl Open

Total

3

1

13

4

7

2

30

10.0

3.3

43.3

13.3

23.3

6.7

100.0

10.0

13.3

56.7

70.0

93.3

100.0

Frequency Percent Cumulative %

Figure 3: Distribution of tooth pattern between genders

Table 2: Frequency distribution of tooth print patterns among genders

Wavy Branched

Whorl open

Loop

Wavy Branched,

Whorl Open

Wavy Branched,

Loop

Loop, Whorl Open

Total

2

1

7

3

2

0

15

1

0

6

1

5

2

15

3

1

13

4

7

2

30

Male Female Total


94

of tooth prints, such as using cellophane tape, cellulose acetate

paper and rubber base impression materials. Though cellulose

acetate paper produced better prints as reported by Manjunath (2)et al (2011) , we preferred the most commonly and

economically available cellophane tape over the acetate paper.

As per our observation, cellophane tape did produce

comparably good prints but few prints were not complete

leaving small areas of blank spaces in between the patterns as (2)reported by Manjunath et al (Figure 4A, B). This could be

attributed to the errors that could have occurred while

recording the patterns like unequal pressure application,

incorporation of air bubbles while adhering the tape on to tooth

surface and to the slide, incomplete drying of teeth following

acid etch rinse etc.

Biometric analysis of the recorded tooth prints was done using

Verifinger software version 6.5. This software is commonly

used for finger print verification. Manjunath et al in his study

verified the reliability of Verifinger SDK v5.0 software for the (13)analysis of enamel rod end patterns . Therefore, we employed

similar software but of a higher version in our study.

The pattern recorded under the microscope mainly consisted of

cross sections of enamel rods basically resembling a fish scale

appearance or a key hole pattern (Figure 5A). Photos obtained,

were entered in the software and processed to intricate patterns

(Figure 5B). The software uses points called minutae for

identification and comparison of patterns (Figure 5C). These

points are discontinuities of lines, line endings, dots, small

lines and empty spaces between two lines. We found that no

two patterns matched with each other and numbers of minutiae

were different for all the patterns.

Finger prints are composed of single distinct patterns like

whorl, loop or arch, whereas as tooth prints comprise of basic (12,14)sub-patterns and a combination of the latter .

In the current study, analysis of 30 tooth prints showed only

one main pattern (loop pattern) and two sub-patterns

consisting of wavy (branched) and whorl (open) (Fig 6-7).

This is in contrast to the observation by Manjunath et al. where

8 distinct sub-patterns - wavy (branched), wavy (unbranched),

linear (branched), linear (unbranched), whorl (open), whorl (13)(closed), loop and stem-like were reported .

Loop pattern was found to be predominant in our study, in (4) (15)distinction to the study by Naziya et al and Manjunath et al

against the wavy branched pattern. This disparity could owe to

Figure 4: Print from taken with cellophane tape A: Shows complete print extraction, B: Incomplete print extraction with blank spaces

in-between)

Figure 5: Enamel Rod patterns recorded 5A: Fish scale pattern captured under light

microscope 5B: Processed Images 5C: Pattern marked by minutiae

Figure 6: Different patterns observed 6A: Loop Pattern, 6B: Wavy Branched

6A 6B

Figure 7: Combination of patterns 7A: Mixture of Loop and Whorl Open 7B: Mixture of Wavy Branched & Loop pattern

7A 7B


95

the fact of a larger sample size being included in the other

studies or associated with the change in the direction of

movement of ameloblast, influenced by environmental (12)conditions or even genetic factors .

Loop pattern was also found to be predominant between both (4)the genders, in contrast to the study by Naziya et al . However

no statistical significant difference in tooth prints were

observed between the genders and this was in accordance with (14) (4)the studies conducted by Raju et al and Naziya et al . On the

whole, none of prints were similar to each other and this study

was concurrent with the many studies reported in (4,15,16)literature

Though enamel is the hardest substance in the body, it is always

subjected to wear and tear. The permanency of tooth patterns

with depth or with wear has to be still corroborated though (17)Manjunath et al has cited that the pattern has to be recorded

every 4 years for its application.

This study further verifies and produces a stronger evidence for

the use of tooth prints as an analog to finger prints or in

association with finger prints as an adjunct.

Limitations:

From the current study, we propose that further studies, with

larger sample size are required to analyze the variations in

patterns, distribution of patterns on the various surfaces of a

single tooth and also the need to focus its variability on a single

tooth surface (comparison between two microscopic fields/

two different photographs taken on a single surface). The

stability of such patterns has to be validated against the

permanency of finger prints as enamel can be subjected to wear

and tear.

CONCLUSION:

The study has proven that no individual has the same tooth

print as another individual and stands out by itself inimitable as

possible, making it a reliable tool for identification,

maintaining its uniqueness in equivalence to finger prints.

Such a tool can be used in adjunct with fingerprints for an

individual's identification. Ameloglyphics is a simple,

economical, rapid and reliable technique that can be used as an

additional aid for personal identification. We thereby propose

that such data can be also added to one's unique identification

as an adjunct.

ACKNOWLEDGMENTS:

We acknowledge and wholeheartedly thank Indian Council of

Medical Research (ICMR) for the approval and financial

assistance given towards the Studentship Project (ICMR STS

no.08685 project of 2019).

REFERENCES:

1. Bharanidharan R, Karthik R, Rameshkumar A, Rajashree

P, Rajkumar K. Ameloglyphics: An adjunctive aid in

individual identification. SRM J Res Dent Sci.

2014;5(4):264-68.

2. Manjunath K, Sivapathasundharam B, Saraswathi TR.

Efficacy of various materials in recording enamel rod

endings on tooth surface for personal identification. J

Forensic Dent Sci. 2011;3(2):71-6.

3. Sansare K. Forensic odontology, historical perspective.

Indian J Dent Res 1995;6: 55-7.

4. Naziya J, Sunil S, Jayanthi P, Rathy R, Harish RK.

Analysis of enamel rod end pattern for personal

identification. J Oral Maxillofac Pathol. 2019;23(1):165-

76.

5. Sha SK, Rao BV, Rao MS, Kumari KH, Chinna SK, Sahu

D. Are tooth prints a hard tissue equivalence of finger print

in mass disaster: A rationalized review. J Pharm Bioallied

Sci. 2017;9(Suppl 1):29-33.

6. Girish HC, Murgod S, Ravath CM, Hegde RB.

Ameloglyphics and predilection of dental caries. J Oral

Maxillofac Pathol. 2013;17(2):181-4.

7. Joshi PS, Bhosale SS. Study of Enamel Rod End Patterns

Using Acetate Peel Technique and Automated Biometrics

for Personal Identification. Int J Dent Med Res

2014;1(4):47-50.

8. Boyde A. Amelogenesis and the structure of enamel. In:

Cohen B, Kramer IR, editors. Scientific Foundations of

Dentistry. London: William Heinemann Medical Books

Ltd.; 1976. p. 341-43.

9. Rakesh N, Sujatha S, Pavan Kumar T, Yashoda Devi BK,

Gupta D, Harish BN. Reliability of Ameloglyphics for

Person Identification Following Adverse Conditions. J

Dent Orofac Res. 2018;14(1):26.

10. Patidar KA, Parwani R, Wanjari S. Effects of high

temperature on different restorations in forensic

identification: Dental samples and mandible. J Forens

Dent Sci. 2010; 2: 3743.

11. Lake AW, James H, Berketa JW. Disaster victim

identification: quality management from an odontology

perspective. Forensic Sci Med Pathol. 2012;8(2):15763.

12. M a n j u n a t h K , S r i r a m G , S a r a s w a t h i T R ,

Sivapathasundharam B. Enamel rod end patterns: a

preliminary study using acetate peel technique and

automated biometrics. J Forensic Odontol 2008 1: 33-6.

13. M a n j u n a t h K , S a r a s w a t h i T R , S r i r a m G ,

Sivapathasundharam B, Porchelvam S. Reliability of


96

automated biometrics in the analysis of enamel rod end

patterns. J Forensic Dent Sci. 2009;1(1):32-6.

14. Raju S, Rao TM, Nandan SRK, Kulkarni PG, Reddy SP,

Keerthi M. Ameloglyphics Can it aid in forensic

identification. Indian J Dent Adv. 2014; 6:166973.

15. Manjunath K, Sivapathasundharam B, Saraswathi TR.

Analysis of enamel rod end patterns on tooth surface for

personal identificationameloglyphics. J Forensic Sci.

2012;57(3):78993.

16. Juneja M, Juneja S, Rakesh N, Kantharaj YDB.

Ameloglyphics: A possible forensic tool for person

identification following high temperature and acid

exposure. J Forensic Dent Sci. 2016;8(1):28-31.

17. Manjunath K, Sivapathasundharam B. Analysis of enamel

rod end pattern at different levels of enamel and its

significance in ameloglyphics. J Forensic Res.

2014;5(4):13.


97



1. Harshita Tara, M.Sc. Forensic Science Student*

2. Amarnath Mishra, Assistant Professor and Program Leader*

*Amity Institute of Forensic Sciences, Amity University, Sector-125, Noida-201313 (Uttar Pradesh), India

Key words: Digital forensics, Data extraction tools, Data acquisition, Data Analysis, FTK Imager.


Dr. Amarnath Mishra

(M.Sc., M.Phil., Ph.D. Forensic Sc.)

Amity Institute of Forensic Sciences, Amity University,

Sector-125, Noida-201313 (Uttar Pradesh), India

Contact : +91 91-9818978527

Email: [email protected], [email protected]

Article History :


Received in revised form : 24 June 2020



INTRODUCTION

Digital forensics is one of the branch of forensic science which

play an extremely significant role in the society due to the

prevalence of various digital devices. The main aim of this is to

acquire the courtroom evidences which are extracted from

various digital devices (such as servers, desktops, laptops,

netbooks and mobile devices) that are used by perpetrators in

various cybercrimes (such as phishing, unauthorized access

into the system and intellectual property theft in corporate

espionage etc.) and also physical crimes (such as drug [1]trafficking etc.) .Conventional crimes leave behind the

various clues such as fingerprints, DNA, footprints, and

witnesses for the investigators to examine and investigate.

Similarly, any kind of digital activity on electronic devices

leaves a trail of data for cyber investigators to investigate and

inspect the particular type of crimes to find the perpetrators. In

all the cybercrime cases it is very crucial to acquire the digital

evidences and they should be handled properly so that they can [2]be further admissible in the court of law . This is the one and

only way of acquiring the information from digital devices

which act as digital evidences and then they can be further used

to support the allegations against the perpetrator or defend an

innocent from false accusations.

Digital forensics tools

These tools have been developed by the programmers and the

various software companies which help the investigators and

digital forensic analysts to collect the digital evidences from

the electronic devices at the crime scene. Digital devices can be

desktops, laptops, USB drives, tablets, mobile phones,

CCTVs, many more. These tools can be both hardware and

software. These can be the commercial ones that can be bought

or these are available online which can be used free of cost.

There are pros and cons to every tool. Not all tools can perform

every digital forensic process whether it is acquisition,

extraction or analysis. So it's a good technique to have various

different tools available to perform the multiple tasks from

basic to advanced level.

A Comparative Study of Digital Forensic Tools for Data Extraction From Electronic Devices

ABSTRACT :

Background - Today, a wide range of digital forensic tools are available, produced by a number of software businesses for digital

forensics investigations. In a court of law, selecting and employing the right instrument might be a deciding factor. As a result,

proper rating and comparison of diverse forensic tools is required. This article discusses the various hardware and software forensic

techniques available for analysing digital evidence.

Method- Different digital forensic tools such as FTK Imager, Encase, Paladin suite, Cellebrite, Oxygen forensic tool and Tableau

hardware have been analysed using computer system and USB drive. Imaging of USB have been performed for retrieve the

information that have been performed.

Result - The acquisition and verification times were measured using the FTK imager and EnCase forensic imager tools. Physical

acquisition on the FTK imager took about 22 minutes, while physical acquisition on the EnCase forensic imager took about 1 hour

1 minute. Physical image verification took 13 minutes with the FTK imager and 50 minutes with the EnCase forensic imager.

Conclusion - When compared to EnCase imager, FTK imager is simpler, faster, and easier to use because EnCase takes longer to

acquire the image than FTK. The capabilities of Cellebrite UFED and Oxygen detective forensic instruments are nearly same,

although UFED is preferable when it comes to ease of use.

98

Functions

Acquisition : It is basically the collection of digital evidences

in the order that acknowledges the volatility of the evidences

and to maximize their preservation. The data is stored in the

way that increases its integrity and accessibility and decreases

the impact on the examined and investigated system. There

are two types of acquisition

1. Physical Data Acquisition : It is the bit-by-bit copy, or

clone, of the device's file system. It basically refers to the hard

drive copy of a normal computer system. It allows the forensic

tool to collect the deleted files and folders.

2. Logical Data Acquisition : It acquired the data by

accessing the file system. It is the extraction of the files and

folders without any deleted data.

Extraction : It is the method of extracting the data from

emails, PDFs, PDF forms, text files, images, etc. It is the

crucial part in digital forensics investigation. Data extraction is

the method of retrieving any deleted data, file, content etc.

from the electronic devices when they cannot be accessed,

searched or opened normally by the user. Being able to extract

the deleted data could help the investigators or analysts to [3]solve various civil or illegitimate cases .File carving is the

method which is used in digital forensics to obtain the data

from the disk drive or from any other storage device without

the assistance or permission of the file system that has created

the file originally. It is the process which extract the files at

unallocated space and is also used to generate the data and [4]execute the computer forensic investigation .

Analysis : It is the process followed by extraction of data. So it

is basically the analysis of extracted data to relate the contents

and presented them in the court of law.

Classification of tools - On the basis of functions they

perform: (Figure 1-3)

Note-There are many other tools which are available for the

collection of the data from the digital evidences like X-ways

forensic tool, Nuix, Magnet, Autopsy, Prodiscover, etc. But I

have been mainly focused on the above mentioned tools as

these are the ones which have been mostly used during

investigation and they perform all the tasks and processes

required for acquiring, extraction and analysis of digital

evidences.

Different Digital Forensic tools are :

1. FTK Imager Tool-This tool is used to preview data and

also helps in imaging the data. It is developed by the Access

Data shown in figure 4.It is considered to be the best hard disk

drive and the solid state drive digital forensic tool in the [1]industry . FTK Imager create the bit-by-bit and sector by

sector forensic images of the computer data without making [2]any changes or damage to the original evidence . It allows an

investigator to inspect and investigate the files and folders on

local hard disk drives, zip drives, floppy disks, etc. and preview

the data stored as the forensic images. It can organize the

evidence by the type of file, file saved with extension, site on

the drive, and more. It is also used to carve and deleted content

as well as it can be used to locate the social security, debit card

numbers, etc. An investigator can also use this tool to create

MD5 and SHA1 hashes of the different files for the verification [5]of the forensic image of data with that of the original one .

Note: This tool also helps the analyst to run it from the USB

drive as it has its portable version.

Fig. 3 Tools used in Analysis and reporting

Fig

4 F

oren

sic

Too

lkit

Su

ite

Analysis and reporting

Encase, FTK Forensics, Intella


99

2. EnCase Forensic Imager tool- EnCase version7.12.01.18

is the tool which is distributed and maintained by Guidance

Software shown in figure 5. It is the tool which offers the

functionality and the flexibility. Investigators have the

flexibility to complete the investigation efficiently and quickly

with this tool.

It provides the flexibility for any investigator to acquire data

from the wide variety of digital devices and it also includes 25

types of mobile devices such as smart phones, tablets, iOS etc.

It helps an investigator to complete the investigation in the

forensically defined manner.

It produces the extensive reports of the whole investigation and [5]also maintain the integrity of the evidence .

It is used to transfer evidence files directly either to law [6]enforcement or to the legal representatives .

It creates the exact duplicate files of original data which is

further verified by hash and Cyclic Redundancy Check (CRC)

values.

3. Paladin Forensic Suite :

It is a Live “Linux” distribution which is created based on

Ubuntu that simplifies various tasks and processes in a

forensically sound manner via this toolbox. It is available in

64-bit and 32-bit versions. It is used by thousands of digital

analysts or forensic examiners such as law enforcers, military,

federal, state and corporate agencies. With the Paladin toolbox,

user can easily triage- search – image and more. It includes

more than 80 tools which are simplified into 25 groups such as

Imaging Tools, Social Media Analysis, etc.

Characteristics :

• It helps in complete visibility into your network.

• It also helps in acquiring the volatile data including

internet history and RAM and then it stores that content

in the pen drive or any other storage drive.

• It also works efficiently in apple windows, android

windows, and Linux. (Figure 6)

4. Cellebrite UFED - Cellebrite has developed the series of

products called 'Universal Forensic Extraction Device' i.e.

(UFED) for computer forensics examination. Basically this

system i.e. Universal Forensic Extraction Device is a portable

device with optional personal computer software, data cables, [7]chargers etc.

UFED 4PC- Cellebrite presents UFED 4PC (Figure 7) which

is the cost-effective, flexible and the most convenient

application suite for any investigative personnel requiring a

specialized mobile forensic tool kit on their existing desktops

or laptops. UFED 4PC provides digital analysts with advanced

capabilities to perform tasks like data extraction, decoding and

analysis on the same platform from the widest range of mobile

devices.

Key Features :

—Physical abstraction and decrypting while bypassing the

pattern lock / security password / postal index number from

android or iOS gadgets.

—It contains the unique and enough set of analysis

characteristics that includes timeline, malware detection, etc.

—It also helps in logical eradication of contents i.e.

Applications data, passwords, instant messaging, contacts, [8]emails, pictures, audios, videos, call logs, phone details etc.

—It also performs the cloning of Subscriber Identity Module

(SIM) ID which is used to quarantine the phone from network

activity during the investigation.

—It has the many software updates that occur frequently to

ensure its compatibility with the newly introduced phones in

the market.

—It generates the reports that are easy to read in the different

forms using the UFED Physical Analyzer Tool.

UFED Physical Analyzer- UFED PA is available with the

UFED Touch Ultimate. It offers the advanced analysis,

decrypting and reporting features in the mobile forensics. It

also helps in malware detection, advanced decoding and

reporting features, transferring data capabilities etc.

Fig

5. E

nC

ase

For

ensi

c Im

ager

Fig

6. P

alad

in T

ool


100

Advanced features for various operating systems :

iOS -

—By decoding simple and difficult passwords when an

investigator is performing any physical and file system

eradication on selected apple operating system devices.

—It helps is real-time decryption of data, apps, and keychain [9]real-time decoding while disclosing user passwords .

Android-

—Helps in advanced decryption of all physical eradications

which are performed on android running devices.

—Advanced description of various apps and their files

5. Oxygen Forensics Detective-It is a forensic software

detective tool which is created to obtain the data from the

various electronic devices, their cloud backups and pictures,

storage cards, subscriber identity module (SIM) cards, drones,

Google storages and many more. It has played a crucial role in

various illegitimate investigations and also it is used by the [10]various law enforcers, police officials, army personnel, etc .

Key features

—Acquire information from the devices, information of call

logs.

—Acquire and analyze texts (SMS, MMS, messages in iOS,

electronic mails with attached files), pictures, visual clips and [10]audio recordings, voice notes, documents, files and folders.

—It also helps in finding passwords to encrypt device backups

and images.

—It also eradicate travel history and stored media files from [10]drones .

—It collects contents stored in Windows, Mac and Linux PCs.

—It also helps in recognition of facial and image security locks

on mobile devices.

6. Tableau Hardware : This is the hardware tool which is used

in digital forensics for the duplication, imaging, cloning of data

from source to various destinations. There are two types of

tableau hardware in use

Forensic Imager Tx1- It has the touchscreen interface which

is colored in appearance (figure 8) and it is easy to use by the [11]analysts or an investigator . It is the powerful forensic imager

that offers the superior local and networked imaging

performance. It supports many drive connections than any

other forensic imager including SATA, USB 3.0, PCIe, SAS,

FireWire 800 & IDE.

Key features :

—It has the ability to target file-based evidence with the

powerful logical imaging function that includes an intelligent

and easy to use search engine.

—It clones Serial Advanced Technology Attachment (SATA),

Universal Serial Bus (USB) 3, PCIe, SAS, FireWire 800 and [12]IDE(with optional IDE adapter) as described in fig.9-10 .

—It outputs to Serial Advanced Technology Attachment [12](SATA), Universal Serial Bus (USB) 3, and SAS .

—It helps in performing imaging of two devices simultaneously [12].

—It has the ability to clone or image duplication of the data to up

to four destinations per source.

Tableau TD2U Forensic Duplicator- This hardware

duplicator has the perfect combination of easy doing operation,

dependence and very fast forensic imaging performance. It

provides high performance digital forensic features at a low [13]cost or friendly price . (Fig. 11-12)

Standard operations of TD2U :

—Disk-to-Disk copying – Cloning

—Disk-to-File copying-Imaging

—Format

—Wipe

—Hash values verification i.e. Message Digest Algorithm 5

(MD5) and Secure Hash Algorithm-1(SHA-1)

—Blank Disk Check

Key features :

—It images Serial Advanced Technology Attachment (SATA),

Universal Serial Bus (USB) 3.0, and IDE hard disk drives as

shown in figure 13.

—Its bit-by-bit copying speeds is 15 GB/minute including

.extension01 file, compressed with Message Digest Algorithm


101

5 (MD5) and Secure Hash Algorithm-1 (SHA-1) hash values [14].

—It is capable of creating 1:1, 1:2, and 1:3 forensically-sound

copies of the digital evidences.

—It outputs to raw demand draft, .extension01, .ex01, or .dmg

file formats.

—Its data wiping speed is 25 GB/minute.

—It supports whole disk coding of the destination disk drives.


Intel core i3-4005U CPU, 4 GB of RAM (with Microsoft

Windows 10 Pro operating system), USB Drive of 32 GB (It

contained the data of 12.1 GB). This USB Drive was used for

the comparison between the FTK imager and EnCase based on

the acquisition and verification.

ANALYSIS :

Digital Forensic software such as Encase forensic imager,

version 7 have acquired the image of the USB drive (digital

evidence) and tested how long it would take to acquire (both

physical and logical acquisition) the information and the

verification time of the image.

Next tool used was FTK Imager 4.3.0.1.8, a simpler imaging

program and same USB drive was imaged to retrieve the

information and then compared the acquisition as well as

verification time of both EnCase forensic imager and FTK

imager with same compression level.

RESULTS AND DISCUSSIONS :

Table 1-3 Showing the results of completion time of

acquisition and verification by FTK imager and EnCase

forensic imager tools

The initial tool used was FTK imager. First test was the

simple acquisition.

—FTK imager took approximately 22 minutes for physical

Fig. 11 Tableau

TD2U Duplicator

Fig

. 12

Upp

er P

art

of T

D2U

Fig

. 13

Low

er P

art

of T

D2U


102

acquisition as shown in figure 14 and 21 minutes approx. for

logical acquisition as shown in figure 16.

—Second test was the verification of the acquired data to make

sure that the acquired information was not altered.

—Physical image verification was completed in 13 minutes

approx. as shown in figure 15 and logical image verification

was completed in 8 minutes as shown in figure 17.

Next tool used was EnCase forensic imager :

—Simple acquisition took approximately 1 hour 1 minute for

physical acquisition as shown in figure 18 and 1 hour 5

minutes approx. for logical acquisition as shown in figure 19.

—Physical image verification was completed in 50 minutes

approx.as shown in figure 18 and logical image verification

was completed in 17 minutes approx. as shown in figure 19.

Below are the some screenshots depicting the acquisition and

verification performed by FTK Imager and EnCase forensic

tool.

Physical Acquisition

Verification

Logical Acquisition

Verification

Start

Stop

Start

Stop

Start

Stop

Start

Stop

16:00:25 pm

16:22:34 pm

16:22:36 pm

16:35:51 pm

17:01:04 pm

17:22:30 pm

17:22:32 pm

17:30:18 pm

5:35:10 pm

6:34:50 pm

6:34:52 pm

6:53:18 pm

11:34:18 am

12:29:29 pm

12:29:31 pm

12:46:36 pm

FTK imager EnCase imager

Table 1: Showing the results of completion time of acquisition and verification by FTK imager and EnCase forensic imager tools

Table 2: Showing the list of different functions performed by FTK and EnCase forensic tools

Function

Acquisition

Physical data copy

Logical data copy

Validation

Hashing

Filtering

Extraction

Data viewing

Carving

Decrypting

Deleted data

Bookmarking

Analysis

Header analysis

Keyword searching

Indexing

Reconstruction

Disk to disk copy

Disk to file copy

Image to disk copy

Partition to partition copy

Image to partition copy

Reporting

Log reports

Report generator

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

FTK imager En Case imager

Table 3 : Showing the list of different functions performed by Cellebrite UFED and Oxygen detective forensic tools

Function

Open source tool

Commercial tool

Data acquisition

Logical files

Physical data dump

Media cards

Data verification

MD5

SHA1

Sim cards support

SIM cloning

Analysis

Bookmarking

Data carving of

Multimedia files

Data comparison

Deleted data recovery

File sorting

GPS point mapping

Image viewer

Report formats

HTML

PDF

XLS

TXT

XML

Threads

Cellebrite UFED

No

Yes

Yes

Yes

Yes

Yes

No

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

No

Yes

Yes

No

Yes

Yes

Yes

Yes

Yes

No

No

Yes

Yes

No

Yes

No

Yes

Yes

No

Yes

Yes

Oxygen detective


103

CONCLUSION :

For EnCase V7.04.01, we have recorded that it took 1hour

1minute to acquire the physical image 12.1 GB data from the

32 GB USB drive and another 50 minutes to verify that the data

acquired was indeed the same as on the USB drive while it took

1 hour 5 minutes to acquire the logical image and another 17

minutes for its verification.

For FTK Imager 4.3.0.1.8, the physical imaging of the USB

drive was completed in 22 minutes and another 13 minutes for

the verification while it took approximately 21 minutes to

acquire logical image and another 8 minutes for its

verification.

Based on the above results of acquiring the image and

verification, FTK imager is simpler, faster, and easier as

compared to EnCase imager as EnCase took longer time for

acquiring the image than FTK.

Although Cellebrite UFED and Oxygen detective forensic

tools have more or less similar functions but among two UFED


104

is more preferred when it comes to easy to use. Also it supports

maximum number of devices such as iOS devices including

all iPhone models (iPhone 4S to iPhone XS/XR), iPad, iPad

mini, iPad Pro and iPod touch, running iOS 5 to iOS 12 ,

Samsung devices including Galaxy S6/S7/S7+/S8/

S8+/S9/S10, A5/A7/A8, J1/J2/J3\/J6/J7, Note 5/Note 7/Note

8/Note 9 , Huawei including P8Litem, P10Lite, P20Lite,

Honor Note 10, Mate 9, Mate 10, Y7, Nova 2, Nova 3, Honor

Magic 2, Enjoy 8 Plus , LG including G5, Nexus 5X, V20, V33

Qua, M327, G6 , Other androids including Alcatel, Motorola,

ZTE, HTC, Nexus, Xiao MI and more.

REFERENCES :

1. Powell A, Haynes C. Social media data in digital forensics

investigations. In Digital Forensic Education 2020 (pp.

281-303). Springer, Cham.

2. Hassan NA. Digital Forensics Basics: A Practical Guide

Using Windows OS. A press; 2019 Feb 25.

3. Surviving with Android.

Available at https://www.survivingwithandroid.com /,

accessed 2020

4. InfoSec Resources 2020.

Available at https://resources.infosecinstitute.com/.

5. Tabona O, Blyth A. A forensic cloud environment to

address the big data challenge in digital forensics. In2016

SAI computing conference (SAI) 2016 Jul 13 (pp. 579-

584). IEEE.

6. UFL Research Repository.

Available at https://repository.uel.ac.uk/,accessed 2019.

7. Pyramid Cyber Security.

Available at https://pyramidcyber.com/ ,accessed 2018.

8. Military Systems and Tecchnology.Available at

https://www.militarysystems-tech.com/,accessed 2020.

9. Myspace International.

Available at http://myspaceintl.com/index.html,accessed

2019.

10. Oxygen forensics. Available at https://www.oxygen-

forensic.com/en/.

11. Digital Intelligence.

Available at https://digitalintelligence.com/,accessed

2016-20.

12. Digital forensics.

Available at https://shop.avatu.co.uk/,accessed 2020.

13. Fulcrum management.

Available at https://fulcrum.net.au/,accessed 2012.

14. Siva Kumar P. Effectual web content mining using noise

removal from web pages. Wireless Personal

Communications. 2015 Sep 1;84(1):99-121.


105



1. Rohit Zariwala, Professor & Head, Department of Forensic Medicine, Gujarat Adani Institute of Medical Sciences, Bhuj

2. Krunal Pipaliya, Associate Professor, Department of Forensic Medicine, Banas Medical College, Palanpur, Gujarat.

3. Dimple Patel, Professor & Head, Department of Anatomy, AMC MET Medical College, Maninagar, Ahmedabad.

Key words: Image based, Non image based, Teaching learning methods(TLM), Forensic medicine & Toxicology (FMT)


Dr. Rohit Zariwala,

Professor & Head,

Department of Forensic Medicine, Gujarat Adani Institute of

Medical Sciences, Bhuj - 370001.

Contact : +91 99250-30322


Article History :


Received in revised form : 26 July 2020

Accepted on : 26 July 2020


INTRODUCTION :

Images are frequently used as 'icebreakers' at the start of a

presentation to motivate an audience to listen and pay

attention. The image is chosen to promote the relevance of the

lecture content 'perhaps it might happen to me', which is [1] [2]important in adult learning. Cosgrov described the use of

images of a toy train-set to illustrate oxygen delivery to tissues.

Physiotherapy students in the study group obtained higher

marks in MCQ papers following the lecture, compared with a

control group. This suggests the imagery significantly

increased understanding of the topic and possibly memory

retention as well.

Careful structured use of images improves attention, [3]cognition, reflection and possibly memory retention .

4Memory for pictures may be better than for words and this fits

with the dual code theory that images are stored via a different [4]pathway to auditory information in the brain


After taking ethical approval from institutional ethics

committee, GAIMS, Bhuj and written informed consent from

participants, Present study was conducted at Forensic thMedicine Department, GAIMS, Bhuj from 15 October 2018

thto 15 Mach 2019 on 146 students of 2nd year MBBS (2017-

18) to evaluate effectiveness of image based interactive

teaching learning method on academic performance by taking

their feedback.

The study group was divided in two groups (Group A and

Group B) consisting 73 students in each group. Randomization

Introduction And Evaluation of Effective Image Based Interactive Teaching Learning Method In Forensic Medicine Amongst Second MBBS Students

ABSTRACT :

Introduction: Use of carefully structured image improves attention, cognitionand reflection.

Aim: To facilitate learning in FMT by image based interactive teaching.

Objectives: To obtain student's perception after introduce and evaluation of effectiveness of image based interactive teaching

learning method.

Materials and Methods: Prospective, interventional and cross over study was conductedover 6 months period on 144 second

MBBS students of GAIMS. Pre Sensitization of session of one hour was conducted. Participants were randomized into two groups

- A (n = 73) and B (n = 71). Two topics were taught by image based and none imaged based TLM with Crossover. Assessment was

done by pre validated 10 MCQs test after each topic. Data were statically analysed. Participant feedback was taken in Google form

by using questioners based on Liker's scale.

Result: Mean ± SD of imaged based TLM was higher (7.53 ± 1.35) than nonimage based TLM (5.94 ± 1.80) on Abrasion. Mean ±

SD of imaged based TLM was higher (6.15 ± 1.80) than non image based TLM (4.77 ± 1.70) on Contusion. P value was statically

highly significant on image based TLM. Student's feedback most of the students agreed with imaged based TLM.

Conclusion Image based TLM is found to be useful learning tool for FMT. Ithastens understanding of complex components of

FMT in shorter period of time than non-image based teaching.

106

of students was done. Absent participants on day of teaching

were excluded. Faculty and Students were sensitized regarding

the project prior to study.

Topics included in the project were Abrasion and Contusion

which is decided after discussion with the faculties of

Department of Forensic Medicine and students. MCQs were

validated by two experts from the Department of Forensic

Medicine.

Topic I (Abrasion): GROUP A: Teaching with use of image

based & GROUP B: Teaching with use of non-image based.

Topic II (Contusion): GROUP A: Teaching with use of non-

image based & GROUP B: Teaching with use of image based.

Both topics were taken by same teacher. The impact of

teaching-learning methods was analyzed by assessing

performance of students in printed copies of the MCQ based

test consisting of 10 MCQs (10 marks) on respective topic

taught. Time for the test was ten minutes.

The entire process was part of the teaching methodology and it

was completed in the class time. No sensitive questions were

asked as part of the feedback and anonymity was maintained.

The students was asked to fill the pre validated structured

questionnaire about their views and perception of two

teaching-learning methods. Feedback given by students was

evaluated on a five point Likert scale (i.e., strongly agree,

agree, agree/disagree, disagree and strongly disagree)

Collection of Data: Collected data of questionnaires and

MCQ tests was recorded in Microsoft excel worksheet.

Statistical analysis: It was done by two tailed independent t

test after consulting to the statistician

Evaluation: The data was collected, tabulated, and

statistically analyzed by an appropriate statistical tool (e.g.

Prism software trial version)

RESULTS :

Table 1 show that Means ± SD for the topic Abrasion in image

based teaching was 7.53 ± 1.35 as compared to the non-image

based traditional teaching i.e. 5.94±1.80. And for the topic

Contusion Means±SD in image based teaching was 6.15 ± 1.80

as compared to the non image based traditional teaching i.e.

4.77 ±1.70.

P value for the 2 tailed independent t test in Abrasion and

Contusion is <0.001 respectively which is highly significant.

Figure 1, 2 and 3 Vertical Bar - Diagram shows average

percentage scored by students from image and non image

based TL method. It is clearly evident that percentage scored

by students in topics taught by image based teaching is higher

than the topic taught by non-image based teaching.

Figure 4 shows the students feedback for the image based

teaching on 5 point Likert scale.

DISCUSSION :

FM is a visually oriented subject. Investigation of MLC cases

in FM primarily depends on the inspection findings in most

cases. Hence, the images can serve as a valuable teaching

material. Further, the interpretation of MLC cases in the native

skin color poses challenges to a beginner who is baffled by the

variations in presentation. Repeated exposure to images is [5]expected to increase the diagnostic skills, as well.

Table 1 : Comparative performance of students with image based teaching and non image based teaching ( mean±SD)

TL METHOD

COUNT (n)

Mean±SD

P VALUE IMAGEV/S NON IMAGETEACHING

IMAGES IMAGES

73

7.53±1.35*

*<0.001*p<0.001, Highlysignificant

*<0.001*p<0.001, Highlysignificant

NON IMAGE NON IMAGE

71

5.94±1.80

68

6.15±1.80**

70

4.77±1.70

TOPIC ABRASION CONTUSION


107

Advantages for image based teaching :

1. Repeated exposure to image facilitates active learning and

retention of knowledge.

2. It will be an effective supplement in a set up where clinical

teaching material is limited.

3. Ti will be a time saving method of teaching.

4. D/D of particular condition can be discussed easily with

image alone.

5. It provides long lasting visual memory of subtle

diagnostic clue for students.

6. Unlimited number of image of different patients can be

used which will be as effective as clinical cases.

7. Creation of an image bank ensures uniformity in exposure

to the teaching material used.

We also could perceive a change in the learning behavior of the

students who showed constant enthusiasm in learning

throughout this method of teaching.

Teaching students in a clinical setup give them the opportunity

to handle the clinical problem in a reality wherein all

components described in Millers pyramid of assessment can be 6addressed . This setup also addresses the affective domain of

learning among students.7Aubrey et al. used interactive teaching mechanisms such as

didactic lectures, preceptor-led live patient sessions, poster

exhibit, and CD-ROM program composed of digital

reproduction of Kodachrome slide images presented in

lectures, to teach “Introduction of Dermatology” to 2nd year

medical students. They found that among the teaching

mechanisms, live patient session program, CD-ROM and

poster exhibits (in decreasing order) generated highest ratings.

In the feedback given by students, there had been a

considerable number of requests for even greater access to 6virtual images of skin diseases.

CONCLUSION :

Image based interactive teaching is found to be a useful

learning tool for Forensic Medicine & Toxicology. It hastens

understanding of complex components of Forensic Medicine

& Toxicology in a shorter period of time than non image based

teaching. It is recommended that the technique may be

explored for the core area learning in FMT on regular basis in

class room teaching.

RECOMMENDATION :

It is recommended to further evaluate effectiveness of image

based interactive teaching learning method in other subjects.

LIMITATIONS :

•Image based Interactive teaching requires greater preparation

& planning.

•Inter topic variability may exist depending on availability of

images and levels of difficulties.

•Participants were not followed-up to assess the long-term

retention of knowledge acquired during the FM posting.

•Faculty feedback was not available as study was not be

planned for these objectives.

ACKNOWLEDGEMENTS

We are thankful to Dr Gurudas Khilnani, Dean, Dr Tejas

Khakhkhar, Associate Professor, Pharmacology and Ms.

Maitri Hathi, Statistician, of GAIMS.

REFERENCES :

1. Knowles MS, Holton EF, Swanson RA.Emerging issues

in the practice of University Learning and Teaching.

Publisher AISHE, Eire. 2005:

http://www.aishe.org/readings/2005-1/toc.html (last

accessed 1 March 2010) the Adult Learner 6th Edition.

Elsevier, London, 1998

2. Cosgrove JF, Fordy K, Nesbitt IDl. Thomas the tank

engine and friends improve the understanding of oxygen

delivery and the pathophysiology of hypoxaemia.

Anaesthesia: 2006;61:106974 [PubMed]

3. Elizabeth M Norris. Journal of the Royal Society of

Medicine : “TheConstructive use of Images in medical

teaching: a literature review”, 2012 May; 3(5):33.

4. Sadoski, M , and Paivio, A. 'Imagery and Text a dual

coding theory of reading and writing', Erlbaum Assoc,

New Jersey 2001 Google Scholar

5. Fawcett RS, Widmaier EJ, Cavanaugh SH. Digital

Figure 4 : Students feedback


108

technology enhances Dermatology teaching in a family

medicine residency. Fam Med. 2004; 36:89-91.

6. Wass V, Van der Vleuten C, Shatzer J, Jones R.

Assessment of clinical competence. Lancet. 2001;

357:9459. Hartmann AC, Cruz PD., Jr Interactive

mechanisms for teaching dermatology to medical

students. Arch Dermatol. 1998; 134:72-58.

7. Hartmann AC, Cruz PD., Jr Interactive mechanisms for

teaching dermatology to medical students. Arch Dematol.

1998; 134:725-8 (PubMed) (Google Scholar)


109



1. Sathish.K, Assistant Professor, Department of Forensic Medicine and Toxicology, Shri Sathya Sai Medical College and

Research Institute, Ammapettai, Nellikuppam, Chengalpet, Tamilnadu, India, 603108.

2. Kusa Kumar Shaha, Professor, Department of Forensic Medicine and Toxicology*

3. Ambika Prasad Patra, Associate Professor, Department of Forensic Medicine and Toxicology*

4. J. Sree Rekha, Associate Professor, Department of Pathology*

*Jawaharlal Institute of Postgraduate Medical Education & Research, Puducherry, India, 605006.

ABSTRACT :

Introduction : Snake bite is considered as an occupational hazard, especially in rural and semi-urban regions where agriculture is

the major source of occupation. According to the National Crime Records Bureau, there were 8,660 deaths due to snake bite

reported in the year 2015, but this does not reflect the actual data because of the traditional methods and healers opt by the people.

Materials and Methods: An autopsy based prospective study was conducted on fatal cases of snakebite reported at the Mortuary

of JIPMER, Puducherry over 2 years from January 2017 to December 2018. Epidemiological and demographic data were collected

and analysed.

Results: The cases studied about 2.7% (38) of the total 1407 medico-legal autopsies conducted during the study period. Most of the

cases were male with the age group of 41-60 (36.9%) was affected the most. Most of the incidents occur in the agricultural fields

(52.6%) and the people working there become more vulnerable to the bite. There was a marked increase in the number of cases in

the summer season (50%). Snakes were unidentified in 25 cases (65.8%) and among the identified cases the most common culprit

was Viper amounting to 12 (31.6%) cases. The lower extremity was the most frequently involved site of the bite (81.6%). Majority

victims (78.9%) had been applied a tourniquet or native traditional methods before hospitalization.

Conclusions: These results urge in educating the rural population about the preventive measures of snakebite and the importance

of early hospitalization to save the golden period engulfed by the traditional healers.

Key words: Snake bite, Epidemiology, Autopsy, South India, Occupational Hazard


Dr. Sathish.K, Assistant Professor, Department of Forensic

Medicine and Toxicology, Shri Sathya Sai Medical College

and Research Institute, Ammapettai, Nellikuppam,

Chengalpet, Tamilnadu, India, 603108.

Contact : +91 9789672020


Article History :

Received : 26 October 2020


Accepted on :15 December 2020


INTRODUCTION:

Snakes are enthralling and also an essential constituent of

fauna are the objects of wonder and curiosity since the origin of

civilization. Snake venom is one of the oldest known poisons

to the human being and has been described in ancient epics,

myths and medical writings. It has appeared in various

traditions, either as a demon or as divine. In Greek mythology,

it represented Goddess Hygeia and was worshipped, along

with Asclepius the God of Health. The tradition is carried over

to the modern time and the snake has found a place in the 1universal symbol of the medical profession. Snakebite is one

of the common causes of unnatural death ever since the

evolution of mankind. The prevalence of snake bites is

common in tropical countries such as Africa, South and

Southeast Asia, and Latin America. There are about 3500

species of snakes known to the world out of which only around

350 are poisonous. In India snakes of around 330 species are

found of which 70 are poisonous. These include 40 species of 2land snakes and 30 species of sea snakes. Snake bite is one of

the neglected tropical diseases that the World Health

Organization (WHO) aims to exterminate, which constitutes a

major public health problem in the tropical areas of the world.

WHO states that around 5.4 million snake bites occur each

year, causing in 1.8 to 2.7 million cases of envenoming. It is

estimated these effect in the deaths of 81000-138000 people a 3year and leaves added 400000 with permanent disabilities.

India, being a tropical country where farming is a major source

of employment, snake bite has become a common medical

emergency and an occupational hazard with the highest

snakebite mortality in the world, about 45,000 deaths per

Epidemiological Profile of Fatal Snake bite Cases in a Tertiary Care Centre in South

India

4annum. According to the National Crime Records Bureau,

there were 8,660 deaths due to snakebite reported in the year 52015 of which 2,230 from south India .Most of the current data

available concerning the epidemiology are purely based on

under-reported hospital statistics. There have been fewer

efforttaken to evaluate based on the socio-demographic

factors. So the fatalities reported representing only the tip of 6the iceberg. There is a global discrepancy in the

epidemiological data of snake bite because of because more

people prefer traditional healers and witchcraft rather than a 7hospital. This study was carried out to describe the

epidemiology, arrival delays, and the outcome of snakebites

which were appreciated in a tertiary care hospital of Southern

India.


An autopsy based cross-sectional study was conducted over a

period of two years January 2017 to December 2018 on

snakebite cases in all age groups received at the mortuary,

department of forensic medicine and toxicology, JIPMER,

Puducherry. This institute is a referral tertiary care hospital in

Puducherry, India, where patients come from the various

districts of Tamilnadu and other parts of Southern India. All the

cases brought to the department of forensic medicine as a

snake bite for medico-legal autopsy are included in the study.

The data on the demographic factors and variables such as age,

sex, occupation, place of bite, site of the bite, type of snake,

time of the bite, first aid taken were collected using a structured

questionnaire. The data was collected from the police and

legally acceptable representative in all the autopsy cases who

died due to snakebite. All data recording and analysis were

carried out using IBM PASW statistics (SPSS) - Version 19.0.

RESULTS:

Out of the total 1407 medico-legal autopsies conducted in the

study period, 38 cases were due to fatal snake bite

envenomation which constitutes around 2.7% of the total

cases. All the 38 were satisfied with the necessary inclusion

criteria and were incorporated into the study. Most of the

deaths (36.90%) occurred in the age group of 41-60 years

followed by the 21-40 years contributing (34.20%) of the

cases. (Fig.1) Males were affected more than the females and

the male/ female ratio was 1.7:1. Majority of the victims

(60.50%) were farmer by occupation. We observed that the

educational qualification of most of the deceased was primary

school with 42.1% cases. The uneducated category also

comprises 42.1% of cases which includes those who did not go

to school and children in the study. The peak incidence of fatal

snake bite in our study (50%) was seen in the summer season in

the months of March to June. The time distribution was

comparatively equally distributed in our study with less

frequency between 12 AM to 5.59 AM. Most of the cases

(52.6%) occurred in the agricultural fields followed by 31.6%

cases in the house premises. Most of the cases (50%) occurred

in an outdoor environment most commonly while working in

agricultural fields, 34.2% of cases occurred while doing

household activities and 10.5% cases took place while sleeping

at home.(Table 1) In the majority of the cases (65.8%) the type

of snake was not identified by either the victim or the

bystanders. Among the identified cases the most common

offender was Viper amounting to 31.6% of cases (Fig.2)

110

FactorsGenderMaleFemale

Number of Cases, N=38 (%)

24 (63.2%)14 (36.8%)

23 (60.5%)7 (18.4%)8 (21.1%)

16 (42.1%)4 (10.5%)2 (5.3%)16 (42.1%)

19 (50%)9 (23.7%)10 (26.3%)

10 (26.3%)10 (26.3%)10 (26.3%)8 (21.1%)

6 (15.8%)20 (52.6%)12 (31.6%)

4 (10.5%)13 (34.2%)19 (50%)2 (5.3%)

Figure 1: Age-wise distribution of cases


followed by Cobra causing 2.6% of the deaths. The most

common site of the bite were the lower extremities where

81.6% of bite marks were located followed by the upper

extremities (15.8%) and head, neck and trunk in 2.6% of

cases.(Table 2) Majority of cases (71.1%)were applied with

tourniquet at the site of bite prior to the hospitalization., while

21.1% of victims did not receive any first aid treatment. 7.9%

of cases were applied or gone to the folk remedies (Suction

and/or Application of herbal remedies used by the rural quacks

and by some alternative medicine practitioners) before

hospitalisation. (Table 3)

Most of the cases (86.8%) received Anti Snake Venom (ASV)

before death. Most of the cases (71.1%) were received the ASV

within 1 to 6 hours of bite which was followed by 13.2% of

cases where they received in less than one hour. It was

observed that 42.1% of cases in the study were survived

between 1-3 days followed by 31.6% of cases where they

survived for 3-7 days. The minimum duration of survival

observed was 2 hours and maximum survival duration was 23

days (the snake was Unidentified by the case/sources).(Table

4)

DISCUSSION:

A total of 38 cases of snake bite were received during the study

period, constituting 2.7% of the total cases. Other studies done

in India, report a relatively equivalent percentage of fatal cases

of snake bite, ranging from 0.47% to 2.50% of all the autopsies

conducted during the study period. Among 38 snake bite

deaths, the maximum number of cases belongs to 41-60 years

of age group constituting 36.9% of the total followed by 21-40

years (34.2%). Similar findings were found in the other 8-10studies conducted where the maximum number of cases

between 15-59 years of age group. Most fatalities were noticed

among younger and middle age group because they are the

working population group and snake bite is also an

occupational hazard. The majority were male victims in our

study because in India they are the earning person in the family

who is constantly exposed to the working environment and

other outdoor activities like agriculture, sleeping in farmyards 8,9,11-16etc. Similar results were obtained by the previous studies.

Our study goes in accordance with other studies in the 13,17educational status of the victims. The morbidity and

mortality were more in those who were illiterate and had

primary education. They do not aware of safety precautions

that prevent the bite and ignorant about the significance of

early medical attention and losing their precious time by

attending traditional healers and witchcraft. India agriculture

being the major backbone of the country the farmers are

frequently affected while working in their fields, and

plantation workers, those who work barefooted in the fields

were also affected. Hence snake bite was called as an 12-14, 19-20Occupational hazard. Identifying the type of snake is

important in the line of management. In this study 65.8% of

cases species of the snake were unidentified which correlates 13,21,22with other similar studies. The reason behind the

111

Factors Number of Cases, N=38 (%)

Site of biteLower limbUpper limbHead, Neck and trunk

12 (31.6%)1 (2.6%)25 (65.8%)

31 (81.6%)6 (15.8%)1 (2.6%)


Survival durationless than 1 day1-3 days3-7 daysmore than 7 days

5 (13.2%)16 (42.1%)12 (31.5%)5 (13.2%)

5 (13.2%)27 (71%)1 (2.6%)5 (13.2%)


First aid received prior to hospitalizationNilTourniquetFolk remedies*

8 (21%)27 (71.1%)3 (7.9%)

Figure 2: Crime scene Picture showing a Russell's Viper


unidentified snake species could be due to that the victims

could not see and recollect when the incident happened

because of the dark environment and when the snake rushed off

suddenly. The time distribution between the cases was

comparatively equally distributed with less incidence between

12 to 6AM. Other studies showed greater incidence both in day 13-18,20,21,23and night time. Our results were similar to the other

previous studies where the incidence happened in the outdoors 13,18,24,25mostly in the agricultural fields. Increased incidence of

cases during the summertime attributes in this study may be

due to the more number of harvest and new plantation occur

during this time in the regions of study, and thereby more

encounter to the snake in the agricultural fields. This is similar 26to the other results reported by Jayahrishnanet al. The site of

the bite was lower limb in 81.6% of cases in this study followed

by upper limb in 15.8% cases. Since most of the victims work

barefooted in the agricultural fields they get bitten by the

snake. Some people might accidentally step into the snake

during walking. These results are comparable to other studies

where lower extremity was the most common site 8,9,12,13,18,22-26involved. We observed that 71.1% of cases were

applied with tourniquet above the site of bite when arrived at

the hospital. This was similar to the other studies where most of

the victims where they go for native first aid methods in which 13,18,21,24,26,27,30tourniquet application was more common. The

custom of tourniquets, which increases the local complications

by cumulative the tissue anoxia and by producing severe

systemic envenoming right after their removal, has currently

been strongly discouraged. Most of the victims (71.1%)

received the ASVbetween 1 to 6 hours after the bite followed

by 13.2% of cases within 1 hour of the bite. Other studies also 13, 24,26,28,29showed comparable results. In the present study 42.1%

of cases were survived between 1 to 3 days. As our study was

conducted in the tertiary care centre the duration of treatment

and the services attributed to the increased survival duration.

These results were analogous to other studies where mean

hospital stay in snake bite victims was 6 days with ranges from 1,13,18,241 to 26 days.

CONCLUSION:

Snakebite remains a significant cause of accidental deaths in

this modern era and its occurrence is usually underestimated. It

is considered an occupational hazard and it can be easily

prevented by simple health education among the high-risk

population especially those working in agricultural fields,

plantations and other outdoor activities. It can also be termed

as a disease of poverty endemic to the geographical

distribution of farming and its related activities. The present

study highlights the various facets of demographic data on the

fatal cases of snakebite. It shows that snake bites were more

common in rural areas and among people who were engaged in

agricultural fields. Males were affected the most and lower

limbs were bitten in the majority of cases. Most of the

traditional methods for the first aid treatment of snakebite have

been found to affect more harm than good. The immobilization

and the quick transport of the victims to the hospital, along with

the early administration of ASV will reduce the morbidity and

the mortality in near future.

Conflict of interest: None

Funding: None

Ethical approval: Obtained from Institutional Ethics

Committee.

REFERENCES:

1. Anjum A, Husain M, Hanif SA, Ali SM, Beg M, Sardha M.

Epidemiological profile of snake bite at tertiary care

hospital, north India. J Forensic Res. 2012;3(4):201-5.

2. Organic Irritant Poisons. In: Pillay VV. Modern medical

toxicology. 4th ed. New Delhi: Jaypee Brothers Medical

Publishers; 2013; p. 145-56.

3. World Health Assembly. Addressing the burden of

snakebite envenoming [Internet]. Geneva: 2018 [updated

24th May 2018;cited 06th August 2018]. Available from

http://www.who.int/neglected_diseases/news/Snakebite-

envenoming-mandate-global-action/en/

4. Mohapatra B, Warrell DA, Suraweera W, Bhatia P,

Dhingra N, Jotkar RM, et al. Snakebite mortality in India:

a nationally representative mortality survey. PLoSNegl

Trop Dis. 2011;5(4):e1018.

5. National Crime Records Bureau Ministry of Home

Affairs. Accidental deaths and suicides in India 2015

[Internet]. [Cited 2018 Feb 21]. Available from:

http://ncrb.gov.in/StatPublications/ADSI/ADSI2015/cha

pter-1%20accidents.pdf

6. Rao CP, Shivappa P, Mothi VR. Fatal snake

bitessociodemography,latency pattern of injuries. J Occup

Med Toxicol.2013 Mar 25;8(1):1.

7. Snow RW. The prevalence and morbidity of snake bite and

treatment-seeking behaviour among a rural Kenyan

population. Ann Trop Med Parasitol 1994;88:665-71.

8. LeiteRde S, Targino IT, Lopes YA, Barros RM, Vieira AA.

Epidemiology of snakebite accidents in the municipalities

of the state of Paraíba, Brazil. CienSaude Colet. 2013;

18(5):1463-71.

9. Lal P, Dutta S, Rotti SB, Danabalan M, Kumar A.

Epidemiological profile of snakebite cases admitted in

JIPMER hospital. Indian J Community Med. 2001;

26(1):36-8.

112


10. VenkataRaghava S, Sumangala C N. Study of deaths due

to snake bite. J SIMLA. 2017; 9(1):48-50.

11. Bhargava S, Kaur R, Singh R, Epidemiological profile of

snake-bite cases from Haryana: A five year (20112015)

retrospective study. J Forensic Leg Med. 2018; 54:0913.

12. Majumder D, Sinha A, Bhattacharya SK, Ram R,

Dasgupta U, Ram A. Epidemiological profile of snake bite

in South 24 Parganas district of West Bengal with focus on

underreporting of snake bite deaths. Indian J Public

Health 2014; 58:17-21.

13. Halesha BR., Harshavardhan L, Lokesh A,

Channaveerappa P, Venkatesh K. A study on the clinico-

epidemiological profile and the outcome of snake bite

victims in a tertiary care centre in Southern India. J

ClinDiagn Res. 2013; 7(1):1226.

14. Bayapa Reddy N, Magesh B, Singh RK, Pallavi M,

Nagarjuna Reddy. Factors affecting the snake bite and

health seeking behavior of snake bitten individuals of

Madurai district, Tamilnadu. Nat J Res Com Med.

2012;1(2).

15. Manigandan G, Selvaraj T, Epidemiological Profile of

deaths due to snake bite at Tertiary care Hospital, South

India. Indian Journal of Forensic Medicine & Toxicology.

2016; 10(2):155-8.

16. Vijay Kautilya D, Shruti P Hegde , Guru Raghavendra.

Study of Snake Bite and Factors Influencing Snake bite

among the rural population of Kancheepuram District. J

Punjab Acad Forensic Med Toxicol 2019;19 (2).

17. Navinkumar M. Varma&P.R.Kulkarni: Postmortem study

of snake bite cases. Int J Current Med Applied Sci. 2017;

16(2):110-16

18. Farooqui JM, Mukherjee BB, Manjhi SN, Farooqui AA,

Datir S. Incidence of fatal snake bite in Loni, Maharashtra:

An autopsy based retrospective study (20042014). J

Forensic Leg Med. 2016; 39:61-4.

19. Sharma R, Dogra V, Sharma G, Chauhan V. Mass

awareness regarding snake bite induced early morning

neuroparalysis can prevent many deaths in North India.

Int J CritIllnInj Sci. 2016; 6:1158.

20. Srivastava A, Gupta A, Singh KS. Epidemiological profile

of snake bite at tertiary care hospital, East India. Int J Adv

Med. 2017; 4(5):1422-8.

21. Logaraj M, Thirumavalavan R, Gopalakrishnan S.

Epidemiology of snakebite reported in a Medical College

Hospital in Tamil Nadu. Int J Health Allied Sci. 2013;

2:53-5.

22. Paudel KM, Poudyal VP, Rayamajhi RB, Budhathoki SS.

Clinico-epidemiological profile and outcome of

poisonous snake bites in children using the WHO

treatment protocol in western Nepal. J Nobel Medical

College. 2016; 4(1):21-5.

23. Kularatne SA. Epidemiology and clinical picture of the

Russell's viper (Daboiarusseliirusselii) bite in

Anuradhapura, Sri Lanka: a prospective study of 336

patients. Southeast Asian J Trop Med Public Health. 2003;

34(4):855-62.

24. Mohankumar P, Sivagurunathan C, Umadevi R. Study on

the clinico-epidemiological profile and the outcome of

snake bite victims in a rural health centre in

Kancheepuram district, Tamilnadu. Int J Pharm Bio Sci.

2015; 6(2):544-50.

25. Thapar R, Darshan BB, Unnikrishnan B, Mithra P, Kumar

N, Kulkarni V, et al. Clinico-epidemiological profile of

snakebite cases admitted in a tertiary care centre in South

India: A 5 years study. Toxicol Int. 2015; 22:66-70.

26. Jayakrishnan MP, Geeta MG, Krishnakumar P, Rajesh TV,

George B. Snake bite mortality in children: beyond bite to

needle time. Arch Dis Child. 2016; 102:445-9.

27. Suchithra N, Pappachan J M, Sujathan P. Snakebite

envenoming in Kerala, South India: clinical profile and

factors involved in adverse outcomes. Emerg Med J.

2008; 25:20004.

28. Ahmed SM, Nadeem A, Islam MS, Agarwal S, Singh L.

Retrospective analysis of snake victims in Northern India

a d m i t t e d i n a t e r t i a r y l e v e l i n s t i t u t e . J

AnaesthesiolClinPharmacol. 2012; 28(1):45-50.

29. Sarkhel S, Ghosh R, Mana K, Gantait K. A hospital based

epidemiological study of snakebite in PaschimMedinipur

district, West Bengal, India. Toxicology Rep. 2017; 4:415-

90.

30. Mishra A, MohantySN ,Rastogi P. A Study on Snake Bite

Poisoning in a Tertiary Care Hospital in Rural Odisha,

India. J Punjab Acad Forensic Med Toxicol 2019;19(1).

113


114



1. Shalvi Upadhyay, Ph.D. Scholar, Galgotias University, Greater Noida and Assistant Professor & Course Coordinator

(Forensic Science), Sharda University, Greater Noida, India

2. Lalit P. Chandravanshi, Ex. Assistant Professor, Galgotias University, Greater Noida, India

Key words: Forensic Science, Disguise Handwriting, Handwriting Characteristics, Forensic Experts, Occupations


Shalvi Upadhyay,

Ph.D. Scholar,

Galgotias University, Greater Noida and Assistant Professor

& Course Coordinator (Forensic Science), Sharda University,

Greater Noida, India

Contact : +91 98188-10892


Article History :




Available online : 31August 2021

INTRODUCTION:

Disguise handwriting is deliberate change of ones handwriting

from its normal handwriting, which is used for some criminal

act or to hides its own identity while doing any wrongful act. It

is activity in which persons needs to supress the habit of (1)writing . When we talk about disguise then we generally look

for the formation of letters which most of the people try to

changes but they focus less on the characteristics like

alignment, pen-pressure, slant, speed etc. which is not very

easy to disguise. Forensic document examiners also mainly

give their opinion in form of simulation or disguised instead of (2)giving their opinion on authorship . One of the studies shows

that if a person is writing its genuine signature, disguised

signature and forged signature then there will be significant

change in velocity, size and pen pressure also said on

comparison of genuine signature with any one of the other

category of signature at least one parameter shows

(3)differences . In another study it is also been shown that

Structural features of handwriting extracted from three

character 'd', 'y', 'f' and grapheme 'th' and the study shows more

discrimination were found in grapheme 'th' then other single

characters i.e the differences in handwriting depends on the (4)adjacent characters also .

In the present study the disguised samples of forensic experts

were analysed with the help of different instruments like (5) (6)DocuCentre Nirvis (PIA 7000) , Docubox HD(PIA 7000)

and it is done to know that the knowledge related to disguise

and their occupation will affect the persons act of disguise or

whether it will show some kind of similarity in the particular

occupation when they disguise their handwriting.

MATERIAL & METHODS :

Handwriting samples were collected by 100 Forensic experts

by taking their original writing of London letter paragraph and

again at same time told them to disguise their writing on the

Forensic Examination of Forensic Expert's Disguise Handwritings

ABSTRACT :

Introduction: Disguise handwriting is change of handwriting for hiding the identity of writer. This is only done for some mean

purpose. In present study disguise handwriting of forensic experts were analysed and seen the similarities in particular occupation

while disguising their writing and also their occupational impact on the act of disguise handwriting.

Material and methods: In this study 100 original and 100 disguise handwriting samples were taken from the forensic experts and

analysed on the basis of different handwriting characteristics & also with the help of different instruments like Docubox HD,

Docucenter Nirvis etc.

Result: After comparison and analysis, it is found that mostly the experts emphasised on disguise of skill and letter formation i.e.

73% and 79% of experts which shows the impact of their occupation as being a forensic expert they know these two characteristics

are having much values in examination. Whereas, there are very few who are able to disguised their alignment and slant i.e. 28%

and 16%.

Conclusion: This study shows that instead of having a knowledge of disguise writing no one is able to fully change their writing as

their sub-conscious habit cannot be supressed fully also due to high number of people emphasized in changing their skill and

formation of letters shows impact of their occupation while disguising their handwriting.

next paper as per their best knowledge about disguise without

seeing their original writings and give samples in running

writing as shown in below images:

And then these samples were analysed on the basic

characteristic of disguise i.e. Alignment, spacing between

words and lines, Pen pause, skill, different formation of letters,

slant, pen pressure and skill. Apart from this it has also been

analysed that which letters were most commonly disguised by

forensic experts.

Instrumental analysis- Some of the instruments are also used

i.e. DocuCentre Nirvis, Docubox HD and Magnifying glass.

RESULTS :

When we compared and analysed these 100 sample of original

handwriting with their 100 disguised handwritings shown few

of them in below images.

After analysis the below table shows the percentage of experts

who are able to disguise their handwriting and which

characteristics were disguise by the experts most.

The table 1 shows that these forensic experts who are well

known to the disguise characteristic were more emphasised in

disguising skill and formation of letters which may lead to

change the opinion as skill cannot be changed very easily and

change in formations of letter may also lead to negative

opinion while examination. So, it is found that skill and

formation of letter disguised by 73% & 79% of experts. Apart

from that most of them were also disguised their speed, pen-

pressure as we can see in above table. But it has been found that

most of them given lots of pen pauses during writing of

paragraph which is one of the important characteristics of

analysing disguise handwriting. It has also been found that

instead of knowing all the rules of disguise very less were able

to disguise their alignment, spacing and slant i.e.28%, 46% and

16% which again proof the sub-conscious act of writing and

writing cannot be changed fully until a serious effort has been

115

Fig1: Original writing

Fig2: Disguised writing

Fig3: Docucenter Nirvis

Fig:4 Docubox HD


done. When we see the letters which the experts were focussed

to change are mostly 's', 'D', 'B', 'H', 'a', 'g', 'f', 'w', 'N', 'q', 'L', 'R',

'J', 't', 'm', 'n' and very few were able to change the letter 'o'

which is having very less scope to change in formation.

DISCUSSION :

Handwriting is something which at one focus shows the exact (7)personality and nature of person . It is something which tells

us the mental ability of person and also states of mind. When

we see for the disguise of handwriting a study has been done in

which it is shown that if a person is using secondary hand for

disguising their handwriting many letters show similar (8)formation due to subconscious act of handwriting . In other

study on the basis of statistical method 'Pearson chi square'

estimated the common characteristic of handwriting which can

be changed during the process of disguise and it concluded that

all the class characteristic can be changed except the spacing (9)between the words which shows consistency . But one of the

study also claim that if expert pen men penmen can produce

very skill stimulated writing of model then a normal layman

and even it can be difficult for Forensic handwriting examiner (10)to identify . In this study it is found that some of the experts

disguised their writing so well that it is difficult to give opinion

on them at one look but when we see it in context of each

characteristic of handwriting which were considered for

analysis then none of the expert able to fully disguise their

writing but due to their knowledge about disguise and

handwriting examination they disguised mostly to the

characteristic which plays most important part at the time of

examination and framing a report. So, this shows the impact of

their profession at the time of act of disguise.

CONCLUSION :

In this study disguise handwriting has been taken from the

Forensic experts who are well known to all rules of hiding their

handwritings and after analysis it has been found that they used

the most important characteristic to disguise which they

analyse first at the time of giving opinion and also which can

change opinion i.e. skill and formation of letters. Apart from

that most of them were disguised their speed, pen-pressure etc,

but instead of knowing every point of disguise writing they are

unable to change their alignment and slants which shows that

the sub-consciousness overlaps on consciousness and they

unable to hide their writing perfectly. Hence, after analysis of

samples of forensic expert's disguise handwriting it is found

that in their samples impact of their occupations are also found

and except the two characteristic which we have considered for

analysis they are able to disguised each of them very easily.

Also, some of the letters which are mentioned above they all

used that common letters only to change the formation.

Conflict of Interest: No potential conflict of interest reported

by the authors.

Source of funding : NIL

REFERENCES :

1. Kelly J, Lindblom B. What is forensic document

examination? Scientific Examination of Questioned

Documents: Boca Raton, FL, CRC/Taylor & Francis;

2006. p. 65.

2. Bird C, Found B, Ballantyne K, Rogers D. Forensic

handwriting examiners' opinions on the process of

production of disguised and simulated signatures.

Forensic Science International. 2010;195(1-3):103-7.

116

Alignment

Speed

Pen pressure

Pen Pause

Skill

Difference in formation of letter

Spacing

Slant

28%

67%

61%

61%

73%

79%

46%

16%

Percentage of Forensic

Expert disguised

Characteristic of handwriting

Table 1


3. Mohammed LA, Found B, Caligiuri M, Rogers D. The

dynamic character of disguise behavior for text‐based,

mixed, and stylized signatures. Journal of forensic

sciences. 2011;56:S136-S41.

4. Pervouchine V, Leedham G. Extraction and analysis of

forensic document examiner features used for writer

identification. Pattern Recognition. 2007;40(3):1004-13.

5. Projectina. Docucenter Nirvis 2020 [cited 2020 07].

Av a i l a b l e f r o m : h t t p s : / / w w w. a s s i n g . i t / w p -

content/uploads/2017/04/dc_nirvis.pdf.

6. Ultra. Docubox Hd 2020 [cited 2020 07]. Available from:

https://www.ultra-forensictechnology.com/en/our-

products/document-examination/docubox-hd.

7. Osborn AS, Osborn AD. Questioned document problems,

the discovery and proof of the facts. 2d ed. Albany, N.Y.,:

Boyd printing company; 1946. xxx, 2, 569 p. incl. front.,

illus. (incl. facsims.) ports. p. 240.

8. Zhen-yi S. Distinguishment and Identification of the

Character of Chinese Handwriting Disguised by Left

Hand. Chinese Journal of Forensic Sciences. 2015(2):11.

9. Mohameda R, Hazira NM, Yongb WK, Ahmada UK,

Mohamadc I. Statistical Examination of Common

Characteristics for Disguised Handwriting amongst

Malaysian. Malaysian Journal of Forensic Sciences.

2011;2:8-15.

10. Dewhurst T, Found B, Rogers D. Are expert penmen better

than lay people at producing simulations of a model

s igna tu re? Fo rens i c s c i ence in t e rna t iona l .

2008;180(1):50-3.

117


118



1. Smitha Rani, Assistant Professor*

2. Vinay J, Assistant Professor*

3. Aravind GB, Associate Professor*

4. Arun M, Professor and Head*

5. Chandrakanth HV, Professor*

*Department of Forensic Medicine and Toxicology, J.S.S Medical College, JSS Academy of Higher Education and Research,

Mysuru, Karnataka, India

Key words: Online learning, Medical Education, COVID 19


Dr. Vinay J,

Assistant Professor

Department of Forensic Medicine and Toxicology, J.S.S

Medical College, JSS Academy of Higher Education and

Research, Sri Shivarathreeshwara Nagar, Bannimantap,

Mysuru-570015, Karnataka, India.

Contact : +91 9740135014


Article History :

Received : 26 September 2020

Received in revised form : 24 March 2021

Accepted on : 24 March 2021


INTRODUCTION :

COVID 19 pandemic has posed a lot of challenges to the

education sector. As a measure to restrain the spread of the

disease, educational institutions across the world are shut

down. As on 16 July 2020, 1,066, 817, 855 learners are affected

and in 107 counties there is countrywide closure of educational [1]institutions. This unprecedented situation brought in the

paradigm shift in the education system. Educational

institutions across the globe had to look out for an alternative

way to engage the students effectively so that the learners are

not denied their opportunity to learn.

The global educational crisis has put emergency remote

teaching into practice. In contrast to the online distance

education which requires planning, designing and

determination of aims to create an effective learning ecology,

emergency remote teaching is a temporary shift of

instructional delivery to an alternate delivery mode due to [2]crisis circumstances.

Emergency remote teaching has become a new norm,

empowering the educators to provide a continuous and

uninterrupted learning experience. Video conferencing

platforms are being used as a mode to conduct live interactive

Students' Perception of Emergency Remote Teaching during COVID -19 Pandemic

ABSTRACT :

Background: In the wake of COVID-19 pandemic all the educational institutions in India have suspended in-campus activities as a

means to curtail the spread of the disease and have embraced online teaching to impart education. Emergency remote teaching has

become a new norm, wherein different learning management systems and video conferencing tools have replaced the classroom

teaching in this unprecedented circumstance.

Objective: This study aimed to assess the students' perception towards emergency remote teaching.

Method: A cross-sectional descriptive questionnaire-based survey was conducted among undergraduate students pursuing MBBS

(Bachelor of Medicine, Bachelor of Surgery) and BSc (Bachelor of Sciences) in Forensic Science who attended live interactive

online classes in June 2020.A pre-tested structured proforma was administered through electronic form. Data collected was further

analyzed for descriptive statistics like mean and percentages.

Results: A total of 123 out of 239 undergraduate medical and biomedical students attending the online classes participated in the

present study. 60.16% of the respondents preferred classroom teaching over the online teaching method and they perceived that

online teaching is less effective than classroom set up. 82.11% of the students reported technical glitches while attending online

classes. Lack of discipline, decreased student-teacher and peer interaction were stated as drawbacks of this method of teaching.

Conclusion: The study suggests that classroom teaching is preferred over emergency remote teaching among undergraduate

students. Online platforms can be utilized to teach as an adjunct to classroom teaching but cannot be considered as a replacement

for traditional teaching methods.

online classes. Synchronous lectures designed to keep to the

same days and times as face to face instruction are a major

factor distinguishing emergency remote teaching from online

education which tends to use asynchronous lecturing allowing [3]learners to get content on their own schedules.

The pandemic has led to an abrupt change in teaching-learning

methods from classroom teaching to emergency remote

teaching. Effectiveness of any teaching method can be judged

based on whether it is oriented to and focused on students and

their learning. Two broadly accepted components of effective

university teaching are, it requires a set of particular skills and

practices as identified by research and that it should meet the [4]requirements of the context in which it occurs. Evaluating the

effectiveness of this relatively unexplored method of teaching

is the need of the hour.

Students' perception of the effectiveness of particular teaching

method can provide valuable input, which is helpful to provide

quality education. As the end recipients, students can provide

vital feedback not only on what they perceive to be appropriate

but also on what they would like to see changed and how it [5]should be changed. Hence a survey was conducted among

undergraduate medical and biomedical students to assess the

effectiveness of this mode of education.


A cross-sectional, descriptive study was conducted among

students studying in their second year of MBBS (Bachelor of

Medicine,Bachelor of Surgery) and 3rd and 5th Semester of

BSc (Bachelor of Sciences) in Forensic Science at a private

medical college in India. Ethical clearance was obtained from

institutional ethical committee prior to the study. Students who

had attended live interactive online classes for two months

duration conducted through Zoom app, which is a

videoconferencing tool were included in the present study.

Students who never attended the live interactive online classes

and who did not wish to participate were excluded. A pre-

designed, pre-tested structured questionnaire was developed.

Electronic questionnaire was created using Microsoft Forms

(Appendix-I). The study was conducted in the month of June

2020. By convenient sampling method, 239 students were

selected for the present study and the said questionnaire was

sent to them through a mobile instant messaging app. Out of

239 students, 123 of them responded to the questionnaire

survey by giving informant consent. Data collected was

analyzed further for descriptive statistics.

RESULTS :

A total of 82 MBBS students and 41 students pursuing BSc in

Forensic Science responded to the questionnaire. The number

of male respondents was 52(42.28%) and females were

71(57.72%) in number. 75(60.97%) students were attending

classes using the mobile phone (Table 1).

The source of internet connection while attending the classes

for 56(45.52%) respondents was cellular data, 22(17.88%)

were relying on WIFI (wireless fidelity)to attend the classes

whereas 45(36.58%) had access to both cellular data and WIFI

to attend the classes. Figure 1 enlists the difficulties faced by

the participants while attending the online classes. Network

issues were stated as a hurdle faced to attend the classes by

101(82.11%) respondents.69(56.09%) students felt that the

distraction was caused due to gadgets used to attend the

classes, such as receiving phone calls and pop-up message

notifications. 40(32.52%) participants perceived that home

environment is not conducive for learning. Health issues such

as headache was reported by 32(26.02%) respondents, which

they attributed to increase in screen time and 18(14.63%)

students reported disturbances due to peers. Connectivity issue

was the major concern reported by the respondents irrespective

of their geographical location (Table 2) while attending the

classes.

119

Table 1 : Type of device used to attend online classes

75

42

5

1

93

20

10

75.60

16.26

8.13

60.97

34.14

4.06

0.81

Type of device

Mobile Phone

Table 2 : Geographical location of the participants while attending the class

Figure 1 : Difficulties Faced while attending Online Classes


Only six participants answered that they did not face any

difficulties while attending online classes. Table 3 indicates

the drawback of online teaching as perceived by the

participants.27(21.95%) students thought that there were no

drawbacks.

74(60.16%) students preferred classroom teaching over live

interactive online classes and 43 (34.95%) respondents

preferred both methods of teaching equally. 41(33.33%)

participants believed that both methods are equally effective.

74(60.16%) of them felt that classroom teaching is more

effective than online teaching (Figure2).

76(61.78%) participants felt that practical classes cannot be

conducted in online mode, 39(31.70%) responded that it might

be possible whereas 8(6.50%) felt that it is possible.

62(50.40%) respondents answered that they would not prefer

to attend the online classes once the pandemic ceases,

23(18.69%) said that they would like to attend such classes

whereas the response of 38(30.89%) was equivocal.

DISCUSSION :

The COVID-19 pandemic has resulted in an unprecedented

change in the method of imparting education. Medical

educators are also adopting to currently available technologies [6]in medical education. Emergency remote teaching methods

are widely used to impact education in medical colleges. Use

of technology in medical education is not devoid of challenges

which need to be addressed to obtain the desired outcome and [7]impact. Students' perception of a particular teaching method

is useful in determining its impact. Hence, we carried out this

survey to learn the students' preferences, determine the

difficulties faced by them and drawbacks if any in this method

of teaching.

Out of 123 respondents in the present study, 75 of them used

mobile phones to attend the live interactive online classes

followed by a laptop which was used by 34.14% of the study

population. Findings of the present study are in concurrence

with results of a Pakistani study who found 75.7% of the

students of the medical and dental stream used mobile phones

for their e-learning followed by a laptop which was used by [8] 21.2% of the students. Our findings were in contrast to the

study conducted by Murphy A et al on Australian student

population, who found that the dominant technology used to

support learning was a laptop which was used by 85% of the [9]respondents. In research conducted at Lancaster Medical

School, the authors concluded that their students seldom used [10] smart phones for learning. The disparity of findings between

our study and those conducted in the western world could be

because most of the medical universities in the United States

and the United Kingdom provide their medical students with

laptop/ tablet as an institutional policy to support their [11-12]studies.

In a study conducted on students' perception on the practice of

long-distance learning, the researchers noted that 40% of the

study population used a combination of cellular data and WIFI

to connect to the internet during long-distance learning, 31.9%

relied on cellular data only and 28.1% of them had access to [13]only WIFI. Participants using only WIFI to connect to the

classes was the least in our study, which is comparable to the

former study however we found that most of our students

(45.52%) relied on cellular data to attend the classes. Hence the

chance of losing network connectivity is higher in the absence

of an alternate source of internet. The success of e-learning is

dependent upon internet connectivity. Lower speed or [14] interruptions lead to sub-optimal use of this modality.

Although the majority of the study subjects (75.60%) hailed

from different cities across India, the unstable network was

reported as a hindrance for attending the online classes by

82.11% of the participants. A similar report was given by QS

I·GAUGE student survey involving 7594 Indian students,

which revealed that connectivity and signal issues are the most

prevailing problem while attending online classes. As per the

said survey, the infrastructure in terms of technology in India

has not achieved a state of quality to ensure sound delivery of

online classes to students across the country. Technology

enablers and telecom companies need to scale up their services

120

Table 3 : Drawback of online teaching as perceived by the participants

Teacher-studentinteraction is less

Frequency* (n=123)

*Multiple Responses

Lack of discipline

Lack of peerinteraction

55

55

51

44.7

44.7

41.5


[15]for effective online learning.

Lack of concentration due to gadget distraction had been

reported by 56.09% of respondents. Attia NA et al have

reported that the pop-up messages in laptops have been found

to reduce students' performance and increase the number of

errors. Even with the use of mobile phones students get easily

distracted by the text messages and feel the urge to reply [16] instantly. In a study conducted at Chile to assess the strengths

and weaknesses of digital education in orthopaedic programs,

the challenge noted by the researchers was the necessity to

obtain a conducive learning environment at home, avoiding

the distractions that usually are not present in the classroom set [17] up. Absence of a favourable learning environment at home

has been expressed by 32.52% of the participants in the present

study.

In a study conducted to investigate the association of excessive

screen time exposure and headache in young adults, the

authors reported that high levels of screen time exposure are

associated with migraine in young adults. No significant 18association was found with the non-migraine headache. In the

present study, 26.01% of the students reported health concerns

such as headache as a difficulty faced while attending the

online classes. Since the live interactive online classes

conducted in our setup lasts for the maximum of 3 hours per

day and some days it is even lesser, the headache cannot be

attributed to the classes alone because we do not have the

information regarding their overall screen exposure per day.

Distraction due to peers is reported to be the least, which was

expressed by 14.63% of the students. Unlike classroom

teaching, this could be very well addressed in live interactive

online classes conducted through videoconferencing tools

such as Zoom application. The host of the meeting, which is

usually the faculty engaging the classes, has the control to mute

the participants and restrict the chat between them. Hence the

distractions due to peers can be reduced to the bare minimum.

Interaction is one of the most important components of

teaching and learning experiences. In a study conducted at

Indonesia Open University, Taiwan branch, face to face

learning was perceived to have a more social presence, social

interaction, and satisfaction in comparison to online [19] learning. Lack of interaction between the teacher and

students was reported to be the drawback of emergency remote

learning by 44.71% of respondents and 41.46% opined that

there is lack of peer interaction. Although in live interactive

online classes, the interaction between the teacher and students

and amongst the peers is possible utilizing chats and face to

face interaction, it becomes difficult if a larger group of

students are to be catered for.

Lack of discipline has been perceived as a drawback of remote

learning by 44.71% of the students in the present study. Self-

discipline is considered to be a key indicator to improve

learning outcomes in an e-learning environment. Course

instructors should take initiatives to motivate the students and

is also dependent on the ability of the teacher to maintain the [20]discipline in the most democratic form.

60.16% of the participants in the present study preferred

classroom teaching and found it more effective than

emergency remote teaching. Similar findings were expressed [8,19] by certain other researchers. If the shortcomings of this

method of teaching are adequately addressed and when both

teacher and students become more experienced in this mode of

instruction, the perception towards it might change.

76(61.78%) participants felt that practical classes cannot be

conducted in online mode. Despite the undoubted advantage of

IT and simulation-based education, in the current situation,

there are distinct disadvantages. The foremost is the fact that all

these tools can be supplemental to clinical teaching but not a

replacement. Clinical teachings are best-learnt bedside with a

"live" patient. Not only does the medical student get a first-

hand experience of patient's clinical findings but also learns

about the dynamics of patient interaction, psychology and [21]counselling.

50.40% of the respondents in our study answered that they

would not prefer to attend the online classes once the pandemic

ceases. This is in accord with the findings of the study 17conducted at Chile. These findings infer that classroom

teaching is still perceived to be an irreplaceable component of

medical education.

Limitations of the study:

The present study was conducted on small sample size and the

study population was drawn from a single medical institution

hence the perceptions expressed may not be reflective of the

entire student population.

CONCLUSION :

Although emergency remote learning is helping the educators

and learners to tide over the present pandemic situation, the

results of the present study suggest that undergraduate medical

and biomedical students still value classroom teaching as a

means of learning. Hence, we conclude that online platforms

can be utilized to teach as an adjunct to classroom teaching but

cannot be considered as a replacement for traditional skill

imparting teaching methods.

REFERENCES :

1. UNESCO. COVID-19 Impact on Education. Available

from: https://en.unesco.org/covid19/educationresponse.

(Accessed 17 July 2020).

121


devices in the clinical setting and the influence of patients.

BMC Med Educ 2019, 19:376.

13. Daroedono E et al. The impact of COVID-19 on medical

education: our students perceptionon the practice of long

distance learning. Int J Community Med Public Health.

2020 Jul;7(7):2790-2796.

14. Dhir SK, Verma D, Batta M, Mishra D. E-learning in

medical education in India. Indian Pediatr 2017; 54:871-7.

15. QS. I GAUGE.COVID-19: A wake-up call for Indian

I n t e r n e t S e r v i c e P r o v i d e r s . Av a i l a b l e

from:https://www.igauge.in/news/2020/4/covid-19-a-

wake-up-call-for-indian-internet-service-providers.

(Accessed 24 July 2020).

16. Attia NA, Baig L, Marzouk YI, Khan A. The potential

effect of technology and distractions on undergraduate

students' concentration. Pak J Med Sci. 2017;33(4):860-

865. https://doi.org/10.12669/pjms.334.12560.

17. Figueroa F, Figueroa D, Calvo-Mena R, Narvaez F,

Medina N, Prieto J. Orthopedic surgery residents'

perception of online educationin their programs during the

COVID-19 pandemic: should it be maintained after the

c r i s i s ? A c t a O r t h o p a e d i c a 2 0 2 0 ; D O I :

10.1080/17453674.2020.1776461.

18. Montagni I, Guichard E, Carpenet C, Tzourio C, Kuth T.

Screen time exposure and reporting of headaches in young

adults: A cross-sectional study.Cephalalgia. 2016; 36

(11):1020 1027.

19. Bali S, Liu MC.Students' perceptions toward online

learning and face-to-facelearning courses.J. Phys.: Conf.

Ser 2018;1108 012094. doi :10.1088/1742-

6596/1108/1/012094.

20. Gorbunovs A, Kapenieks A, Cakula S.Self-discipline as a

key indicator to improve learning outcomes in elearning

environment. Procedia - Social and Behavioral Sciences

2016; 231:256- 262.

21. Sahi PK, Mishra D, Singh T. Medical education amid the

COVID-19 pandemic . Ind ian Ped ia t r.2020;

https://www.indianpediatrics.net/COVID29.03.2020/SA

-00181.pdf.

2. Hodges C, Moore S, Lockee B, Trust T, Bond A. The

Difference Between Emergency Remote Teaching and

O n l i n e L e a r n i n g . A v a i l a b l e f r o m :

https://er.educause.edu/articles/2020/3/the-difference-

between-emergency-remote-teaching-and-online-

learning . (Accessed 19 July 2020).

3. Gurung RAR. Pandemic Pedagogy: Will Remote

Te a c h i n g I m p r o v e E d u c a t i o n ? Av a i l a b l e

from:https://www.psychologytoday.com/us/blog/the-

psychological-pundit/202004/pandemic-pedagogy-will-

remote-teaching-improve-education. (Accessed 19 July

2020)

4. Devlin M, Samarawickrema G. The criteria of effective

teaching in a changing higher education context. Higher

Education Research & Development 2010;29(2): 111-

124. https://doi.org/10.1080/07294360903244398.

5. Govender SM. Students' perceptions of teaching methods

used at South African higher education institutions. South

African Journal of Higher Education 2015; 29 (3) :23-41.

6. Goh P, Sandars J. A vision of the use of technology in

medical education after the COVID-19 pandemic. Med

Ed Publish 2020; 9:49.

7. Saiyad S, Virk A, Mahajan R, Singh T. Online teaching in

medical training: Establishing good online teaching

practices from cumulative experience. Int J App Basic

Med Res 2020; 10:149-55.

8. Abbasi S, Ayoob T, Malik A, Memon SI. Perceptions of

students regarding E learning during COVID 19 at a

private medical college. Pak J Med Sci. 2020 May; 36

(COVID19- S4): S57- S61.

9. Murphy A, Farley H, Lane M, Hafeez-Baig A, Carter B.

Mobile learning anytime, anywhere: What are our

students doing? Australasian J Inf Syst. 2014;18(3)

doi:10.3127/ajis.v18i3.1098.

10. Curtis F, Cranmer S. “Laptops are better”: Medical

students' perceptions of laptops versus tablets and

smartphones to support their learning. In: Bayne S, Jones

C, de Laat M, Ryberg T, Sinclair C., (Eds.) Proceedings of

the 9th International Conference on Networked Learning.

2014:6775.

11. Mathis J.Yale gives iPads to med school students.

Available from:

https://www.macworld.com/article/1162076/yale_gives_

ipads_to_med_school_students.html. (Accessed 23 July

2020).

12. Clarke, E., Burns, J., Bruen, C. et al. The 'connectaholic'

behind the curtain: medical student use of computer

122


123

Appendix-I (Questionnaire)

1. Please specify your gender.

2. Your geographical location while attending online classes

(Please specify the name of the village, taluk, district and

state wherever applicable)

3. What gadget do you use to attend the online classes?

· Desktop · Laptop

· Mobile phone · Table

4. What is your source to connect to the internet?

· Cellular data only

· WiFi only

· Both

5. Which method of teaching do you prefer?

· Classroom teaching · Online Teaching

· Equally prefer classroom and online teaching.

6. How do you rate the effectiveness of online teaching in

comparison with classroom teaching?

· Equally · Less · More

7. What difficulties do you face with this form of education?

(A multiple response question)

· Health concerns due to increased screen time (Please

specify the health issue)

· Lack of concentration due to gadget/ home

distraction

· Network issues

· Home environment is not conducive for learning

· Disturbance due to peers

· None of the above

8. What according to you are the drawbacks of online

classes? (A multiple response question)

· Lack of peer interaction

· leads to lack of discipline

· Teacher - student interaction is less

· No drawbacks.

9. Do you believe practical classes can be conducted in

online mode?

· Yes · No · Maybe

10. After the pandemic is over, would you prefer to attend the

online classes?

· Yes · No · Maybe


124



1. Gurmeet Kaur Brar, Associate Professor*

2. Vineet Jalota, Senior Resident*

*Department of Psychiatry, Adesh Institute of Medical Sciences and Research ,Bathinda

Key words: Externalizing symptoms, Internalizing symptoms, Drug abuse violence


Dr. Vineet Jalota,

Senior Resident

Department of Psychiatry, Adesh Institute of Medical

Sciences and Research ,Bathinda

Contact : +91 7986509403


Article History :





INTRODUCTION :

Harmful use of psychoactive substances acts as a leading risk

factor for population worldwide and causes impact on health

related targets of sustainable development goals(SDGs)

including those for non communicable diseases, maternal and

child health, injuries, poisonings and mental health. The

effects of alcohol consumption on mortality are greater than

those of tuberculosis (2.3%), HIV/AIDS (1.8%), diabetes (1)(2.8%), road injuries (2.5%) and violence (0.8%). Alcohol

and other psychoactive substances when abused affect the

personal, social, economic, and occupational domains

significantly, with many suffering from psychotic disorders,

mood disorders, and a few among committing deliberate self-(2)harm. These substances affect cognition and perception

profoundly, impairing their ability to exercise control over (3) substance taking behaviour. Recent studies have

demonstrated a significant portion of Disability Adjusted Life (4)Years(DALYs) and years lived with disability. Drugs of

abuse can range from stimulants causing psychomotor

agitation, euphoria to benzodiazepines causing disinhibition

leading to recreational ,self medication misuse. Crimes

committed by substance abusers usually focus on stealing,

burglary, shoplifting ,matters related to finance substance (5,6)use. Symbolically crime and violence have become major

cause of mortality and morbidity in patients with injectable (7)drug use. Specially for intimate partner violence(IPV)

psychoactive substance abuse has been seen as an considerable (8)risk factor. Violence has been found to influence

neurobiological pathways related to threat perception,

potentially altering the response not only in the presence but in (9)the absence of the threat on daily basis. Externalizing and

internalizing symptoms both pose an independent risk factor

for substance use as they confer risk of likelihood of alienation

from institutions like school ,prosocial peers and increased

tendency to self medicate which is enhanced by negative (10,11)reinforcement of pharmacological use. Alcohol weakens

cognitive controls and allows for dominant cues and dominant (8)response options to have a stronger influence on behavior.

Relationship of mental illness and violence has a significant (12,13)impact on mental health policy in guiding allocation of

(14-16)limited resources and imposing mandatory treatment to

recognize and protect public health safety at the expense of (17-20)patient's liberty. Previously quantitative correlation have

been studied, keeping in the view paucity of published

Association of alcohol and psychoactive substances use with Mental Health Symptoms, crime and violence

ABSTRACT :

Introduction: Harmful use of psychoactive substances acts as a leading risk factor for population worldwide. Violence has been

found to influence neurobiological pathways related to threat perception, potentially altering the response. Externalizing and

internalizing symptoms both pose an independent risk factor for substance use as they confer risk of likelihood of alienation from

institutions like school ,prosocial peers and increased tendency to self medicate

Materials and Methods: A cross sectional study on 82 consenting patients between 19-65 years of age was undertaken for 3

months at a tertiary care centre. The aim of the study was to assess association between mental health symptoms, alcohol and

psychoactive substance abuse and crime and violence.

Results and Conclusions: Variables externalizing symptoms and crime and violence were positively correlated to psychoactive

substance abuse.

qualitative data this study to assess association of mental

health symptoms, drug abuse, crime and violence was

undertaken.


A cross sectional study of 82 consenting participants was

undertaken for 3 months between October 2020 to January

2021 at a tertiary care hospital in North India by purposive

sampling. Patients of either sex meeting criteria in

International Classification of Diseases(ICD-10) for substance

use disorder as currently using the substance between 19-65

years of age and who gave written informed consent were

included. Patients who had Organic brain syndrome like

delirium, dementia, seizures, intellectual disability were

excluded from the study. Modified Kuppuswamy scale was

used to collect the socio-demographic details of the patients.

Global Appraisal of Individual Needs- Short Screener (GAIN-

SS)- The instrument measuring 23 symptoms of behavioral

health disorders and when did the these behaviours occur the

last time (never, more than a year ago,4-12 months ago or last

month) which provides as the core on the severity of the

individual in 5 areas: internalizing symptoms, externalizing

symptoms (which comprises the mental health area),substance (21)use, crime and violence and total severity was used.

Statistical analysis was done using Statistical Package for

Social Sciences(SPSS)20.0 version.To verify the associations

between the variables of symptoms and related problems in the

areas of use of alcohol and other drugs, mental health,crime

and violence, univariate and multiple ordinary least squares regression models (Ordinary Least Squares- OLS) werecarried

out. It was analyzed, as dependent variables, the symptoms

related to the use of psychoactive substances, and as

independent variables: symptoms related to mental health

(which includes internalizing and externalizing symptoms),

problems related to crime and violences with which the patient

may be involved).

Ethical Committee approval was taken.

RESULTS :

All patients were male,with majority being within 31-40 years

of age. Most of them were Hindu and belonged to rural

population area. Majority of them were semi-skilled workers,

studied till high school and were married. Most of them were

earning between 1803-8988 monthly and lived with spouse

and children.(Table 1)

Table 2 shows that the symptoms most commonly reported by

patients were internalizing symptoms among symptoms of

mental health (4.40 symptoms on average).

Table 3 shows that, in relation to the dependent variable, the

variables externalizing symptoms and crime and violence

were significant. These variables, which have value p≤0.5,

were included in the multiple model. The univariate models

indicate which variables should be explored in the multiple

model, to verify the correlation.

Table 4 shows that in the multiple model , the variables

externalizing symptoms (p<0.031) and crime and violence

(p<0.001) remained significant. It was observed that the

variables externalizing symptoms and crime and violence were

positively correlated regarding the symptoms related to the use

of substance use. This shows that the greater the report of

externalizing symptoms and problems related to crime and

violence, the greater the number of symptoms related to the use

of substance use they have.

125

Table 2: Characteristics of Study Participants

Variables

IDSCR

WDSCR

SDSCR

CVSCR

TDSCR

Mean

4.40

3.90

4.79

4.33

17.46

LB

4.06

3.49

4.61

3.99

16.62

U.B

4.75

4.32

4.98

4.67

18.31

5

5

5

5

20

1.58

1.88

0.84

1.56

3.84

0

0

0

0

3

6

5

5

6

21

MedianStd.

Deviation Min Max95% Confidence

Interval for Mean

Table 3: Univariate linear regression models for symptoms related to the use of substance use

P-value

<0.001

0.137

<0.001

0.015*

<0.001

<0.001*

<0.001

0.190

t

16.009

1.503

20.740

2.481

15.136

4.458

14.645

-1.322

Std. Error

0.275

0.059

0.209

0.048

0.248

0.054

0.359

0.010

4.403

0.088

4.326

0.120

3.753

0.240

5.251

-0.013

Variable

(Constant)

IDSCR

(Constant)

EDSCR

(Constant)

CVSCR

(Constant)

AGE

Unstandardized Coefficients (B)


126

DISCUSSION :

The results state that with the increase in reporting of

externalizing symptoms, symptoms related to crime and

violence, the increase in reporting of symptoms related to

substance use is also observed.

Various studies have shown that most often psychiatric

diagnosis associated with co-occuring substance use disorder ( 2 2 , 2 3 )are mood,anxiety and personality disorders.

Epidemiological Catchment area study(ECA) reported

substance use disorder to be comorbid with wide range of

psychiatric disorders such as schizophrenia, bipolar affective (24)disorder, anti social personality disorders etc. Patients with

comorbidity were associated with earlier onset of substance (25)use, greater severity and functional impairment.

A study by Crowley et al found out that externalizing

symptoms and substance use involvement were correlated, (26)which is similar to results of our study. Hawkins et al found

that behavior problems including both internalizing and (27)externalizing symptoms precede and escalate substance use.

King et al showed similar association between externalizing

disorder like conduct disorder and psychoactive substance use (28)in their study.

Many studies have documented higher rates of violence among (29-31)patients with injectable drug use .The relationship between

violence and psychiatric disorders has been studied for over 2

decades and the most significant contributor has been use of

psychoactive substance use which is similar to our study in

which in multivariate analysis substance use and symptoms of (32)crime and violence are positively correlated. Drug use

associated increase in violence has been shown to be mediated

by person specific characteristics such as harsh discipline, lack (33-35) of parental supervision. The association between alcohol,

drug use and intimate partner violence (IPV) has been seen in (36-42)many studies.

Results obtained bring focus towards treatment programmes

for substance use disorders, identification of psychiatric

comorbidities, violent behavior and partner violence in

communities. It would enhance treating of two problems

simultaneously .

CONCLUSION :

Statistically significant correlation between symptoms of

externalizing disorder, crime and violence and psychoactive

substance use is present which enhances the need for

interdisciplinary and intersectorial interventions .

REFERENCES:

1. WHO. Global status report on alcohol and health. Geneva:

World Health Organization; 2018

2. Rather YH, Bashir W, Sheikh AA, Amin M, Zahgeer YA.

Socio-demographic and Clinical Profile of Substance

Abusers Attending a Regional Drug De-addiction Centre in

Chronic Conflict Area: Kashmir, India. Malays J Med Sci.

2013;20(3):31-38.

3. Gallassi AD, Alvarenga PGd, Andrade AGd, Couttolenc BF.

The cost of problems caused by alcohol abuse. Rev

PsiquiatrClín. 2008;35(supl 1):6.

4. Chisholm D, Saxena S, Ommeren Mv, World Health

Organization. Dept. of Mental Health and Substance Abuse.

Dollars, DALYs and decisions : economic aspects of the

mental health system. Geneva: World Health Organization;

2006. 56 p

5. Rognli EB, Berge J, Håkansson A, Bramness J. Does the

pattern ofamphetamine use prior to incarceration predict later

psychosis? A longitudinal study of amphetamine users in the

Swedish criminal justice system. Drug Alcohol Depend.

2014;143:219224

6. McCabe SE, Boyd CJ, Teter CJ. Subtypes of nonmedical

prescription drug misuse. Drug Alcohol Depend.

2009;102:6370.

7. Marshall BD, Fairbairn N, Li K, Wood E, Kerr T. Physical

violence among a prospective cohort of injection drug users:

a gender-focused approach. Drug and Alcohol Dependence.

2008;97(3):237-46.

8. Clements K, Schumacher JA. Perceptual biases in social

cognition as potential moderators of the relationship between

alcohol and intimate partner violence: A review. Aggress

Violent Behav. 2010;15(5):357-68

9. LeDoux J. Rethinking the emotional brain. Neuron. 2012;

73(4):65376.

10. Dodge KA, Malone PS, Lansford JE, Miller S, Pettit GS,

Bates JE et al. A dynamic cascade model of the development

of substance-use onset. Monographs of the Society for

Research in Child Development. 2009; 74(Serial No.

294):1134.

11. Tarter R, Vanyukov M, Giancola P, Dawes M, Blackson T,

Mezzich A, et al. Etiology of early age onset substance use

disorder: a maturational perspective. Development and

Psychopathology. 1999; 11:657683. [PubMed: 10624720]

12. Friedman RA. Violence and mental illness: how strong is the

Table 4: Multiple linear regression model for symptoms related to the use of AOD

P-value

<0.001

<0.001*

0.031*

t

12.184

4.266

2.203

Std. Error

0.282

0.053

0.044

3.435

0.226

0.097

Variable

(Constant)

CVSCR

EDSCR

Unstandardized Coefficients (B)


127

link?. N Engl J Med. 2006;355(20):2064-2066.

13. Appelbaum PS. Violence and mental disorders: data and

public policy. Am J Psychiatry. 2006;163(8):1319-1321.

14. Cole TB, Glass RM. Mental illness and violent death: major

issues for public health. JAMA. 2005;294(5):623-624.

15. Skeem JL, Monahan J, Mulvey EP. Psychopathy, treatment

involvement, and subsequent violence among civil

psychiatric patients. Law Hum Behav. 2002;26 (6):577-603

16. Monahan J, Bonnie RJ, Appelbaum PS, Hyde PS, Steadman

HJ, Swartz MS. Mandated community treatment beyond

outpatient commitment. Psychiatr Serv.2001;52(9):1198-

1205.

17. Erstling SS. Police and mental health collaborative outreach.

Psychiatr Serv. 2006;57(3):417-418.

18. Cerulli C, Conner KR, Weisman R. Bridging healthcare,

police, and court responses to intimate partner violence

perpetrated by individuals with severe and persistent mental

illness. Psychiatr Q. 2004;75(2):139-150.

19. McNiel DE, Binder RL. Effectiveness of a mental health court

in reducing criminal recidivism and violence. Am J

Psychiatry. 2007;164(9):1395-1403.

20. Swanson JW, Van Dorn RA, Monahan J, Swartz MS. Violence

and leveraged community treatment for persons with mental

disorders. Am J Psychiatry. 2006;163(8):1404-1411.

21. Dennis M, Chan Y, Funk R. Development and validation of the

GAIN Short Screener (GSS) for internalizing, externalizing

and substance use disorders and crime/violence problems

among adolescents and adults. Am J Addict. 2006;15 Suppl

1:80-91.

22. Jane-Llopis, E., & Matytsina, I. (2006). Mental health and

alcohol, drugs and tobacco: A review of the comorbidity

between mental disorders and the use of alcohol, tobacco and

illicit drugs. Drug and Alcohol Review,25, 515536.

23. Langas, A. M., Malt, U. F., & Opjordsmoen, S. Substance use

disorders and comorbid mental disorders in first-time

admitted patients from a catchment Area. European

Addiction Research.2012; 18, 625.

24. Regier DA, Farmer ME, Rae DS, Locke BZ, Keith SJ, Judd

LL et al. Comorbidity of mental disorders with alcohol and

other drug abuse. Results from the Epidemiologic Catchment

Area (ECA) Study. Jama. 264(19):2511-2518

25. Johnson JG, Spitzer RL, Williams JB, Kroenke K, Linzer M,

Brody D et al. Psychiatric comorbidity, health status, and

functional impairment associated with alcohol abuse and

dependence in primary care patients: findings of the PRIME

MD-1000 study. Journal of consulting and clinical

psychology. 63(1):133-140.

26. Crowley TJ, Mikulich SK, Macdonald M, Young SE, Zerbe

GO. Substance-dependent, conduct disorder edadolescent

males: Severity of diagnosis predicts 2-year outcome. Drug

and Alcohol Dependence 1998;49:225-237. [PubMed:

9571387]

27. Hawkins JD, Catalano RF, Miller JY. Risk and protective

factors for alcohol and other drug problems in adolescence

and early adulthood: Implications for substance abuse

prevention. PsychologicalBulletin. 1992; 112(1):64-105.

[PubMed: 1529040]

28. King SM, Iacono WG, McGue M. Childhood externalizing

and internalizing psychopathology in the prediction of early

substance use. Addiction. 2004; 99(12):15481559. [PubMed:

15585046]

29. Chermack ST, Blow FC. Violence among individuals in

substance abuse treatment: The role of alcohol and cocaine

consumption. Drug Alcohol Depend 2002;66:2937.

[PubMed: 11850133]

30. Farris CA, Fenaughty AM. Social isolation and domestic

violence among female drug users. Am J Drug Alcohol Abuse

2002;28:339351. [PubMed: 12014819]

31. Vlahov D, Wientge D, Moore J, Flynn C, Schuman P,

Schoenbaum EE, Zierler S. Violence among women with or

at risk for HIV infection. AIDS Behav 1998;2:53-60.

32. Parker RN, Auerhahn K. Alcohol, drugs, and violence. Annu

Rev Sociol 1998;24:291-311.

33. Chermack ST, Giancola PR. The relation between alcohol

and aggression: An integrated biopsychosocial

conceptualization. Clinical Psychology Review

1997;17(6):621-649. [PubMed:9336688]

34. Roth, JA. Psychoactive substance and violence. National

Institute of Justice, Office of Justice Programs; Washington,

DC: 1994.

35. Giancola PR. Irritability, acute alcohol consumption and

aggressive behavior in men and women. Drug and Alcohol

Dependence 2002;68(3):263-274. [PubMed: 12393221

36. Coker AL. Frequency and correlates of intimate partner

violence by type: Physical, sexual, and psychological

battering. American Journal of Public Health

2000;90(4):553-559. [PubMed:10754969]

37. Cunradi CB, Caetano R, Schafer J. Alcohol-Related

Problems, Drug Use, and Male Intimate Partner Violence

Severity Among US Couples. Alcoholism: Clinical &

Experimental Research 2002;26(4):493-500.

38. Jewkes R. Intimate partner violence: causes and prevention.

The Lancet 2002;359:1423-1429.

39. Silverman JG. Dating violence against adolescent girls and

Associated substance use, unhealthy weight control, sexual

risk behavior, pregnancy, and suicidality. Journal of

theAmerican Medical Association 2001;286 (5):572579.

[PubMed: 11476659]


128

40. McCauley J. The “Battering Syndrome”: Prevalence and

clinical characteristics of domestic violence in primary care

internal medicine practices. Annals of Internal Medicine

1995;123(10):737746. [PubMed: 7574191]

41. Leonard E, K. Senchak M. Prospective prediction of husband

marital aggression within newlywedcouples. Journal of

Abnormal Psychology 1996;105:369380. [PubMed:

8772007]

42. Moore TM. Drug abuse and aggression between intimate

partners: A meta-analytic review.Clinical Psychology

Review 2008;28(2):247274. [PubMed: 17604891]

Table 1: Socio-demographic Characteristics of Study Participants

Category

<=30

31-40

41-50

>50

Mean ±SD

Male

Hindu

Sikh

Rural

Urban

Single

Married

Divorced

Widowed

Separated

Illiterate

Primary School

Middle School

High School

High School Diploma

Graduate/Post Graduate

Unemployed

Unskilled Worker

Semi-Skilled Worker

Skilled Worker

Clerical

Semi Profession

<1802

1803-5386

5387-8988

8989-13494

13495-17999

18000-36016

>36017

Parents

Alone

Spouse and Children

Frequency

29

31

13

9

36.17±9.73

82

47

35

50

32

24

49

3

4

2

5

7

20

32

15

3

9

19

37

12

4

1

15

21

21

18

5

1

1

23

13

46

Percentage

35.4

37.8

15.9

11.0

100.0

57.3

42.7

61.0

39.0

29.3

59.8

3.7

4.9

2.4

6.1

8.5

24.4

39.0

18.3

3.7

11.0

23.2

45.1

14.6

4.9

1.2

18.3

25.6

25.6

22.0

6.1

1.2

1.2

28.0

15.9

56.1

VARIABLES

AGE

GENDER

RELIGION

ADDRESS

MATRIAL STATUS

EDUCATION

EMPLOYMENT

STATUS

TOTAL MONTHLY

INCOME

LIVING WITH



Forensic Identification of Mifepristone and Misoprostol by TLC and FT-IR Methods

1. Bhuvnesh Yadav, PhD, Assistant Professor II, Dept. of Chemistry, Biochemistry and Forensic Science, Amity School of

Applied Sciences, Amity University, Gurugram, Haryana, India.

2. Meena Jha, M.Sc., Sr. Scientific Assistant, Toxicology division, Forensic Science Laboratory, Madhuban, Haryana, India.

3. Lingaraj Sahoo, PhD, Senior Scientific officer, Forensic Science Laboratory, Rohini, New Delhi, India.

4. Sonu Kumar Maurya, M.Sc., Sr. Scientific Assistant, Forensic Science Laboratory, Rohini, New Delhi, India.

ABSTRACT :

Introduction: Medical abortion while a necessity is a social taboo depending upon the situations. Since ancient times, numerous

methodologies have been employed for carrying out abortions. Developments in medical sciences have made the procedure easy

by use of some abortive drugs like Mifepristone and Misoprostol. However, these drugs have been misused with impunity for

forced abortions, especially for female foeticide. The study was conducted to standardize the method for identification of these

drugs in forensic cases related to illegal abortions. Thin Layer Chromatography (TLC) and Fourier Transform – Infrared

Spectroscopy (FTIR) technologies were employed for the same.

Results: Various combinations of solvents were employed and it was observed that Mifepristone was best separated in

Chloroform-Acetone (9:1) and Toluene-Ethyl acetate (7:3) solvent systems. A unique inverted foetus shaped spot of Mifepristone

can be visualized with Dragondorff's reagent, Zwikker reagent and Iodine fumes. However, visualization of Misoprostol was

difficult by Thin Layer Chromatography method with these developers. Fourier Transform – Infrared Spectroscopy analysis gave

the positive results in both the drugs.

Conclusion: The standardization of Thin Layer Chromatography for forensic identification of abortive drug (Mifepristone) was

done in this study. FTIR can be concluded as the method of choice in the identification of Misoprostol in forensic cases.

Key words : Drug Analysis, Misoprostol, Mifepristone, Thin Layer Chromatography, Fourier Transform – Infrared Spectroscopy.


Dr. Bhuvnesh Yadav, PhD,

Assistant Professor II,

Department of Chemistry, Biochemistry and Forensic

Science, Amity School of Applied Sciences, Amity

University, Gurugram, Haryana, India.

Contact : +91 98994-02613


Article History :



Accepted on : 2 September 2020


INTRODUCTION:

Unsafe abortions are the major cause of female fatality across

the world, as non-surgical strategies involved lead to sepsis,

uterine perforation, cervical laceration, incomplete

evacuation, haemorrhage, miscarriage, future sterility and [1]finally death . As per WHO, 19 million women had unsafe

abortions worldwide every year; of which 18.5 million have [2]taken place in the developing countries . In developing

countries, of the 28 million pregnancies that take place each

year, 36% end in abortion. Serious efforts are being made to

reduce the number of unsafe procedures, by replacing them

with safer choices for pregnancy termination. A number of

drugs have since been introduced in the markets that are meant

for early termination of pregnancy and combination of two

medicines (Mifepristone and Misoprostol) was introduced as a

successive regimen for early medical abortion in the fourteenth

[3-4]WHO essential drug list .

Mifepristone, commonly called "The Abortion Pill ", or RU-

486, is hostile to progestin that hinders the activity of

progesterone, which is important to build and keep the

placenta and embryo attached. Because of its antiprogesterone

action, it was suggested that mifepristone be utilized in the [5]early end human pregnancy up to gestational age of 49 days .

Misoprostol, when used orally or vaginally, empowers uterine

constrictions that remove the developing life and placental [6]tissue .

The main concern, however, is their extensive use as a self-

medication and pharmaceutical has also supported their

endorsement in different nations, predominantly in countries

like India where foetus removal is viewed as unlawful. In

2000, the Food and Drug Administration (FDA), US has

endorsed Mifepristone, in combination with Misoprostol for

129


[7]early termination of pregnancy . The drug was approved for

marketing and use in India in 2002. In the current scenario in

India, where abortion-related mortality and morbidity are

high; medical abortion offers great potential for improving the

access to abortion and safety, as it does not require extensive

infrastructure and is non-invasive. Further, as no

hospitalization required, this type of abortion offers women

greater independence, control and privacy. However, the

potential for misuse is a matter of concern. In fact, although

abortion tablets are to be sold by medical prescription and

consumed under medical supervision, these pills are

reportedly widely available over-the-counter and

unsupervised consumption is rising by illegal abortions by

females and abortion rackets and consequence maternal [8-9]mortality . These two drugs have some adverse effects such

as excessive bleeding, which may be fatal, preterm delivery,

low birth weight, stillbirth, neonatal death or malformation in [10-12]pregnancy . Legally in India, it is only available under

medical supervision and not by prescription, due to adverse [13]reactions such as excessive bleeding . The government of

India has enacted Pre-Natal Diagnostic Techniques Act of

1994 and the Medical Termination of Pregnancy (MTP) Act

of 1971 with the intention of reducing incidence of illegal

abortions. Indian Penal Code (Act No. 45 of 1860) permitted

abortion only when it was justified in good faith for saving the

life of the woman. As, the methodology for identification of

Mifepristone for forensic investigation has not been developed

yet, especially in cases of illegal abortion from the body fluids,

this study has been conducted with the aim of developing a

simple and efficient method for identification and

determination of these abortive drugs from the body fluids, so

that the methodology can be used as evidence in the legal

process.

MATERIALS AND METHODS: In the present study, an

attempt has been made for identification and determination of

Mifepristone and Misoprostol (Abortifacient drugs), from

human urine by using TLC and FTIR. The study was

conducted on the samples of case of death due to illegal

abortion and the data were standardized with reference drugs.

The urine samples used for this purpose was collected from

Delhi Forensic Science Laboratory, Chemistry & Toxicology

Division. The standard drugs were purchased from the medical

stores for sample testing. Mifepristone (Proprietary name

MIFEPREX) and Misoprostol (Proprietary names

CYTOTEC) were used for the analysis.

[14]Chemical structure of Mifepristone

IUPAC Estra-4,9-dien-3-one, 11b-[4-(dimethylamine)

p h e n y l ] - 1 7 b - h y d r o x y - 1 7 a - ( p r o p - y n y l ) - 1 1 b -

[p(Dimethylamino)phenyl]-17b-hydroxy-17-(1-propynyl)

estra-4,9-dien-3-one.

Chemical structure of Misoprostol

IUPAC(±)Methyl (11α,13E)-11, 16-dihydroxy-16-methyl-

9-oxoprost-13-en-1-oate.

TLC and FTIR are two methodologies which were employed

for the sample identification. For TLC, the samples were

extracted from human urine by adding sufficient quantity of

phosphoric acid or tartaric acid. It was then extracted with two

30 ml portions of ether. The ethereal solution was extracted

with 5 ml of 0.5 M sodium hydroxide and the extract is retained

for examination of weakly acidic substances. The ethereal

solution was washed with water. The ethereal solution was

then dried over anhydrous sodium sulphate and evaporated to [15]dryness . The sample preparation was done by dissolving the

evaporated extract in Methanol or Chloroform or combination

of both. Chloroform: Acetone (9:1), Toluene: Ethyl Acetate

(7:3), were used as mobile phase. The various combinations

and proportion of movers and restrainers were tried for best

separation of Mifepristone (Table 1). The sample was allowed

to dry before being kept in the developing chamber. The

developed TLC plate was put inside the UV cabinet in order to

locate the spot on a TLC plate. Three methodologies

(Dragondorff's reagent, Zwikker reagent and Iodine fumes)

were used for the spot identification and results observed are

compared for the best developers. The samples were further

analyzed by Fourier Transform – Infrared Spectroscopy.

130


Tablets purchased from pharmacy were taken for assay, finely

powdered and homogenized. An accurately weighed quantity

of powder was dissolved in 5 ml phosphate buffer pH 6.0

followed by 20 ml of methanol. The solution is maintained

under stirring for 5 min and was centrifuged in order to

separate excipients. The analysis was done by mounting the

drugs in the form of thin film on KBr plate. The plate was

placed into specimen holder and then spectrum was generated.

The spectrum was analysed and compared with previously

available data. The statistical accuracy was determined by

adding known amount of Mefipristone and misoprostol as

reference standard to the sample.

RESULTS:

It has already been reported that Misoprostol is widely

retained, and experiences fast de-esterification to its free

carboxylic group, which is in charge of its clinical action, and

unlike to the parent compound, is noticeable in plasma and

urine. TLC has been used as a broad-spectrum screening test

for detection of various drugs of abuse.

In the comparative analysis of different solvents and the

developing agents, it was observed that in TLC, Mifepristone

was best separated in Chloroform-Acetone (9:1) and Toluene-

Ethyl acetate (7:3), solvent systems as compared to the other

solvent systems (Table 1). It was observed that the TLC were

significantly good with all the three reagents for Mifepristone

and all the developing techniques gave a peculiar inverted

foetus shaped spot for Mifepristone in standard (Figure 1) and

the test sample (Figure 2).

Similar results were observed with Iodine fuming also,

however, the spots faded with time after preservation in case of

iodine fuming (Figure 3).

131

Figure 1: TLC plate analysis with UV Illumination for

Mifepristone Standard

Figure 2: TLC plate analysis with UV Illumination for

Mifepristone test sample

Figure 3: Mifepristone Sample spot analysis by Iodine

Fuming


Figure 4: Mifepristone and Misoprostol Sample spot

analysis by spraying with Dragondorff's

Reagent

The results were similar as that of the TLC observed from the

standard sample prepared from the drug tablet (Figure 1).

None of the developing reagents were able to develop the spot

for Misoprostol. However, the spots were observed only when

the Misoprostol was developed with Mifepristone (Figure 4).

That may be due to the fact that the amino group of

Mifepristone bind with Dragondorff's reagent to make the

Nitro compound of the same. Similar results were observed

with Zwikker's reagent (Figure 5). The studies for impurity

analysis have been conducted for mifepristone but the current

study concluded as the TLC analysis is highly significant in the

analysis and forensic identification of Mifepristone or the

combination of Misoprostol and Mifepristone.

To carry out forensic analysis of Misoprostol, the study was

extended to FTIR analysis and both the drugs were subjected to

FTIR analysis. FTIR analysis gave qualitative results. The mix

of the crucial vibrations or revolutions of different functional

groups and the cooperation of these functional groups with

other atoms of the molecule brings about the unique, for the

most part complex infra-red range for each singular

compound. In the IR-Spectra of Misoprostol (Figure 6), the -1spectra in the region 3200-3550 cm indicated the presence of

-1hydroxyl (O-H) group; vibrations in the region 2950-2840 cm

indicated the stretching of C-H bonds of methyl group;

presence of (=C-H) bonds was observed by vibrations in the -1region 3100-3000 cm ; continuing to the double bond region,

-1strong absorption at 1655.20 cm pointed towards the presence

of carbonyl group and the vibrations in the region 1080-1300 -1cm suggested the presence of an ester group.

In the IR-Spectra of Mifepristone (Figure 7), the aromatic ring 2found to be responsible for the absorption due to sp C-H

-1stretching vibrations (3100-3000 cm ); the ring skeletal

vibrations were observed at 1614.83, 1591.12, 1518.77 and -11441.98 cm ; and the C-H bending vibrations were noticed at

-1865.90, 769.58 and 733.65 cm . The carbonyl group vibrations -1(1865.89 cm ); C-H bonds of methyl group vibrations (2970-

-1 -12865 cm ); C=C vibrations (2100-2260 cm ); O-H stretching -1vibration (3480.12 cm ) were also observed with IR spectrum.

The replicability of results were observed with both the

methods utilized. The detection limit was observed to be

132

Figure 5: Mifepristone Sample spot analysis by spraying

with Zwikker's Reagent

Figure 6: IR spectra for Misoprostol


1ng/ml. This technique extends the use of a standard IR

spectrophotometer, typically used for forensic identification

purpose.

DISCUSSION:

The validation of TLC technique for the detection of these

abortive drugs from forensic samples has not been done yet,

but the utility of mass spectroscopy has been reported in

forensic samples for detection of Misoprostol and its urinary [16]metabolites . With the analysis of FTIR graphs of

Misoprostol and Mifepristone, the functional groups of both

the drugs were identified that can be compared with standard [14, 17]graphs and can be used for the forensic analysis and

identification of these abortive drugs from the various

biological samples. The identification methods will help in the

forensic cases of toxic shocks or death due to these abortive [18, 19]drugs . These techniques will be helpful in correlating the

[20]congenital abnormalities with misoprostol misuse . The

combination of diclofenac and misoprostol has been identified

by liquid and gas chromatographic/tandem mass spectrometric [16]methods . The sensitivity and limit of detection (LOD) was

1ng/ml for FTIR, however, the sensitivities was previously

reported from HPLC method was 10 ng/ml for mifepristone [21] [22]after 120 h and 20.4 ng/ml after 96 hr . For the forensic

utility, thin layer chromatography and FTIR can be used as the

test of choice for the determination of Mifepristone and

Misoprostol in the body fluids.

CONCLUSION:

The study can be concluded with the development of novel

approach for the determination of the Mifepristone and

Misoprostol. TLC can be the earmarking and cheap techniques

for determination of the Mifepristone from body fluids. FTIR

can be utilized as the confirmative test for Mifepristone and

Misoprostol and will be highly helpful in criminal cases like

illegal abortions and female feticides.

List of abbreviations:

TLC - Thin Layer Chromatography

FTIR- Fourier Transform Infrared Spectroscopy

HPLC - High Performance Liquid Chromatography

LOD - Limit of Detection

MTP - Medical Termination of Pregnancy

GFMER-Geneva Foundation for Medical Education and

Research

WHO- World Health Organization

REFERENCES:

1. Grimes DA, Creinin MD. Induced abortion: An overview

for internists. Ann Intern Med. 2004;140:620-626.

2. World Health Organization, Department of Reproductive

Health and Research. Safe Abortion: Technical and Policy

Guidance for Health Systems. 2012. SBN:

9789241548434

3. WHO Model List of Essential Medicines. World Health

Organization, April 2015. Archived (PDF) from the

original on 13 December 2016. Retrieved 8 December

2016.

4. Geneva Foundation for Medical Education and Research

(GFMER). Application for inclusion of mifepristone

combined with misoprostol for first trimester (until 9

weeks) medical abortion in the WHO Model List of

Essential Medicines.

5. Kshirsagar SC, Wankhede UN. Combination of

mifepristone and misoprostol: An effective method of

medical abortion upto gestational age of 49 days. Int J

Reprod Contracept Obstet Gynecol. 2017;6(7):2923-

2925.

6. Thong KJ, Baird DT. Induction of abortion with

mifepristone and misoprostol in early pregnancy. Br J

Obstet Gynaecol. 1992; 99:1004-1007.

7. Corey EJ. Molecules and Medicine. John Wiley & Sons.

2007. ISBN 9781118361733

8. Coêlho HL, Teixeira AC, Santos AP, Forte EB, Morais

SM, La Vecchia C, Tognoni G, Herxheimer A.

Misoprostol and illegal abortion in Fortaleza, Brazil.

Lancet. 1993;341(8855):1261-1263. 9. Daisley H Jr. Maternal mortality following the use of

misoprostol. Med Sci Law. 2000;40(1):78-82.

10. Chen A, Yuan W, Meirik O, Wang X, Wu S, Zhou L, et al.

Mifepristone-induced early abortion and outcome of

subsequent wanted pregnancy. Am J Epidemiol.

2004;160:110–117.

11. Virk J, Zhang J, Olsen J. Medical abortion and the risk of

subsequent adverse pregnancy outcomes. N Engl J Med.

2007;357:648–653.

12. Elul B, Ellertson C, Winikoff B, Coyaji K. Side effects of

133

Figure 7: IR Spectra of Mifepristone


mifepristone-misoprostol abortion versus surgical

abortion. Data from a trial in China, Cuba, and India.

Contraception. 1999; 59(2):107-14.

13. Baird DT. Medical abortion in the first trimester. Best

Pract Res Clin Obstet Gynaecol. 2002;16:221-236.

14. Gallagher P, Young AH. Mifepristone (RU-486) treatment

for depression and psychosis: a review of the therapeutic

implications. Neuropsychiatr Dis Treat. 2006;2(1):33-42.

15. Clarke's Analysis of Drugs and Poisons in rdpharmaceuticals, body fluids and postmortem material. 3

edition, edited by Anthony C Moffat, M David Osselton &

Brian Widdop. Publisher: Pharmaceutical Press:London.

2004;2:1176. ISBN: 0-853-69473-7.

16. Watzer B, Lusthof KJ, Schweer H. Abortion after

deliberate Arthrotec® addition to food. Mass

spectrometric detection of diclofenac, misoprostol acid,

and their urinary metabolites. Int J Legal Med.

2015;129(4):759-69. doi: 10.1007/s00414-014-1136-4.

17. Verma K, Sharma PK, Dudhe R, Patro SK. Formulation,

design and development of mifepristone immediate

release tablet. Int J Pharma Sci and Res. 2017;5(11):760-

769.

18. Cittadini F, Loyola G, Caradonna L, Minelli N, Rossi R. A

case of toxic shock due to clandestine abortion by

misoprostol self-administration. J Forensic Sci.

2014;59(6):1662-1664.

19. Murray S, Wooltorton E. Septic shock after medical

abortions with mifepristone (Mifeprex, RU 486) and

misoprostol. Canadian Medical Asso J. 2005;173(5):485.

doi:10.1503/cmaj.05098.

20. Gonzalez CH, Marques-Dias MJ, Kim CA, Sugayama

SM, Da Paz JA, Huson SM, Holmes LB. Congenital

abnormalities in Brazilian children associated with

misoprostol misuse in first trimester of pregnancy. Lancet.

1998;351(9116):1624-1627.

21. Guo Z, Chu C, Yin G, He M, Fu K, Wu J. An HPLC

method for the determination of ng mifepristone in human

plasma. J Chromatography B. 2006;832:181-184.

22. Wei Y, Zhang M, Wang G, Zhao Z and Shao Q.

Pharmacokinetics of mifepristone after low oral dose in

healthy Chinese women. Chinese J Clin Pharm.

2003;19:430-433.

134


135

Table 1: Comparative result analysis of different solvent systens and developers for the identification of the Mifepristone

and Misoprostol

No. Sample Solvent system Mobile Phase Developer Result

Mifepristone

Mifepristone

Mifepristone

Mifepristone+

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Mifepristone

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Misoprostol

Chloroform-Acetone (9:1)









Toluene-Ethyl acetate(7:3)









1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

Methanol

Chloroform

Methnol +Chloroform

Methanol

Chloroform

Methnol+Chloroform

Methanol

Chloroform

Methnol+Chloroform

Methanol

Chloroform

Methnol+Chloroform

Methanol

Chloroform

Methnol+Chloroform

Methanol

Chloroform

Methnol+Chloroform

Dragondorf's reagent



Zwikker reagent

Zwikker reagent

Zwikker reagent

Iodine fumes

Iodine fumes

Iodine fumes




Zwikker reagent

Zwikker reagent

Zwikker reagent

Iodine fumes

Iodine fumes

Iodine fumes

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Positive

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative

Negative



INTRODUCTION :

India has one of the largest agrarian societies in the world with

the majority of the population dependent on agriculture both

for income and survival. Agriculture as an occupation has seen

a lot of technological advancements along with an increased

use of chemicals for better agricultural returns. This

inadvertent overuse to chemicals has led to human morbidity

and its complications. Poisoning is considered to be one of the 1. most common methods of committing suicide The most

common reasons for poisoning are because of the common use 2.of chemicals and pesticides for better agricultural output

Among these agricultural poisons, paraquat is found to be one 3of the chemicals causing deaths among agriculturists .

Paraquat (PQ) is N, N'-dimethyl-4, 4′-bipyridinium

dichloride, a synthetic quaternary nitrogenous organic 4compound . There are various reasons for the lethality of this

chemicals one among them is the lack of specific treatment. In

fact, paraquat has been banned in many of the developed

countries because of its severe toxic effects, and even if

available, they are subject to strict regulatory licensing and

oversight. In developing countries, it is still available because

of lack of strict enforcing of laws, its inexpensive nature of and


Dr. Pavanchand Shetty H


Department of Forensic Medicine,

Kasturba Medical College Mangalore, Manipal Academy of

Higher Education, Manipal, India

Contact : +91 95917-02214


KEYWORDS : Paraquat poisoning, Autopsy, Agriculture

Article History:Received: 31 May 2021Received in revised form: 30 June 2021 Accepted on: 30 June 2021Available online: 15 August 2021

ABSTRACT :

Introduction: India has one of the largest agrarian societies in the world with the majority of the population dependent on

agriculture both for income and survival. Agriculture as an occupation has seen a lot of technological advancements along with an

increased use of chemicals for better agricultural returns. This inadvertent overexposure to chemicals has led to human morbidities

and its complications. Among agricultural poisons, paraquat is found to be one of the common chemicals causing deaths among

agriculturists.

Materials and Methods: This study was conducted in VIMS Bellary, Karnataka, India with the data collected from the

postmortem report of the bodies brought in for autopsy with confirmation of poison involved based on chemical analysis reports

issued by the forensic science laboratories. The study was a retrospective one done on 235 deaths due to paraquat poisoning.

Results: In this study it was found out that male mortality was higher in comparison to females. The vulnerable or susceptible age

group was found to be individuals aged between 41-50 years among the studied sample and those involved in the agricultural

profession.

Conclusion: The study gives us an understanding about the population and the occupation of the population in the region studied

with respect to the chemical paraquat. It brings into focus the young and middle-aged productive group exposed to paraquat and

hopefully can give directions for various preventive steps to be taken in future.

1. Gururaj Biradar, Assistant Professor, Department of Forensic Medicine, VIMS Bellary2. Pavanchand Shetty H, Associate Professor*

3. Haneil Larson Dsouza, Associate Professor*4. B Suresh Kumar Shetty, Professor*5. Prateek Rastogi, Professor and Head*6. Charan Kishor Shetty, Assistant Professor and Unit Head, Department of Forensic Medicine, University Sultan Zainal

Abidin (UniSZA) Malaysia 7. V Yogiraj, Professor and Head, Department of Forensic Medicine, VIMS Bellary

*Department of Forensic Medicine, Kasturba Medical College Mangalore, Manipal Academy of Higher Education, Manipal, India

Profile of Paraquat Poisoning in Bellary District- A Retrospective Study


136

its effectiveness.


In India autopsy is done in cases of death due to poisoning .The

law of the country mandates the conduction of autopsy in

poisoning deaths for reasons that include awarding of financial

compensation to the family members of the deceased. The

present study was done using the data collected from the

postmortem reports of the autopsies conducted in the mortuary

of VIMS Bellary, Karnataka, India. The study period was

between the years 2016 to 2020,a five year time-frame. The

confirmation of the poison involved being paraquat was based

on chemical analysis reports issued by the forensic science

laboratories.

RESULTS :

In the present study, a total of 235 postmortem reports were

analyzed and various required parameters were recorded and

studied as depicted in the following tables

In the present study it was found that the most common age

group which suffered the fatality of poisoning was in the age

group of 41 to 50 years ( Table 1 ). The least common age

group involved was more than 70 years.

The present study showed that males were more commonly

involved than females. The fatalities and involvement of males

were more common than females. Out of the 235 reports

analyzed 178 were males and 57 were females. (Table 2)

The study showed that poisoning deaths were more common in

married people.(Table 3)

The study showed that the paraquat poisoning was more

common in rural population in comparison to urban

population. Out of the 235 cases studied 189 were from rural

background and 46 were from urban population. (Table 4)

The study showed that the poisoning and its fatality was found

to be more common and prominent in the people employed in

the occupation of agriculture.176 people who suffered

mortality were from agricultural background. Agriculture is

the most dominant and prominent occupation in poisoning

deaths. (Table 5)

The Study showed that out of the 235 cases, majority of the

people, that is, 190 were from low socioeconomic strata.

(Table 6)

DISCUSSION :

Paraquat is highly toxic to humans. It is one of the most

common agricultural chemicals used. The management of

paraquat poison is a challenge to the treating physicians as

effective antidote or specific treatment are not available.

Paraquat even though highly toxic is commonly used because 5of its easy availability and effectiveness . The most common

method of poisoning seen is by ingestion, but toxicity is also 6possible through other routes The collection and analysis of

data in such toxic and fatal poison has got epidemiological

137

Table 1 : Age wise Distribution

S. No.

1

2

3

4

5

6

7

Age in years

11-20

21-30

30-40

41-50

51-60

61-70

>70

Total

No. of cases

05

10

49

132

18

17

04

235

Table 2 : Sex wise Distribution

S. No.

1

2

Sex

Male

Female

Total

No. of cases

178

57

235

Table 3 : Marital status wise Distribution

S. No.

1

2

Marital Status

Married

Unmarried

Total

No. of cases

158

77

235

Table 4 : Locality Distribution

S. No.

1

2

Locality

Urban

Rural

Total

No. of cases

46

189

235

Table 5 : Occupation wise Distribution

S. No.

1

2

3

4

5

Occupation

Employed

Un employed

Student

Agriculturist

Housewife

Total

No. of cases

05

13

12

176

29

235

Table 6 : Socioeconomic Status wise Distribution

S. No.

1

2

3

No. of cases

05

40

190

235

Socioeconomic Status

Upper

Middle

Lower

Total


benefits. The present article examines the most vulnerable age

group, socio economic status and the gender of the victims of

poisoning. The results in the present study show that the

middle age group, and gender-wise, males are the most prone

for death due to poisoning. This may be due to the fact that the

particular age group and gender are the ones who are actively

involved in the agricultural profession. Hopefully, this data can

be used to get some reforms in the administrative and health

sectors. The present study was possible due to the information

collected from the postmortem reports, thus further

emphasizing the importance of data collection during the

process of postmortem examination. The present study has

concentrated on a particular region wherein the rural

population were found to be more involved . The study also

focused on the availability of the poisons in the particular

occupation which can give a guidance to restrict the use of

paraquat or regulate it to prevent further casualty.

CONCLUSION :

The study gives us an understanding about the population and

the occupation they are engaged in and the accessibility of the

chemical to this population in the region studied. It brings into

focus that young and middle aged productive group are more

exposed to the poison paraquat and hopefully can give

directions for various preventive steps to be taken in future.

Research Funding-None

Conflict of Interest-None

Ethical Clearance-Taken from VIMS, Bellary

REFERENCES :

1. Kanchan T, Menon A, Menezes RG. Methods of choice in

completed suicides: Gender differences and review of

literature. J Forensic Sci. 2009;54:938–42.

2. Bumbrah GS, Krishan K, Kanchan T, Sharma M, Sodhi

GS. Phosphide poisoning: A review of literature. Forensic

Sci Int. 2012;214:1–6.

3. Ram P, Kanchan T, Unnikrishnan B. Pattern of acute

poisonings in children below 15 years - A study from

Mangalore, South India. J Forensic Leg Med.

2014;25:26–9

4. D M Roberts L S Herbicides ; Nelson N A Lewin M A

Howland R S Hoffman L R Goldfrank Goldfrank's

Toxicologic Emergencies9th editionMcGraw HillNew

York201115026

5. MA Janeela A Oommen AK Misra I Ramya Paraquat

poisoning: Case report of a survivorJ Fam Med Prim

Care201763672310.4103/2249-4863.222042

6. Wesseling C, van Wendel de Joode B, Ruepert C, Leon C,

Monge P, Hermosillo H, et al. Paraquat in developing

countries. Int J Occup Environ Health. 2001;7:275–86.

138



INTRODUCTION :

It is a well-established fact that a good doctor is a boon while a

negligent one, a curse.

Professional negligence is defined as the omission to do

something (act of omission) which a reasonable person would

do or doing something (act of commission) which a reasonable [1]person would not do.

Criminal negligence - Section 304-A of the Indian Penal

Code,1860 states that whoever causes the death of a person by

a rash or negligent act not amounting to culpable homicide

shall be punished with imprisonment for a term of two years, or

with a fine, or with both.

A negligent person is one who inadvertently commits an act of

omission and violates a positive duty. A person who is rash

knows the consequences but foolishly thinks that they will not

occur as a result of his/ her act. A reckless person knows the

consequences but does not care whether or not they result from

his/ her act. Any conduct falling short of recklessness and

deliberate wrongdoing should not be the subject of criminal

liability. Thus, a doctor cannot be held criminally responsible

for a patient's death unless it is shown that he/ she was

negligent or incompetent, with such disregard for the life and

safety of his patient that it amounted to a crime against the [2] State.

Mistakes can be fatal and negligence in the field of medicine

can have drastic consequences for both the doctor and the

patient. An increase in the knowledge and awareness among

general populations about their rights and medical negligence

has led to a rise in suits against doctors for medical

malpractice.

A report published in Hindustan Time on August 30, 2017

states that Complaints of negligence rise by 30-40% over the

past 5 years, but less than 10% of doctors are held accountable.

This study is being carried out with the intention of assessing

the knowledge and awareness among consultants and their


Dr. Jaswinder Singh,

Professor,

Shri Ram Murti Smarak Institute of Medical Sciences,

(SRMS-IMS), Bareilly.

Contact : +91 90458-60105


KEYWORDS : Medical Malpractice; Medical Negligence; Medical Malpraxis

Article History:Received: 17 July 2020Received in revised form: 18 June 2020Accepted on: 18 June 2020Available online: 31August 2021

ABSTRACT :

Introduction: Medical malpractice is prevalent and alleged cases of negligence widespread. Most cases are to tarnish image of the

doctor and to gain monetary benefit.

Materials and Methods: Present study was undertaken with aim to assess knowledge and awareness of consultants towards

medical negligence at SRMS-IMS, Bareilly. Participants were subjected to a questionnaire of 10 questions with responses based on

LIKERT scale varied from strongly agree to strongly disagree.

Results: Out of 80 participants, 75% agreed that professional negligence in any form should be considered a violation of

Hippocratic oath, 82.5% agreed that refusing to attend a patient in emergency is negligence. 36.3% agreed that imprisonment as a

punishment for criminal negligence by law is appropriate.

Conclusions: Present study reflected that the consultants of SRMS-IMS, Bareilly have profound knowledge and are aware about

medical negligence.

1. Siddhartha Taneja, MBBS Student* 2. Jaswinder Singh, Professor*3. K.K.Bairagi, Professor*4. Tarun K. Singh, Assistant Professor* *Department of Forensic Medicine, Shri Ram Murti Smarak Institute of Medical Sciences (SRMS-IMS), Bareilly.

Assessment of Knowledge and Awareness towards Medical Negligence among Consultants in a Tertiary Care Teaching Hospital in North India


139

views towards medical negligence.


This study is being undertaken with the aim to assess the

knowledge and awareness among consultants towards medical

negligence in a tertiary care teaching hospital of SRMS-IMS,

Bareilly.

Total 80 consultants from departments of medicine, surgery,

obstetrics and gynaecology, paediatrics, otorhinolaryngology,

ophthalmology, orthopaedics, radiodiagnosis, oncology,

anaesthesia, dermatology, respiratory medicine are subjected

to a questionnaire containing 10 questions related to medical

negligence with responses based on LIKERT scale which vary

from strongly agree to strongly disagree. (Table 1)

Consultants are chosen as the sample population for the

research as they are the pivot around which the issue of

negligence rotates, they are not only responsible for their

actions but also their juniors and the staff as under contributory

negligence. Institutional ethical approval was obtained prior to

commencement of the study.

RESULTS :

Out of the 80 participants, 45% strongly agreed, 30% agreed

upon that professional negligence in any form be considered a

violation of Hippocratic oath, 13.8% were neutral while 2.5%

strongly disagreed and 8.8% disagreed with the same.

45% consultants strongly agreed while 37.5% agreed that

refusing to attend a patient in emergency is negligence only

7.5% disagreed and 2.5% strongly disagreed with the same

while 7.5% remain neutral.

35% consultants stayed neutral on the question that is

performing or helping for euthanasia a negligence,17.5%

agreed and 6.3% strongly agreed upon it while 26.3%

disagreed and 15% strongly disagreed with it.

Out of 80 participants, 36.3% agreed that imprisonment as a

punishment for criminal negligence by law is appropriate,

12.5% strongly agreed, 16.3% disagreed, 16.3% strongly

disagreed and 18.8% stayed neutral.

47.5% consultants disagreed, 27.5% strongly disagreed and

10% stayed neutral about toxic result of drug administration in

a patient should be considered negligence, 11.3% agreed while

3.8% strongly agreed it.

50% consultants agreed while 26.3% strongly agreed, 13.8%

remain neutral, 6.3% disagreed and 3.8% strongly disagreed

that failure to give proper post-operative care be considered

negligence.

37.5% consultants agreed and 2.5% strongly agreed that

concealing negligence of another doctor is negligence, 16.3%

disagreed, 8.8% strongly disagreed and 35% stayed neutral.

31.3% consultants agreed, 6.3% strongly agreed that treating a

patient without his consent even for his own good is

negligence, 30% disagreed and 10% strongly disagreed and

140

No.

1

2

3

4

5

6

7

8

9

10

SA

45%

45%

6.3%

12.5%

3.8%

26.3%

2.5%

6.3%

10%

41.3%

Table 1: Knowledge and Awareness of Consultants towards Medical Negligence.

A

30%

37.5%

17.5%

36.3%

11.3%

50%

37.5%

31.3%

45%

52.5%

N

13.8%

7.5%

35%

18.8%

10%

13.8%

35%

22.5%

23.8%

3.8%

D

8.8%

7.5%

26.3%

16.3%

47.5%

6.3%

16.3%

30%

18.8%

1.3%

SD

2.5%

2.5%

15%

16.3%

27.5%

3.8%

8.8%

10%

2.5%

1.3%

QUESTIONS

Should professional negligence in any form be considered a violation of Hippocratic oath?

Refusing to attend patient in emergency is negligence?

Is performing or helping for euthanasia a negligence?

Imprisonment as a punishment for criminal negligence, appropriate by law?

Should toxic result of drug administration in a patient be considered negligence?

Failure to give proper post-operative care be considered negligence?

Should concealing negligence of another doctor be considered negligence?

Is treating a patient without his consent negligence, even if it is for his own good?

Inability to produce required medical records upon requirement, by a consultant considered negligence?

Should a death review committee be set up in hospitals to counter negligence?

SA: Strongly Agree A: Agree N: Neutral D: Disagree SD: Strongly Disagree


22.5% remain neutral.

45% consultants agreed,10% strongly agreed that inability to

produce required medical records upon requirement, by a

consultant considered negligence,18.8% disagreed, 2.5%

strongly disagreed while 23.8% stayed neutral.

52.5% consultants agreed, 41.3% strongly agreed on setting up

a death review committee in hospitals to counter negligence,

1.3% disagreed, 1.3% strongly disagreed and 3.8% stayed

neutral.

DISCUSSION :

Medical malpractice is prevalent and alleged cases of

negligence widespread. Most of the suits made are to tarnish

the image of the doctor and to gain monetary benefit.

According to a study conducted by Pragnesh Parmar and

Gunvanti Rathod on Knowledge and Awareness among

general population towards medical negligence, showed that

general population has quite a good knowledge regarding

medical negligence which may increase gradually over a [3]period of time.

Due to this increasing knowledge often, the public is

confounded in the actual scenario of the doctor patient

relationship and deviation in their slightest of expectations

leads them to believe that the doctor is negligent. The present

study resolved on the fact that the consultants have a good

knowledge and are aware about medical negligence.

While answering the questionnaire, majority (75%) said that

professional negligence in any form violates the Hippocratic

oath.

Again majority (82.5%) agreed that refusing to attend a patient

in emergency due to any reason is negligence. As per the law,

any doctor who provides first aid in an emergency case will not

be held liable or negligent in case any mishap occurs after that [4]patient leaves his care.

While in another judgement, it was held that the amount of

care, skill and caution expected of a reasonable and prudent

medical practitioner in normal times and during an emergency [5]may not be the same.

Being asked upon performing or helping for Euthanasia is a

negligence or not, majority (35%) stayed neutral while next

majority (26.3%) disagreed to it. Euthanasia is a widely

debated topic but as per law today, only passive euthanasia is

legal in India. In a study conducted by Dr. Shreemanta Kumar

Dash in Kallinga institute of medical sciences, on the question

Do you favour euthanasia? 85% of consultants said NO, while [6]5% said Don't Know.

Majority (48.8%) agreed that it is appropriate by law, to

imprison a medical practitioner as punishment if found guilty

of criminal negligence.

75% disagreed that toxic result of drug administration should

be considered negligence by a doctor. Upon discussion

majority supported spontaneous monitoring but ultimately

resolved on the fact that adverse reaction is unpredictable if

otherwise caused by a negligent act.

There was a strong agreement (76.3%) that failure of a

consultant to give proper post-operative care is in fact

negligence and worsening of the condition of patient due to any

deficiency in post-operative care makes the doctor guilty.

Majority (40%) agreed that it will be in fact considered

negligence to hide the faults of another doctor who is guilty,

resulting in any sort of harm to the patient. While 35% stayed

neutral and 25.1% disagreed the same.

Majority (40%) disagreed that treating a patient without

consent even for his own good should be considered

negligence. While almost 37.6% agreed that it would be an act

of negligence to treat a patient without his consent. Although

law withholds any medical practitioner to start any treatment or

procedure without taking appropriate consent however, if a

doctor feels that providing information to a patient who is

anxious or disturbed would not be processed rationally by him

and is likely to psychologically harm him, the information can [7]be withheld from him as a therapeutic privilege.

Majority agreed (55%) that it is negligence on part of a doctor

to not produce required medical records when needed.

Provisions of the Limitation Act 1963 and section 24A of the

consumer protection Act 1986, lays down time within which a

complaint can be filed; it is advisable to maintain records for 2

years for outpatient records and 3 years for inpatient and

surgical cases. The records that are subject to medicolegal

cases should be maintained until the final disposal of the case [8]even though only a complaint or notice is received.

Strong majority (93.8%) agreed that a death review committee

should be set up in hospitals to counter negligence and aid in

justice if any. The committee would not only serve as a

valuable check to the actions of consultants but also document

all the sensitive facts in case of any death appearing to be due to

alleged negligent act. This would also contribute to education

of medical, paramedical and nursing staff to decrease death [9]rate due to a preventable cause.

CONCLUSION :

Present study reflected that the consultants of SRMS-IMS,

Bareilly have profound knowledge and are aware about

medical negligence. Their interaction with their patients, on a

daily basis incorporates all the aspects of medical ethics which

begins right from the out-patient department, treatment,

operation theatre and post-operative.

141


CONFLICT OF INTEREST: Nil

SOURCE OF FUNDING: Self-Funded

REFERENCES :

1. Parikh C. K., Parikh's textbook of medical jurisprudence,

forensic medicine and toxicology. New Delhi: CBS

Publishers & Distributors; 6th edition 2007: 1.42-1.43.

2. House of Lords decision in R vs Adomako (1994).

Available from:

https://www.casemine.com/judgement/uk/5a8ff8c960d0

3e7f57ecd71e. Accessed on 24th April 2021.

3. Parmar P, Rathod GB. Knowledge and awareness among

general population towards medical negligence. IAIM,

2016; 3(7): 250-254.

4. In Amir Ali Shakir v. St John's Medical College Hospital,

Bangalore, 1996(1) CPJ 169; 1995(3) CPR 174

( K A R N ATA K A S C D R C ) . Av a i l a b l e f r o m :

https://kscdrc.kar.nic.in . Accessed on 24th April 2021.

5. In New India Assurance Co. Ltd. V Dr Kriti Kumar S sheth

And Anr. 1997 ACJ 1103, Para 13. Available from:

https://indiankanoon.org/doc/1711277/ . Accessed on

24th April 2021.

6. Dash, Shreemanta. (2010). Original research paper

Medical Ethics, Duties & Medical Negligence Awareness

among the Practitioners in a Teaching Medical College

Hospital - A Survey. JIAFM, 2010; 32(2): 153-156.

7. Kannan JK, Mathiharan K. Legal and ethical aspects of

medical practice. In: Modi A, editor. Textbook of Medical

Jurisprudence and Toxicology. 24th edition Nagpur: Lexis

Nexis Butterworths Wadhwa; 2012. P. 61-118.

8. Thomas J. Medical records and issues in negligence.

Indian J Urol 2009;25(3):384-388.

9. Vargas-Rosendo R, Alemán-Velázquez P, Jasso-Gutiérrez

L. The Mortality Committee: a hospital need. Bol Med

Hosp Infant Mex. 1992 Oct;49(10):683-8.

142


Estimation of stature from Percutaneous Length of Tibia in Living Subjects in Jhalawar region of Rajasthan

1. Mukesh Kumar Meena, PG 2nd Year*

2. Sanjaya Kumar Jain, Senior Professor*

3. Ramakant Varma, Associate Professor*

*Department of Forensic Medicine & Toxicology, Jhalawar Medical College, Jhalawar, Rajasthan

ABSTRACT :

Background: As said “to identify the individuality of human being and to reconstruct stature from different body part is his birth

right” and also the stature of a person is considered as an inherent character by the anthropologists. So, for establishment of the

identity of a person, measurement of stature is considered as the most valuable parameter in forensic anthropology.

AIM: The present study made an attempt to establish the statistical correlation between stature and pre-cutaneous tibial length

(PCTL) BY formulating a simple regression equation and multiplication factor (M.F.) for the people of Jhalawar region.

Material and methods: between the Present study was carried out on 200 subjects (100 male and 100 female) among the people of

Jhalawar region. Between the age group of 18-24 years were chosen. PCTL of right and left tibia was measured with the help of

spreading caliper. The stature was estimated from percutaneous tibial length was measured and the data was analyzed statistically

and the regression equation was derived.

Result: The linear regression equation derived from percutaneous tibial length for the measurement of height t showed statistically

significant relationship (p < 0.05) in both the sexes.

Conclusion: It was concluded that the stature in Jhalawar region. present study revealed that there is a positive correlation exists

between the stature and percutaneous tibial length. Hence, this study is very much useful for forensic expert as well as for the

anthropologist.

Key words: Anthropometry, Percutaneous tibial length, Stature.


Dr. Ramakant Varma,


Department of Forensic Medicine & Toxicology,

Jhalawar Medical College, Jhalawar, Rajasthan

Contact : +91 94609-62020


Article History :

Received : 19 October 2020

Received in revised from : 13 December 2020

Accepted on : 13 December 2020


INTRODUCTION :

Anthropometry is a systematic study of measurement on man

and it involves scientific techniques for taking various

measurements and somatic observation on the living subjects.

Stature estimation is an important part of the identification in

human skeletal remains or body parts, especially long bones of 1,2,3,4the limbs. The estimation of stature from femur and tibia,

5are more accurate than the humerus and ulna, especially the

tibia and the femur as these have a direct correlation to the 6height of an individual. Forensic's While dealing with skeletal

remains use of anatomical method for stature reconstruction

has limited role due to non-availability of the complete 7skeleton from a scene of crime in most of the cases.

The mathematical method can be used in these cases where 8 9-10only a part of the body or part of the bone are available for

determination of the stature.

Anthropology is the branch of science which deals with the

comparative study of human being, their origin, physical and 11-13.cultural development and biological characteristics . It also

gives us knowledge about the evolutionary history of human

being, the variation in social and cultural behavior among the

different race of people, the structural development and

variation in physical status of different group of human 14population and it also proved itself as a boon for researchers .

The term anthropology comes from the Greek word

“Anthropos” meaning “human being” and “logia” meaning

“study”. Deals with the study of human being, their working

style and the culture in the society and the variation among

them is also included.

Physical Anthropology: Subdivision of anthropology:

Anthropology can be subdivided into the following two parts:

Social Anthropology: it is the branch which deals with the



143

study of human being, their working style and the culture in the

society and the variation among them is also included. It deals

with the long-term development of human being and the study 25of biological behavior of humans .

In the field of forensic anthropology determination of identity

of an individual is considered as the most important character,

specifically when a damaged body or mutilated bodies are

found and also if bones are available after the death of 26individual at the site of crime or any other place .

As we know that various part of the body like head, trunk and

length of upper and lower limbs are in close relation with the

height of a person. So, for anatomist, anthropologist, and

forensic medicine experts, height estimation has become a

matter of interest by measuring the different parts of the 21,27,28body .

Stature and percutaneous tibial length: Stature is the body

height of an individual subjects in standing position. It

represents the distance between the top of the head(the vertex)

and the bottom of the feet. The legs should be kept parallel to

each other with both feet joined together and the great toe

should face forward. The person should be stand bare footed

and should maintain the anatomical position of the body with 19the head adjusted in Frankfurt plane . Percutaneous tibial

length is the total length of tibia significantly presenting the

distance between the medial most superficial point on the

upper border of the medial condyle to the superficial lower

most point (tip) of medial malleolus of tibia, and the person

should maintain the angle between flexor surface of leg and 1thigh at 90° .

The standing height is in great contribution with the lower limb

length; hence the most predictive equation is based on the 20bones of lower extremity length like tibia, femur and fibula .

21Tibia holds about 22% of the total human body length . The

height of the new generation is increasing with improved

socioeconomic condition of the world. Hence the relationship

between height and length of long bones is changing day by 22day, therefore fresh formula is needed for each generation. It

is also useful for medicolegal experts and anthropological 23,24studies.


The study was conducted on 200 subjects (100 male and 100

female) between the age group of 18-24 year among the

population of Jhalawar region. The stature and per cutaneous

tibial length were measured. The stature was measured with

the help of stadiometer and percutaneous tibial length was

measured by spreading caliper.

Technique for measurement of stature: The person was

asked to stand erect, eyes forward and both arm by the side of

the body, palm faces forward and both the leg parallel to each

other, both feet are joined together and the great toe faces

forward, and the head were adjusted in the frankfurt¼s plane.

All the measurement was taken by bringing the sliding

horizontal bar up to the vertex. All the measurement was taken

in centimeter. (Figure 1)

Technique of measuring percutaneous tibial length: For

measuring the percutaneous length of tibia the person was

asked to sit on a stool so that the thigh should be placed in a

straight line, and the leg and thigh should be placed right angle

to each other (maintain the angle of 90°with each other ), foot

was rotated laterally, so that the bony projection were

prominently seen. Then proximal and distal points of tibia

were marked by marker pencil. Then the two points (proximal

and distal) were measured by spreading caliper. To determine

the length of tibia spreading caliper was used. The length of

tibia was measured in centimeter. (Figure 2)

Proximal point: The superficial superior most point of upper

border of the medial tibial condyle was considered as the

proximal point of measurement of the tibia.

Distal point: superficial inferior most point which is the tip of

medial malleolus of tibia was considered as the distal point in

measuring the tibia.

Statistical analysis: The data was statistically evaluated by

calculating the mean, the standard deviation (SD) as well as the

standard error (SE). Pearson's correlation coefficient was used

to correlate between stature and percutaneous tibial length.

The regression formula was derived by calculating the stature

as well as the PCTL of left as well as right side of both the

sexes. The regression formula used was Y = a + b (x) Where,

144

Figure 1 Figure 2


“Y” is the Height which has to be measured, “a” is the intercept

(i.e. the point between the Y- axis and the regression line), “b”

is the slope of regression line and“x” is the independent

variable i.e. the PCTL. Different parameters were compared by

using student's t-test and p-value <0.05 was considered as

statistically significant.

RESULTS :

The present study was conducted on 200 subjects (100 male

and 100 female) among the population of Jhalawar region.

This study includes both the sexes between the age group of

18-24 year. The stature and percutaneous tibial length of all the

subjects were measured and the statistical analyses was done

by calculating the mean, standard deviation(±SD), standard

error (SE), range (minimum and maximum).

Using Pearson's correlation coefficient and Subjects t-test with

its p-value of significance for each parameter to find out any

significant correlation between the parameters and also the

regression equation was also derived.

Table 1 Showing that the mean age of male was19.63 and that

of the female was18.73,and of both the sexes was 19.18 . The

standard deviation of the age of male was 1.83, female was

1.14 and of both the sexes was 1.55. The total number of

populations was 200 out of which 100 were male and 100 were

female. The minimum age was 17 year and the maximum age

was 24 year.

Table 2 shows the descriptive statistics of male, the mean of

the stature is 171.38 and that of the PCTL is 37.93. The SD of

stature, PCTL is 6.42, 1.87 respectively. The minimum stature

is 155 and the maximum stature is 186 and the range is 31. The

minimum PCTL is 32.6 whereas the maximum PCTL is 43.7.

The range of PCTL is 11.1.

Table. 3. shows the descriptive statistics of female. The mean

stature was 159.02 and the mean PCTL was 35.13. The SD of

stature, PCTL was 6.25, 1.79 respectively. The maximum

stature was 173 and minimum stature was 142 and the range is

31. The maximum PCTL was 39.5. The range of PCTL was

8.5.

Table 2 and 3 are showing the total count of male and female

was 100 each.

Table 4 shows the regression statistics of both male and female

which was calculated between stature and PCTL. The value of

correlation coefficient (r) varies from 0 to 1 (i.e. 0.88 in male

and 0.86in female). The value of R-square of male was 0.774

and that of female was 0.739.The degree of freedom (DF) in

male and female was 99 (100-1).

It also shows a positive correlation between the height and the

PCTL in male and female. It shows that the relationship

between the body height and PCTL length and p-value is less

than 0.05 (p<0.05) shows significant in male and female.

We have derived the regression equation formula for both male

and female separately to calculate the height from PCTL. We

have considered a linear relationship between x and y and as

such we have calculated a linear regression equation in the

form of y = a + bx. The linear regression equation derived from

percutaneous tibial length for the measurement of height

showed statistically significant relationship (p< 0.05)in both

145

Table 1: Statistical correlation between the age of the males, females and also both the sexes.

Group

Number of Population

Mean

Standard Deviation (±)

Variance

Minimum

Maximum

Male

100

19.63

1.83

3.35

17

24

Female

100

18.73

1.14

1.29

17

24

Both Sexes

200

19.18

1.55

2.4

17

24

Table 2: Descriptive statistics of the parameters of males (all the parameter was measured in centimeter).

Description

Mean

Standard Deviation (SD)

Range

Minimum

Maximum

Count

Stature

(In cm*)

171.38

6.42

31

155

186

100

PCTL

(In cm*)

37.93

1.87

11.1

32.6

43.7

100

Table 3: Descriptive statistics of all the parameters of female (all the parameter was measured in centimeter).

Description

Mean

Standard Deviation (SD)

Range

Minimum

Maximum

Count

Stature

(In cm*)

159.02

6.25

31

142

173

100

PCTL

(In cm*)

35.13

1.79

8.5

31

39.5

100

Table 4: Regression statistics of male and female of PCTL

Description

Correlation coefficient (r)

R-square

DF

p-value

Male

0.88

0.774

99

<0.05

Female

0.86

0.739

99

<0.05


the sexes.

For the measurement of stature 'Y' from percutaneous tibial

length we have derived the regression equations. To solve this

equation, we have calculated value of 'A' and value of 'B'.and

'x' is percutaneous tibial length.

Y=A + B X

Where, “Y” is the value which has to be measured i.e.

dependent variable (stature). “A” is the point of cross between

regression line and Y- axis (Intercept).

“B” is the slope of regression line (Slope). “X” is the PCTL

(independent variable).

The formulae have been obtained by using the statistical

equation in both male and female separately.

X-171.38=0.88×6.42÷1.87 (Y-37.93) X=3.02Y+56.79

Female:

X-159.02=0.86×6.25÷1.79 (Y-35.13)X=3.0Y+53.53

'Y' is tibial length 'X' is stature

Regression Equation for male is X=56.79 + (3.02)

PCTL Regression Equation for female is Y=53.53 + (3.0) *PCTL PCTL : percutaneous tibial length.

DISCUSSION:

As said “Stature reveals identity” and in the field of forensic

anthropometry height estimation is considered as an important

step for identification. The process of identification is very vast

and various techniques are use din this process. Stature 25estimation from skeletal remain is one of them.

We have conducted the study in India. We have selected 200

Subjects (100 male and 100 female) between the age group of

18 – 24 year. Then the stature and PCTL were measured and the

data was calculated.

Our study was conducted among the age group of 18 – 24 years

people and the similar age group was considered by Trivedi et 35al , who studied the age group between 18 – 21 year.

[21]Similar age group was also considered by Kaore etal 27Agnihotri et al . In

our finding the maximum number of subjects was of the age

group of 19 year in male and 18 year in female and after

comparing the both the maximum number of subjects was of

the age group of 19 year, and the least number of subjects was

of the age group of 24 year.

In our study the stature was measured for male and female

separately. The study revealed a co-relation between height

and tibial length in both the genders. The stature measured for

male was 171.38 cm and that of female was 159.02. Similar 18 11 19,result was found Ashmawyet. Al ,Kaore et al , Saini et al

30.Laxmi N. C. et al21Our value also matches the study of Rani et al , in which they

had measured the stature among the population of Delhi, and

found that the mean stature in male was 169.5 cm and that of

female was 159.5cm.32Similar type of result was found by Chavan et al in which the

stature of male was 167.89 cm and that of female was 151.41

cm. our study also correlates the study of Bhavna and 33SurenderNath in which the male stature was foundto

be167.66 cm and the female stature was found to be 154.40 cm.34Our finding nearly correlates the study of Mohanty M.K , in

which they found the stature in male was 161.92 cm and in

female was 152 cm.

CONCLUSION: The

present study reveals that a positive and definite correlation

exists between the per-cutaneous tibial length and the stature

as well as regression equation is also established. In the present

study we have found moderate statistically significant

correlation between height and PCTL and there is minimum

standard error of estimation in stature.

Conflicts of Interests: None

REFERENCES:

1. Trotter M, Gleser GC. Estimation of stature from long

146

Table 5 : Shows the Regression analysis

Description

Intercept (a)

Slope of regression line (b)

Male

56.79

3.02

Female

53.53

3.0

Previous studies

Magdy Mohamed [28]Ashmawy et al

[21]AshitaKaore et al [29]Naha Saini et al

[30]Laxmi N. C. et al

Present Study.

Table 6 : Showing the comparison of stature of the present study with the previous studies

Year

2006

2012

2013

2013

2020

Male

Stature

171.48

170.08

174.91

171.18

171.38

Femal

Stature

162.42

156.2

157.53

159.09

159.02

Previous studies

[21]Ashita Kaore et al[35]AkhileshTrivedi et al

Present Study.

Table 7: Shows the correlation of PCTL of male and female of previous studies with the present study

Year

2012

2014

2020

Male

PCTL

35.77

38.26

37.93

Femal

PCTL

32.19

36.1

35.13


bones of Americanwhites and negroes. Am J Phys

Anthropol 1952;10:463-514.

2. Mall G, Hubig M, Büttner A, Kuznik J, Penning R, Graw

M. Gender determination and estimation of stature from

the long bones of the arm. Forensic Sci Int 2001;117: 23-

30.

3. Duyar I, Pelin C. Body height estimation based on tibia

length in different stature groups. Am J Phys Anthropol

2003;122:23-7.

4. Petrovečki V, Mayer D, Šlaus M, Strinović D, Škavić J.

Prediction of stature based on radiographic measurements

of cadaver long bones: a study of the Croatian population.

Journal of Forensic Sciences. 2007; 52 (3):547-52.

5. Lundy JK, Feldesman MR. Revised equations for

estimating living stature from long of the South African

Negro. S Afr J Sci 1987; 83: 54-55.

6. Brothwell D, Zakrzewski. Metric and non-metric studies

of archaeological human bone. In: Brickley M, McKinley

JI, editors. Stature estimation. Guidelines to the Standards

for recording Human Remains. South ampton/Reading:

BABAO/ Institute of Field Archeologists; 2004

7. Allbrook D. The estimation of stature in British and East

African males based on tibial and ulnar bone lengths. J.

For. Med.1961; 8: 15-28.

8. Ozaslan A, Iscan MY, Ozaslan I, Tugcu H, Koc S.

Estimation of stature from body parts. Forensic Sci Int

2003;132:40-5.

9. Badkur P, Nath S. Use of regression analysis in

reconstruction of maximum bone length and living stature

from fragmentary measures of the ulna. Forensic Sci Int

1990;45:15-25.

10. Holland TD. Estimation of adult stature from fragmentary

tibias. J Forensic Sci 1992;37:1223-9.

11. Pan N, lengths of long bones and their proportions to body

height in Hindus. Journal Anatomy; 1924;58:374-8.

12. Abdul Malik AK, Ahmed AM, EL Sharwaki SA, Hamid

NA. Prediction of stature from hand measurement.

Forensic Sci Int., 1990;46(2):181-87.

13. Das BM, outlines of anthropology. Allahabad kitab mahal,

2008;26ed :1.

14. Singh A, Kumar A, Chavli KH, Dasari H, Use of arm span

and foot length for estimation of height of the person. J

Punjab Academy of Forensic Med Toxicology,

2010;12(2):87-91.

15. Singh IP, Bhasin MK, Anthropometry – a laboratory

manual or biological anthropology. Delhi Kamla Raj

Enterprises, 1968;18(39):3-7.

16. Choi BY, Chae YM, Chung IH, Kang HS, Correlation

between the postmortem stature and dried limb bone

length of Korean adult's male. Yonsei medical journal,

1997;38:79-85.

17. Chavan SK, Chavan KD, Mumbre SS, Makhani CS.

Stature andpercutaneous tibial length- a study in

Maharashtrian population. Indian journal of forensic

medicine and pathology; 2009:2(3):109-111

18. Joshi NB, Patel MP and Dongre AV,Regression equation

of height on Ulnar length. Ind. J. Med. Res.

1964;52(2):1088-91.

19. Bogin D, Silva MIV, Leg length, body proportion and

health:a review with a note on beauty. Int J environ Res

Public Health, 2010;7:1047-1075.

20. Bokariya P, Sontakke B, Waghmare JE, TarnekarAditya,

Tripure BH, Shende MR, The anthropometric

measurement of tibia. J Indian Accad Forensic Med,

2012;34(4):223- 234.

21. Kaore A, Kaore BP, Kamdi A, Kaore A. Stature estimation

from tibial length. NJIRM; 2012;3(2).

22. Lal CS, Lala JK. Estimation of height from tibial and ulnar

length in North Bihar. Journal of Indian Medical

Association, 1972;58(4):120-121.

23. Mondal MK, Jana TK, Das J, Biswas S. Use of length of

ulna for estimation of stature in living adult male in

Burdwan district and adjacent area of west Bengal.

Journal of the Anatomical Society of India,

2009;58(1):121- 23.

24. Joshi NB, Patel MP, Dongre AV. Regression equation of

height on ulnar length. Ind. J. Med. Res. 1964;52(2):1088-

1091.

25. Ilayperuma I, Nanayakkara G, Palahepitiya N. A model

for the estimation of personal stature from the length of

forearm. Int. J. Morphol, 2010;28(4):1081-86.

26. Vercelloti G. Stature estimation in an early medieval (xi-

xii) polish population: Am J. Physical Anthropol

2009;16(42):140-135.

27. Agnihotri AK, Kachhwaha S, Vandna J, Pratap S.

Estimation of stature from percutaneous length of tibia

and ulna in Indo-Mauritian population. Forensic Science

International, 2009;187:109-113.

28. Ashmawy MM, Ayman Abdel –hamid Nagy. Prediction of

height from percutaneous tibial length among Egyptians.

Sebha Medical Journal2006;5(2):223- 229.

29. Saini N, Chauhan S, Katara P, Parashar R. A correlational

147


study between stature and PCTL in adult males and

females of Rajasthan. Indian Journal of Basic and Applied

Medical Research, 2013;3(1):21-26.

30. Chandravadiya LN, Patel SM, Goda JB, Patel SV.

International journal of biological and medical research,

2010;66-85.

31. Mukta R, Tyagi AK, Verma SK, Kohli A. Estimation of

stature from percutaneous measurements of legs. Journal

of forensic medicine and toxicology, 2004;21(1):12- 14.

32. Chavan SK, Chavan KD, Mumbre SS, Makhani CS.

Stature andpercutaneous tibial length- a study in

Maharastrian population. Indian journal of forensic

medicine and pathology; 2009:2(3):109-11.

33. Bhavna S, Surinder Nath. Use of lower limb measurement

in reconstructing stature among Shia Muslims. The

international journal of biological anthropology;

2009:2(2).

34. Mohanty NK, Prediction of height from percutaneous

tibial length amongst Oriya population. Forensic Sci Int.,

1998;98(3):137-41.

35. Trivedi A, Saxena S, Morya R, Jehan M. Stature

estimation using percutaneous tibial length in people of

Gwalior Region:JOSR- JDMS,2014;13(5):65-70.

36. Pearson K, Length of long bones and their proportion to

body height in Hindus. J. Anat. 1899; 192:169- 244.

37. Trotter M, Glasser GC, Trends in stature of American

Whites and Negroes born between 1840 – 1924. Am. J.

Phys. Anthropol. 1951;9:103-117.

148



INTRODUCTION :

Fatal road traffic accidents (RTA) are a major cause of death all

over the world. It is considered as one of the most significant

but preventable cause of death. Approximately 1.35 million

people die as a result of RTA worldwide. That account for

almost 3700 deaths per day due to road traffic accidents. As per

World Health Organization the RTA can rise upto 2.4 million rdby 2020 and will make it the 3 most common killer in the

nd [1]World and 2 most common in the developing countries. As

per history it was 1896 when the First automobile accident

occurred when a car hit a bicycle rider whereas in 1899 was the

year when first fatal accident occurred in the city of London. In

same year in the New York City a pedestrian died after he was

hit by a car. The factors that decide the outcome of injuries

sustained in an RTA but are not limited to: the type of vehicle

involved in the accident, the condition of road, the location and

time of accident, etc. The significant factors that lead to

accident vary from driver fatigue, over speeding, fault in the

vehicle, error in human assessment, drunken driving, poor [2]road conditions, traffic rules violations etc. It is the only

problem in the society where decision makers still can't refuse

[3]mortality and morbidity among young people on high scale.

It was highest among the people between 15-44 years age

group and predominantly in males with greater the 1.8 lakh [4]death under the age of 15 years. The aim of present study was

to assess the pattern of road traffic injuries.


The present study was based on the autopsy findings of 87 fatal

cases due to road traffic accident conducted in the Department

of Forensic Medicine & Toxicology, Govt. Medical College &

Hospital, Jammu. The duration of the study was from August

2017 to August 2019.The cases included in this study were

from various police stations in and around Jammu.

RESULTS :

During the study period out of the total number of cases of

medico-legal autopsies 87 cases were of fatal road traffic

accident. Age group between 31-40 years (31.03%) was

among the most frequent age group seen that was followed by

21-30yrs (20..68%). (Table 1). Road traffic accident victims

aged above 61 years and lesser then 10 years were least [5-6]involved with 5.74% and 3.4% respectively.

Corresponding Author : Dr. Preet Mohinder Singh,


Department of Forensic Medicine & Toxicology, Govt.

Medical College, Kathua

Contact : +91 78897-85106


KEYWORDS : Road traffic accidents, RTA, Injuries, fatal road traffic accident, Jammu

Article History:Received: 25 January 2020Received in revised form: 30 April 2020Accepted on: 30 April 2020Available online: 31 August 2021

ABSTRACT :

Introduction: Fatal road traffic accidents (RTA) are considered as a major cause of death all over the world. Approximately 1.35

million people die as a result of RTA worldwide. That account for almost 3700 deaths per day due to road traffic accidents. The aim

of this study was to know the injury pattern from fatal road traffic accidents either found dead on arrival or died during treatment and

presented in the mortuary of Govt. Medical college & hospital, Jammu. During the study period out of total 181 cases of medico-

legal autopsies 87 cases were of fatal road traffic accident.

Results: Among the age group 31–40 years, highest number (31.03%) of road traffic fatalities occurred. Males predominated over

the female by almost four and a half times. Most common external injuries were seen in Head, Neck & face (34.82%) followed by

lower extremities (17.58%) with abrasion dominated (57.24%) follower by laceration (23.1%).Abdomen and Pelvis were least

involved among other injuries (11.03%). Fracture of the skull was the most frequently fractured bone (28.96%) whereas the pelvis

and the spine were the least fractured bones with 3.44% & 1.37% respectively. Brain was the most commonly injured internal organ

seen on autopsy(34.69%).

1. Preet Mohinder Singh, Assistant Professor, Department of Forensic Medicine & Toxicology, Govt. Medical College, Kathua.2. Kirandeep Kour Raina, Medical Officer, PHC Mansar.

3. Sandya Arora, Associate Professor, Department of Forensic Medicine & Toxicology, Govt. Medical College, Jammu.

Pattern of fatal Injuries in Road Traffic Accidents in & around Jammu region: An Autopsy Based Study


149

Part of the body

Brain

Liver

Spleen

Heart & major blood Vessels

Lungs

Kidneys

Stomach

Intestine

Total

Number

51

21

10

14

35

5

2

9

147

Present

34.69

14.28

6.8

9.52

23.8

3.4

1.36

6.12

100

Table 5: Distribution of visceral injuries amongst RTA victims

[5]Males victims predominated this study also. Majority of the

victims were males. (Table 2) Almost four and a half times

males dominated in this study as compared to females

Head, neck and face were the most effected organs in the

RTA(n=101, 34.82%) that was followed by upper extremities

(n=60, 20.68%) and lower extremities (n=51, 17.58%).

Abrasion was the most common type of external injury(n=166,

57.24%) among the total count of external injuries(n=290). It

was fol lowed by Lacerat ion(n=67, 23.1%) and

Contusion(n=57, 19.56%) with respectively. (Table 3).

Fracture of the skull was the most frequently fractured bone in

an RTA (n= 42, 28.96%) whereas the pelvis and the spine were

the least fractured bones (Table 4).

Brain was the most commonly injured internal organ seen on

autopsy(n=51, 34.69%).(Table 5). The total number of skeletal

injuries (n=145) as well as visceral organ injuries (n=147)

surpassed the total number of RTA victims (n=87) visibly

demonstrating multiple injuries sustained by victims of RTA

(Table 4, 5).

In maximum number of victims of RTA(n=42, 48.27 per cent)

the cause of death was head injury. It was followed by

haemorrhagic shock and Poly trauma

with 31 (35.63 percent) and 11 (12.64 percent) individuals

respectively. Complications and Spinal cord injury as a result

of RTA took life of two and one victim respectively. (Table 6).

Victims that died at the spot of RTA or on the way to hospital

were in high numbers (n=53, 60.9%). Mere 9 (10.43%) victims

of RTA survived for time of 2-6 hours after the incidence. Least

2 (2.29%) victims were those who survived for a period greater

than fourteen days of hospital admission.

DISCUSSION : Most common factors like use of alcohol,

bad driving skills, bad condition of roads, defects in the vehicle

are frequently responsible for RTAs. 71 victims out of 87 [7](81.6%) were males. The studies from Khajuria et al ,

150

Table 1: Distribution of age in RTA victims

Age Class

0-10

11-20

21-30

31-40

41-50

51-60

Above 61

Frequency

3

9

18

27

15

10

5

Present

3.4

10.34

20.68

31.03

17.24

11.49

5.74

Sex

Male

Female

Frequency

71

16

Present

81.6

18.39

Table 2: Distribution of Sex in RTA victims

Table 3: Distribution of external injuries in victims of fatal RTA over different part of the body.

Abrasion

41(14.13)

37(12.75)

43(14.82)

18(6.2)

27(9.31)

166(57.24)

Part of body

Head, Neck

and Face

Thorax

Upper Extremity

Abdomen &

Pelvis

Lower Extremity

Total

Laceration

33(11.37)

2(0.68)

9(3.1)

5(1.72)

18(6.2)

67(23.1)

Contusion

27(9.31)

7(2.41)

8(2.75)

9(3.1)

6(2.06)

57(19.65)

Total

101(34.82)

46(15.86)

60(20.68)

32(11.03)

51(17.58)

290(100)

Part of the body

Skull

Face

Spine

Thorax

Pelvis

Upper Extremities

Lower Extremities

Total

Number

42

17

2

29

5

23

27

145

Present

28.96

11.72

1.37

20

3.44

15.86

18.62

100

Table 4: Distribution of fracture in RTA victims

Table 6: Distribution of RTA victims according to cause of Death.

Cause of death

Head injury

Polytrauma

Hemorrhagic shock

Spinal cord injury

Complications

Total

Number

42

11

31

1

2

87

Present

48.27

12.64

35.63

1.14

2.29

100

[8] [9] [10] Ganveer and Tiwari , Kochar et al. , Azmani et al.[11] [12]Moharamzad et al. , Jha G et al. also reported similar results

in their respective studies.

In the present study victims between 21-30 years of age were [7]the most commonly effected. As per Khajuria et al. 53.01%

victims suffered in RTA belong to the age group between 20-40 [6] [8] years. , Ganveer and Tiwari observed most of the victims,

about 75% were in the age group of 18-37 years. The capability

for negligence in the use of safety features like seatbelt,

helmets, restraints etc and ignorance of traffic rules &

regulations of 20-40 years of age group can explain the this

scenario. It forces us to think about the grave loss of economy

to the community due to the involvement of this highly

productive age group in RTA. These are similar with [13-16]authors.

The dominance of males in this study coincides with reporting [9,10,12,17-20]from other research studies . As per the traditional

ways more males work outside homes and are more exposed to

RTA, this could be the reason behind the gender bias. This

could lead to very adverse impact on economy of the family as [21]most of them were the sole bread winners of their families.

In this study the injuries to musculoskeletal with regards to

pattern of injuries in RTA was mostly seen on limbs when

counted together that was followed by head(neck and face), [22]thorax and abdomen. In their study Singh et al. reported

extremity injuries when taken together were present in

78.5%,followed by head, thorax and abdomen with 77.6%, [12]44% and 31.8% respectively . These are similar with other

[23,24]studies.

The most common injury site in victims of RTA was Brain, it [12]was followed by lungs as second most common. Jha et al. in

his research study reported one-third of victims had head

injuries, that was followed by lower limb injuries and face.

Most of the victims of RTA (60.9%) either died on spot or on

the way to hospital. The similar finding were observed by other 11,18,19,20research studies . It can be explained due shortage of pre-

24 hospital teams shortage In case of cranial injury the survival

time of the victim depends upon the degree of injury and also

services in health care that were given to the victim. This is [23,24]consistent with studies made by other researchers.

The commonest type of external injury seen in victims were

Abrasions. The total number of injuries(external)that were

sustained by 87 cases of RTA were 290.This shows occurrence

of multiple injuries in the victims of RTA. If calculated the

total external injuries sustained were 3.33 per victim. [25] Chaudhary et al observation showed 1.66 external injuries

per victim. Skull has maximum number (28.96%) of fractures. [21,25] Other studies also report a similar nature of fracture.

CONCLUSION :

Deaths because of Road traffic accidents is an alarming

problem in the society. Due to the death or disability of the

affected person their families, friends, colleagues get effected

financially, emotionally and otherwise too. There is loss of

resources which ultimately decreases the economic growth of

the society. It asks for the necessity of establishing a decent and

prompt trauma services at the site and excellent pre hospital

care for the victims of RTA. The most common and life-

threatening injury suffered in RTA remains Head injuries. A

good neurosurgical care is the demand for such patients Apart

from that hospitals near to such sites should be equipped with

well experienced surgery, orthopaedic & anaesthetic teams

with advanced facilities like CT scans, USG and blood banks

can decrease the motility in case of RTA victims. It also

stresses upon the enhancement of the roads with the

upgradation of surfaces, increasing the visibility and

appropriate placement of road signs n traffic lights, removal of

unnecessary obstacles placed in the roads and extending the

width of roads at the narrow sections.

Source of Funding: None.

Conflict of Interest: None.

REFERENCES :

1. WHO Global status report on road safety 2018, Available

from:

https://www.who.int/violence_injury_prevention/road_s

fety status/2018/GSRRS2018_Summary_EN.pdf

7.12.19

2. Kaul A, Sinha U.S, Pathak Y.K, Singh A, Kapoor A.K,

Sharma S, Singh S.Fatal Road Traffic Accidents, Study of

Distribution, Nature and Type of Injury. JIAFM.2005;

27(2):71-75.

3. Mohan D. Road traffic injuries-a neglected pandemic.

Bulletin World Health Organisation 2003; 81(9):684-5.

4. Health Action Road Safety, a collective responsibility

April 2004.

5. Singh B, Palimar V, Arun M, Mohanty MK.Profile of

Trauma related Mortality at Manipal. KUMJ 2008;

6(23):393-398.

6. Sindhu DS, Sodi GS, Banerjee AK.Mortality Profile in

Trauma Victims. J Indian Med Assoc. 1993; 91(1):16-8.

7. Khajuria B, Sharma R, Verma A. A profile of the autopsies

of road accident victims in Jammu. J Clin Diag Res

2008;2:639- 42.

8. Ganveer GB and Tiwari RR. Injury pattern among non-

fatal road traffic accidents: A cross-sectional study in

151

central India; Indian J Med Sci 2005;59:9-12.

9. Kochar A, Sharma GK, Mutari A, Rehan HS. Road traffic

accidents and alcohol: A prospective study. International

Journal of Medical Toxicology & Legal Medicine.

2002;5:22–4.

10. Azmani W, Rusli MA, Ismail AA, Hashim M. Factors and

road accidents during festive seasons in Kelantan. NCD

Malaysia. 2005;4:24–7.

11. Moharamzad Y, Taghipour H, Firoozabad NH.

Mortality pattern according to autopsy findings

among traffic accident victims in Yazd, Iran. Chinese

J Traumatol 2008;11:329-34.

12. Jha N, Srinivasa DK, Roy G. Injury pattern among

road traffic accident cases: A study from South India.

Indian J Comm Med. 2003;28:85-90.

13. Rajesh DR, Kaur B, Singh A, Venkateshan M,

Aggarwal OP. Pattern of Injuries due to Fatal Road

Tr a ffi c A c c i d e n t s i n R u r a l H a r y a n a : A n

Epidemiological Survey. JIAFM 2012;34(3):229-

32.

14. Rajesh DR, Kaur B, Singh A, Venkateshan M,

Aggarwal OP. Pattern of Injuries due to Fatal Road

Tr a ffi c A c c i d e n t s i n R u r a l H a r y a n a : A n

Epidemiological Survey. JIAFM 2012;34(3):229-

32.

15. Kaul A, Sinha U.S, Pathak Y.K, Singh A, Kapoor AK,

Sharma Set al. Fatal Road Traffic Accidents , Study of

Distribution, Nature Type of Injury. JIAFM

2005;27(2):71-5.

16. Singh B, Palimar V, Arun M, Mohanty MK. Profile of

Trauma related Mortality at Manipal KUMJ

2008;6(23):393-8.

17. Menon A, Pai VK, Rajeeev A. Pattern of fatal head

injuries due to vehicular accidents in Mangalore.

Journal Forensic & Legal Medicine. 2008;15:75–7.

18. Bansal YS, Dikshit PC. Pattern of chest injuries in

fatal vehicular accidents in central Delhi.

International Journal of Medical Toxicology & Legal

Medicine. 2001;4:21–6.

19. Henriksson E, Ostrom M, Erikson A. Preventability

of vehicle-related fatalities. Accident Analysis

Prevention. 2001;33:467–75.

20. Toro K, Hubay M, Sotonyi P, Keller E. Fatal traffic

injuries among pedestrians, bicyclist and motor

vehicle occupants. Forensic Science International.

2005;151:151–6.

21. Salgado MSL, Colombage SM. Analysis of fatalities

in road accidents. Forensic Science International.

1988;36:91–6.

22. Singh H, Dhattarwal S, Mittal S. A review of

pedestrian traffic fatalities. J Indian Acad Forensic

Med 2007;29(4):55-8.

23. Gopal B K, Ahamed A, Ahamed F, Tonse S.B. Pattern

of Skull Fractures due to Blunt Force. JKAMLS

2015;24(2):27-31.

24. Singh YN, Bairagi KK, Das KC. An Epidemiological

Study of Road Traffic Accident Victims in Medico

Legal Autopsies. JIAFM 2005;27(3):166-9.

25. Chaudhary BL, Singh D, Tirpude BH, Sharma RK,

Veena M. Profile of road traffic accident cases in

Kasturba Hospital of M.G.I.M.S., Sevagram,

Wardha, Maharashtra. Medico-Legal Update.

2005;5:127–33.

152


INTRODUCTION :

Forgery is been practised since long back in all countries

where writing and papers were used for the financial purpose.

Forgery is fraudulent of genuine writing or alteration of

documents. In this case forgery can be done of full (1)documents/paper or only of writing/ signatures . But when we

talk about writing it is skill which is been acquired by ones in (2)his/her life-time. It is also a neuro-muscular task , so, copying

of one's character is bit impossible because copying of

anyone's minute detail of writing or living of own special

writing feature is work of lot practise. In forgery we consider

many characteristics of handwriting to identify its

genuineness. Some of the characters taken are:

•Unnatural appearance •Line quality

• Absence of rhythm

•Patching, Retouching & overwriting(3)• Emphasis on letter formation

In the present study we are comparing the Forged Urdu

signatures of two region peoples those who are not familiar to

Urdu language. The area covered in this study are Sikkim and

Kashmir. This study is useful for the forensic documents

examiners as when they examine the cases to link with the area

and person. Other study shows that when person do forgery

then their strokes are clumsy and tremorous. Also, they have

careful connection to hide the pen-lift while writing,

retouching looks like pen painting than original or genuine (4)writing . The study shows that Speed, wrinkleless and

acceleration of writing is more helpful while differentiation (5)between the genuine and forged writing . In one of the study it

is shown that when we examine single letter there is less

difference from original letter formation but in combination of

letters there is always more differences found, which shows (6)forgery also depend on letter connection and combinations . A

study was also done dependent on local base-line and primary (7)base-line to analyse different style of Arabic language . In one

of the studies it is found 12% of forged signature shown less

pen lift than the original and 22% shown the more pen lift than

the original. So, on the basis of this study it was concluded that

alone one of the characters i.e. pen-lift cannot form any definite (8)opinion in case of fixing the authorship .

MATERIAL S AND METHODS :

For this study 100 samples were collected out of which 50


Dr. Rajeev Kumar,


Galgotias University, Greater Noida, India.

Contact : +91-9411923188


KEYWORDS : Forensic Science, Handwriting, Forgery, Urdu handwriting, Docubox HD, Docucenter Nirvis.

Article History:Received: 29 November 2020Received in revised form: 13 December 2020Accepted on: 13 December 2020Available online: 15 August 2021

ABSTRACT :

Introduction: Forgery is an act of copying someone else signature or writing and while copying the act we have to keep in mind that

we imitate the characteristic of the real signatory in our forged writing and hide our own real characteristics of handwriting.

Material and Methods: In this study we have studied and analysed the forged Urdu signatures of Kashmir & Sikkim population

and target only to those people who are not familiar with the Urdu language.

Result: While analysing their sample we found that the Kashmir population have done forgery with less caution as they are not very

much emphasised on letter formation and re-touching and overwriting is found very less. While in Sikkim population its opposite as

their writing shows much stress on letter formation which automatically caused slower speed, retouching, overwriting in their

writing.

Conclusion: So, this study shows that knowledge of language is not only show impact while forgery but also the region cause

impact but both regions have different line-quality which is found common.

1. Syed Ahmar Ali Hashmi, Ph.D. Scholar, Galgotias University, Greater Noida & Junior Forensic/Assistant Chemical Examiner (Documents), Forensic Science Laboratory, Govt. of NCT of Delhi, India.

2. Shalvi Upadhyay, Assistant Professor & Coordinator, Forensic Science Department, Sharda University, Greater Noida, India.3. Rajeev Kumar, Associate Professor, Galgotias University, Greater Noida, India.

Comparative Study of Forged Urdu Signatures Done By Persons Not Familiar To

Language Belongs To Region of Sikkim And Kashmir


153

collected from Kashmir people who are unknown to Urdu

language and 50 samples from Sikkim of same category by

giving controlled Urdu signature and told them to copy the

signature at same paper by the best way they can.

For analysing the samples parameter were taken as follows:

Unnatural appearance, Line quality, Absence of rhythm,

Patching, Retouching & overwriting, Emphas i s on l e t t e r

formation

Instruments used :

Scientific instruments used for the analysis are Magnifying (9) (10) glass, Docucenter Nirvis & Docubox HD (Figure 1-2)

RESULT :

On analysis of these samples we found the below tables of each

features of both the region

DISCUSSION AND CONCLUSIONS :

In the table-1 we found that the Urdu unknown population of

Kashmir while doing forgery they unable to copy the line-

quality of controlled signature as 98% people have different

line quality from real signature but when we see the unnatural

appearance it is found in very less signatures which is 14%,

patching, re-touching and overwriting were also found in less

samples i.e. 12% which shows the effect of their region. Also,

the population less emphasised on the letter formation.

When we analysed the forged signature of Sikkim population

in table-2, we found that everyone has different line quality

than the real signature and rhythm is not found while doing

forgery of signature. 66% persons were emphasized on letter

formation which cause decrease in their speed of writing also.

40% of population have patching, re-touching and overwriting

in their forged signatures and 55% shows unnatural

appearances in their signature while doing forgery.

When we compare forged signature of Urdu unknown

population of Sikkim and Kashmir, we found that the Kashmir

population who are unknown to language are quite good in

Urdu due to region where they live. They don't know the

language but they are familiar because they belong to that

environment where maximum persons are having knowledge

of Urdu. This shows that instead of their self-knowledge about

the language their region also effects the skill which help them

while doing the act of forgery which is not seen in the forged

writing of Sikkim population as their region in not that kind of

population as Kashmir have. So, Sikkim population were more

emphasised on letter formation while doing forgery which

cause unnatural appearance in their samples and also shows

patching, retouching and overwriting in their forged samples.

Conflict of Interest :

No potential conflict of interest reported by the authors.

Source of funding : NIL

154

Fig. 3: Comparative analysis of forged signature written by Kashmir & Sikkim Population.

Fig-1 Docucenter Nirvis Fig-2 Docubox HD

Kashmir RegionFeatures taken for analysis

S.No.

Unnatural appearance

Line quality

Absence of rhythm

Patching, Retouching & overwriting

Emphasis on letter formation

1

2

34

5

Forged signature features

14% shows Unnatural appearance

98% Changed from original signature

58% don't have rhythms

12% found patching, Retouching & overwriting

32% emphasised on letter formation

Table 1: Analysis of Signature Written by Kashmir Region Population.

Features taken for analysis

S.No.

Unnatural appearance

Line quality

Absence of rhythm

Patching, Retouching & overwriting

Emphasis on letter formation

1

2

34

5

Forged signature features

55% shows Unnatural appearance

100% Changed from original signature

100% don't have rhythms

40% found patching, Retouching & overwriting

66% emphasised on letter formation

Table 2 : Analysis of signature written by Sikkim region population.

Sikkim Region


REFERENCES :

1. Koppenhaver KM. Forensic document examination:

principles and practice: Springer Science & Business

Media; 2007.

2. Huber RA, Headrick AM. Handwriting identification:

facts and fundamentals: CRC press; 1999.

3. Sharma B. Handwriting forensic2018. 341-59 p.

4. Puri D. Study of a copied forgery. Journal of Security

Administration. 1980;3(2):79-87.

5. Chen H-C. Forged Handwriting Detection,”. Proceedings

of Student Research Day, CSIS, Pace University.

2003:9.1-9.6.

6. Pervouchine V, Leedham G. Extraction and analysis of

forensic document examiner features used for writer

identification. Pattern Recognition. 2007;40(3):1004-13.

7. Razzak MI, Sher M, Hussain S. Locally baseline

detection for online Arabic script based languages

character recognition. International Journal of Physical

Sciences. 2010;5(7):955-9.

8. Dewhurst TN, Ballantyne, K. N., & Found, B. Exploring

the significance of pen lifts as predictors of signature

simulation behaviour. . Journal of the American Society of

Questioned Document Examiners. 2015;18(2):3–16.

9. Projectina. Docucenter Nirvis 2020. Available from:

https://www.assing.it/wp-content/ uploads/ 2017/ 04/

dc_nirvis.pdf.

10. U l t r a . D o c u b o x H D 2 0 2 0 . Av a i l a b l e f r o m :

https://www.ultra-forensictechnology.com/en/our-

products/document-examination/docubox-hd.

155



INTRODUCTION :

The Urdu language is originated in north India in 12th century.

It is influenced by four different languages i.e. Persian, Arabic,

Turkish and Hindi. Due to similarity in grammar with Hindi

language, Urdu language is referred as sister language of

Hindi. During 14th century the Urdu language used for official

work & literature. After partition of India & Pakistan in 1947 (1)Urdu language was chosen as official language in India . In

present, there are almost 26Lakh people in Delhi who have a

knowledge of Urdu language which is around 14% of the total (2)population of Delhi . When we take under consideration of

forgery of Urdu language then still maximum population are

unknown about the script and rules of writing to this language.

So, when we study the writing habit of unknown Urdu writer

which we generally got in case of forgery which is done for

some mean purpose, then many of the characteristic been

found which shows their knowledge of Urdu script. Apart from (3)the characteristic of forgery which is commonly found in any

forgery case of any language some new characteristic are

found like many of them don't focus on the starting point of

letters and some knows that Urdu is written from right to left so

they start from right to left point but at the time of formation of

letters in the middle of any signature of sentence they only

focus on pictorial effect and forget to focus on initial or

commencement of letters. In the below study we focused on

the characteristic of forgery and also some of the new criteria

which can be only found in forgery of Urdu language and

which also establish the fact that forgery of Urdu signature or

writing done by any population also shows the knowledge of

that population in language. Pervouchine & Leedham shows in

their studies that when we take single character its shows less

discr iminat ion but in the combinat ion of le t ters

discriminations are more which shows writing in forgery also (4)effected by the adjacent letters and combination of letters .

Razzak & Hussain also studied different style of Arabic

language with the help of local base-line and primary base-(5)line .

KEYWORDS : Forensic Science, Urdu script, Forgery, Tremors, Docucenter Nirvis, Docubox HD, handwriting characteristics.

ABSTRACT :

Introduction: Urdu is considered as one of the official languages of Delhi and used in almost all official old documents.

Materials and Methods: In this study we find out the common characteristics features of forged Urdu signature written by Urdu

Unknown Population of Delhi. The considered population is a group of people who are graduate by educational qualification and

know at least Hindi & English language. For better & conclusive result 100 sample of forged Urdu writings/signatures were taken

from the group of people by showing them sample Urdu signature. Tremors, Movement, Strokes, Speed, Connectivity of letters and

Alignment are the parameters which were consider for examination, also some of the instruments like Docucenter Nirvis works on

software PIA 7000, Docubox HD works on software PIA 7000, Different Magnifying Glasses etc were used.

Results :The analysis revels that the unknown writer of Urdu script initiated the formation of letters in a mixed movement which

shows in some letter's writers started from left to right and some letters they started from right to left. Whereas, Urdu is always

written from right to Left. Also, pen pressure is extremely high, the width of stroke is comparatively thick. This identification is

based upon basic characteristic of forgery and Urdu letter formation.

Forensic Characteristic Identification of Forged Urdu Signature Written By

Population of Delhi Who Are Stranger To The Language.


156

1. Syed Ahmar Ali Hashmi, Ph.D. Scholar, Galgotias University, Greater Noida & Junior Forensic/Assistant Chemical Examiner (Documents), Forensic Science Laboratory, Govt. of NCT of Delhi, India.

2. Shalvi Upadhyay, Assistant Professor & Coordinator, Forensic Science Department, Sharda University, Greater Noida, India.3. Rajeev Kumar, Associate Professor, Galgotias University, Greater Noida, India.


Dr. Rajeev Kumar,


Galgotias University, Greater Noida, India

Contact : +91 94119-23188


Article History :





Aims: Analysing the common forgery characters of Urdu

Unknown Population of Delhi.


Sample size - 100 Samples of forged Urdu signatures from

non-familiar population of Delhi.

Sample collection - Sample collection was done by taking

Urdu signatures of Real Signatory and then told to the other

population to forged the same signature by keeping the

controlled signatures as a reference. Below are images of

sample collection: (Figure 1-2)

Following are the parameters which were taken for the sample

analysis:

1. Commencement of Signature

2. Terminal Point of Signature

3. Pen Pressure

4. Skill

5. Tremors

6. Speed

7. Size

Instruments used- Scientific instruments used for the analysis (6) (7)are Magnifying glass, Docucenter Nirvis & Docubox HD

RESULTS :

We have done our study on 100 sample taken from Urdu

unknown population of Delhi and after examination we found

many points that shows the knowledge of language and

characteristic features of forgery. Points found during our

examination are explained below with the help of some of the

images of our sample (Figure 3).

In the below image as we see that the sample Urdu signature of

real signatory show freedom in execution in their strokes, it is

having blunt nature of commencing stroke along with sharp

tail ending in terminal stroke which is the characteristic feature

of genuine signatures, the movement of signature is wrist cum

finger movement and the signature moves from right to left and

show less pen pressure. When we compare this genuine

signature with the forged signature in the below fig 3 we

observed that the forged signatures is lacking on many

parameters such as if we see at marking 1, 4, 6 & 7 in forged

sample it is showing the commencement of the signature with

the blunt or hook commencement and if we see the marking 3 it

is show the terminal ending of letter 'Ain'( ع) is start from left to

right. At marking no.7 we see tremors & high pen pressure that

shows slow speed of execution of forged signature. Then at

marking no. 2, 5 & 6 the strokes are very thick which shows

that the speed of the signature is slow. In the terminal curved

body part of letter 'Choti Ye'(ى ) in forged signature the size of

terminal curved body part shows larger difference in size

which cannot be considered under natural variation. When we

see the letter 'Alif'(ا ) the commencement & terminal strokes

are blunt along with size difference. In some of the Urdu letters

like 'ع' & 'ل' ,'ى' in forged sample writer started from left to right

whereas in letters like 'م’ & 'ر' ,'ح’ in forged sample writer

started from right to left which shows that writer is not well

known with language he just follow the pattern of English

language and started the letter from where it superficially

looking at top initiation. After considering all these points

which differ in forged signatures shows that the people who are

executed these signatures for forgery are not very familiar to

the language and they mostly focused on the pictorial design of

the letters in signature and because of which their speed and

fluency in the signature not matched with the sample signature

of real signatory.

From the above analysis when we considered collectively of all

samples which is shown by pie chart in figure 4, we found that

83% of population were using mixed type of commencing and

ending the letter i.e. from left to right and right to left whereas

very few i.e. 15% were actually following the rule of writing

Urdu script. Apart from this if we see the other forgery

characteristic then, speed of 90% people is slow whereas when

we see the size of letter then most of them which is 86% people

157

Figure 1: Sample Signature by real signatory Figure 2: Forged Signature by Delhi population

1 2

Figure 3: Table showing the variation during forgery


increased the size of letter at the time of forgery but few of them

i.e. 14% decreased the size also. Unnatural tremors were also

seen in most of the forged sample, 93% of forged samples were

having tremors while doing the act of forgery.

DISCUSSION :

Urdu script examination is one of the challenging areas in

document examination. Many studies were done on Urdu

writing examination. In one of the studies it is shown that

mainly seven character i.e. 'Alif' , 'Be', 'Waoo', 'Daal', 'Re',

'Kaaf' and 'Ze' show maximum variation in their initial and

middle portion while formation(8). Some other studies have

also done which is based on peculiar writing system(9) and

also on categorical measure of cursive handwriting(10).

In present study the forged Urdu signature were analyzed

which were written by the people those who are not familiar

with Urdu language and it is found that they mostly emphasize

on the pictorial formation of letter and not even bothered about

the fact that the formation of Urdu letters will always take place

from right to left. They used any of the direction for the

formation and in that activity their speed was also decreased

and most of them increased the size of letters also. The basic

forgery features were prominent and also the knowledge of

language among the people can also be easily seen. This fact

can be of great importance for the Forensic Document

Examiners at the time of examining forged Urdu writing or

signatures.

CONCLUSION :

Based upon the scientific finding the forged samples revels that

the Urdu Unknown population of Delhi write in a mixed

manner i.e. from left to right & right to left direction in a

signatures and the pressure is extremely high, the writer is

more focused on pictorial design and formation of letters rather

than basic of Urdu script as they form letters opposite to the

writing rule of Urdu script, also at the time formation of letter

the size of letters is bigger than usual. Beside this blunt nature

of commencement & terminal strokes which show the speed of

writer and is also the most important characteristic of forgery

apart from that tremors, pen pauses, pen lifts which are also the

basic characteristic of handwriting forgery is present.

Hence, we can conclude that apart from the basic characteristic

of handwriting forgery, the Urdu unknown population of Delhi

also differ in their formation of Urdu letter and way of Urdu

language writing.

Conflict of Interest and Source of Funding : Nil.

REFERENCES :

1. London UC. Urdu Language – history and development 2020.

Available from:

https://www.ucl.ac.uk/atlas/urdu/language.html.

2. Wikipedia. States of India by Urdu speakers 2020. Available

from:

https://en.wikipedia.org/wiki/States_of_India_by_Urdu_speak

ers.

3. Osborn AS. Questioned Documents: A Study of Questioned

Documents with an Outline of Methods by which the Facts May

be Discovered and Shown: Lawyers' co-operative publishing

Company; 1910.

4. Pervouchine V, Leedham G. Extraction and analysis of forensic

document examiner features used for writer identification.

Pattern Recognition. 2007;40(3):1004-13.

5. Razzak MI, Sher M, Hussain S. Locally baseline detection for

online Arabic script based languages character recognition.

International Journal of Physical Sciences. 2010;5(7):955-9.

6. Projectina. Docucenter Nirvis 2020. Available from:

h t t p s : / / w w w. a s s i n g . i t / w p - c o n t e n t / u p l o a d s /

2017/04/dc_nirvis.pdf.

7. Ultra. Docubox HD 2020. Available from: https://www.ultra-

forensictechnology.com/en/our-products/document-

examination/docubox-hd.

8. Naqvi N, Saran V, Mishra MK. Study of Urdu alphabet and

character for forensic examination. Eur J Forensic Sci Jan-

Mar2017: Vol.4(1):21.

9. Hensel E, Khan I, Dizon J. Forensic examination of peculiar

writing systems. Journal of the Forensic Science Society.

1973;13(2):143-52.

10. Eldridge M, Nimmo-Smith I, Wing A, Totty R. The dependence

between selected categorical measures of cursive handwriting.

Journal of the Forensic Science Society. 1985;25(3):217-31.

158

Figure 4: Pie-chart showing the forgery characteristic done by percentage of populations


159



1. Latif Rajesh Johnson, Assistant Professor*

2. Ranjit Immanuel James, Assistant Professor*

*Department of Forensic Medicine & Toxicology, Christian Medical College Vellore, Tamil Nadu

Key words: Assessment, Classroom response system, Clickers, Didactic lecture, Medical education


Dr. Ranjit Immanuel James,


Department of Forensic Medicine & Toxicology, Christian

Medical College Vellore, Tamil Nadu

Contact : +91 81056-94947


Article History :

Received : 4 November 2020

Received in revised form : 16 April 2021

Accepted on : 16 April 2021


INTRODUCTION :

Since time immemorial, knowledge has been passed from one

generation to the next. Like all other professions, healers and

physicians have also imparted their knowledge and skills to

students or apprentices. Many different techniques have been

developed and used by teachers over centuries to help teach

their students. Similarly, many techniques have also been

developed to assess if the student has learnt or acquired

knowledge and skill.

The traditional, didactic lecture is the most common teaching

tool in medical education. Didactic lecture is a time efficient

and economical way to teach concepts in medicine to large

groups of students. However, they have their drawbacks.

Medical students may find them very unidirectional, passive

and even monotonous. Despite the best efforts of the teacher 1,2

to encourage students to focus and understand the core

concepts, the lecture may not always suit the learning needs of

all students.3

Modern day medical education has evolved to demand a lot

from both the student and the teacher. The medical teacher has

to not only take a class but also keep the class fresh, relevant

and interesting for the students. Medical students are

increasingly comfortable with technology and interactive

content. They often find it challenging to maintain

concentration during a class. Engaging a class during a lecture

is an even bigger challenge when the number of students is

very high, often 200 to 250 students in a batch. Encouraging

active learning and making teaching sessions engaging is now

of great interest to educators.4-7

Teachers often use basic methods of instant evaluation like a

simple show of hands as an agree or disagree response to a

question. Others have used colour coded flashcards with each

colour corresponding to a particular option in a multiple-

choice question (MCQ). The use of “clickers”, which are small

hand-held devices that students can use to respond to

questions, posed during a teaching session is fast gaining wide

popularity.

Clickers in Medical Education – Boon or Bane?

ABSTRACT :

Introduction: Modern-day medical education has evolved to demand a lot from both the student and the educator. The medical

teacher has to not only take a class but also keep the class fresh, relevant and interesting for the students. Despite the best efforts of

the teacher to engage the students, the traditional didactic lecture may fall short in holding their attention. Classroom response

system (CRS) like “clickers” provide an accessible means of assessing students and also provide immediate feedback.

Methodology: The authors used the clickers during theory classes in the form of pre- and post-lecture tests, and as monthly exams

of Forensic Medicine & Toxicology. Towards the end of their Forensic Medicine & Toxicology curriculum, the students were asked

to give their feedback anonymously in the form of a 5 point Likert scale. Ninety-four students submitted the feedback, which was

then analysed.

Results: Although 77.7% of students agreed that the clicker-based tests were far less stressful than conventional written tests, only

49.9% felt that clicker-based tests were more convenient. 56.4% thought that the clicker-based tests removed variability between

the examiners. 45.7% felt that adequate assessments were conducted over the duration of their course and 73.3% felt they had

sufficient preparation time. From a technical standpoint, 69.2% students faced a glitch at least once during the clicker-based tests.

Conclusion: Clickers can be a useful teaching tool, especially when used to review performance and give immediate feedback

160


Christian Medical College Vellore has adopted Turning point

(Turning technologies) with radiofrequency receivers as the

preferred audience response system. Each student is issued a

clicker during admission into first year of college. They are

given an orientation on how to use the clickers in class. The

supporting software “Turning Point” is installed in computers

of all lecture halls.

The authors used the clickers in two different scenarios in the

teaching and assessment of Forensic Medicine & Toxicology.

1. Routine lecture: The authors incorporated pre and post-

lecture quizzes as either True or False questions or MCQs in

their lectures. 5 to 10 questions on the topic for the class were

projected on the screen before starting the class and the same

questions were projected again after the lecture. This enabled

the authors to immediately assess if any part of the lecture was

not well understood. It also enabled the authors to see which

students had difficulty in understanding the concepts or if any

concept needed further elaboration.

2. Monthly exams: The monthly exams were conducted in

Multiple-choice questions (MCQs) format. Three different

types of questions were prepared. The questions were designed

to assess either the knowledge or understanding or application

of knowledge and understanding. The batch of 100 students

was divided into two groups of 50. Each group were assigned a

separate lecture hall as a venue for the monthly exam. The

exams were conducted simultaneously in both the lecture halls.

The questions were projected on the screen with a timer and

students were asked to respond using the clicker in the allotted

time. In case there was a failure of the technology the authors

also provided the students a paper sheet on which they could

write the answer as well. In such a situation the written answer

was considered.

RESULTS :

The students were administered a feedback survey using 5

point Likert scale towards the end of their fifth semester in

2018 at the end of the Forensic Medicine & Toxicology

curriculum. Ninety-four students were in attendance on the day

feedback was administered. This feedback was then analysed

retrospectively. (Table 1)

DISCUSSION:

How are clickers used in teaching sessions?

These classroom response systems (CRS) or audience

response systems (ARS) are also called as “keypads'' or

“clickers” in the United States and “zappers” or “handsets” in

the United Kingdom. Clickers can be used along with multiple 8

Well organised

Clear instructions

Sufficient time for answering each question

Less stress

Removed variability between examiners

More convenient

Better assessment of knowledge and understanding than

conventional written tests

Pre and post-lecture were useful for self-evaluation

Adequate tests were conducted over the duration of the

course (1.5 years)

Adequate time was given between tests

Syllabus was clearly demarcated

Questions projected on the screen were clear

Questions covered the prescribed syllabus

No technical difficulties tests.

Any technical difficulties were appropriately handled.

Preference over conventional written tests

Forensic Medicine assessments should be clicker-based.

8.5

18

23.4

32

14.8

14.8

8.5

28.7

7.4

14.8

27.7

33

16

1

10.6

8.5

5.3

39.3

59.5

50

45.7

41.4

35.1

25.5

52.1

38.3

58.5

56.4

44.7

42.5

17

37.2

11.7

21.3

15.9

11.7

14.8

10.6

33

12.8

23.4

9.6

21.3

13.8

6.3

10.6

25.5

12.8

27.7

18

17

25.5

5.3

10.6

8.5

5.3

22.3

24.5

7.4

22.3

8.5

5.3

9.6

12.8

37.2

11.7

27.7

23.4

10.6

5.3

1

3.2

5.3

14.8

18

2.1

10.6

4.3

4.3

2.1

3.2

32

12.8

34

33

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

Questions S.No.

Strongly agree (%)

Agree (%)

Not sure (%)

Disagree (%)

Strongly disagree

(%)

Table 1: Students feedback comparing clicker-based tests with conventional written tests as an assessment method.


161

choice questions (MCQ) to independently assess students

understanding in real-time during a class. The responses can

be recorded in real time and the results can be displayed if

needed, making the class more engaging. This method of

assessment encourages the student to commit to an answer,

thus promoting engagement in both the assessment process

and subsequent feedback. Such an assessment provides the 9-12

teacher with a chance to identify students who are struggling

with understanding concepts, allowing an opportunity for

clarifications. The electronic classroom response systems 13

have other advantages such as anonymity of respondents and

storage of data for future reference. Towards this end, the

authors have used CRS during lectures in the form of pre-test

and post- tests and to conduct monthly examinations.

A student responds to a question projected on a screen using the

clicker which transmits the information to a receiver connected

to a computer. The software on the computer records the results

and collates the data, allowing the teacher to get real-time

information. The first-generation clicker only had a single

button for response. The latest versions of the clickers have a 14

10-digit alpha-numeric keypad, screen, accessory functions

keys, power button, and channel button which permit text

entries. The earliest generations of clickers were connected by

wires to the computer but the latest versions are wireless and

they transmit their response either by radiofrequency (RF)

signals or infrared (IR). The radiofrequency signals require a

single receiver, don't interfere with other IR emitting devices

and don't need a direct line of sight between the receiver and

the student.

Each student is assigned a clicker with a unique ID, thus the

response from each student can recorded and identified

accurately by using the clicker ID. Once the polling or time to

respond to the questions is over, the teacher can choose to

display the correct response and the percentage of various

responses on the screen in the form of a bar diagram or other

such representations. Some software offer more sophisticated

analysis of the responses, and most setups are easy to use with 15

intermediate computer skills.

Are clickers necessary for interactive teaching sessions?

There is increasing use of technology in classes and it is

worthwhile using technology in the classroom when it

addresses a specific instructional requirement. This is 16

certainly relevant when simple technology can be used to

overcome difficulties and maximize the potential of traditional

delivery. Many institutions have adopted the use of clickers

with hoping to address the lofty attrition rates of didactic

lectures.17

Studies show that students recall the initial five minutes of a

lecture the most. We can use clickers to leverage this time and 18

attempt to engage the students and emphasize the important

concept. This activity during the initial period, can make the

students attentive for the rest of the session. Studies have 19

shown that the use of clickers have enhanced the engagements

of the students in the classroom. 20-23

The anonymity granted to students by using clickers is

probably another benefit. Even a student who is shy and does

not normally engage with the teacher in the class, can use the

clicker to participate in the class and can also assess where they

are in comparison to the rest of the class. This helps them gain

confidence. Clickers give students the opportunity to

independently assess their understanding of core concepts in a

non-threatening manner. According to a study conducted by

Caldwell, students were twice as likely to respond to a question

if the mode of submitting answers is through clickers. Some 12

studies suggest that higher order of learning is due to classroom

participation and interaction, as peer discussions also

encourage peer learning. However, many studies have 24,25

shown that the use of clickers may potentially decrease the

time available for the lecture. Their application in clinical 26

teaching is also becoming common and studies have shown

their use to be beneficial due to their ability to increase student

interaction and to promote knowledge retention.27-30

What can clickers be used for?

1. To initiate or increase interaction with students: The

teacher can use questions which focus on or start

discussions, or questions which require peer 31-33interactions. The teacher can also use open ended

questions to get feedback on a particular question

2. To evaluate the preparedness of the student and ensure

accountability: The teacher can give homework or self-

directed learning assignment to the students. A quick quiz

or poll can be conducted before the next class to assess the

students on that topic. This will ensure that the student is 32accountable for completing the assignment.

3. To assess the students' knowledge

i. Conduct a Pre-test to assess the pre-existing

knowledge on the topic.

ii. Conduct a Post-test after the class to assess the change

in knowledge.

iii. Higher order questions can be designed and

administered using clicker.

iv. Open ended questions requiring short answers can be

asked.

4. For quiz programs: Clickers can be used to conduct

quizzes among students. Depending on the question it can


162

determine the active thinking process or reasoning skills of the 33 students. Analysis of the student feedback shows that a

majority of the students felt that the clicker-based tests were

well organised. The students also agree they were given clear

instructions regarding the use of clickers and the nature of the

assessments. 73.4% of the students also concurred that they

were given sufficient time to answer questions during the

clicker-based tests.

A better part of the class, (77.7%) agreed that the clicker-based

tests were far less stressful than written tests. Surprisingly, only

half the students (49.9%) felt that clicker-based tests were

more convenient than conventional written tests. Although

more than half the students (56.4%) thought that the clicker-

based tests removed variability between the examiners, almost

a third of them were not sure. Less than half the students

(45.7%) felt that adequate assessments were conducted over

the duration of their course and nearly three-fourth of them

(73.3%) felt they had sufficient preparation time.

Studies suggest that using clickers in a lecture can transform a

didactic lecture into a discussion-style session, with the 11responses via clicker facilitating deeper discussions.

Unfortunately, the time taken for discussion may not leave

sufficient time for covering all the topics unless the class is

planned meticulously. Now, contrary to the other studies,

almost two-third of the students did not have a positive

response regarding understanding of the topic being covered.

In fact, 42.5% of the students felt that knowledge retention and

understanding were better during conventional written tests.

Although an overwhelming majority of them (80.8%) agree

that clicker-based tests were the ideal tools for self-evaluation.

From a technical standpoint, 69.2% students faced a glitch at

least once during the clicker-based tests, although, most of

them agreed that they were promptly assisted by the teaching

faculty. A concern raised by the students was that the

University examinations are in the conventional written

format, so they would rather familiarize themselves with that

pattern of assessment. These factors probably are a reason why

two-third of the students (61.7%) preferred conventional

written tests.

Advantages of using clickers:

a. Real time and instant evaluation are possible

b. Active participation from students

c. Detailed statistical analysis possible

d. No need for attendance as their clicker IDs can be matched

with their names

e. Multiple options are available:

i. First response only (if a student once responds he/she

cannot change their answer)

ii. Timer function for every question (polling will stop

as soon as the timer ends)

iii. Colour coding or highlighting the correct answers

iv. Hiding the response results in histogram

f. Manual evaluation is not needed

g. Data can be analysed in many ways. For example:

question to question based (comparative results will show

whether students correct their mistakes after the lecture),

question to student based, etc.

h. While taking a poll in the class, the anonymous nature of

responses encourages shy students to participate.

i. Instant feedback can be given based on the responses

recorded.

j. It saves a lot of time since the evaluation and analysis of

the result is automatic.

k. The data can be exported into excel for documentation

Disadvantages of using clickers:

a. The students or the college have to purchase the clickers

and the receivers

b. Some basic computer knowledge is needed by the teacher

to use the software

c. Despite your best effort technical errors may still happen

d. The battery in the clicker can run out and hence the student

should check the clicker prior to every exam.

e. It is possible that one receiver may receive responses from

another hall if both the halls are using the same channel

number. The authors have faced such difficulties during

one of the examinations.

f. Clicker-based tests is not congruent with current

University examinations, which is based on conventional

written tests.

Alternative to using clickers: The ongoing pandemic has put

a fresh emphasis on technological assistance for taking classes.

One of the developments that has come to the fore is the use of

online polling software like poll everywhere which is available

from www.pollev.com. The poll everywhere can be

downloaded as a plugin to Microsoft PowerPoint. During an

online class using PowerPoint all participants can log onto

www.pollev.com and enter responses. These responses can be

seen live on the screen in real time or can be saved for analysis

and review later.

CONCLUSION :

Several studies have questioned the effectiveness of a didactic

lecture as a teaching tool. It is often said that lectures are more


163

teacher-centric and that they do not promote problem solving.

It has also been said that lectures lack interaction and are not

engaging enough for students to foster their critical skills. The

Competency Based Medical Education guidelines has

significantly reduced the time allotted for didactic lectures and

is actively encouraging other forms of teaching and learning.

For the students, the sessions when clickers were used were

more enjoyable and engaging and the majority perceived the

devices to have a positive impact on their self-evaluation.

Various studies have shown, the positive effects of clicker

usage surpass their disadvantages. Though there are technical

aspects to consider for the usage of clickers on a regular basis,

it is evident that clickers positively influence the student

response rates and drastically minimizes the time required for

assessment. Furthermore, the anonymity offered to students

by clickers encourage inclusion and engagement. In

conclusion, clickers can be a useful teaching tool, especially

when used to review performance and give immediate

feedback.

Acknowledgement: The authors would like to thank Dr.

Daniel Manoj for his critical inputs and valuable insights.

Ethical Committee Clearance: Approved by Institutional

Review Board

Funding: None

Conflict of interest: None

REFERENCES :

1. Mascolo MF. Beyond student-Centered and teacher-

Centered pedagogy:teaching and learning as guided

participation. Pedagogy Human Sci.2009;1(1):3–37.

2. Young MS, Robinson S, Alberts P. Students pay attention!

Act Learn High Educ. 2009;10(1):41–55.

3. Mattick K, Crocker G, Bligh J. Medical student

attendance at noncompulsory lectures. Adv Health Sci

Educ Theory Pract. 2007;12(2):201–10.

4. Courtier J, Webb EM, Phelps AS, Naeger DM. Assessing

the learning potential of an interactive digital game versus

an interactive-style didactic lecture: the continued

importance of didactic teaching in medical student

education. Pediatr Radiol. 2016;46(13):1787–96.

5. Duggan PM, Palmer E, Devitt P. Electronic voting to

encourage interactive lectures: a randomised trial. BMC

Med Edu. 2007;7:25.

6. Palocaren J, Pillai LS, Celine TM. Medical biochemistry:

is it time to change the teaching style? Natl Med J India.

2016;29(4):222–4.

7. Dhaliwal HK, Allen M, Kang J, Bates C, Hodge T. The

effect of using an audience response system on learning,

motivation and information retention in the orthodontic

teaching of undergraduate dental students: a cross-over

trial. J Orthod. 2015;42(2):123–35.

8. D'Inverno R. Using a personal response system for

promoting student interaction. Teach Math Appl Int J

IMA. 2003;22(4):163–9.

9. Wit E. Who wants to be… The Use of a Personal Response

System in Statistics Teaching. MSOR connect.

2003;3(2):14–20.

10. Beatty ID. Transforming student learning with classroom

communication systems [Internet]. arXiv [physics.ed-

ph]. 2005. Available from:

http://arxiv.org/abs/physics/0508129

11. Beatty ID, Gerace WJ, Leonard WJ, Dufresne RJ.

Designing effective questions for classroom response

system teaching. Am J Phys. 2006;74(1):31–9

12. Caldwell JE. Clickers in the large classroom: current

research and best-practice tips. CBE Life Sci Educ. 2007

Spring;6(1):9–20.

13. Lang J. Metacognition and Student Learning [Internet].

The Chronicle of Higher Education. 2012 [cited 29

October 2020]. Available from:

https://www.chronicle.com/article/metacognition-and-

student-learning/

14. Poulis J, Massen C, Robens E, Gilbert M. Physics

lecturing with audience paced feedback. Am. J. Phys.

1998;66(5):439-441.

15. Roschelle J, Penuel WR, Abrahamson L. The networked

classroom. Educ. Leadership. 2004;61(5):50-54.

16. Draper S. Niche-based success in CAL. Comput. Educ.

1998;30(1):5-8.

17. Burnstein RA, Lederman LM. Using wireless keypads in

lecture classes. Phys Teach. 2001;39(1):8–11.

18. Burns RA. (1985). Information Impact and Factors

Affecting Recall. Presented at Annual National

Conference on Teaching Excellence and Conference of

Administrators, Austin, TX, May 22–25, 1985. Available

from: https://eric.ed.gov/?id=ED258639

19. Elliott C. Using a personal response system in economics

teaching. Int Rev Econ Educ. 2003;1(1):80–6.

20. MacGeorge E, Homan SR, Dunning JB, Elmore D, Bodie

GD, Evans D, Lichti S. The influence of learning

characteristics on evaluation of audience response

technology. Journal of Computing in Higher Education.


164

2008;19(2):25-46.

21. Boatright-Horowitz SL. Useful pedagogies or financial

hardships? Interactive response technology (clickers) in

the large college classroom. International Journal of

Teaching and Learning in Higher Education.

2009;21(3):295-298.

22. Hoffman C, Goodwin S. A clicker for your thoughts:

technology for active learning. New Libr World.

2006;107(9/10):422–33.

23. Greer L, Heaney PJ. Real-time analysis of student

comprehension: An assessment of electronic student

response technology in an introductory earth science

cour se . Jou rna l o f Geosc ience Educa t ion .

2004;52(4):345-351.

24. McKeachie W. Research on college teaching: The

historical background. Journal of Educational

Psychology. 1990;82(2):189-200.

25. Smith D. College classroom interactions and critical

thinking. Journal of Educational Psychology.

1977;69(2):180-190.

26. Simpson V, Oliver M. Electronic voting systems for

lectures then and now: A comparison of research and

practice. Australas J Educ Technol [Internet]. 2007;23(2).

Available from: http://dx.doi.org/10.14742/ajet.1264

27. Pradhan A, Sparano D, Ananth CV. The influence of an

audience response system on knowledge retention: an

application to resident education. Am J Obstetr Gynecol.

2005;193(5):1827–30.

28. Schackow TE, Chavez M, Loya L, Friedman M. Audience

response system: effect on learning in family medicine

residents. Fam Med. 2004;36(7):496–504.

29. Latessa R, Mouw D. Use of an audience response system

to augment interactive learning. Fam Med.

2005;37(1):12–4.

30. Mains TE, Cofrancesco Jr J, Milner SM, Shah NG,

Goldberg H. Do questions help? The impact of audience

response systems on medical student learning: a

randomised controlled trial. Postgrad Med J.

2015;91(1077):361–7.

31. Trees AR, Jackson MH. The learning environment in

clicker classrooms: student processes of learning and

involvement in large university‐level courses using

student response systems. Learn Media Technol.

2007;32(1):21–40.

32. Knight JK, Wood WB. Teaching more by lecturing less.

Cell Biol. Educ. 2005;4(1):298–310.

33. Draper S, Cargill J, Cutts Q. Electronically enhanced

classroom interaction. Aust. J. Educ. Technol.

2002;18(1):13–23.




Dr. Rajinder Saini,

Post Graduates,

Department of Forensic Medicine, MMIMSR, Mullana Distt. Ambala

Contact : +91 9138149887


KEYWORDS : Stature, Index finger, Length


INTRODUCTION :

Identification of deceased especially in a dismembered body is

a herculean task for forensic expert and estimation of stature

helps in such cases. There is an established relationship

between stature and different parts of the body. Every body

part has a more or less constant relationship with stature. This

relationship between different body parts can help a forensic

expert to calculate stature from mutilated and dismembered

body parts in forensic examinations.

Various studies in past have utilized various body parts such as

upper and lower extremities including hand and foot 1-2dimensions for estimation of stature. Studies were also

3-conducted to estimate stature from hand and phalange lengths4 however only recently studies were conducted using finger

5-12lengths.

The formula for stature estimation has to be population

specific and there is paucity of studies on such parameters.

Thus in view of above said reasons & importance of estimation

of stature from the different body parts, the present study was

undertaken.


The present study was undertaken with aim of measuring the

stature from the length of right index finger on 31 male & 33

female normal healthy MBBS students of MMIMSR,

Mullana who are natives of State of Haryana (3 generations &

above).

Individuals with any musculo-skeletal deformity like

kyphosis, scoliosis, poliomyelitis, trauma, amputation

(surgical or accidental) and Individuals with nails extending

over the fingers were excluded.

Measurements: The measurements were taken at a fixed time

between 2.00 to 4.00 PM to eliminate diurnal variation and by

the same person to avoid personal error in methodology.

a) Stature (Using Stadiometer) It was measured as vertical

distance from the vertex to the foot by making the subject

to stand erect on a horizontal resting plane on the

stadiometer bare footed. Palms of hand turned inwards

and fingers horizontally pointing downwards and head

oriented in eye-ear-eye plane (Frankfurt Plane). The

movable rod of the stadiometer is brought in contact with

ABSTRACT:

Introduction: Stature is an important and useful anthropometric parameter to establish partial identity of an individual. There is an

established relationship between stature and different parts of the body which can help a forensic expert to calculate stature from

mutilated and dismembered body parts in forensic examinations.

Materials and Methods: Relationship between percutaneous length of right index finger and stature was carried out on 31 males

and 33 females students.

Results: Significant correlation exists between stature and finger length. Pearson correlation between finger length and stature was

higher among females than males.

Conclusions: These findings suggest that index finger length can be used as predictive tool for stature calculation of an individual

by Anthropologists and Forensic Medicine experts.

1. Sabina Bashir, Senior Resident, Department of Forensic Medicine & Toxicology, SKIMS Medical College and Hospital,

Bemina, Srinagar

2. Rajender Kumar Saini, Post Graduates, Department of Forensic Medicine, MMIMSR, Mullana Distt. Ambala 3. Yatiraj Singi, Associate Professor, Department of Forensic Medicine & Toxicology, SKIMS Medical College and Hospital,

AIIMS, Bilaspur (HP)


Correlation of Stature With Finger- Length of Native Haryana Population

165

vertex in the mid sagittal plane

.b) Right Index Finger Length (RIF ): I t was measured

percutaneously as straight distance from the midpoint of

the ventral proximal finger crease to the tip of the finger by

Vernier caliper by hand placed on the plane surface and

palm of the hand facing upwards. Where there was a band

of crease at the base of the digit, the most proximal crease 13was used.

RESULTS :

DISCUSSION :

Due to higher correlation coefficient and small error of

estimate; long bones are preferred for estimation of stature.

However, in instances where only dismembered body part is

available for forensic examination, it becomes difficult. Thus

arises need for exploring newer parameters to estimate stature

from different body parts such as head, face, hand, foot, 1-12phalanges, finger length etc. especially in circumstances

where sophisticated techniques such as DNA typing are not

available or where such techniques have limitations.

Quite a few studies have demonstrated the utility of fingers in

estimation the stature.5Ruchir Sharma et al on their study on 145 Haryanvi students,

observed a strong correlation between height and index finger

length and if either of the measurement (index finger length or

total height) is known, the other can be calculated and this

would be useful for Anthropologists and Forensic Medicine

experts.6Bardale et al postulated that index finger and ring finger

lengths can be used successfully to predict living stature of an

individual. They also postulated that accuracy of stature

estimation in females is more than males.7Krishan et al estimated stature from index and ring finger

length in a North Indian populationand observed that stature

can be estimated from these finger lengths with a reasonably 8accuracy.A positive correlation was observed by Kumar et al

on their study on 200 subjects from Uttarakhand, India aged

Table 1: Height of Study Subjects

Average height of study population was 164.99 (males -

169.34 and females - 160.91)

Range (Ht) (in cm) Male

140-150

151-160

161-170

171-180

181-190

Total

0

4

13

12

2

31

2

14

15

1

1

33

Female

Range (RIF) (in cm) Male

6-6.5

6.6-7

7.1-7.5

7.6-8

8.1-8.5

8.6-9

Total

0

4

12

11

3

1

31

6

13

7

5

2

0

32

Female

Table 2: Length of right index finger

Average length of RIF in study population was 7.33 (males -

7.59 and females – 7.1)

Fig 1: Relationship between Index Finger Length (Cm) & Stature (Cm) in Male

Figure 2: Relationship between Index Finger Length (Cm) & Stature (Cm) in Female

Correlation Coefficient

Pearson correlation between right index finger length and stature was highly significant and values obtained were higher among females than males.

Stature Male Significance Female Significance

RIF 0.537 0.002 0.682 0.000

166


phalanges lengths of Egyptians. J Forensic Leg Med

2010;17:156-60

5. Sharma R, Dhattarwal SK; Estimation of Stature by using

Linear Regression Equation from Length of Index Finger

in Haryana Region, Int J Basic Appl Biol 2015 2(6), 430-

32

6. Bardale RV, Dahodwala TM, Sonar VD, Estimation of

Stature from Index and Ring Finger Length, JIAFM,

2013, 35(4), 353-7

7. Krishan K, Kanchan T, Asha N. Estimation of stature from

index and ring finger length in a north Indian adolescent

population. J Forensic Leg Med 2012; 19:285-90

8. Kumar L, Jain SK, Mishra P. Study of correlation between

length of thumb and stature in Uttarakhand population.

JIAFM 2012; 34:203-5

9. Shivakumar AH, Vijaynath V, Raju GM. Estimation of

correlation between middle finger length and stature of

females in Southern Indian population. Indian J Forensic

Med Toxicol. 2011; 5:75-6

10. Verghese AJ, Balraj BM, Kumar PN. A study of

estimation of stature from length of fingers in Mysore.

Indian J Forensic Med Toxicol. 2010; 4: 12-3

11. Rastogi P, Kanchan T, Menezes RG, Yoganarasimha K.

Middle finger length a predictor of stature in the Indian

population. Med Sci Law 2009; 49:123-6

12. Tyagi AK, Kohli A, Verma SK, Aggarwal BB. Correlation

between stature and finger length, Int J Medical Toxicol

Legal Med 1999; 1:20-22

13. Fink, BJ. Manning T, Neave N, Tan U; Second to fourth

digit ratio and hand skill in Austrian children. Biol.

Psychol., 67(3): 375-84

between 21 years to 30 years for correlation between length of 9thumb and stature.Shivakumar et al while studying south

Indian female students found correlation coefficient of 0.53

between middle finger length and stature.

Best finger to predict the height was proposed by Varghese et 10al who suggested that ideal finger to estimate stature in case of

males was left thumb and in females it was right thumb.Study

conducted on both north and south Indian population by 11Rastogi et al to estimate stature from middle finger,

researchers noted a positive correlation from 0.504 to 0.696 12between middle finger length and stature.Tyagi et al observed

a positive correlation between stature and finger lengths and

have suggested that index finger was best for the prediction of

stature in both males and females in Delhi population.

Results of our study are encouraging. Statistically significant

correlation was noted between length of right index finger and

stature. In female (r=0.682) the correlation was higher

compared to males (r=0.537) In other words the accuracy of

stature estimation in females is more than males.

Findings of our study are in consistency with study by Bardale 6et al who also observed higher correlation coefficient for

females than males in Maharastrian population. However, 5Ruchir et al observed exactly the opposite in Haryanvi

11population. Whereas Rastogi et al noted that statistically no

significant difference existed between the mean stature and

middle finger length of south Indian and north Indian

populations.

Thus similar studies should be encouraged in this and other

geographical areas and with different sets of populations

across various age groups so as to evaluate existence of any

population and geographical difference or not.

CONCLUSION :

Stature calculation is important mode of partial identification

and importance of stature estimation from different body part

cannot be undermined. The results of this study suggest that

(right) index finger length can be used to assess stature of an

individual.

REFERENCES :

1. Ozaslan A, Iscan MY, Ozaslan I, Tugcu H, Koc S.

Estimation of stature from body parts. Forensic Sci. Int.

2003; 132:40-5.

2. Krishan K, Sharma A. Estimation of stature from

dimensions of hand and feet in a north Indian population. J

Forensic Leg Med 2007; 14:327-32

3. Jasuja OP, Singh G. Estimation of stature from hand and

phalange length. JIAFM 2004; 26:100-6

4. Habib SR, Kamal NN. Stature estimation from hand and

167



INTRODUCTION :

It was reported that annually 1.24 million people die globally,

which comes to around 3400 deaths in a day due to RTI. Nearly

90% of the total road traffic mortalities occur in low- and (1) middle-income countries.

According to National Transportation Planning and Research

centre (NTPRC) of New Delhi in India for every four minutes,

a person is injured or succumbed in road accident. Around 45

percent of the accidents occur due to the negligence of the (2) drivers. There occurs an accident for every two minutes and a

(3)suicide for every five minutes in India. According to the

Indian government the estimated rate of deaths per 1000

vehicles is 1.3. In India among the total accidental deaths Road

traffic accidents comprises 37.2 % and Railway accidents -(4)7.7%. In this study the Thoraco-abdominal (TA) injuries

were compared according to age, sex, place, time, pattern of

injury, occupation, period of survival etc., after sustaining

injury. In future this information will play a significant role in

reducing morbidity and mortality and help to improve

strategies for prevention of TA injuries.


Dr. Siddhartha Das,

Additional Professor and Head,

Jawaharlal Institute of Post Graduate Medical Education and

Research, Puducherry

Contact : +91 9445803019


KEYWORDS : Fatal thoraco-abdominal injuries, Road traffic accidents

Article History:Received: 30 November 2019Received in revised form: 3 March 2020Accepted on: 3 March 2020Available online: 15 August 2021

ABSTRACT :

Introduction : The increase in the number of RTA is caused by the increase in the number of different types of vehicles used on

various types of roads. In India we see the transportation system is very weak because of which people started using their own

vehicles in cities as well as rural areas by which people's health has been affected.

Aims and Objectives : To describe the Pattern of TA Injuries in RTA 2. To identify the association between type of vehicle and TA

injuries.

Materials and Methods : This was a prospective descriptive study done for all the cases of RTA attending to the mortuary with TA

injuries for a period of 18 months and were either found dead on arrival or died during treatment. All the victims were autopsied at

the post-mortem centre of jipmer puducherry.

Results : In the present study there were 200 road traffic accidents with TA injury in a period of 18 months. Males outnumbered

females (81.5 % vs 18.5%) with a ratio of 4.4:1. RTAs are more commonly seen in 30-40 years age group followed by 20-30 years

and the least in 0-10 years. In the present study the un-employed n=95 (47.5%), were commonly injured with RTAs subsequently to

students (n=50, 25%).Majority of the accidents were occurred during summer season (n=73, 36.5%). In our study most of the

accidents occurred in the evening hours 13.00-18.00 (n=62, 31%) followed by 19.00-24.00 hours (n=59, 29.5%). The most

common type of vehicle involved is two wheeler vehicle (n=102, 51%).followed by light motor vehicles (n=58, 29.0%). Of all the

external injuries abrasion were most common n=176, followed by laceration n=150, contusion n=34

Conclusion : Our study displays that RTAs are a foremost concern to human life. Major thing to avoid accidents is the prevention.

In order to prevent these RTAs some interventions like restriction of speed, strict implement of helmets, graduate licensing etc.

There is a need for government to involve and strictly plan accordingly in a systematic way to reduce the problem in India.

1. B Rupesh Kumar Naik, Assistant Professor, Sri Venkateshwara Institute of Medical Sciences-SPMCW Tirupathi, Andhra

Pradesh.

2. Siddhartha Das, Additional Professor and Head*

3. Kusa Kumar Shaha, Professor*

*Jawaharlal Institute of Post Graduate Medical Education and Research, Puducherry

Pattern of Thoraco-abdominal Injuries Sustained in Road Traffic Accidents:

An Autopsy Based Observational Study


168

AIMS AND OBJECTIVES :

1. To describe the Pattern of TA Injuries in RTA

2. To identify the association between type of vehicle and TA

injuries.


Place of study : Mortuary attached to Department of Forensic

Medicine, JIPMER hospital, Pondicherry a tertiary level

health care centre.

Study design : It was a prospective descriptive study.

Study duration :18 months

(i) INCLUSION CRITERIA :

Autopsies with an alleged history of RTA with TA

injuries are included in the study.

(ii) EXCLUSION CRITERIA:

1. Autopsies with a history of RTA but having only

a) Head injuries.

b) Injuries to the extremities.

2. Fall from height.

3. Assault cases.

4. Autopsies that have no history of RTA like Burns, poisoning,

hanging, etc.

STUDY DESIGN AND ANALYSIS :

The study was conducted for a period of 18 months. After

receiving the inquest report given by the investigating officer,

the history of the case is obtained from the police personnel.

The hospital records regarding the case have gone through.

History of the case from the relatives are also recorded.

Identification of the body is done for the name, age and

identification mark present in the documents of the

investigating officer and by the relatives. A detailed external

examination was carried out with special reference to the

wounds regarding its type, dimension, direction, and site of the

wound.

An I-shaped incision is given to expose the ribs and examine

for any fractures. The thorax is first opened by disarticulating

both sternoclavicular joints and the other ribs by cutting along

the cartilaginous part of the joint lateral to costochondral

junction. The whole sternal plate is lifted and examined for any

fractures. Individually each organ is retrieved carefully and

noting any contusions, lacerations, etc. Any associated injuries

in the head, spine, pelvis, fractures of limbs are also examined.

Details regarding age, sex, date, time and the circumstances of

the incident were analysed. Concerning TA injuries, in

particular, details like fracture of the ribs, Laceration of lung,

heart, liver, kidney, etc. with gross findings were studied. A

Proforma was specially designed for this study and used for

collection of data. After collection of data analysis is done by

using SPSS-20.

RESULTS :

During the study period a total of 200 cases were analysed. A

detailed post mortem examination was conducted in these

cases at department of forensic medicine and toxicology,

JIPMER subject to inclusion and exclusion criteria.

Distribution of RTA with respect to age and gender :

In all the age group males are more commonly involved.

(Table.1) Among females > 50 age group was more commonly

affected and the least was in the 0-10 age group

Occupation of the victims

The Unemployed persons were the highest n=95 (47.5%) in

number among the 200 victims. The students were the next

highest (n=50, 25%). Labourers were 25 (12.5%), employee in

service 16 victims (8%), house wife 12 (6%).

Distribution of cases with respect to season

In this study cases are categorized into season wise as winter

(January to February), Summer (March to May), Rainy (June

to September), Post monsoon (October- December).

Maximum number of deaths were seen in the summer season

(n=73 cases, 36.5%) followed by Post monsoon (n=49 cases,

29.5%), rainy (n=46 cases, 23.0%) and the least in winter

(n=32 cases, 16%).

Distribution of cases with respect to place of death

In this study most of the victims died in hospital (n=141,

70.5%), followed by spot dead n=56, 28.0% and least (n=3,

1.5%) during transport.

Distribution of cases with respect to roads

In our study the roads have been categorized as national

highways, State highways, City roads and Village roads. It is

observed that most of the accidents occur in the state highways

(n= 82, 41.0%) followed by city roads (n=68, 34.0%), national

highways (n=32, 16.0%) and village roads (n=18, 9.0%).

169

Table 1: Distribution of RTA victims based on age and sex

Age (years)

0-10

11-20

21-30

31-40

41-50

> 50

Total

Male (%)

2 (1.2)

16 (9.8)

39 (23.9)

38 (23.3)

30 (18.4)

38 (23.3)

163

Female (%)

2 (5.4)

3 (8.1)

3 (8.1)

8 (21.6)

6 (16.2)

15 (40.5)

37

Total no of

cases (%)

4 (2)

19 (8.5)

42 (21)

46 (23)

36 (18)

56 (28)

200


Distribution of cases according to time of accident

In our study the time was divided into four periods of 6 hours

interval i.e. 0.01-6.00 hours, 07.00-12.00, 13.00-18.00, and

19.00-24.00. Most of the accidents were noted during 13.00-

18.00 hrs.

Type of injury

In this study type of injury were considered in four categories

abrasion, contusion, laceration and abraded contusion. Here

we noted that abrasions were common (n=176, 45.59).

Contusions were the next highest n=148, 38.34%, Abraded

contusion (n=34, 8.8%) and laceration (n=28, 7.25%).

Association between the type of vehicle involved and the

viscera involved in TA injury

Table shows that kidney and bladder were significantly

associated with the type of vehicle involved

Survival period with respect to accident victims

It is observed that number of persons who died within 6 hours

(91 cases 45.5%) from the time of accident was maximum,

which was subsequently followed by death within 12-24 hours

(24 cases 12.0%).

Cause of death :

Maximum number of cases (n=110, 55.0%) died due to

Haemorrhagic shock with head injury followed by

Haemorrhagic shock alone (n=72, 36.0%), Sepsis (n=15,

7.5%) and Peritonitis in 3 cases.

Other associated injuries :

Total 200 cases in our study head and neck was the most

common [n=65, 32.5%] associated injury in the RTAs. There

were no associated injuries noted in nearly 64 cases 32.0%.

Lower limbs were noted with 54 cases 27% and the least

common involved were the upper limbs n=37 18.5%.

DISCUSSION :

The present study showed that out of 200 cases males

outstripped over females [81.5 % vs 18.5%] with a ratio of

4.4:1 in all age groups. Most commonly involved age group

was >50 years [n=56, 28.0%], followed by 30-40 years [n=46,

23.0%], 20-30 years [n=42, 21.0%]. Our study was supported

by Mirzha FH et al. (5) Kumar PM et al.(6) The age group of

more than 50 years was the most vulnerable period of life. It is

noted that the Unemployed persons were commonly involved

in RTAs. The students were next in number followed by

Labourers, employee in service, house wives. Most of victims

died during summer season followed by post monsoon, rainy

and least in winter. Our finding correlates with the finding of

Kumar A et al. (7) Yogesh G. (8) Most of the victims died in the

hospital, followed by spot dead and least while transporting to

hospital. Correlated with Shruthi P (9), Singh H et al. (10).

In our study most common involved place of accidents are

state highways followed by city roads, national highways and

least common accidents occurred in the village roads. This

finding correlates with Kumar N et al (11). Contrary to this

finding Singh H .et al (10) found national highways, followed

by state highways. The state highways were more involved in

our study, may be due to higher speed of vehicles in the state

highways when compared with the city and village roads. In

this study most of the accidents has occurred during 13.00-

18.00 hours followed by 19.00-24.00 hours and least during 0-

6.00 hours which was in concurrence with the study of Das

D.K (12) and Mahajan N et al, (13) Working people usually get

strained due to heavy work load all the day through and get

fatigue, because of which there is a decreased reflex action

leading to accidents. In our study two wheelers were more

170

Lung

Heart

Stomach

Intestine

Liver

Spleen

Mesentery

Kidney

Bladder

Multiple organs

76

10

05

11

32

11

28

02

01

01

31

97

102

96

75

96

79

105

106

106

58

14

03

08

30

09

32

10

07

01

35

79

90

85

63

84

61

83

86

02

Table 2 : Showing Association Between type of Vehicle and the Type of Viscera Involved.

TA organ involved

Two wheeler & Bicycle (N=102) Four wheeler (LMV,HMV) (N=93) Chi square test

Involved InvolvedNot involved Not involved

Chi=1.390, p=0.2507

Chi= 1.042, p=0.3073

Chi=0.0253 p=0.8735

Chi=0.0262, p=0.8713

Chi=0.0421 p=0.8373

Chi=0.0201, p=0.8873

Chi=1.240, p=0.2654

Chi=5.476, p=0.0193

Chi=4.045, p=0.0443

Chi=0.0099, p=0.9260


commonly involved in accidents followed by light motor

vehicles, heavy motor vehicles and least common involved

were cycles. Our study correlates with study of Kumar N et al

(11), Kumar PM et al (6) Jha N et al (14). The increasing trend

in the young generation to drive fast may be the reason behind

this. It is noted that there is a significant association for kidney

and bladder with type of vehicle involved. In our study

abrasions were more common followed by contusion, abraded

contusion and laceration. Yogesh G. (8) was noted with same

finding. Abrasions were more common. This may be due to

decreased level of resistance for the body. Most common

injured viscera is lung followed by liver, mesentery, heart,

spleen and least in bladder. This finding is similar with studies

done by Hanumantha et al (15), Further it is noted that multiple

organ injury was the commonest. Uterus involvement was

very rare. Bladder involvement was seen in cases with pubic

symphysis fracture. With regard to time maximum number of

person died within 0-6.00 hours followed by 12.00-24.00

hours and 3- 7 days. Our study correlates with study of Numan

H et al.(16) Our study found that accidents are more common

in the evening hours 13.00-18.00 hours. This may be attributed

to high over load of vehicles and not following traffic rules.

In our study the most common cause of death is haemorrhagic

shock with head injury followed by haemorrhagic shock alone,

sepsis and peritonitis. Our study co-relates with Singh H et al

(10) Kumar PM et al. (6) This can be explained, as the majority

of the vital organs are located in the TA region of the body,

injury to this region causes contusion and laceration of vital

organs which leads to haemorrhagic shock. Most common

associated injury was with the head and neck, followed by nil,

lower limbs and in the upper limbs. Chaudhary et al (25)

supports our findings.

CONCLUSIONS :

The present study is based on the observation of 200 cases of

road traffic accidents with TA injuries. To meet the objectives

of the study listed in the earlier sections, epidemiological and

scientific analysis of the cases are done.Our study displays that

RTAs are at foremost concern to human life. In order to prevent

these RTAs some interventions like restriction of speed, strict

implement of helmets, graduate licensing etc. It needs a

holistic approach to coordinate and monitor the problem.

There is a need for government to involve and strictly plan

accordingly in a systematic way to reduce the problem in India.

Our study explains the significance protecting and preventing

the TA region by wearing seat belt; like the head region where

there is use of helmet to protect vital organ. This study helps us

to make strategies and various policies in reduction of

mortality and morbidity from TA injuries. Meanwhile this

improves the knowledge of clinicians in the treatment of

trauma victims and various medico legal specialists to deposit

their evidence in the court of law.

Conflict of Interest – None

REFERENCES :

1. World Health Organization (WHO) 1957. Technical

Report Serial No. 118.

2. Mathiharan K, Patnaik AK. Modi's medical jurisprudence

and toxicology. 23rd edition; Lexis Nexis publication:

Railway injuries: pp - 783.

3. Verma PK, Tewari KN. Epidemiology of Road Traffic

Injuries in Delhi: Result of a Survey; Regional Health

Forum WHO South-East Asia Region 2004; 8(1).

4. National Crime Records Bureau, Ministry of Home

Affairs, Govt. of India. Accidental Deaths & Suicides in

India - 2010 Available at: http://ncrb.nic.in. Accessed Oct

24, 2015.

.5. Mirza FH, Hassan Q, Jajja N. An autopsy-based study of

death due to road traffic accidents in metropolis of

Karachi. J Pak Med Assoc.2013; 63 (2):156-160.

6. Kumar PM, Ziya A, Prashant A. Fatality due to chest

injury in road traffic accident victims of Varanasi and

adjoining Districts, U.P. Medico-Legal Update. 2006;

6(3): 65-70.

7. Kumar A, Pandey SK. Epidemiological Study of Road

Traffic Fatalities: 5 Years Retrospective Autopsied Cases

Study in Varanasi, Uttar Pradesh, India. International

Journal of Science and Research. 2014; 8 (3): 502-506.

8 . Yogesh G. Pattern of Injuries in Fatal Road Traffic

Accidents: Autopsy Based Study. Journal of Evidence

based Medicine and Healthcare.2015; 2 (4): 321-327.

9. Shruthi P, Venkatesh VT, Viswakanth B, Ramesh C,

Sujatha PL , Dominic IR. Analysis of Fatal Road Traffic

Accidents in a Metropolitan City of South India. J Indian

Acad Forensic Med. 2013; 35 (4): 317-320.

10. Singh H, Dhattarwal SK, MD. Mittal S, Aggarwal A,

Sharma G, MD. Chawla R. A Review of Pedestrian Traffic

Fatalities. J Indian Acad Forensic Med. 2007; 29(4): 55-8.

11. Kumar N, Kumar M. Medicolegal Study of Fatal Road

Traffic Accidents in Varanasi Region. International

Journal of Science and Research. 2015; 4 (1):1492- 96.

12. Das DK. Study of Road Traffic Accidental Deaths in and

around Barpeta District: An Autopsy Based Study. Journal

of Evidence based Medicine and Healthcare. 2015; 2 (22):

3329-3337.

13. Mahajan N, Aggarwal M, Raina S, Verma LR, Mazta SR,

Gupta BP. Pattern of non-fatal injuries in road traffic

171


crashes in a hilly area: A study from Shimla, North India.

Int J Crit Illn Inj Sci 2013; 3: 190-4.

14. Jha N, Srinivasa DK, Roy G, Jagdish S. Injury pattern

among road traffic accident cases: a study from South

India. Indian J Community Med. 2003; 28(2):84 90.

15. Hanumantha A, Reddy BN, Pallavi M, Reddy NN,

Radhakrishna L, Reddy SN. An epidemiological study on

pattern of thoraco-abdominal injuries sustained in fatal

road traffic accidents of Bangalore: Autopsy Based Study.

Narayana Medical Journal. 2012; 1(2):19-27.

16. Numan H, Chavan KD, Bangal RS, Singh B. Pattern of

Thoraco-abdominal Injuries in Rural Region. Indian

Journal of Forensic Medicine and Pathology. 2009; 2 (3):

97-103.

17. Chaudhary B L, Deepak S, Tirpude B H, Sharma R K,

Veena M. Profile of Road Traffic Accident Cases in

Kasturba Hospital of M.G.I.M.S., Sevagram, Wardha,

Maharashtra. Medico-Legal Update. (2005-10-2005-12)

5 (4). www.indmedica.com-accessed on 20-11-2015.

172



INTRODUCTION :

Forensic Odontology is that branch of dentistry which in the

interest of justice deals with proper handling and examination

of dental evidence and with the proper evaluation and

presentation of dental findings. Establishing one's identity is [1]an important aspect in any forensic investigation . Age

Estimation is a vital component of forensic odontology in

human identification. In this regard teeth are apposite tissue

structures as they can survive for several decades or even

thousands of years due to their hardness and resistance to

corrosion and can estimate the age of an individual right from

the individual's journey from cradle to the grave.

In India, birth certificates may not be readily available from a

few people from rural or tribal background. This becomes a

hassle for the justice system where age is a requisite for

criminal/civil proceedings. Age estimation practices using

sexual and somatic maturity can be coupled with dental age

estimation in these situations. This is possible owing to the

continuous and progressive change a tooth undergoes with

age.

Gustafson's technique of age estimation (1950) uses factors

like attrition, secondary dentin deposition, apical migration of

periodontal attachment, cementum deposition at the root apex, [2]root resorption at the apex and root dentin translucency .

Later, investigators explored individual variables for their

efficiency to estimate age. However, there are factors like race,

diet, gender and masticatory forces which affect the

development and maintenance of teeth, which may alter the


Dr. Shweta Yellapurkar,


Department of Oral Pathology and Microbiology,

Manipal College of Dental Sciences, Mangalore.

Manipal Academy of Higher Education, Manipal.

Contact : +91 95919-55590


KEYWORDS : Age estimation, Odontology periodontal ligament, Radiographic visibility

Article History:Received: 4 May 2021Received in revised form: 6 June 2021Accepted on: 6 June 2021Available online: 31 August 2021

ABSTRACT :

Introduction: Teeth are apposite tissue structures as they can survive for several decades or even thousands of years due to their

hardness and resistance to corrosion and can indicate the age of an individual. Not only the hard tissue changes but also, the visibility

of the dental soft tissues, periodontal ligament can be used for age estimation.

Material and methods : The study sample consisted of 330 OPGs of patients [aged between 14 and 76 (mean age of 32.82±12.75

years)]. Visibility of the periodontal ligament in lower third molars was done in accordance with the method followed by Guo et al

(2020) and was graded in 4 stages. The regression equations were derived using simple linear regression analysis to estimate the

efficiency of prediction of the age in total as well as stratified by gender.

Results :

Our study results showed a significant trend (p<0.001) of increasing age with higher grades of periodontal ligament score in males

and females as well as in total.

Conclusion :

Periodontal ligament visibility scores can be used as an adjunct to other age estimation techniques for confirming the age of living

individuals as well as deceased.

1. Ayan Bhadra Ray, Intern*2. Kushaggr Rastogi, Intern*3. Srikant N, Professor and Head, Department of Oral Pathology and Microbiology and Coordinator, Centre of Forensic

Odontology*4. Shweta Yellapurkar, Assistant Professor, Department of Oral Pathology and Microbiology*5. Nidhin Philip Jose, Associate Professor, Department of Orthodontics and Dentofacial Orthopaedics*6. Ceena Denny, Associate Professor, Department of Oral Medicine and Radiology* *Manipal College of Dental Sciences, Mangalore. Manipal Academy of Higher Education, Manipal, Karnataka, India

Reliability of age estimation using periodontal ligament visibility in South Indian

Population


173

Figure 1: Visibility of the periodontal ligament in the lower

third molars method adapted from Guo et al.

A.Stage 0: The periodontal ligament is visible along the full

length of all roots.

B. Stage 1: The periodontal ligament is invisible in one root

from the apex to more than half of the root.

C. Stage 2: The periodontal ligament is invisible almost the

entire length of one root or along the part of the root in two

roots.

D. Stage 3: The periodontal ligament is invisible along the

entire length of two roots

outer structure of teeth in relation to enamel and dentin.

Progressive reduction in the periodontal ligament space is

noted with age which is seen as reduction in visibility of

periodontal ligament space radiographically. The loss of the

space might be attributed to formation of cementum on the

tooth surface with increasing age. Guo Y et al (2020) suggested

a method of age estimation using radiographic visibility of the

periodontal ligament in lower third molars, which is also a [3,4]modification of study by Olze et al(2010) . These studies

were conducted in the European, Turkish and Chinese [3,4]populations . The aim of our study is to attempt to evaluate

the efficiency of these grading systems of periodontal ligament

visibility in the third molars to estimate age in the individuals

of Indian population.


This retrospective study was conducted following the approval

from the institutional ethics committee of the Manipal College

of Dental Sciences, Mangalore. Based on the key article by [3]Guo Y et al (2019) on the dental age estimation on the

radiographic assessment of the periodontal ligament with 4

grades, the mean age of females for score 0,1,2 and 3 in Table 3 [3]of Guo Y et al was taken for sample size calculation. Having,

4 groups with a power of 80% and an alpha error rate of 5 % the

Z scores used were 0.84 and 2.64 respectively. Having a

standard deviation of 5.1 and to assess a clinically relevant

difference (d) of 3 units, we estimated a sample of 70 per group

making the total sample of 280. Accounting for a 15% error

having radiographs with errors or malformed molars we

arrived at a sample size of 330 radiographs.

The sample used in this study consists of orthopantomogram

radiographs taken for treatment purposes by Department of

Oral Medicine and Radiology and Department of

Orthodontics and Dentofacial orthopaedics which comprised

of 330 orthopantomographs of patients chronologically aged

between 14 and 76 (mean age of 32.82±12.75 years), included

by the method of random sampling. The patient's demographic

details of their date of birth, date of radiography, sex were

retrieved for evaluation. Digital orthopantomographs of 161

male and 169 female subjects were evaluated by two

independent examiners in a dark room on a computer screen.

The chronological age of the individual was estimated as the

difference of the date of radiography and date of birth.

The stages of radiographic visibility of periodontal ligament

was assessed by two examiners. An agreement about the

scoring was established between the examiners in the first 100

radiographs assessed, after which, rest of the radiographs were

scored. Mandibular third molars were preferred as their

visibility in the orthopantomogram is better as they are more

likely to have mesio-angular or disto-angular impactions as

compared to maxillary third molars which have buccal

impactions making them less favourite to view the pulp and

periodontal ligament morphology. All radiographs having

distortions, faults or cases representing fracture, decay, acute

infection, restorations, fused apices or lateral canals were

excluded from the study.

Visibility of the periodontal ligament in lower third molars was

done in accordance with the method followed by Guo et al [3](2020) . The visibility of the periodontal ligament of

mandibular third molars with completed root mineralisation

was graded in 4 stages. (Figure 1) The radiographic visibility

of the periodontal ligaments on the outer parts of the roots

(mesial part of mesial root and distal part of distal root were

assessed.

Statistical Analysis:

For each stage of the periodontal ligament visibility score, the

minimum, maximum, mean, standard deviation, median value,

25th, and 75th percentiles of the age of the individual were

derived for visualizing the changes in age with each stage.

Kruskal Wallis test and posthoc Bonferroni's test were used to

evaluate the association of the stages with age. The regression

equations were derived using simple linear regression analysis

174

with age as the dependent variable and the periodontal

ligament visibility grades as independent variable, reported

with a 95% confidence interval. Analysis were done in total as

well as classified by sex.

RESULTS :

The cohort consisted of 330 OPGs of 161 males and 169

females with mean age of 32 ±12.75 years ( age range 14-75yrs

)Shapiro Wilk test for normality showed that the variables

were skewed in distribution, hence the medians and

interquartile range

(IQR) were taken as the measures of central tendency and

dispersion. Kruskal Wallis test shows a significant trend

(p<0.001) of increasing age with higher grade periodontal

ligament score in males and females as well as in total.

Table-1 shows the association of the stages of radiographic

visibility of the periodontal ligament for tooth 38 and 48 in

total as well as individually among gender. There is a positive

association of increasing age with increasing periodontal

visibility grades. (figure 2)

The periodontal space visibility score (PDL score) showed a

significant gradually increasing trend (p < 0.001; Table 1) of

chronological age [median (IQR)] with PDL scores of the

cases in the females, males and in total.(figure 2)

As we can observe in the table 1, for females, the age [median

(IQR)] increased gradually from 24(20,29))< 28(24,36)<

39(30,45) to 57(29,60) as the PDL score increased from Grade

0 to 3 in relation to tooth 38 and from 23.5(20,29)<

29.5(24,36)< 36(29,43) to 55(55, 57) in tooth 48, respectively.

175

aScore with which significant difference is noted

Female

PDL score 38

PDL score 38

PDL score 38

PDLscore 48

PDLscore 48

PDLscore 48

Male

Total

N Mean (sd) Range Median (IQR) kruskal wallis

chi square

p value posthoc pair wise

acomparison

Score 0

Score 1

Score 2

Score 3

Score 0

Score 1

Score 2

Score 3

Score 0

Score 1

Score 2

Score 3

Score 0

Score 1

Score 2

Score 3

Score 0

Score 1

Score 2

Score 3

Score 0

Score 1

Score 2

Score 3

58

41

21

3

62

38

29

05

54

40

31

15

55

45

24

13

113

81

52

18

118

83

53

18

Table 1: Kruskal-Wallis test to compare the difference in age with each pulp and pdl scores

26.66(9.67)

30.15(9.34)

39.9(13)

48.67(17.1)

25.69(9.04)

30.89(9.08)

37.52(10.64)

57(4.06)

26.44(11.58)

31.6(9.49)

39.42(13.51)

50.6(12.26)

24.75(9.13)

36(12.29)

40.38(13.61)

44.31(14.11)

26.5(10.6)

30.9(9.4)

39.6(13.2)

50.3(12.6)

25.2(9.1)

33.7(11.2)

38.8(12)

47.8(13.4)

17-55

18-57

24-70

29-60

17-58

18-55

24-70

54-64

14-58

20-63

18-76

32-76

14-59

21-76

18-76

26-71

14-58

18-63

18-76

29-76

14-59

18-76

18-76

26-71

24(20,29)

28(24,36)

39(30,45)

57(29,60)

23.5(20,29)

29.5(24,36)

36(29,43)

55(55,57)

21(19,28)

30.5(23.5,36)

37(29,49)

51(41,57)

21(20,27)

33(28,41)

38.5(32,49.5)

41(34,57)

23(20,29)

29(24,36)

38(29.5,47)

51.5(41,57)

21(20,28)

30(26,40)

38(30,45)

54(35,57)

27.149

43.333

46.181

50.293

76.912

85.017

<0.001

<0.001

<0.001

<0.001

<0.001

<0.001

2,3

2

0

0

1,2,3

3

0

0,1

1,2,3

3

0

0.1

1,2,3

0

0

0

Score 1,2,3

Score 0,2,3

Score 0,1

Score 0,1

Score 1,2,3

Score 0,3

Score 0

Score 0,1

In males too, the age [median (IQR)] increased progressively

from 21(19, 28)< 30.5(23.5,36) < 37(29,49) to 51(41,57) in

tooth 38; and from 21(20,27)< 33(28,41)< 38.5(32,49.5) to

41(34,57) in tooth 48; respectively; as the PDL score increased

from Grade 0 to 3. (figure 2)

The same trend was reflected in the overall cohort, with the age

[median (IQR)] increasing progressively from 23(20,29) <

29(24,36) < 38(29.5,47) to 51(36.5,44.5) in tooth 38, and from

21(20,28)<30(26,40)< 38(30,45) to 54(35,57) in tooth 48,

respectively, as the PDL score increased from Grade 0 to 3.

Statistically, Grade 0 was significantly different from the

higher grades. However, significant differences between score

1 and 2, was noted only in tooth 38 (total score) and not with

tooth 48.

Simple linear regression analysis was performed to assess

correlations and derive equations, to predict the age of the

individual, based on the periodontal ligament visibility scores

(Table 2). The correlation coefficients seen in the PDL score

wherein the R values ranged from 0.455 to 0.555.

DISCUSSION

'Registration of Births and Deaths Act' in India, mandates

registration of a birth of child. This lays foundation to the laws

structured according to different age strata for both criminal

and civil cases. For example: the minimum legal age for

marriage in India is 21 years for boys and 18 years for girls.

Under section 16, Indian Army rules 1962, a person should be

21 years to be called an adult. According to article 84 (b) and

Article 173 (b) of the Constitution of India, the minimum age

for election to the council of states (Rajya Sabha) and state

legislative council is 30 years of age. Also in most countries, [5]age milestones of 18, 21, or 35 years are of legal importance .

The retirement age in India is between 58-60 years at various

categories of employment. Thus, it has to be confirmed before

disbursing retirement benefits for the individual. Age

estimation thus plays an important role in cases where birth

records are not maintained, lost, damaged, or in cases of

controversies. Apart from skeletal age estimation methods,

dental age estimation has proven to be a useful adjunct owing

to the gradual change noted in tooth structure.

Researchers have used the stage of mineralization of teeth for

age estimation, but we should be cognizant that the

mineralization process also affects the visibility of the soft

tissues, viz. periodontal ligament, associated with the teeth. In

our present study, we analyse this change as the radiographic

visibility of PDL and correlate it with the forensic age

estimation in individuals with known sex. This was first

studied by Olze et al, in 2010, based on the visibility in an

orthopantomogram. The advantages of this technique are that

it is cost-effective, less time consuming and an individual will [4]be less exposed to radiation .

A search of the English literature identified 07 studies that have

utilised periodontal ligament(PDL) visibility grade for age

estimation (Table 3). In our study, we found that periodontal

space visibility score (PDL score) had a progressively

176

Figure 2: Box Plot Demonstrating an Increasing Trend of Age with the Ordinal Periodontal Ligament Visibility Scores

Table 2: Simple linear regression analysis for age estimation

FEMALE

PDL score 38

PDL score 48

MALE

PDL score 38

PDL score 48

TOTAL

PDL score 38

PDL score 48

0.455

0.565

0.555

0.517

0.533

0.489

0.207

0.319

0.308

0.267

0.284

0.24

10.396

9.539

11.554

11.655

11.308

11.559

Age=25.824+6.409(PDL score 38)

Age=24.894+7.245(PDL score 48)

Age=25.412+7.523(PDL score 38)

Age=26.077+7.147(PDL score 48)

Age=24.854+7.527(PDL score 38)

Age=25.077+6.883(PDL score 48)

R R Square Std. Error of the Estimate

Linear Regression equation

177

Table 3: Summary of findings from the review of literature of studies employing Pulp and Periodontal ligament visibility grading system for age estimation

No. Author Population Sample size Age Range Male Female ratio

Age Distribution Mean(sd)/Median wrt 38 Clinical utility

Stage Male Female

0123

Olze et al4

(2010)1 Berlin,

Germany119815-40569:629=0.9

21.3(1.3)22.4(1.5)31.3(4.7)33.7(4.0)

21.1(1.9)22.9(1.9)31.4(4.8)35.7(4.0)

Stage 1 attainment proves the legally relevant age of 18 years, for stages 2 and 3, it can be stated beyond a reasonable doubt that a person is over 21 years of age.

It was concluded that the presence of PLV-C or PLV-D indicates that a subject is over 18 years with a very high level of probability.

PLV APLV BPLV CPLV D

Olze et al4

(2010)2 London,

England200016-261000:1000=1

20.2720.8522.6323.61

20.2821.2123.3624.33

The findings question the use of this method to estimate age or to discriminate between age younger and at least 18 years.

This method seems to be of limited value for routine application for age estimation in the Chinese population in practice.

Stage 1 indicates older than 18 years of life. Stage 2 indicated older than 21 years of life. Limitation: high number of missing third molars in the studied age group (46– 60)

Compared with the Olze's method, the number of cases that could be successfully evaluated in Chinese subjects was significantly higher.

Periodontal ligament visibility from Stage 1 onwards can be used to state that males or females are above 18 years.

Our study used the method as described by Guo et al, which was modified from the method described by Olze et al.

0123

0123

0123

0123

0123

0123

Chaudhary et al.

8(2017)

Guo et al7

(2018)

Timme et al 6

(2017)

Guo Y et al 3

(2020)

Shah et al10

(2020)

Our study (2020)

3

4

5

6

7

8

London, England

Shaanxi, China

Berlin, Germany

Shaanxi. China1

Belgaum, India

KarnatakaIndia

16316-5375:88=0.85

130015-40650:650=1

234615-701179:1167=1.01

30015-40650:650=1

33915-40180:159=1.13

33014-76161:169=0.95

20.28(3.86)20.77(3.11)21.98(3.48)25.7(5.34)

24.7(5.27)26.66(5.02)33.26(4.45)37.19(2.88)

23.3(4.2)32.1(7.5)44.9(9.1)56.7(8.8)

23.97(4.04)26.93(4.68)32.47(4.53)36.31(3.44)

19(1.33)22.3(2.75)29.3(5.21)33.11(5.01)

26.44(11.58)31.6(9.49)39.42(13.51)50.6(12.26)

21.59(2.66)20.05(2.21)21.56(2.59)26.42(8.22)

25.22(4.64)29.24(5.77)33.09(5.29)37.26(2.81)

24.1(4.8)35.3(10.4)41.5(9.7)49(13.1)

24.36(4.34)28.67(5.16)32.76(4.3)36.49(3.45)

19.57(1.98)22.65(3.91)29.75(5.07)34.56(3.6)

26.66(9.67)30.15(9.34)39.9(13)48.67(17.1)

increasing age from score 0 to score 3 (p < 0.001; Table 1). The

age ranged from 26 to 50 yrs [median (IQR)] as scores noted

were 0 to 3, in the females, males as well as in total. This trend

is similar to the study done by Timme et al.

who demonstrated an age range of 23-56 years. Other studies [3,7] [4,6] [10]in Chinese , British[8,9], German and one Indian study

shows a narrower age range with stage 0 in range of 19-25

years and stage 3 in range of 23-37 years. The biological

explanation for the disappearance of the periodontal ligament,

according to a few authors may be that, as age advances, the

membrane becomes so narrow that it can't be seen on

radiographs. This could be attributed to the continuous

deposition of cementum to adapt to the changes in the

occlusion and attrition. Furthermore, the tooth root surface

might become rougher as time elapses and also the alveolar

bone adjacent to it making the visualization indistinct. It is

also, observed that the radiographic image of the periodontal

ligament disappears sometime after the age of 20 years. These [11]findings were true in our scenario . Moreover, periodontal

ligament attachment level is subjected to the action of various

physical and chemical changes such as occlusal trauma, pulp-

periapical pathoses, and conditions like osteomyelitis. [12]However, these criteria were excluded from our study . Our

[6]results mirror the findings of Timme et al and we concur that

stage 1 indicates an individual to be ≥18 years and stage 2 to be

≥21 years.

The advantage of our present study is that the cohort had

samples well distributed across the age groups with sufficient

representation across strata of age. The variation noted in the

review of literature across the population could be attributed to

the multitude of physical and chemical changes associated

with teeth, like trauma from occlusion, pulp and periapical

diseases, habits like bruxism, tobacco, etc. and weather

conditions. Another drawback of the study could be the lack of

delineation of impacted and non-impacted third molars.

Erupted 3rd molars may be influenced by oral changes which

may stimulate PDL changes as compared to impacted ones.

Further, we must be aware of the prevalence of missing third

molars, which may render the technique for age estimation

invalid.

CONCLUSION :

The present study demonstrates the positive trend shown by

periodontal ligament visibility grading system with age. These

techniques can be used as an adjunct to other age estimation

techniques for confirming the age of living individuals as well

as deceased. Additionally, the review of the literature showed

the efficiency of the technique across the populations, with

possible variations owing to the differences in the habits,

weather and cultural influences.

Institutional Ethics Committee Approval : Ref no:20020.

Conflicts of interest/Funding/ : NoneInformed consent

REFERENCES:

1. Divakar KP.Forensic Odontology: The New Dimension in

Dental Analysis. Int J Biomed Sci. 2017;13(1):1-5.

2. G. Gustafson.“Age determination on teeth,” The Journal of

American Dental Association.1950; 41:45–54.

3. Guo Y., Wang Y., Olze A., Schmidt S., Schulz R., Pfeiffer H.,

Chen T. and Schmeling A.Dental age estimation based on the

radiographic visibility of the periodontal ligament in the lower

third molars: application of a new stage classification.

International Journal of Legal Medicine. 2020;134(1):369-

374.

4. Olze A., Solheim T., Schulz R., Kupfer M., Pfeiffer H.,

Schmeling A. Assessment of the radiographic visibility of the

periodontal ligament in the lower third molars for the purpose

o f fo rens ic age . In te rna t iona l Journa l o f Lega l

Medicine.2010;124;445-448 .

5. Aggrawal A.Age estimation in the living - Some Medicolegal

Considerations. Anil Aggrawal's Internet Journal of Forensic

Medicine and Toxicology [serial online] 2002; 1:2.

6. Timme M, Timme WH, Olze A, Ottow C, Ribbecke S, Pfeiffer

H, Dettmeyer R, Schmeling A.The chronology of the

radiographic visibility of the periodontal ligament and the root

pulp in the lower third molars. Sci Justice. 2017; 57(4):257-

261.

7. Guo YC, Li MJ, Olze A, Schmidt S, Schulz R, Ottow C,

Pfeiffer H, Chen T, Schmeling A.Studies on the radiographic

visibility of the periodontal ligament in lower third molars: can

t h e O l z e m e t h o d b e u s e d i n t h e C h i n e s e

population?.2018;132(2):617-622.

8. Chaudhary MA, Liversidge HM .A radiographic study

estimating age of mandibular third molars by periodontal

ligament visibility. J Forensic Odontostomatol.2017;

35(2):79-89.

9. Lucas VS, McDonald F, Andiappan M, Roberts G. Dental age

estimation: periodontal ligament visibility (PLV)-pattern

recognition of a conclusive mandibular maturity marker

related to the lower left third molahr at the 18-year threshold.

Int J Legal Med. 2017;131(3):797-801.

10. Shah R & Angadi PV.Radiographic assessment of periodontal

ligament visibility in mandibular third molars as a tool for

defining the 18 year threshold among Indians. Australian

J o u r n a l o f F o r e n s i c S c i e n c e s . 2 0 2 0 ; D O I :

10.1080/00450618.2019.1711179

11. Ozle et al, Sequeira CD, Teixeira A, Caldas IM, Afonso A,

Pérez-Mongiovi D.Age estimation using the radiographic

visibility of the periodontal ligament in lower third molars in a

Por tuguese popula t ion . J Cl in Exp Dent . 2014;

6(5):e546–e550.

12. Narayan V K, Varsha V K, Girish H C, Murgod S.

Stereomicroscopic study on unsectioned extracted teeth. J

Forensic Dent Sci. 2017; 9(3):157–164.

178


INTRODUCTION :

Physiology is one of the foundation sciences in medical

curriculum, which has immense importance in understanding

the future clinical sciences. Traditionally teaching in

Physiology has always been through didactic lectures,

practical and tutorials. There is no single method of teaching

that ensures thorough understanding of a topic among

students. So, there has always been a need for an alternative to

the traditional didactic format of lectures in medical education.

The medical curriculum is vast and students are expected to

learn many subjects at the same time. The teachers are also

involved in a number of activities apart from teaching like

research, administrative, updating their knowledge etc. In

doing so, teaching undergraduate medical students frequently

remains a separate academic department without integration to

interrelate or unify subjects. Therefore, Medical Council of

India desires the incorporation of integration in the medical

curriculum in order to provide the students with a holistic [1]rather than fragmented learning perspectives.

The term integration in education means coordination in

the teaching learning activities to ensure harmonious [2]functioning of the educational processes. It is defined as

organization of teaching matter to interrelate or unify

subjects frequently taught in separate academic courses or [3]departments. Integrated teaching aims to provide knowledge

to the students in a complete organized and wholesome

manner thereby enabling the students to have a more


Dr. Sonia Kochhar,

Associate Professor and Head (Oficiating),

Department of Physiology, All India Institute of Medical

Sciences, Bathinda.

Contact : +91 98966-72381


KEYWORDS : Case based learning, Self directed learning, Reasoning skills, Integrated Teaching, Physiology

Article History:Received: 8 August 2020Received in revised form: 18 February 2021Accepted on: 18 February 2021Available online: 15 August 2021

ABSTRACT :

Objectives: Small group teaching in the form of Case Based Learning (CBL) –a guided inquiry approach was used to teach

Endocrine Physiology. The aim was to assess the effectiveness of case-based learning in the first year MBBS students. The

objectives were to promote self directed learning, to enhance reasoning skills in the students & to motivate faculty to adopt new

integrated teaching methodology.

Methods: The study was conducted in the department of Physiology. The study group of 150 students (n=150), was divided into 2

groups A & B based on their roll numbers. Group A students experienced CBL & Group B students experienced Didactic lectures.

Both groups were examined by MCQs, pretest & posttest respectively. The scores of the two tests were compared for student's

comprehension. Students & faculty feedback was evaluated for the teaching method using Likert scale. Appropriate parametric &

non-parametric tests were used to analyze the data.

Results: The student's performance in MCQ tests was statistically significantly better after CBL (Mean±SD, 10.0±1.96)) as compared to after traditional teaching (Mean±SD, 7.7±2.17) (Paired t test, p- value of 0.004). In student's feedback 86% agreed that CBL encouraged active learning & improved problem solving ability. 76.8% considered it to be more informative & helpful in relating & retaining knowledge. 80.2% students acknowledged that it helped to develop communication skills & 72.6% agreed that it improved group dynamics. More than 90% of the students felt that CBL would promote a better teacher-student relationship. Faculty feedback stated CBL useful for developing interest, improving understanding & clinical reasoning of the students. They also showed their willingness to participate in such sessions in future & acknowledged Case Based Learning as a better method of teaching. Conclusions: Students performance & strong preference for CBL inferred more modules of CBL should be implemented in medical education.

1. Ashwani Ummat, Professor & Unit Head, Department of Orthopaedics, Adesh Institute of Medical Sciences & Research, Bathinda.

2. Sonia Kochhar, Associate Professor and Head (Oficiating), Department of Physiology, All India Institute of Medical Sciences, Bathinda.

An Approach Towards Integrated Teaching: Case-Based Learning (CBL) in Physiology


179

clear view of the topic, while on the other hand it takes a toll [4]on the students themselves. To put it simply, instead of

imparting knowledge on a topic in disintegrated manner, a

particular topic can be taken by two or more departments

by forming a co-ordinated integrated teaching program [5](correlation level).

Current drift in medical education is a shift from teacher

centered submissive learning environment to student centered [6]energetic, positive learning. The Medical council of India has

framed the learning process for graduate medical education

which incorporates case studies and problem-oriented

approach as well as introduction of horizontal and vertical [7]integration throughout the UG curriculum.

Medical Council of India also uplifts learner centric attitudes.

Various methods are used by many institutes to reinforce

lectures in teaching medical education for undergraduate

students. These are case based learning, problem based [8,9]learning and patient centered learning. One of such

approach is CBL (case-based learning) where the students

learn with the help of case scenarios and are actively engaged

to solve a problem to attain the learning objectives. CBL is

known to transmit analytical skills and ability to solve real [10,11]medical problems in the students. CBL is the method of

learning not perceptibly different from PBL (problem based

learning) but without patient exposure & in a protected [12]environment. Since CBL motivates students toward self-

directed learning and to develop analytic and problem solving

skills; thus, CBL could be beneficial for students entry into

clinical departments and finally, in managing patients.

CBL is one method where students are motivated to learn on

their own and integrate knowledge from different subjects to

solve problems. It is a small-group method in which both

students and faculty members contribute to discussion,

learning issues are preidentified, and preparatory readings are

assigned while student discussion and guided inquiry around [13] clinical problems are still promoted.

Hence we thought of incorporating innovative teaching

methods to make the learning process student centered. In our

study the teaching learning intervention in the form of CBL

was conducted in the Department of Physiology to compare

the academic performance of undergraduate medical students

by using traditional methods and innovative methods (CBL).

It was an attempt towards making students responsible for their

own learning and narrow down the gaps between students and

teachers.

AIMS & OBJECTIVES:

1. To compare the academic performance by using traditional

methods (Didactic lecture) and innovative methods (CBL).

2. To promote self-learning among students & to encourage

application of theory based knowledge to solve problems by

integrating basic science subjects with clinical scenarios.

3. To motivate the peer group to adopt a new teaching learning

methodology & make process of learning interesting &

enjoyable.

MATERIALS AND METHODS :stThis study was conducted on 150 students of 1 Year MBBS

(Bachelor of Medicine, Bachelor of Surgery) in MMIMSR,

Mullana during the academic year 2018-2019. Permission was

obtained from the Institutional Ethics Committee of our

institute. The study population was the undergraduate students

of first year MBBS. All first year MBBS students who

voluntarily gave the informed consent were included for the

evaluation of performance difference.

After the ethical committee clearance for the CBL

intervention, 7 topics were selected, cases were constructed,

and faculty of Physiology was trained. MCQ's and feedback

questionnaire for students and the faculty were designed, they

were prevalidated and validated. A facilitator training program

was undertaken in the department under the guidance of Chief

(Head) of the Medical Education Unit of the institute. The

“facilitators” were physiologists and physicians. Before

intervention counseling of the students was done. Informed

written consent was obtained from first MBBS students who

were willing to participate in the study. The study group

(n=150), was divided into 2 groups A & B based on their roll

numbers. For each topic, all the students were given MCQ

pre-test in order to elicit their base line knowledge about the

given topic. Group A consisted of students with Odd Roll

Numbers & Group B of students with Even Roll Numbers.

Group A students experienced CBL & Group B students

experienced Didactic lectures. The Interventional group was

divided into small groups of 15 with one facilitator for each

group. CBL session was conducted wherein they were

presented with a case scenario. (Appendix A) The case

scenario included the clearly written symptoms and signs

related to the topic. Adequate time was given for case

discussion and for solving the Specific Learning Objectives by

the students. The facilitator during the phase, motivated and

guided the students. Then afterwards, the case was discussed

under the guidance of facilitator properly & systematically.

Relevant questions were asked by the facilitator, so as to

streamline the thought process. Students were also encouraged

to ask questions to the facilitator during the session. This was

followed by MCQ post-test. The faculty from other

departments also attended the CBL session as observers.

A five-point Likert scale was used ranging from strongly

disagree to strongly agree to determine the overall rating of the

180


program by students and teachers (Appendix B). The feedback

survey of the students was done on nine parameters using five-

point Likert Scale ranging from strongly disagrees to strongly

agree and expressed in percentage. The participants were

exposed to the questions regarding the perception about the

CBL. Similarly, feedback from 20 faculties, who were

facilitators & observers, was obtained on nine parameters by a

Likert scale. Five separate questionnaires were developed for

teachers with more open-ended questions that could help in the

better implementation of CBL in the future. To determine the

effectiveness of the program, a pretest (before the session) and

post test (after the session) were also conducted. The

questionnaire designed for the pre- and post-test had 20

multiple choice questions (MCQs) with a combination of

recall type and higher order type based on problem-solving

skills and clinical application. The other group, Group B was

taught the same topic by the same teacher in a didactic lecture

form.

Statistical analysis. The objective of the study was to evaluate

the impact of the intervention i.e. CBL, on the students and

compare the academic performance with traditional methods,

i.e., Didactic lecture. The method was implemented by

different teachers, who measured the pre- and post-

intervention impact on their respective tests. Average pre- and

post-intervention scores of all students were obtained for each

teacher. Data was collected & entered in Microsoft office Excel

and the analysis was carried out using the SPSS (version 20)

package. To assess the overall impact of the intervention, data

was checked for normality by Shapiro-Wilk test and the

appropriate parametric (independent t-test) or non-parametric

test (Mann-Whitney test) was used.

RESULTS : All 150 students were present during the session.

Group A had 38 Male & 37 female students; Group B had 40

male & 35 female Students (Graph 1).

There was a significant improvement in student performance

when pre- and post-test scores were compared (p value-0.004),

which provided evidence as to the effectiveness of CBL

(Graph 2)

CBL was highly appreciated by the students (92%). The

majority of the students (86%) were of the opinion that CBL

helped them in self-study and improved their problem-solving

ability, and 76.8% of the students felt that CBL helped them in

relating knowledge from different subjects (basic sciences

with para-clinical and clinical subjects) and in better retention

of knowledge. According to 80.2% of the students, the small-

group discussions in CBL helped them to improving soft skills

such as communication skills, and 72.6% of the students felt

that CBL improved the group dynamics. More than 90% of the

students felt that CBL would promote a better teacher-student

relationship.

CBL was equally appreciated by faculty members also.

According to 90% of the teachers, CBL is a better method of

teaching and learning, because it promotes self-study and

problem- solving abilities of the students. The majority (78%)

of teachers felt that CBL would help in improving

communication skills, understanding principles of group

dynamics, and facilitating a better and healthy teacher-student

relationship. Following were the Suggestions to make CBL

better- faculty members felt that training of teachers should be

regularly done. Most teachers (90%) felt that although CBL is

a good teaching- learning method, it requires more time,

faculty members, and infrastructure. Some teachers (42%)

found it difficult to involve shy and less interested students in

the group discussion. Some teachers admitted that it was

difficult to just be a facilitator as they know the subject

thoroughly. Faculty members also suggested topics that can be

taught by CBL in the next session and showed their

willingness to be a faculty member for all CBL sessions in the

future, as it promoted them to revisit other subjects because

CBL helps in integrating knowledge of the topic from different

181


subjects.

DISCUSSION :

Teaching in Physiology has traditionally been through didactic

lectures, practicals, and tutorials. There is no single method of

teaching that ensures thorough understanding of a topic among

students. Lectures are definitely a powerful method of

delivering information to a large number of students quickly.

However, there are many limitations, such as lectures are a

passive method of learning by students and too much

information is given without application or a problem-solving

approach.

There has always been a need for an alternative to the [14,15]traditional didactic format of lectures in medical education.

Thus, we thought of adopting a combination of didactic

lectures and CBL sessions as a new innovative method in our

institute so as to retain the lectures and supplement them with a

new teaching learning methodology, which will give a

problem-solving approach. As medical teachers, we provide

students a large amount of information, but, at same time, it is

necessary to ensure that it should be used to establish and

optimize students' understanding.

In Case Based Learning by discussing a clinical case related to

the topic taught, students evaluated their own understanding of

the concept using a high order of cognition. This process

encourages active learning and produces a more productive [16,17]outcome. In our study CBL was incorporated with the

[18]following purpose :

1. To provide students with a relevant opportunity to see theory

in practice.

2. To require students to analyze data to reach a conclusion.

3. To develop analytic, communicative, and collaborative

skills along with the content knowledge.

4. To provide an opportunity for students to put themselves as

the decision maker's.

The results of our study prove that the learning of students is

significantly improved with the new learning methodology

(CBL) as students were able to answer application-based

questions as well. The result of the study also proves that the

assimilation of the knowledge was also improved because

discussing a case after the didactic lecture was helpful in

reinforcing the key elements of the topic. The retention of

knowledge was also better because students were required to

study the same topic from all subjects simultaneously so as to

integrate the knowledge to solve the given problem.

In some medical colleges in India, similar types of studies have [1,19]been introduced and the results have been encouraging An

early clinical exposure program consisting of CBL in

Endocrine Physiology in a medical college in India also

demonstrated that the majority of students (96.4%) gave an

overall rating of the program as good to excellent on a five-[20]point Likert Scale.

[21]According to study by VariRC et al. teaching endocrine

physiology in a patient-centered learning curriculum, students

are better equipped to analyze clinical problems, find and apply

appropriate basic science knowledge, and present their

patients compared with students from a traditional curriculum. [13]In a comparative study by Srinivasan M et al. between

problem-based learning and CBL, both students and faculty

members preferred the CBL method, as it offers more

opportunities for problem- solving skills within a session. In a [22]similar study carried out in India by Setia S et al. , the

majority of students reported CBL as a more suitable way of

learning compared with problem-based learning and that CBL

helped to improve their diagnostic skills and lateral thinking.

The teachers who were facilitators & observers in the CBL

project admitted that with this exposure to a new teaching-

learning process, their knowledge about the new teaching-

learning method has increased, Also they observed an

improvement in Student teacher relationship and so they were

ready to experiment with new methods of teaching (theory or

practical), assessment, and evaluation. Hence, we suggest the

incorporation of this new learning method in physiology,

which can be implemented in other departments also.

CONCLUSION :

Physiology forms the backbone of medicine and a lot of

medicinal subjects rely mainly on the normal physiology for

its understanding. So what a student learns and imbibes in the

first year of MBBS curriculum forms the base of future

education. From this study we conclude that the newer

concept of integrated teaching is a better and more

effective. CBL motivates students toward self-directed

learning and to develop analytic and problem-solving skills.

Hence, it will be desirable for students' entry into clinical

departments and ultimately in managing patients successfully.

ACKNOWLEDGEMENT :

The authors acknowledge the guidance and the support

provided by the dean of the institute and faculty members of

the department. We would like to specially thank the students stof 1 year MBBS for their continuous engagement with this

research.

Funding- No funding resources.

Conflict of Interest- None declared.

REFERENCES :

1. Arun V. Jamkar, Vishwnath L Yemul and Gurpreet Singh:

182


Integrated teaching program with student centered case

base learning for undergraduates at B J Medical College

Pune.

www.faimer.org/education/fellows/abstracts/04jamkar.p

df

2. Irby D, Wilkerson L. Educational innovations in academic

medicine and environmental trends. J Gen Intern Med

2003; 18: 370-376.

3. Muller JH, Jain S, Loeser H, Teby DM. Lesson

learned about integrating a medical school curriculum:

perceptions of students, faculty and curriculum leaders.

Med Edu. 2008; 42: 778-785.

4. Sameer M. Khan. “Integrated Teaching: A New

Approach in Medical Teaching”. Journal of Evolution of

Medical and Dental Sciences 2014; Vol. 3, Issue 57,

October 30;12939-45.

5. Atwa HS, Gouda EM (2014) Curriculum Integration in

Medical Education: A Theoretical Review. Intel Prop

Rights 2: 113. doi:10.4172/ 2375-4516.1000113

6. Naheed Bano, Farhat Arshad, Sadia Khan, C. Aqeel

Safdar; Case Based Learning and Traditional Teaching

Strategies: Where Lies The Future. Pak Armed Forces

Med J 2015;65(1): 118-24

7. Srabani N. Bhattacharya, Aniruddha A. Malgaonkar,

Sundaram Kartikeyan: Effect of case-based learning in

reproductive physiology on cognitive domain scores of

first year medical students in Western India; International

journal of Reproduction, contraception, Obstetrics and

Gynecology; 2017; Jun;6(6):2559-564.

8. Monika Bansal, Manoj Goyal: To introduce and measure

the effectiveness of case-based learning in physiology;

Internat ional journal of Research in medical

students;2017, Feb; 5(2); 437-445.

9. Vision 2015; Medical Council of India.

10. Nair SP, Seth S, Pandit N, Shah GCV: Case Based

Learning: A Method for Better Understanding of

Biochemistry in medical Students; Journal of clinical

Diagnosis Research; 2013,7 (8):1576-8.

11. Majjed F: Effectiveness of case-based teaching of

physiology for nursing students; Journal of Taibah

University Medical Sciences, 2014;9 (4): 289-292.

12. Tabassum Naveed, Naveed Mazhar Bhatti, Romana

Malik: Perception of Medical students regarding Case

Based Learning; Journal of Rawalpindi Medical College;

2017;21 (3); 303-305.

13. Srinivasan M, Wilkes M, Stevenson F, Nguye T, Slavin S.

Comparing problem-based learning with case-based

learning: effects of a major curricular shift at two

institutions. Acad Med 82: 74–82, 2007.

14. Ghosh S. Combination of didactic lectures and case based

problem solving tutorials toward better learning:

perception of students from a conventional medical

curriculum. Adv Physiol Educ 31: 193–197, 2007.

15. Lujan HL, DiCarlo SE. Too much teaching, not enough

learning: what is the solution? Adv Physiol Educ 30:

17–22, 2006.

16. Lake DA. Student performance and perception of a

lecture-based course compared with the same course

utilizing group discussion. Phys Ther 81:896–902, 2001.

17. Modell HI. Preparing students to participate in an active

learning environment. Adv Physiol Educ 270: 69–77,

1996.

18. Centre for Teaching and Learning, Queen's University.

W h a t I s C a s e - B a s e d l e a r n i n g ? ( o n l i n e ) .

www.queensu.ca/ctl/resources/topicspe - cific/casebased.

html [7 January 2012].

19. Vyas R, Jacob M, Faith M, Isaac B, Rabi S, Sathishkumar

S, Selva- kumar D, Ganesh A. An effective integrated

learning program in the first year of the medical course.

Natl Med J India 21: 21–26, 2008.

20. Sathishkumar S, Thomas N, Tharion E, Neelakantan N,

Vyas R. Attitude of medical students towards early clinical

exposure in learning endocrine physiology. BMC Med

Educ 7: 30, 2007.

21. Vari RC, Borg KE, McCleary VL, McCormack JT, Ruit

KG, Sukalski KA, Olson LM. Endocrine physiology in a

patient centered learning curriculum. Adv Physiol Educ

25: 241–248, 2001.

22. Setia S, Bobby Z, Ananthnarayanan P, Radhika M,

Kavitha M, Prashanth T. Case-based learning versus

problem-based learning: a direct comparison from first-

year medical students perspective. Webmedcentral Med

Educ 2: WMCOO1976, 2011.

183


Case 1: A 21-year-old noncompliant male with a history of type

I (insulin-dependent) diabetes mellitus was found in a coma. His

blood glucose was high, as well as his urine glucose, urine

ketones, and serum ketones. His serum bicarbonate was <12

mEq/L. His respiration was exaggerated and his breath had an

acetone odor. His blood pressure was 90/60 and his pulse weak

and rapid (120).

Case 2: A 45-year-old male presented with the following

symptoms during February: weakness, fatigue, orthostatic

hypotension, weight loss, dehydration, and decreased cold

tolerance.

His blood chemistry values follow: Serum sodium:128 mEq/L,

Serum potassium:6.3 mEq/L, Fasting blood glucose:65 mg/dL,

BUN:4.5 mg/dL and Serum creatinine:0.5 mg/dL

Hematology tests resulted in the following values:

Hematocrit:50%, Leukocytes:5000/cu mm

He also noticed increased pigmentation (tanning) of both

exposed and non exposed portions of the body and back. A

plasma cortisol determination indicated a low cortisol level.

Following administration of ACTH, plasma cortisol did not rise

significantly after sixty and ninety minutes. Endogenous

circulating levels of ACTH were later determined to be

significantly elevated.

Case 3: A 28-year-old male complained of abrupt polydipsia

and polyuria.

Blood and urine analyses provided the following results:

Fasting blood glucose:93 mg/dL, Serum sodium:145 mEq/L,

Serum potassium:2.8 mEq/L, Urine specific gravity<1.005,

Urine osmolality<200 mOsm/L, Urine volume:15 L/day, Urine

glucose:Nil

Water deprivation and hypertonic saline infusion do not cause a

significant reduction in the polyuria and concentration of urine.

Complete water-deprivation results in the following: Urine

specific gravity:1.009, Urine osmolality:225 mOsm/L

However, there is a significant concentration of the urine and a

decrease in urinary output following administration of ADH.

Case 4: A 50-year-old male had a total thyroidectomy followed

by thyroid hormone-replacement therapy. Thirty-six hours later

he developed laryngeal spasms, a mild tetany, and cramps in the

muscles of the hands and arms.

The following tests were performed: Urine calcium 20 mg/dL,

Urine phosphorus 0.1 g/day, Plasma calcium 7.0 mg/dL, Plasma

phosphorus 5.0 mg/dL.

Calcium gluconate and vitamin D (calcitriol) were given orally

each day and the tetany and laryngeal spasms were alleviated

Case 5: A 20-yr-old woman, visited the Medical Outpatient

Department with a history of swelling in the front of the neck

since the last 6 month. Recently, she also developed complaints

of palpitation, excessive sweating, and tremors. There is a

significant history of weight loss in last 3 month, but with no loss

of appetite. She does not have any hoarseness of voice or

difficulty in swallowing or breathing. On examination, she was

told that she is suffering from goiter and advised to seek further

investigations. It was further found that there were no signs of

exophthalmoses.

In next session: After 1 wk, she returned to the doctor with her

reports. Upon investigation, it was found that her thyroxine

levels were raised and thyroid-stimulating hormone levels were

less than normal. A thyroid scan confirmed the diagnosis of

multinodular goiter. She was prescribed anti-thyroid drugs and

β-blockers and advised to consult a surgeon.

Case 6: A mother came with a 24-month old girl child who has

failure to thrive and an unusual gait. She has bowed legs, thick

wrists and dental caries. Her weight (8Kg) and height (72.5cm) rdare below the 3 percentiles for her age. Her diet consists

predominantly of breastfeeding 5 times daily. The mother's

antenatal, delivery and post-natal history are unremarkable.

Case 7: A 63 year old women presents with history of acute low

back pain. She had menopause at 44 years of age, but never

received postmenopausal HRT. Reported a history of a Colles'

fracture at the age of 60 years.

Lumbar spine X-ray reveals veretrbrae fracture (L1). DXA of

the hip shows a BMD T-score of -1.8SD, and of -2.7 at LS (L2-

L4).

184

APPENDIX A: Case Scenarios


185

Feedback questionnaire on CBL for students.

Sr No.

1.

2.

3.

4.

5.

6.

7.

8.

9.

Feedback Questionnaire A.Strongly disagree

B.Disagree

C.Neither agree nor disagree

D. Agree

E.Strongly agree

CBL is a better method of teaching/learning than the conventional one.

CBL promotes self-study and problem-solving abilities of the students

CBL helps in the recall and application of basic sciences to the given clinical scenario.

CBL helps in better retention of knowledge.

CBL helps in improving communication skills of the students.

CBL helps in understanding the principles of group dynamics.

CBL deprives students of an opportunity to acquire knowledge from experienced and good teachers.

CBL gives an opportunity for even staff members with poor teaching skills to be good facilitators

CBL facilitates a better and healthy teacher-student relationship.

Appendix B-I


Open ended Questions:

10. Give suggestions to make CBL better.

11. Should CBL be included in the timetable as a regular teaching- learning activity (yes/no)?

12. List the disadvantages or drawbacks of CBL, if you found any.

13. Comment on the problems you encountered as a facilitator in CBL.

14. Comment on the problems in implementing CBL in your department.

15. Suggest a few topics that can be taught by CBL in your department.

Sr No.

1.

2.

3.

4.

5.

6.

7.

8.

9.

Feedback Questionnaire A.Strongly disagree

B.Disagree

C.Neither agree nor disagree

D. Agree

E.Strongly agree

CBL is a better method of teaching/learning than the conventional one.

CBL promotes self-study and problem-solving abilities of the students

CBL helps in the recall and application of basic sciences to the given clinical scenario.

CBL helps in better retention of knowledge.

CBL helps in improving communication skills of the students.

CBL helps in understanding the principles of group dynamics.

CBL deprives students of an opportunity to acquire knowledge from experienced and good teachers.

CBL gives an opportunity for even staff members with poor teaching skills to be good facilitators

CBL facilitates a better and healthy teacher-student relationship.

186

Feedback questionnaire on CBL for teachers

Appendix B-II



INTRODUCTION :

Lying has been an integral part of human society since its

beginning. We may not want to admit this or not be aware of it,

but lying has become a part of our everyday lives. A study of

social interactions reported that on an average, college

students told two lies per day, and community members told

one lie per day. Undergrads reported lying in about one third of

their social interactions, while people from the community lied 1in one fifth . Most of these lies have low stakes though.

Lying is described as the deliberate act of deviating from the

truth. A person is said to lie when he intends to mislead another 2without having been explicitly asked to do so by the victim .

Newer techniques, other than polygraph, like use of verbal

clues, linguistic analysis, voice analysis, micro expression

analysis and f-MRI for detecting memory and encoding

related multifaceted electroencephalographic response 2(MERMER) have shown promising results.

Darwin was of the belief that emotions are universal, evolved 3and cannot be controlled easily . In this emotional approach to

lying, it is emphasized that deceiving causes physiological,

psychological and emotional responses due to the arousal. The

arousal is the result of the guilt and fear of being caught. Part of

these emotions can be controlled but most of the times this

conscious approach to control emotions leads to leaks that give 4away a lie . Non-Verbal communication is perhaps the most

important communicative tool that one can learn to use,

observe and interpret. Mehrabian formulated that,

transmission of emotional messages in a brief interaction

between strangers more on facial expressions (55%), than

vocals (38%) and verbal's (7%). These non-verbal and vocal

clues are thought to be subconscious leaks of one's inner 5emotional states and can deceive a person's lie . It is by far

concluded from many previous studies that there is no single

Pinochio response that can give away a lie. When these facial

behaviors are studied in context of the lie, they can be an effective means to detect a lie.

As behavior, emotion and expression are strongly influenced 6by cultural factors , there is a strong need for studying micro

expressions in Indian settings. The intention of this study was

to observe the behavior of participants when lying or telling the


Dr. Vijay Kautilya D,

Professor,

Department of Forensic Medicine & Toxicology, Manipal

TATA Medical College, Jamshedpur.

Contact : +91 94486-51848, 90949-43338


KEYWORDS : Lie detection, Micro expressions, verbal cues, Non-verbal cues

Article History:Received: 13 April 2021Received in revised form: 9 July 2021Accepted on: 9 July 2021Available online: 31 August 2021

ABSTRACT :

Background: Use of verbal and nonverbal clues for deception have been analyzed recently and have shown promising results.

This study attempts to cataloged the various verbal and nonverbal cues of deception and analyze their significance.

Methodology: - The study was conducted among 50 subjects of south Indian origin who participated in an experiment which

required them to generate true statements and statements of deceit. The recordings of these statements were analyzed for verbal and

nonverbal clues and the results tabulated.

Results: - In the study it was found that the rate of occurrence of various nonverbal responses increased in a deceit statement. Blink

rate and rate of shift of posture showed statistically significant increase in deceit statements. Asymmetric and false smiles were

associated with deceit statements.

Conclusion: From the findings of the study, it can be concluded that there is no single response that can detect deceit statement.

These cues of deception have to be viewed in comparison to the persons own baseline and cannot be generalized.

1. Vijay Kautilya D, Professor, Department of Forensic Medicine & Toxicology, Manipal TATA Medical College, Jamshedpur*

2. Shruti Prabhat Hegde, Professor, Department of Ophthalmology, Manipal TATA Medical College, Jamshedpur*

3. Pramika Rajashekaran, MBBS student, Shri Sathya Sai Medical College & Research Institute.

*Manipal Academy of Higher Education, Manipal

Study of the Profile of Verbal and Non- verbal Clues of Deception among People of South Indian descent.


187

truth. In our study we have attempted to catalogue and

establish a profile of various verbal and Non-verbal clues of

deception in South Indians and also attempt to determine their

significance in detecting a lie individually and in the context of

the statement analysis annotations. The results of this study

will be of benefit to police interrogators, psychotherapists,

lawyers, judges, teachers, personal managers and voters in

detecting deception.


The study was conducted in Shri Sathya Sai Medical College

and Research center, Ammapettai, Chennai over a period of

two months. After obtaining Institutional Ethics Committee

Clearance an advertisement was put up in the college campus

asking for volunteers willing to participate in the study. The

subjects above 18yr of age (n=50, 24male & 26 female) were

selected from faculty, office staff and students on first come

first serve basis. Mother tongue (Telugu, Tamil, Kannada, and

Malayalam) was noted to select subjects from south of India.

Subjects resisting emotions in public sphere, subjects wearing

glasses and subjects unwilling to tell a lie were excluded from

the study. The participants were informed of the procedure and

purpose of the study and informed consent was obtained in

writing from all the participants.

Procedure of collection of data:

The study was designed in line with the study done by Biland et 7 5al and “20 Dollars for a Lie test” by Paul Ekman . In our

experiment, two subjects were to face each other and play a

game where one had to either tell the truth or lie to the other.

One player would try to discover if the other was lying. Care

was taken to pair male with another male subject and female

with another female subject in order to avoid gender

interaction effects and to balance the belief that women are

more skilled at observing and detecting nonverbal cues (NVC) 5based on evolutionary principals .

The Participants of the study performed the following

exercises as part of the game.

a) Exercise :- The participants had to write down six

statements describing incidences in their personal life which

they feel have an emotional value. Three of the statements need

to be true and the other three deceptive. The participant then

was asked to describe the statement convincingly to another

participant who judges if the statement is a lie or truth. For

every successful deceptive statement which the partner could

not identify the participant would get rupees 100. The reward

was given to provide motivation for lying so as to create high

stakes environment.

Data Analysis: -

The video recordings in the exercises were meticulously

analyzed for Verbal and Non-Verbal clues for deception using

video (kinovea 0.08.15) and audio (audacity 1.3 beta) analysis

software. Various nonverbal modulators of deception like

blinking, eye contact, gaze aversion, head movement, smile,

hand movement, posture shift, self-manipulation (scratch etc.)

and verbal modulators like voice, verbal style, verbal

statement, speech latency, repeated phrases or words studied in

the previous studies were analyzed for their frequency of

occurrence.

The data was statistically analyzed using SPSS (Statistical

Package for Social Sciences) computer software. As the

response variables are clustered within the participants with

each response being measured twice for the same participant

especially in exercise one repeated measure or paired sample

analysis was used. Frequency of occurrence of each parameter

in relation to the lie or truth with its statistical significance

waste calculated.

RESULTS:

The study sample consisted of 50(26 female & 24 Male)

subjects from Shri Sathya Sai Medical College & Research

Institute between the age group of 18 to 35 years with the

average age being 22.52yrs. As the study group consisted of

medical students (n=40) and medical teachers (n=10). All the

participants were already acquainted to their partners with an

average period of acquaintance being 3.5 yrs (Min-1yr, Max

10yrs).

Verbal and non-verbal cue analysis:

In the process of participation, each participant recorded three

true ad three false statements which were analyzed for the

average occurrence of each of the verbal and nonverbal cues of

deception described in earlier studies (Table no 1). The

variables were measured in an objective manner to ensure

reproducibility.

188

25 (50%)

0 (0%)

25 (50%)

25 (50%)

0 (0%)

25 (50%)

10 (20%)

15 (30%)

25 (50%)

35 (70%)

0 (0%)

15 (30%)

15 (30%)

5 (10%)

20 (40%)

0 (0%)

30 (60%)

20 (40%)

Smile congruence with motion of the statement

Smile symmetry

True smile

True statement

(n=50)

Factor analyzed False statement

(n=50)

Congruent smile

Incongruent smile

Smile absent

Symmetric

Asymmetric

Absent

Involves upper face

Lower face only

Absent smile

Table 1: Frequency of occurrence of various verbal andnonverbal clues of deception in truth and deceit statement.

There was a decrease in the occurrence of self-manipulators.

Touching the chin and scratching the head were prominently

found in true statements. Eye wink was found to be present at

some stage of a deceit statement in 5 participants.

Smile in particular has been studied in most of the previous

studies and associated with deceit. As a significant number of

participants presented with a smile at some stage of the

statement the following features of the smile ware analyzed in

the context of the speech. (Table 2).

As the response variables are clustered within the participants

with each response being measured twice for the same

participant, repeated measure or paired sample analysis was

used. The results of the paired t-test are presented in the tables

below in table no 3 and 4 respectively.

DISCUSSION:

In this study, the participants competed with each other to win

rupees 100 for every lie this created a situation where stakes are

involved thus providing the motivation among the participants

to lie. This was the requirement as described by various other 7 8 9researches like Biland et al , Frank et al and vrij et al . From

repeated analysis of the recordings, various variables and the

changes occurring in them during the deceit and truthful

statement were studied. The results of the study present these

findings.

According to table no 1 presenting the frequency of occurrence

of some verbal and nonverbal behaviors, it can be observed

that there is an increase in the chance of occurrence of these

verbal and nonverbal behaviors when giving a false statement

except in the occurrence self-manipulators which decreased. 4Most of the research done in nonverbal behaviors by Vrij et al ,

7 10 11 12 Biland et al , Matsumoto et al , Francois et al and Allan et al

compliment these findings. Posture shift was found in 60% of

our subjects in deceptive statements contrary to 10% in true

statements.

There was a significant difference in the occurrence of smile

among the deceit (70%) and true statement (50%). Contrary to 13our finding Sporer et al found that smiling was less associated

with deceptive statements. The characters of the pattern of the

smile were further studied and presented in Tables no 2.

Darwin described true smile as one where there is contraction

189

No.

1

2

3

4

5

6

Smile during statement

Posture shift during the statement

Self-manipulators during statement

Voice latency

Fillers (ahh and non ahh speech)

Repetition of words

True statement %

(n=50)

50% (25)

10% (5)

20% (10)

70% (35)

90% (45)

20% (10)

Factor analyzed False statement %

(n=50)

70% (35)

60% (30)

10% (5)

90% (45)

90% (45)

30% (15)

Table 2 :Descriptive statistics of the different characters of a smile.

Table 4: Average and standard deviation of expressed behaviors for each of the verbal indicators.

Factor analyzed

Speech rate (sentences/30sec)

Voice loudness (db)

Period of voice latency (sec)

Rate of fillers (per 30 sec)

Statement length (sec)

Rate of repetition (per 30 sec)

Mean True

statement

11.00

96.05

0.570

4.56

24.56

0.316

Mean False

statement

12.6

94.72

2.489

9.08

33.07

0.68

1.6

1.33

1.919

4.51

8.50

0.364

No.

1

2

3

4

5

6

Paired difference

means

Std. deviation

5.12

6.077

1.48

7.31

18.96

0.143

Significance

(P)

0.032

0.127

0.000

0.000

0.003

0.014

Verbal clues of deception:

Table 3: Average and standard deviation of expressed behaviors for each of the nonverbal indicators.

Nonverbal cues of deception

Factor analyzed

Blink rate (bl/min)

Eye contact (sec/min)

Rate of gaze aversion (per min)

Rate of head movement (per min)

Rate of hand movement (per min)

Rate of posture shift (/min)

No.

1

2

3

4

5

6

Mean True

statement

28.961

53.63

11.33

33.58

44.6

2.07

Mean False

statement

33.63

52.30

10.55

33.12

40.03

4.78

Paired difference

means

4.66

1.33

0.75

0.462

4.56

2.71

Std. deviation

12.44

6.01

6.96

10.92

18.42

7.31

Significance

(P)

0.011

0.124

0.450

0.766

0.086

0.012

of both the muscles of the upper and lower part of the face. 7False smiles involve the lower part of the face only .Congruent

smile is considered when it is appropriate to the content of the

statement made. A symmetrical smile is one which presents

with contraction of the required muscles bilaterally.

Though the smiles in most of the situations were symmetrical,

asymmetrical smiles were only found in deceit statement (5%). 7These findings are in line with other finding by Biland et al ,

12 14Allen et al and Gamson et al .

Further as the verbal and nonverbal variables were measured

objectively for the true and false statement given by the same

person. The average difference of the means was measured and

paired sample analysis was performed to check for the

significance of the difference in the findings.

From the table no 3 it can be clearly seen that all the variables

studied show difference in the means for the true and false

statement. However statistically significant difference at P<

0.05 is found only with blink rate and rate of shift of posture per

minute. Blink rate showed an increase among the deceit

statements (about 4.66) compared to true statements. This was

statistically found to be significant at p<0.05. Blink rate has

been found to be one of the most reliable factors to differentiate

a true from a false statement by most of the resent studies by 3 2 12 14Vrij et al , Dhar et al , Allan et al Gamson et al & Porter et

(15,16)al . This increase in the motor responses during the deceit

statements is expected to be because of the arousal response

experienced by the subject during the deceit statements. Some 9researchers like Vrij et al have also shown decrease in the

motor responses during the deceit due to a conscious attempt

made by the participant to control his response.13Sporer et al in his study found that the period of eye contact

decreases during the deceit statement and there was an increase

in the frequency of gaze aversion however the results have not

been found to be significant statistically. Rate of sift of posture

has been found to be significantly increased during the deceit 11statements. This is similar to the findings of Francois et al .

Other differences found were statistically insignificant.

From the table no 4 showing paired sample analysis for verbal

cues of deception, it is clear that period of voice latency, rate of

fillers (ahh, other irrelevant sounds) and repetition of words 17showed the best statistical significance. Conellac et al

described similar linguistic clues in his study. The findings

were very significant at p<0.001. The rate of fillers, repetition

of words, and period of latency in the speech showed a

significant increase in deceit statement. However, speech rate

and loudness of voice decreased in deception statements. 9 11These finding are also described by Frank et al , Francois et al ,

17 18Conellae et al & Matsumoto et al .

CONCLUSION:

From the study of the verbal and nonverbal cues of deception in

this study it can be concluded that there is no single response

that can differentiate a lie from the truth. Deceptive statements

are associated with an increase in the rate of occurrence of

motor responses and incongruent false smiles. Blink rate and

postural shift are significantly important in deception analysis.

Gaze aversion, eye contact, head movement and self-

manipulation are not significant in identifying deceptive

statement. Vocal clues like voice latency, rate of fillers and

repetition are significant indicators of deception. All these

findings are relevant only when compared with the persons

baseline behavior and cannot absolute or generalized.

Acknowledgement: The study was accepted as an ICMR-

STS project and has been presented as a paper in IMALE-

2014 conference.

REFERENCES:

1. Dyer, Rebecca. Are You Lying to Me?: Using Nonverbal

Cues to Detect Deception. Diss. Haverford College,

Department of Psychology. 2007: P4-5. Available from :

URL: http://hdl.handle.net/10066/995

2. Dhar A , Shriharsh V. The theoretical study of lying and

micro-expressions. Astitva Int J of Commerce

Management and Social Sci. Dec 2012; 1(1): P39.

3. Ursula H, Thibault P. Darwin and emotion expression.

American Psychologist. 2009; 64(2): p 120. DOI:

10.1037/a0013386

4. Vrij A, Semin G. R. Lie experts' beliefs about nonverbal

indicators of deception. J of Nonverbal Behaviour. 1996;

20: p 65-80.

5. Lang Erick. Lie to me: video Analysis of Non-Verbal

Communication Between female Students in a Game of

Deceit. Diss. Dept of social psychology. London School

of Economics and Political Science. P 6-7. Available

from: url:

http://www.lse.ac.uk/socialPsychology/research_activiti

es/Lang_Erik160809.pdf

6. Matsumoto D. Culture and emotional expression.

Problems and solutions in cross cultural theory, research

and application. New York: Psychology press; 2009;

p263

7. Biland , Allione J, Demarchi S, Abric J. The effect of lying

on intentional versus unintentional facial expressions.

Revue européenne de psychologie appliqué. 2008; 58:

p65–73.

8. Frank MG, Menasco AM, O'Sullivan M. Human behavior

and deception Detection. Handbook of Science and

190

Technology for Homeland Security. newyork: John Wiley

& Sons; 2008;p4-5.

9. Vrij A, Edward K, Robert P K, Bull R. Detecting deceit via

analysis of verbal and nonverbal behavior. Journal of

Nonverbal Behavior. 2000; 24(4): p-236- 263.

10. Matsumoto D, Hwang HS, Skinner L, Frank M.

Evaluating Truthfulness and Detecting Deception. FBI

law enforcement Bulletin. June 2011;80(6): p1-8.

Available from: URL: http://www.fbi.gov/stats-

s e r v i c e s / p u b l i c a t i o n s / l a w - e n f o r c e m e n t -

bulletin/june_2011/school_violence

11. Francois P, Gracia E. Studying Liars: Tips for Detecting

Deception. Third Degree Communications, Inc. March

2007; Available from: URL:

http://www.tdcorg.com/download/StudyingLiars-03-24-

07.pdf

12. Allan Peace, Barbra Peace. Evaluation and Deceit signals.

The definitive book of body language. Ed1; Australia

,Peace International: 2004; p 142-192

13. Sporer LS, Schwandt B. Moderators of nonverbal

indicators of deception-a meta-analytic synthesis.

Psychology, Public Policy, and Law. 2007; 13(1): p34.

DOI: 10.1037/1076-8971.13.1.1

14. Gamson, Rachel, Gottesman J, Milan N, Weerasuriya S.

Cues to Catching Deception in Interviews. National

Consortium for the Study of Terrorism and Responses to

Terrorist START. 2012; p2-9.

15. Porter S, Brinke L. Reading between the Lies Identifying

Concealed and Falsified Emotions in Universal Facial

Expressions. Psychological science. 19(5): p508-514.

16. Porter S, Brinke L, Wallace B. Secrets and Lies:

Involuntary Leakage in Deceptive Facial Expressions as a

Function of Emotional Intensity. J Nonverbal Behav.

2012; 36: p23–37. DOI 10.1007/s10919-011-0120-7

17. Connell AC. Linguistic Cues to Deception. Diss. Virginia

Polytechnic Institute and State University. 2012; p6-

Available from: Url:

http://scholar.lib.vt.edu/theses/available/etd-05092012-

160131/unrestricted/ Connell_CA_T_2012.pdf

18. Matsumoto D, Hwang HS, Skinner L, Frank M.

Evaluating Truthfulness and Detecting Deception- New

Tools to Aid Investigators. FBI law enforcement Bulletin.

2011; P1-9. Available from: Url:

http://davidmatsumoto.com/content/Evaluating%20

Truthfulness%20and%20Detecting%20Deception.pdf

191


INTRODUCTION:

Education and technology have been inextricably linked in

recent decades, as education is the bedrock of academic fields.

As a result, scientists have coined the terms "information age," 1"computer age," and "digital age" to define the new period .

The constant evolution of medical science in general, and in

particular of medical services, has created the need for

advances and improvements in medical education. Graduate

medical education has traditionally been lecture-based, and

students rely heavily on textbooks and clinical training for

learning purposes. Clinical training plays an important role in

the growth of medical skills and in the training of individuals

and students are able to apply learned principles in practice.

Research results suggest that deficiencies, such as lack of

coordination between theoretical learning and clinical

services, lack of proper training facilities and equipment,

diversity in the role of trainers and lack of training time, have

made the standard of clinical training not satisfactory, as well

as ensuring the safety and satisfaction of patients facing 2-4challenges . Medical students, on the other hand, rely heavily

on medical books and tools and need timely access to

information such as algorithms and clinical recommendations,

drug reference, statistical statistics, demographic information,

and also the latest scientific evidence at the point of care from 3-6anywhere at any time . Therefore to meet such information

needs in clinical training, it is must for students to have

knowledge about the latest technology and also use them in

practice.

The emergence of new technology, such as smartphones, is not

limited to clinical practice, but has also made its way into

medical training.Smartphones have been identified as mobile

telecommunications devices with advanced features such as

medical applications, word processing, internet access and 7other computing capabilities . The ability to access medical

knowledge through a smartphone often expands its use beyond


Dr. Arti Ajay Kasulkar,


Department of Forensic Medicine & Toxicology, NKP Salve

Institute of Medical Sciences & Research Center and Lata

Mangeshkar Hospital, Digdoh Hills, Hingana Road, Nagpur-

440019.

Contact : +91 9881907277


KEYWORDS : Smart phones, Medical related applications, Learning, Medical undergraduates, Questionnaire.

Article History:Received: 9 June 2021Received in revised form: 9 July 2021Accepted on: 9 July 2021Available online: 31 July 2021

ABSTRACT :

Introduction: Smart phones are becoming a more relevant forum for delivering health information and medical interventions. The

majority of newer generation smart phones are increasingly being seen as portable computers.

Material and Method: A cross-sectional questionnaire-based online survey was conducted among medical students to assess their

knowledge regarding use of smart phones and medical related applications and to identify barriers if any in its usage.

Result: 197 (98.5%) students owned a smart phone, android 173(86.5%) being the preferred operating system. Marrow (49.6%),

Prepladder (34.1%), and Medscape (22.9%) were the top one medical application they preferred to use. 145(72.5%) students used

Medical information education programming for learning purpose and found useful and reliable for learning.

Conclusion: Rapid introduction of modern technology has altered many facets of our communication and has the ability to alter

how we educate, read, and practice medicine. Smartphone technology is transforming how medicine is learned and practiced, with

medical students increasingly preferring to access convenient, frequently updated web-based literature over hard copies of books or

journals.

1. Sakshi Singh Chauhan, MBBS Student, NKP Salve Institute of Medical Sciences & Research Centre and Lata Mangeshkar Hospital, Nagpur.

2. Arti Ajay Kasulkar, Associate Professor, Department of Forensic Medicine & Toxicology, NKP Salve Institute of Medical Sciences & Research Centre and Lata Mangeshkar Hospital, Nagpur.

Knowledge and practice of smart phones and medical related applications in learning by medical undergraduates.


192

simple communication devices. Recently, there has been a

meteoric rise in the popularity of smartphones and

subsequently the use of medical applications (commonly 8referred to as "apps") . There are currently more than 10,000

9apps in the category medical, health and fitness on app store .

Smartphone apps are self-contained software programs that 10can be downloaded and run from these smartphones . The

emerging trend in smartphone-related medical apps is also

providing medical students with groundbreaking means of

education. Some of the most common and useful smartphone

apps on the Android market are Medscape, Medicogram, Fast

LabRef, Marrow, Prepladder, and medscape, offer case-based

knowledge to students. In addition, students are also given the

opportunity to learn about rare medical conditions that are not

available in general clinical rotation. From this point of view,

researching the use of apps among medical students varies

considerably across other subjects.It is therefore crucial to

understand all facets of medical students' devices, smart

phones and academic life. The goal is to explore the use of

smartphones as an m-learning tool among medical students.

Mobile learning, or m-learning,is broadly defined as the

provision of learning material using mobile technology that

can be accessed at the convenience of a student from any 11location .

Although there are many benefits to using these smartphones

and medical-related apps, there are some challenges that

students face when implementing these applications. Some of

them could be expensive smartphones to buy, network

connectivity issues as some applications need a good internet

connection to work, privacy issues, usability of the battery, and

time consuming. With the emergence of new technology, it is

important to determine whether students have access to and

attitudes about new technology before it is incorporated in the

medical curriculum. With this in mind, the present study was

carried out to know about the use of smart phones and related

medical applications by medical graduates and to identify

barriers (if present) in its use.


After obtaining permission from the Institutional Ethics

Committee, a cross-sectional questionnaire-based online

survey was conducted among medical students of N.K.P. Salve

Institute of Medical Sciences & Research Centre and Lata

Mangeshkar Hospital, Nagpur from August 2020 to September

2020. The online validated questionnaire was developed with a

consent form attached to it.

The questionnaire covered demographic details, questions

assessing the knowledge of students regarding use of

smartphones and medical related applications, sources from

which they got to know about these applications and their

frequency of usage of these applications. The questionnaire

also focused towards understanding the barriers that prevent

the accessibility of this application for learning in medical

students. The questions elicit responses of students of all

academic year ranges regarding knowledge, usefulness and

reliability on these medical applications in learning.

The link of the questionnaire was sent to medical students

through E-mails and WhatsApp. On receiving and clicking the

link, the participants got auto directed to the information about

the study and informed consent.

Inclusion criteria: The students who were willing to

participate and consent were included.

Exclusion criteria: The students who were unwilling to

participate were not included in the study.

The online responses were tabulated and analyzed for

frequencies and percentage.

RESULTS :

The online survey was conducted among 200 medical

undergraduate students of all batches [Males = 107 (53.5%)

and Females = 93 (46.5%)]. The cohort comprised of first year

(n=47), second year (n=78), third year (n=47) and fourth year

(n=28) students. Year of study and gender wise distribution is

depicted in Table 1.

We observed that 197 (98.5%) medical undergraduate students

owned a smart phone (Fig. 1) and android 173(86.5%) was the

preferred operating system in their phones (Fig. 2).

Marrow (49.6%), Prepladder (34.1%), and Medscape(22.9%)

were the top one medical applications they preferred to use.

E m e d i c o z ( 1 8 . 6 % ) M e d i c a l e n c y c l o p e d i a ( 1 3 % ) ,

Pubmed(10.5%), Medicogram(3.1%) were the other popular

ones. In open ended question students also mentioned about

Dr. Najeeb, Osmosis, Histogram/Plexus, Prognosis,

auscultation, Medical pneumonic, GRG, General anatomy

app, Ankidroid, Clinical scenario, etc. (Fig. 3). Most of the

students 145(72.5%) used Medical information education

programming for learning purpose and found useful and

reliable for learning (Fig. 4).

It was also observed that 165(82.5%) students used social

media applications also for medical learning purpose with

Google and YouTube being the two topmost priorities of

students in all the MBBS professional years (Fig. 5).

As shown in Table 2, majority of the students 185(92.5%) were

aware about various medical related online available

applications, of which 161(80.5%) owned those applications.

Maximum participants 117(58.5%) had 1 to 2 applications in

their smart phones. When inquired about the source of

information regarding the medical applications, it was

193


predominantly through their friends followed by internet.

Medical applications were being used for educational

124(62%) as well as clinical learning 37(18.5%) several times

a day approximately spending 45 minutes a day.

A multiple-choice question with more than one answer correct

addressed barriers to using mobile devices for study and

practice. “No wireless access in the college or hospital” was

reported as the main barrier to using mobile devices for

information seeking, with 48.4%of students recognizing it as

being a problem (Fig. 6). Wireless access was broadly

recognized as a problem among all groups. As the college also

has some dead spots in cellular network coverage, the situation

even worsens. “Technical problems” (31%) and “Lack of

knowledge about the availability” are the other most

commonly reported barriers to access. Also, 22.3% students

faced no barriers at all.

DISCUSSION:

Smart phones and their incorporation with information

technology in health care facilities have the potential to change

the way health care is provided in the future due to rapid rise in

usage of medical applications and its users for efficient

learning. To our knowledge, very few studies of such kind have

been carried out. The collected data could be a useful

component to form smartphone ownership and usage 12landscape. Previous research by Chatzipavlou, Ioannis et al

finds Smartphone ownership equal to 96.6% but in our study,

98.5% ownership was observed. The slight increase shows the

increased popularity of smart phones among students. The 13result of the research conducted by Sefdari R et al shows that

in terms of prioritizing, the varieties of medical applications

are Up to date, Skyscape and Pubsearch. But the results of this

study show Marrow, Prepladder and Medscape are the first

three priorities.14The results of researches conducted by Vinay KV et al

indicates that Smart phones and their increasing integration

with information technology in colleges and hospitals can

change the way inwhich healthcare is delivered in the future.

When asked about if the students will recommend these

medical applications to their fellow students and juniors,

152(94.4%) students answered in yes. Almost 100% students thof 4 MBBS answered in yes. Such application by medical

college will help in compilation of all the presentations at one

place which in turn can be a great help for the students to learn.

CONCLUSION:

Today, technology is changing the way medicine is taught and

practiced. In particular, there is a rapid rise in medical

applications worldwide and an increase in people around the

world using these medical applications and other resources

available on smart phones for efficient learning. With the

widespread availability of downloadable medical applications

related to medical education, the level of smart phone use by

medical students and professionals is growing day by day. It is

therefore necessary to assess the current knowledge of Indian

universities' medical undergraduates regarding the use of

smartphones and medical applications for learning, so that

students can compete globally with other medical

undergraduates.

A thorough use of the resources available on smartphones for

learning purposes can expose students to recent medical

developments and keep them up-to-date. It is therefore very

important for us to know how medical graduates use these

applications and what the barriers that prevent them from

doing so are.

Acknowledgement:

We are grateful to the participants of the present study, without

their cooperation this study could not have been carried out.

Financial support and sponsorship: Nil.

Conflicts of interest: There are no conflicts of interest.

REFERENCES:

1. Abu-Faraj ZO, Barakat SS, Chaleby MH, Zaklit JD. A

S I M c a r d - b a s e d u b i q u i t o u s m e d i c a l r e c o r d

bracelet/pendant system — A pilot study. 4th International

Conference on Biomedical Engineering and Informatics

(BMEI); 2011: 1931-35.

2. Harati R. Collaboration teaching and its role on education

performance and student's achievement. European

Journal of Experimental Biology 2012; 2 (6):2182-2187.

3. Hoffman KG, Donaldson JF. Contextual tensions of the

clinical environment and their influence on teaching and

learning. Med Educ. 2004;38(4):448–54.

4. León SA, Fontelo P, Green L, Ackerman M, Liu F.

Evidence-based medicine among internal medicine

residents in a community hospital program using smart

phones.BMC Medical Informatics and Decision

Making2007; 7: 5.

5. Rahnema B, Rahnema F, Noure Elahi MH. An empirical

probe into integration of communication information

technology on psychological management of students and

staff at science and research branch, Islamic Azad

University, Tehran. European Journal of Experimental

Biology 2013; 3(5):46-60.

6. Davies BS, Rafique J, Vincent TR, Fairclough J, Packer

MH, Vincent R, et al. Mobile Medical Education

(MoMEd) - how mobile information resources contribute

to learning for undergraduate clinical students - a mixed

194


methods study. BMC Med Educ 2012; 12:1.

7. Putzer GJ, Park Y. Are physicians likely to adopt emerging

mobile technologies? Attitudes and innovation factors

affecting smartphone use in the southeastern United

States. Perspect Health Inf Manag 2012;9:1-22.

8. Boulos MNK, Wheeler S, Tavares C, Jones R. How

smartphones are changing the face of mobile and

participatory healthcare: An overview with example from

eCAALYX. Biomedical Engineering Online 2011; 10:

24.

9. Havelka S. Mobile resources for nursing students and

nursing faculty. Journal of Electronic Resources in

Medical Libraries 2011; 8: 194- 199.

10. Krishna S, Boren SA, Balas EA. Healthcare via cell

phones: A systematic review. Telemedicine Journal and E-

Health 2009; 15: 231-40.

11. Caudill J. The growth of m-learning and the growth of

mobile computing: parallel developments. The

International Review of Research in Open and Distance

Learning 2007;8(2):1-13.

12. Chatzipavlou I, Misirlis N, Vlachopoulou M. Smartphone

medical app use: A survey among medical students at

Aristotle university of Thessaloniki. Ninth Mediterranean

Conference on Information Systems (MCIS) Proceedings

2015: 36.

13. Sefdari R, Jebraeily M, Rahimi B, Doulani A. Smartphone

medical applications use in the clinical training of medical

students of UMSU and its influencing factors. European

Journal of Experimental Biology 2014; 4(1):633-637.

14. Vinay KV, Vishal K. Smartphone applications for medical

students and professionals. NUJHS March 2013; 3(1):

59-62.

195

Table 1: Distribution of students as per year of study & gender

Year of study

I MBBS

II MBBS

III MBBS

IV MBBS

Total

Males

26 (55.3%)

33(42.3%)

28(59.6%)

20(71.4%)

107(53.5%)

Females

21(44.7%)

45(57.7%)

19(40.4%)

8(28.6%)

93(46.5%)

Total

47(23.5%)

78(39%)

47(23.5%

28(14%)

200(100%)

Figure 6: Barriers for usage of medical applications for learning

Figure 1: Year wise distribution of students who own smart phone

Figure 2: Operating system preferred by students


196

Figure 3: Use of different Medical Applications Figure 4: Medical applications frequently used by students

26(92.9%)

24(85.7%)

20(71.4%)

2(7.1%)

1(3.6%)

1(3.6%)

15(53.6%)

13(46.4%)

1(3.6%)

10(35.7%)

7(25%)

17(60.7%)

7(25%)

24(85.7%)

22(78.6%)

24(100%)

185(92.5%)

161(80.5%)

117(58.5%)

33(16.5%)

8(4%)

2(1%)

119(59.5%)

81(40.5%)

15(7.5%)

43(21.5%)

41(20.5%)

124(62%)

37(18.5%)

147(73.5%)

130(65%)

152(94.4%)

Table 2: Practice of smart phones and medical related applications in learning

Parameters

Aware about various online

medical related applications

Own medical applications

Medical related applications in smartphone

1-2

3-4

5-6

>6

Source of information

Friends

Internet

Teachers

Coaching classes

Others

Purpose for use of medical related applications

Educational learning

Clinical learning

Medical applications found useful

for learning purpose

Medical applications found

reliable for learning purpose

Will recommend these medical

applications to fellow students

I MBBS (n=47)

II MBBS (n=78)

III MBBS(n=47)

IV MBBS (n=28)

Total (n=200)

41 (87.2%)

27(57.4%)

20(42.6%)

5(10.6%)

2(4.3%)

0

18(38.3%)

10(21.3%)

8(17%)

3(6.4%)

4(8.5%)

21(44.7%)

6(12.8%)

20(42.6%)

18(38.3%)

22(81.48%)

75 (96.2%)

67(85.9%)

47(60.3%)

15(19.2%)

4(5.1%)

0

53(67.9%)

38(48.7%)

4(5.1%)

16(20.5%)

18(23.1%)

56(71.8%)

11(14.1%)

61(78.2%)

52(66.7%)

64(95.5%)

43(91.5%)

43(91.5%)

30(63.8%)

11(23.4%)

1(2.1%)

1(2.1%)

33(70.2%)

20(42.6%)

2(4.3%)

14(29.8%)

13(27.7%)

30(63.8%)

13(27.7%)

42(89.4%)

38(80.9%)

42(97.7%)

Figure 5: Use of social media for learning purpose


197



1. Abirami Arthanari, BDS, PG (MSc Forensic Odontology)*

2. Nagabhushana Doggalli, Reader, Department of Forensic Odontology*

3. Vidhya A, BDS, PG (MSc Forensic Odontology)*

4. Karthikeya Patil, Professor and Head, Department of Oral Medicine and Radiology*

5. Sushma Rudra Swamy, Senior Lecturer, Department of Public Health Dentistry*

6. Sowmya Srinivas, Senior Lecturer, Department of Prosthodontics*

* JSS Dental College & Hospital, Mysuru, Karnataka- 570015

Key words: Forensic Odontology, Dental Age Estimation, UT Age Estimation software, Blankenship method, Kasper method


Dr. Nagabhushana Doggalli,

Reader,

Department of Forensic Odontology,

JSS Dental College & Hospital, Mysuru, Karnataka- 570015

Contact : +91 9844413396


Article History :

Received : 4 August 2020

Received in revised form : 19 August 2020

Accepted on : 19 August 2020


INTRODUCTION:

Forensic age estimation has been beneficial in assisting

authorities in narrowing the search possibilities of unknown

victims, estimating the age at death, differentiation of cluster

victims, determining eligibility for social benefits, and aiding

immigration services in the processing of undocumented

immigrants. Numerous studies have demonstrated the

reliability of using the human dentition as an estimator of

chronologic age. Dental techniques that use progressive

morphologic changes have proven to be the most accurate

methods for estimating the ages of infants, children and (1-2)adolescents . Toward the end of human skeletal growth and

development only a few age-dependent features can be

evaluated by morphological methods. The third molar is the

latest tooth to initiate and complete development and therefore (3-6)is the last available dental morphologic predicator of age .


The study was carried out from March 2019 to May 2019 on

samples consisted of 210 OPG's (105 males and 105 females)

of age ranging from 14.0 to 20.9 years with known date of

birth. Samples were divided into seven age groups (Table 1).

All the collected OPG's were taken with PROMAX digital

Planmeca Machine, archived in the Department of Oral

Medicine and Radiology, Mysore, Karnataka, India.

The validation of UT Age Estimation Software was done in the

versions 2.0.22 (Application Developed by: James M. Lewis,

David R. Senn, Jeff Silvaggi, UT Age Estimation Manual 2008

Database)

Installation of the Software was done as follow :

1. Access the Center for Education and Research in Forensics

website: www.utforensic.org

2. Left click on the “Age Estimation” tab.

3. Left click on the UT-Age 2008 Estimation Database

program installation tab.

4. Follow the directions on screen for installation. It is

Validation of University of Texas (UT) Age Estimation Software in Indian Population

ABSTRACT :

Introduction : The present study is to check the validity of Chronological age and Estimated age by using the University of Texas

(UT) age estimation software in Indian Population.

Materials and Methods : The study was conducted to assess the dental age utilizing third molar eruption using UT Age estimation

software of age group from 14.0 to 20.9 years of 210 samples (105 Males, 105 Females) in south Indian population. All four third

molars were included in this study. Statistical analysis was done to obtain Mean Absolute Error (MAE).

Results: Out of 5 methods least mean absolute error of 0.4 years for males in Blankenship method (D3) and MAE 0.7 years for

females in Unknown method (D5) and overall MAE irrespective of sex showed 0.6 years in Unknown method (D5). This proved

that Unknown method (D5) provides best result when compared to others.

Conclusions: Thus this method can be used to estimate age from developing third molar in Indian population by using this

software.

198

recommended to allow the program to be installed in the (11)default directory. Shown in figure 1

OPERATING THE PROGRAM:

After installation of the UT Age Estimation Software, the

window page appears. There are total Four Icons available in

the database like FILE, EDIT, WINDOW, and HELP. Then the (11)New Case entering procedure will begin as follows

Entering New Case Details:

Case data is entered on the Case Information page. Highlight

and left-click “File” then left-click “New Case” (File > New (11) Case) to activate the Case Information page. (Figure 2)

In this Software there are seven required data fields are specific

to each individual case. Those are the DATE, CASE #, FIRST

AND LAST NAME, SEX, ANCESTRY AND 3RD MOLAR

STAGING. If an entry is not made into any one of these fields,

the program will not allow the case information to be saved or

the age estimation to be calculated. The first data field to be

entered is the date.

The current date is always given as a default date but may be

changed. The date should be entered in the (mm/dd/yy) or

(mm-dd-yy) format. After entering the correct date, move to

the next field by pressing the TAB key. Continue entering data

into the appropriate fields and using the TAB key to move to

the next field. Fields that have a downward arrow to their right

are dropdown-box fields that can be populated with previously (11)saved and commonly used entries.

rdHere 3 molar staging scores (Demirjian's Stage 1973) were rdentered to each tooth in appropriate manner, if the 3 molar is

not available in any of the quadrant, that field should be left

blank.

Panoramic Radiographs Entering Procedure:

After entering the case details, Note the small rectangular

button to the upper right of the “Panoramic Radiograph field”.

Left clicking on this button will transform the “Panoramic

Radiograph” field into four fields, labelled “Quadrant PA's) for

the option to enter four periapical radiographs images. It is

possible to enter both a panoramic image and any or all of the

individual periapical images. To the right of the radiograph

image box is a box labelled “Print” with two circles and the

words “Panoramic” and “Quadrant PA's” within it. By default,

the panoramic radiograph image will be printed in the report as

indicated by the blue dot. If you desire to have the PA's as the

default radiograph printed in the report, left click on the empty

circle beside “Quadrant PA's”. If only a panoramic or PA

radiographs are entered, then the application will print that

image by default.

Once at last all the case information entered and panoramic

radiographs entered there is one button “APPLY” click on the

button to save the case information into the UT Age Estimation

Database. The “Cancel” button will clear the form of any (11)unsaved information. (figure 3)

A Demirjian staging chart showing the development of 3rd

molars according to Kasper is available for consultation by

clicking Help>Demirjian Staging. The chart can be enlarged

by maximizing the window screen accomplished by clicking (11)the rectangle in the upper right corner of the window (figure

4)

Table 1: Sample Distribution

Group

1

2

3

4

5

6

7

Total

Age (years)

14-14.9

15-15.9

16-16.9

17-17.9

18-18.9

19-19.9

20-20.9

Male

15

15

15

15

15

15

15

105

Female

15

15

15

15

15

15

15

105

(11)Figure 1: UT Age Estimation 2008 Software

(11)Figure 2: Showing the Case information details


199

(11)DEMIRJIAN STAGING 1973 A-H STAGING :

A Demirjian staging chart showing the development of 3rd

molars according to Kasper is available for consultation by

clicking Help>Demirjian staging. The Chart can be enlarged

by maximizing the window screen accomplished by clicking

the rectangle in the upper right corner of the window (Figure 4)

Statistical Analysis:

All Average mean age were calculated for both Male and

Female. The data was entered in to MS Excel spread sheet. All

statistical analyses were performed on the SPSS software

program. Mean Absolute Error (MAE) for both Male &

Female age groups were carried out.

RESULTS :

In this study we have compared Indian population with four

different methods and one unknown method by using the UT

software. The methods are indicated as “D” and have

mentioned the D1, D2, D3, D4, and D5. (Five types of

methods)

Abbreviation:(7)D1 = Arany 2004.

(8)D2 = Mincer 1993. (10)D3 = Blankenship 2007.

(9)D4 = Kasper 2009.

D5 = Unknown (Utilizing the four ancestral studies, a fifth

category, “Unknown”, has been developed by averaging the (11)data in all four studies)

In table 2 while comparing the values given in the table, the

one which has the least MAE shows better result. In case of

Males it is D3 (Blankenship method) shows better accuracy

with MAE 0.44 years and for Female it is D5 (Unknown

method) of 0.78 years. For the Overall sex D5 (Unknown

method) provides best accuracy with MAE 0.65 years.

The table 3 shows the each MAE for each & overall age group

of 14-14.9yrs to 20-20.9yrs and MAE for both sexes male and

female. In this D2 is showing very less MAE in both male and

female in the age group of 18yrs to 20.9yrs. And, in

combination D5 is showing very less MAE of 0.65years.

DISCUSSION:

NOTE: In Demirjian modified by Kasper the stages were

given from “A H” staging in chart but while using this UT Age

Estimation Software the stages given only from “D H”. So we

can apply this software only when the third molar attains the

stage of “D”

In this present study we have observed the MAE (Mean

Absolute Error) between both age and sexes by using UT

software (University of Texas). According to Indian

population for validation by using Blankenship method ( D3)

male is showing less mean absolute error of 0.44years and by

using Unknown method (D5) female is showing less mean

absolute error of 0.78years. For both Male and Female to

estimate age, Unknown method (D5) is showing very less

MAE of 0.65years.

(11)Figure 3: Showing the data entry

Figure 4: Demirjian staging chart showing the development of 3rd molars according to

(11)Kasper (A - H) STAGING

Table 2: Mean absolute error (MAE)

Male

0.86

0.74

0.44

0.67

0.52

Female

1.05

0.91

0.97

0.91

0.78

Total

0.95

0.83

0.70

0.79

0.65

(7)D1 Arany 2004

in yrs (8) D2 Mincer 1993

in yrs

D3 Blankenship (10) 2007 in yrs

(9)D4 Kasper 2009

in Yrs (11) D5 Unknown

in yrs


200

(7)Arany (2004) were performed on the Orthopantomograms of

1282 Japanese patients between the ages of 14.0 and 24.0

years. Demirjian formation stages of maxillary and mandibular

third molars were recorded for chronological evaluation of

wisdom teeth (i.e.) third molar. There was a statistically

significant differences were noted between the upper and

lower jaws and genders. Accordingly, males achieved root

developmental grades earlier than females. We assessed the

mean ages for all formation grades and predicted the

probability that a Japanese juvenile would be older than the

relevant ages of 14, 16, and 20years In Arany (2004) the data

has shown the Standard Deviation (S.D) for all four eighth

molars, that is for 18 (±3.29), 28 (±3.27), 38 (±2.89), 48

(±2.88) in males and whereas for 18 (±3.26), 28 (±3.28), 38

(±2.86), 48 (±2.81) in females. But in this current study Arany (7)(2004) is showing Mean Absolute Error (MAE) of 0.86 in

males and 1.05 in females and in combination MAE is 0.95 has

observed by using the UT age estimation software in Indians.

(8)Mincer (1993) conducted a study on 'The A.B.F.O. study of

third molar development and its use as an estimator of

chronological age'. They performed a radiographic

examination of 823 individuals between the ages of 14.1 and

24.9 years utilizing the Demirjian classification system for

molars. The population demographics included whites (80%)

and blacks (19%) with 54% of the total population being

female. This study is only statistically significant for an

American White population. Tables were developed

estimating the chronological age and the empirical probability

that an individual has attained 18 years of age based upon the

mineralization and radiographic stage of development. Data

for Demirjian stages A, B and C was omitted from the study

because no teeth in stages A and B were noted and less than 1%

was noted in stage C for the population studied. The authors

recommended inclusion of all available third molar teeth when using this age estimation techniqueAnd also in Mincer (1993)

(8) the data has shown the standard deviation (S.D) for all four

Age Group

Table 3: Mean absolute error (MAE)

Male

Female

Total

1.32

1.58

1.45

0.88

0.99

0.93

0.60

1.16

0.88

0.96

1.06*

1.01

0.39

0.82

0.60

0.88

1.20

1.04

0.99

0.56

0.77

0.86

1.05

0.95

1.5

1.56

1.53

1.24

0.82

1.03

0.62

0.76

0.69

0.45

1.86

1.16

0.28*

0.38*

0.33*

0.65

0.59*

0.62*

0.47

0.44*

0.45*

0.74

0.91

0.83

0.52*

0.74*

0.63*

0.42

0.45

0.43

0.28

0.64

0.46

0.46

2.08

1.27

0.48

1.21

0.84

0.56*

0.89

0.73

0.37*

0.78

0.58

0.44*

0.97

0.70

0.53

0.86

0.7

0.23*

0.44*

0.34*

0.5

0.56

0.53

0.40

1.59

1.00*

1.00

0.79

0.9

1

0.77

0.88

1.04

1.39

1.22

0.67

0.91

0.79

0.93

1.16

1.05

0.62

0.58

0.60

0.28*

0.40*

0.34*

0.29*

1.76

1.03

0.38

0.38*

0.38

0.66

0.66

0.66

0.48

0.56

0.52

0.52

0.78*

0.65*

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

Male

Female

Total

D1 (7) Arany 2004

in yrs

Sex D2 (8) Mincer 1993

in yrs

D3 Blankenship

(10) 2007 in yrs

D4 (9)Kasper 2009

in Yrs

D5 (11) Unknown

in yrs

14-14.9

15-15.9

16-16.9

17-17.9

18-18.9

19-19.9

20-20.9

Total

* Indicate the minimum value in each row.


201

eighth molar by using Univariate and multivariate regression

analysis. By using Univariate regression analysis standard

deviation for 18 (±1.25), 28 (±1.22) 38 (±1.13), 48 (±1.19) and

by using Multivariate regression analysis standard deviation is

±1.10 respectively. While, in this current study the Mean

Absolute Error is 0.74 for male, 0.91 for female and in

combination MAE is 0.83 has observed by using the UT age

estimation software. (9)Kasper (2009) conducted a study on 'Reliability of third

molar development for age estimation in a Texas Hispanic

population'. They evaluated third molar development from a

Texas Hispanic population of 950 individuals ranging in age

from 12 to 22 years with 56% of the studied population being

female. Slightly more than half of the individuals (55%) were

examined in North Texas (Dallas) and the remainder primarily

from colonies in Cameron County in Deep South Texas. This

study utilized the Demirjian classification system as modified

by Kasper. From the resulting data, the estimated age at each

stage and the probability of the individual reaching age 18 was

calculated for males and females sub-grouped by maxillary

and mandibular third molars. While, in this current study the

Mean Absolute Error is 0.69 in male, 0.91 in female and in

combination MAE is 0.79 has observed by using the UT age

estimation software. (10)Blankenship (2007) Third molar (M3) development

determined from dental radiographs in American blacks

(African Americans; n = 637) aged 1424 years was contrasted

against American whites (n = 563) from a previous study using

the method of Demirjian et al. Differences were assessed using

descriptive statistics and the parametric proportional hazards

model. For each developmental stage, the probability of an

individual being at least 18 years old was evaluated. As in other

M3 studies, there were highly significant modal differences,

but the age ranges at each stage overlapped considerably.

Blackwhite differences were highly significant with

developmental stages occurring in blacks a year or so earlier.

Gender differences also varied significantly, both with

increasing age and between races. The empirical likelihood

that an African American male with fully developed M3's is at

least 18 years old is 93% and that for African American female

is 84%. Corresponding risks for whites are 90% and 93%.

While, in this current study the Mean Absolute Error is 0.44 for

male, 0.97 for female and in combination MAE is 0.70 has

observed by using the UT age estimation software.

In this current study, Mean Absolute Error (MAE) has been

observed to obtain the accuracy. Thus this method can be used

to estimate age from developing third molar in Indian

population by using this software.

Comparing our results with a previous results done by Arany

(7) (8) (9)(2004) , Mincer (1993) , Kasper (2009) and Blankenship (10)(2007) we have got a Mean Absolute Error (MAE) of within

few months. Compared to others (Overall error) total of

0.65years. And other studies are like population specific study

and it is useful for population specific variation too. This

present study is completely for Indian population with good

MAE results.

CONCLUSION:

In this study third molar root development is reliably used to

validate the chronological age and estimated age by using four

known method and one unknown method with the help of UT

software (University of Texas). Hence, irrespectively

Unknown method has given the very less Mean Absolute Error

(MAE) of 0.65years for both Male and Female groups.

Estimation of age in living and dead individuals utilizes growth

and developmental indicators that can be active until, the early

fourth decade in the human beings. Data regarding the

development of the third molar compliments of the skeletal

data available to estimate the age of unknown juveniles and

young adults, third molar development is most significant for

age estimation of individuals from mid teens to early twenties.

Acknowledgement:

Mr. Mahadevayya Muddapur, Biostatistician, for his

contribution in biostatistics report.

Contact: [email protected]

Dr. Roshan K. Chaudhary, BDS, MSc (Forensic Odontology)

for his contribution in this study.

REFERENCES:

1. Senn. R. David., P.G. Stimson, Forensic Dentistry, 2nd

edition, Taylor & Francis, Boca Raton, 2010. 263 - 270

2. Demirjian, H. Goldstein, J.M. Tanner, A new system of

dental age assessment, Ann. Hum. Biol. 45 (2) (1973)

211227.

3. Gleiser, E.E. Hunt Jr., The permanent mandibular first

molar: its calcification, eruption and decay, Am. J. Phys.

Anthropol. 13 (2) (1955) 253283.

4. G. Gustafson, G. Koch, Age estimation up to 16 years of

age based on dental development, Odontol. Rev. 25 (3)

(1974) 297306.

5. M.J. Harris, C.J. Nortje, The mesial root of the third

mandibular molar. A possible indicator of age, J. Forensic

Odontostomatol. 2 (2) (1984) 3943.

6. L. Kullman, G. Johanson, L. Akesson, Root development

of the lower third molar and its relation to chronological

age, Swed. Dent. J. 16 (4) (1992) 161167.

7. A. Szilvia, L. Mitsuyoshi, Y. Naofumi, Radiographic


202

Survey of Third Molar Development in Relation to

Chronological Age Among Japanese Juveniles, J Forensic

Sci, May 2004, Vol. 49, No. 3. 2 4.

8. H.H. Mincer, E.F. Harris, H.E. Berryman, The A.B.F.O.

study of third molar development and its use as an

estimator of chronological age, J. Forensic Sci. 38 (2)

(1993) 379390.

9. K.A. Kasper, et al., Reliability of third molar development

for age estimation in a Texas Hispanic population: a

comparison study, J. Forensic Sci. 54 (3) (2009) 651657.

10. J.A. Blankenship, H.H. Mincer, K.M. Anderson, M.A.

Woods, B. L. Eddie Third molar development in the

estimation of chronologic age in American blacks as

compared with whites, J. Forensic Sci. 52 (2) (2007)

428433.

11.Lewis James. M, Senn David. R, Silvaggi. J, UT- Age

Estimation Database Version 2008 2.0.22 Manual. (2008)

4 12.


203



1. Abirami Arthanari, BDS, PG (MSc Forensic Odontology)*

2. Usha Hegde, Professor & Head, Department of Oral Pathology & Microbiology*

3. Nagabhushana Doggalli, Reader, Department of Forensic Odontology*

4. Priyanka Nithin, Assistant Professor, Department of Oral Pathology & Microbiology*

*JSS Dental College & Hospital, Mysuru, Karnataka- 570015

Key words: Forensic Odontology, Dental Age Estimation, UT Age Estimation software, Blankenship method, Kasper method


Dr. Usha Hegde

Professor & Head,

Department of Oral Pathology & Microbiology,

JSS Dental College & Hospital, Mysuru, Karnataka- 570015

Contact : +91 98444-53444


Article History :





INTRODUCTION:

Teeth play a crucial role in personal identification since they

are the hardest and biologically most stable material in the

human body. Teeth have the ability to resist adverse

environmental conditions and the pulpal tissue is well

protected, thus ensuring that it can be used to retrieve

information and aid in forensic investigations. Forensic

identification by its nature is a multidisciplinary approach

relying on positive identification methodology as well as 1presumptive or exclusionary methodologies.

Blood grouping has been one of the corner stone in

identification of biological material. The term blood group is

applied to the presence of inherited antigens on the red cell 2surface by specific antibodies.

A person's ABO type depends upon the presence of two genes

the A and B genes and these genes are encoded on chromosome

9 (in band 9q34.1). They determine part of the configuration on

the red blood cell surface. A person can be A, B, AB, or O blood 3 group based on the expression of the genes. Based on the Rh

blood group system each of the ABO blood groups can be 4either Rh+ or Rh-. Pulp tissue is enclosed within the dental

hard tissues, where post-mortem changes are seen very late.

Since tooth pulp is highly vascular, blood group antigens are

most certainly bound to be present. The possible distribution of

A Time Interval Based Forensic Study on Estimation of ABO Blood Group & Rh Typing From Dental Pulp: An Aid in Personal Identification

ABSTRACT :

Aims & Objectives: To assess the viability of pulp tissue in identifying the ABO blood group of an individual at various time

intervals (same day, after one week and six months of extraction) and assess its reliability by comparing with the routine capillary

agglutination method.

Materials and Methods: The study was conducted on 75 patients. The capillary blood samples were obtained by finger prick

method, the blood grouping and rhesus typing was done by slide agglutination method for each of the 75 patients and considered as

controls. The pulp obtained from the extracted teeth of the same 75 patients was considered as case. The cases were divided into 3

groups based on the time interval of pulp extirpation and examination for blood grouping & rhesus typing after extraction. Group I

(pulp extirpation on day of extraction), Group II (pulp extirpation after one week of extraction) and Group III (pulp extirpation after

six months of extraction). Blood grouping, Rhesus typing for extirpated dental pulp was done by modified absorption elution

method. The results of the cases were compared with the respective controls to arrive at conclusions.

Results: In Group I (n = 25) and Group III (n = 25), the results of blood group estimation by both the methods matched completely

and showed 100% sensitivity. In Group II (n = 25), 24 teeth samples showed consistent results with only one case being non

confirmatory and hence a sensitivity of 96%.

Conclusion: Teeth are hard structures and resist adverse environmental conditions. The pulp tissue within the tooth is well

protected and remains stable retaining the viability of the blood group antigen for at least up to 6 months. Thus, it could be

concluded from the present study that the dental pulp tissue can be used with good reliability in person identification.

204

ABO substances from the pulp cavity wall to the dentin edge

and to the enamel gradually decreases because of fewer

possibilities of diffusion of antigens from both blood and 5saliva.

6Absorption elution (AE) technique was devised by Siracusa 7and modified by Kind. Various modifications have taken place

since then to improve the sensitivity. This technique has been

used acceptably to determine blood group from dried stains,

tissues, secretions, and teeth in various forensic laboratories.

This method is sensitive, highly specific, and least interfered 8with the nature of the substrata.


The present study was conducted in JSS Dental College and

Hospital, Mysore for 6 months on Intact extracted teeth

collected from patients who underwent dental extraction

procedure for orthodontic or periodontal conditions. Decayed

and filled teeth were not included in the study.

The extracted teeth were the study samples and were divided

into three groups with each group having 25 teeth. Group 1:

Same day of extraction, Group 2: One week after extraction

and Group 3: Six months after extraction. All teeth samples

were decoded and labeled appropriately for an unbiased

evaluation.

Following aseptic protocol, the index finger was pricked with a

sterile needle and three separate drops of blood were placed on

a glass slide. To each drop, a drop of antiserum A, antiserum B

and antiserum D were added respectively. Based on the

agglutination occurring with the specific antiserum, the blood

grouping was established as either A (agglutination with

antiserum A), B (agglutination with antiserum B), O (no

agglutination with either antiserum A or antiserum B) and AB

(agglutination with both antiserum A and antiserum B). If

agglutination occurred with Antiserum D, it was Rh+,

otherwise Rh-. The obtained results were recorded and kept as

gold standard.

The extracted tooth was split vertically with carborundum disc

and the dental pulp was scooped out with a spoon excavator.

Tooth pulp was divided into three equal parts and put into

sterile labeled test tubes. To each of the test tube, 3 drops of one

antiserum, either A, B or D were added. It was made sure that

the test samples were sufficiently soaked in antiserum and left

at room temperature for 2 ½ hours to allow the antibodies to

combine with their specific antigens. The antiserum was

removed and each sample was washed three times with cold

saline solution. The samples were agitated by adding two to

three drops of saline, and then centrifuged for 5 min at 4,000

rpm. The supernatant was discarded using a Pasteur pipette and

the excess saline was removed. Two drops of fresh saline was

added to the sample and the test tubes were heated in a water

bath at 56°C for 10 min to elute the antibodies. A drop of 0.5%

A or B group red cell suspension was immediately placed into

each respective test tube to combine the eluted antibodies with

known red blood cells, resulting in agglutination of the

respective antibodies with the antigen present on the cell

surface of red cells. This was incubated at 37°C for 30 min to

enhance agglutination, followed by centrifugation at

1500-2000 rpm for 1 min for flocculants formation. By mildly

shaking of the test tube the presence or absence of red cell

agglutination was ascertained. This sample was used to make a

smear on the slide and a drop of Leishman Stain was added to it

to confirm the coagulation under microscope at magnification

of 100x. The above mentioned procedure was done for all the

samples of Group I. Similar procedure was carried out after

one week for group II samples and six months after the

extraction for group III samples. All the results were recorded.

The results were cross verified with the blood groups which

were already noted by slide agglutination method.

Preparation of A or B Cell Suspension:

Step 1: Withdraw 1ml of blood from a patient of known A/B

blood group.

Step 2: Store in a sterile test tube.

Step 3: Add 10ml of Normal Saline to the collected blood in the

test tube.

Step 4: Mix both collected blood and normal saline well. Then

the preparation of A/B cell suspension is ready.

NOTE: The prepared A/B cell suspension can be stored for 4 to

7 days at -4°c (in a refrigerator).

Statistical Method:

The data was entered into MS excel followed by the analysis

using SPSS version 23 (Statistical Package for the Social

Sciences 23). The demographic characters such as age, gender

etc were represented using arithmetic mean, standard deviation

and proportions. The estimation of the blood groups was done

in percentages and the same were followed at day of extraction,

after one week and after six months using Chi square test/

Fishers exact test. The p value of <0.05 was considered as

statistically significant.

RESULTS:

The results were given with the total number of samples and

ties being equal. When blood grouping from the pulp

correlated with blood group of the person, the result was

recorded as positive and if they did not match, the result was

recorded as negative.

The results were analyzed for the 75 test samples, distributed in

3 groups: Group 1 (blood grouping done on the day of


205

extraction), Group 2 (blood grouping done 1 week after

extraction) and Group 3 (blood grouping done 6 months after

extraction). Each group consisted of 25 samples (13 male and

12 female). The age groups were divided into 3 categories-

Category 1: 18-25 years, Category 2: 26-45 years and Category

3: 46-65 years.

In Group 1: (Table 1)

04 patients belonged to Category 1 (18-25 years), 10 patients

belonged to Category 2 (26-45 years) and 11 patients belonged

to Category 3 (46-65 years).

02 patients belonged to A-, 04 patients belonged to A+, 01

patient belonged to B-, 04 patients belonged to B+, 07 patients

belonged to AB -, 03 patients belonged to AB+, 01 patient

belonged to O- and 03 patients belonged to O+.

Blood grouping obtained from pulp of both males and females

matched with the reference sample, thereby giving a totally

positive result across all age categories, blood groups and in

both genders. The p value was 1.00 and hence statistically

insignificant for all the age groups, both the sexes and different

blood groups.

In group 2: (Table 2)

There were no patients in Category 1 (13-25 years), 06 patients



03 patients belonged to A-, 05 patients belonged to A+, 01

patient belonged to B-, 06 patients belonged to B+, 02 patients

belonged to AB -, 05 patients belonged to AB+, no patient

belonged to O- and 03 patients belonged to O+.

Blood grouping obtained from pulp for males matched with the

reference samples, thereby giving a positive result, however

there was a mismatch in one female gender case, in category 2

age group for blood group AB-. Except for this mismatched

result where the p value was significant (0.317), there were no

such significance in others as the p value was 1.00.

In group 3: (Table 3)

01 patient belonged to Category 1 (13-25 years), 08 patients



There were no patients belonging to A-, 04 patients belonged to

A+, 02 patient belonged to B-, 05 patients belonged to B+, 04

patients belonged to AB -, 05 patients belonged to AB+, 02

patient belonged to O- and 03 patients belonged to O+.

Blood grouping obtained from pulp of both males and females

matched with the reference sample thereby giving a 100%

positive result. Similarly, all the categories of age groups and

blood groups showed positive results and the p value of 1.00

for both genders, across different age categories and between

the different blood groups was statistically insignificant.

Table 1: Comparison of agglutination based on sex, age and blood groups in Group 1:

Group Characteristics

Sex

Male

Female

Age

18-25

26-45

46-65

Blood Group

A-

A+

B-

B+

AB-

AB+

O-

O+

13

12

4

10

11

2

4

1

4

7

3

1

3

13

12

4

10

11

2

4

1

4

7

3

1

3

0

0

0

0

0

0

0

0

0

0

0

0

0

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

ties Negative ranks

P valueTotal number of samples



Sex

Male

Female

Age

18-25

26-45

46-65

Blood Group

A-

A+

B-

B+

AB-

AB+

O-

O+

13

12

---

6

19

3

5

1

6

2

5

---

3

13

11

---

5

19

3

5

1

6

1

5

---

3

0

1

---

1

0

0

0

0

0

1

0

---

0

1.00

0.317

---

0.317

1.00

1.00

1.00

1.00

1.00

0.317

1.00

---

1.00

ties Negative ranks



206

DISCUSSION:

Over the past few decades, information from studies on blood

groups has been applied in medico-legal cases. The use of

blood group detection plays a significant role in identification

of a person. This is based on the fact that once a blood group is

established in an individual, it remains unchanged throughout 9 the life. In Forensic Science, identification of a person is based

on comparison between known characteristics of a missing

individual collected previously, (termed as ante mortem data)

with recovered characteristics from an unknown body, (termed 10postmortem data).

In this current study, 98.66℅ accuracy of results was obtained

when the blood group of the individual established by dental

pulp was compared with their grouping by normal ABO system

using blood as the sample. Out of 75 samples, 74 samples

showed positive results. The p value obtained was 1.00, for all

74 samples except for the one mismatched sample which was

0.317, thus indicating that it was statistically significant only in

one sample (since significance was set at p value is <0.05).

In group 1 & In group 3, all of 25 samples in each group,

showed 100% concurrence. The sensitivity of pulp in

comparison to blood in blood group estimation was found to be

100%. In group 2, out of 25 samples, 24 samples showed

concurrent results and 1 sample showed mismatched results.

The sensitivity of pulp in comparison to blood was found to be

96% in this group. In other similar studies sensitivity varying 2,6,9,11from 80% to 100% have been reported.

In a study, Goodman-Kruskal's gamma co-efficient was done

to see the correlation between the sample and the case and was

noted that the pulp showed large correlation in freshly

extracted teeth and the correlation was moderate in another 2group where it was stored for 6 months.

In the present study, results in all the three categories were

highly concurrent, except for one sample. This was probably

because of improper storage or handling of tissues or

suboptimal laboratory procedures, despite all careful

measures. Hence it is inferred that the blood group obtained by

absorption elution method of pulp can be a reliable method of

establishing a person`s identity for procedures done up to a

span of 6 months after extraction of teeth.

CONCLUSION: Pulp tissue, being well protected within the

tooth offers vital source of information. It can be used to

estimate a person's identification by studying different

parameters. One such parameter is establishing the blood

group by using the pulp tissue. This method is inexpensive and

does not require sophisticated equipment. Various studies

including our present study have shown good sensitivity and

hence we conclude that this can be used in forensic sciences as

a reliable tool in person identification.

Ethical Clearance: Taken From JSSDC & H

Conflict of Interest/Source of Funding: Nil

REFERENCES:

1. Senn DR, Stimson PG. Manual of Forensic Odontology.

Taylor and Francis group, CRC press 2nd edition,

2013;18-28.

2. Ramnarayan BK, Manjunath M, Joshi AA. ABO blood

grouping from hard and soft tissues of teeth by modified

absorption-elution technique. J Forensic Dent Sci

2013;5:28-34.

3. Karthika B, Elumalai M. Identity of blood group from

dental pulp of deceased Human. Int J Pharm Bio Sci

2013;4(2):1000 1004.

4. Dean, Laura. Blood Groups and Red Cell Antigens

[Internet].. Bethesda (MD): National Center for

Biotechnology Information (US); 2005, Chapter.7

5. Smeets B, van de Voorde H, Hooft P. ABO blood grouping

on tooth material. Forensic Sci Int 1991;50:277-84.

6. Siracusa V. La sostanza isoagglutinabile del sangue e la

sua dimostrazione per la diagnosi individuale delle

macchie. Arch Antropol Crimin Psichiat Med Leg

1923;43:362-365.

7. Kind S.S Absorption Elution grouping of dried blood



Sex

Male

Female

Age

18-25

26-45

46-65

Blood Group

A-

A+

B-

B+

AB-

AB+

O-

O+

13

12

1

8

16

---

4

2

5

4

5

2

3

13

12

1

8

16

---

4

2

5

4

5

2

3

0

0

0

0

0

---

0

0

0

0

0

0

0

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

ties Negative ranks



207

smears. Nature 1960;185;397.

8. Landsteiner, K.; Weiner, A. (1940). "An Agglutinable

Factor in Human Blood Recognized by Immune Sera for

Rhesus Blood". Exp Biol Med. 43 (1): 223.

9. Pramod JB, Marya A, Sharma V. Role of forensic

odontologist in post mortem person identification. Dent

Res J 2012;9:522-30.

10. Neiders ME, Standish SM. Blood group determinations in

forensic dentistry. Dent Clin North Am 1977;21:99-111.

11. Vrinda Saxena, Manish Jain, Ravikant Shah. The

credibility of dental pulp in human blood group

identification. Journal Forensic Dent Sci 2017;9(1):6-9.


Case Report

INTRODUCTION :

Ischemic heart diseases (IHDs) are one of the common cause

of sudden death. According to the World Health Organization

(WHO), sudden death is defined as death had taken place [1]within 24 hours of the onset of symptoms and signs of illness .

IHD occurs due to coronary insufficiency resulting from the

atherosclerotic plaque deposition in the coronary vessels

which supplies nutrition to the heart muscles. This plaque

formation results in ischemia of the cardiac muscles resulting

in reduced functionality and the condition are collectively

called Ischemic Heart Diseases. The mean age is 53 years for [2]the prevalence of myocardial infarction in India . Ischemic

heart disease results in complications like cardiomyopathies,

pericarditis, arrhythmias, myocardial rupture, valvular heart [2] disease . The infarctions of the myocardium can be resulting

in weakening and rupture of the myocardium leading to

cardiac tamponade which is a complication observed among

10 % of the population. The weakened myocardium may be

due to the immune- inflammatory disease which occurs at the

infarction site resulting in the necrosis of cardiac myocytes and

is called Dressler's syndrome. This occurs as a late

complication of myocardial infarction or post-traumatic

pericarditis[3]. We herein report one such unique case

Case Report:

A 59 year old man, driver by occupation, had epigastric pain

for 4 weeks before death, for which he had been taking

medication bought from a nearby pharmacy. He was a known

smoker and alcoholic for 30 years. Otherwise, his medical

history did not reveal any significant disease or past

hospitalization. In his house, he went for a bath and was found

lying unconscious inside the bathroom. The patient was found

by his daughter and was immediately brought to the hospital by

his family members. After examination by the casualty

doctors, he was declared brought dead to the hospital. The

autopsy was conducted 14 hours after death, to find the cause

of death.

Autopsy findings:

Internal examination: Both the pleura was adherent over the

apex on the anterolateral aspect of the lungs. The pericardial

sac showed a bluish hue

and appeared full. The

e x p l o r a t i o n o f t h e

pericardial sac revealed

258 grams of reddish

blood clot adhered to the

heart muscle, along with

some serous fluid. The

clot was rubbery and

retained the shape even

after removal (suggestive

of an antemortem clot). (Figure 1)


Dr. Nirmal Krishnan M,

Assistant Professor

Department of Forensic Medicine and Toxicology, Kasturba

Medical College, Manipal, India.

Contact : +91 81293-29510


KEYWORDS : Dressler syndrome, Myocardial infarction, Sudden death, Cardiac tamponade.

Article History:Received: 18 January 2021Received in revised form: 19 February 2021Accepted on: 19 February 2021Available online: 31August 2021

ABSTRACT :

Dressler's syndrome is pericarditis which develops 2-10 weeks after myocardial infarction or due to a traumatic etiology. Dressler's

syndrome is an immune system response that damages the heart tissues or pericardium secondary to events like myocardial

infarction, heart surgery, or traumatic injury with incidence of 3-4 %. This is usually diagnosed in autopsy due to the narrow

treatment window which makes clinical diagnosis difficult. This case highlights the rare condition called Dressler's syndrome.

1. Varun Krishna B, Post Graduate Resident*

2. Nirmal Krishnan M, Assistant Professor*

3. Deepak Nayak M, Associate Professor, Department of Pathology, Kasturba Medical College, Manipal, India.

4. Vinod C Nayak, Professor & Head*

*Department of Forensic Medicine and Toxicology, Kasturba Medical College, Manipal, India.

Dressler's Syndrome – A Case Report.


208

Figure 1: Hemopericardium (Yellow arrow).

Heart: Weighed 321 grams, measured 12.5 x 9.5 x 7.5 cm.

heart walls had a muscular defect, measuring 4 x 0.5 cm x

ventricular cavity deep, which was present over the posterior

lateral aspect of the left ventricular surface situated at a point 5

cm above the apex. (Figure 2)

The right and left coronary artery showed near-total occlusion.

Both coronaries had narrowing of lumen it was hard and gritty

on cut section. The left anterior descending artery showed 80

% lumen occlusion with atheromatous plaques throughout its

course.

On cut section through the ruptured ventricular wall showed a

yellow tan area, measuring 4 x 2 cm, which was present over

the posterolateral aspect of the left ventricle with the center

area showing features of softening of the tissues suggestive of

coagulative necrosis. One of the papillary muscle was ruptured

with the blood clots present over the exposed region of the

myocardium.

The blood investigations suggested severe myocardial

infarction Creatine phosphokinase (CPK) 15406 U/L,

Troponin T 2.810 ng/ml, Creatine Kinase MB (CK MB) 128

ng/ml, N- Terminal B- type Natriuretic peptide 745 pg/ml.

Cardiac tissues were then subjected to Triphenyl

tetrazolium staining:

In the year 1960, triphenyl tetrazolium chloride test, a

histochemical staining method was introduced as

identification of early myocardial infarction. Tetrazolium

chloride is a redox indicator widely used to distinguish

metabolically active and inactive tissues, especially in [4 ]biochemical experiments . Coagulative necrosis of

myocardial tissue occurs at the stage of ischemic injury,

resulting in a marked decrease in the level of enzymes such as

dehydrogenase, diaphorase and coenzymes. The infarction

areas of the above enzymes would be depleted. Non-infarcted

myocardial tissues act with dehydrogenase enzyme and give [5][11]brick red color remains a stained area . The staining

technique helps the identification of early myocardial

infarction in sectioning of gross heart in the morgue with

easier, simpler equipments and it helps the general pathologist

to mount the infarcted area and visualize histopathologically

and correlate the MI features.

Cardiac tissues sent for histopathological examination

after the Triphenyl tetrazolium chloride (TTC) staining:

Microscopy features:

Left ventricular wall defect showed extensively infarcted zone

of myocytes necrosis, neutrophilic infiltrates, and hemorrhage

seen extending to the pericardial cavity, suggestive of a

myocardial rupture. The pericardial adipose tissue showed

inflammatory cells and hemorrhage. Left coronary artery

shows an intimal atheromatos plaque with luminal narrowing.

(Figure 3-4)

209

Figure 2: Left ventricular wall free rupture (Yellow arrow)

Figure 3: An infarct with necrotic myocytes and a neutrophil rich inflammatory infiltrate (H&E; 400x)

Figure 4: Picture showing a transverse section of the heart after triphenyl tetrazolium chloride (TTC) staining. Old infarct (White arrow) and transmural infarction (Black circle).

Figure 4

DISCUSSION:

Myocardial infarction is the most common ischemic heart

disease due to imbalance supply and demand of oxygenated [6]blood leads to the death of myocytes as a result of ischemia . It

is the leading cause of death in developing countries. About

45% of individuals are affected under 65 years when

associated with hypertension as a stronger risk factor than [1]hypercholesterolemia . Myocardial infarction involving 40%

of ventricular mass leads to sudden death and females above 60

years of age with preexisting hypertension are more prone. The

risk of developing deep vein thrombosis and the likelihood of

pu lmonary embol i sm i s t r iggered by pro longed [8]immobilization in MI patients . Post-myocardial infarction

syndrome is sometimes called Dressler syndrome. William

Dressler first identified it in 1956. In post-myocardial [1]syndrome, the prevalence of Dressler's syndrome is 3-4% .

Most commonly associated with disease of the pericardium

causes pericarditis. It is an immunoinflammatory syndrome

that activates an inflammatory response due to heart injury

(traumatic or non-traumatic pericarditis) and is associated with [9]myocardial infarction . Pericarditis is inflammation of the

pericardium with or without pericardial effusion (pericardial [10]exudate or cardiac tamponade) . The pericardium is the fibro-

elastic sac covering the heart it comprises of a visceral and

parietal layer which are separated by each other and forms a

potential sac. The pericardial sac can hold about 200 ml of

blood in acute condition and a rapid increase in the pericardial

sac leads to sudden accumulation of blood up to 2000 ml it is

called cardiac tamponade or hemopericardium which can [14].cause sudden death Our patient had 1040 ml of blood

containing 258 grams of a reddish blood clot in the

pericardium. The time observed for immune reaction is 2 to 3

weeks after myocardial infarction to onset of Dressler [7]syndrome . Coronary re-perfusion or fibrinolysis reduces the

risk of Dressler syndrome in post-myocardial infarction [9].patients The syndrome is ranging from early to late

pericarditis to more complicated cases representing cardiac

tamponade. The symptoms usually start anywhere from 3-4

days to 2-6 weeks after post-cardiac injury when post-cardiac

syndrome is detected. The actin and myosin antibodies are

more elevated in those patients who had undergone cardiac

intervention and these groups of people are more prone to the

post-cardiac syndrome.

The pericardial layer can respond to an event such as an acute

mycocardial infarction either by inciting a pericardial effusion [12]or more lethally, a pericarditis . In the context of a

pericarditis, it is essential to differentiate an early post-infarct

pericarditis from an actual Dressler syndrome. Transmural

infarctions with accompanying necrosis with inflammatory

cells can infiltrate the adjacent visceral and parietal

pericardium, simulating a Dressler syndrome. This condition [13]has been referred to as 'pericarditis epistenocardica' (PEC) .

This disorder, which typically occurs within the first three days

of an acute MI, initially presents with pain and a pericardial

rub. The differentiating characteristics are: In order to damage

the visceral pericardium, PEC requires a transmural infarction,

but Dressler syndrome is independent of this. In Dressler

syndrome I, PEC is more symptomatic with symptoms such as [14]fever, malaise, and chest pain . It has been hypothesised that a

combination of events result in pericarditis seen in a Dressler [15]syndrome . The first trigger is the blood entering the

pericardial space as a result of an transmural infarct. Secondly,

the suffusion of blood additionally inflicts damage to the lining

mesothelial cells, thus creating a pro-inflammation friendly

microenvironment. Thirdly, the necrosed myocytes reveal

neo-antigens (hitherto sequestered within the myocytes),

resulting in a breach of immunologic tolerance, thus activating

the immune system. The net effect is an increase in

antimyocardial antibody titers and an expansion of CD4 T

cells unique to the heart; more inflammatory cells are recruited [16][17]into the insult area .

CONCLUSION:

We strongly believe that our patient had Dressler Syndrome

because of various reasons:

1) Based on the history given by the patient relatives prior to

autopsy as mentioned above earlier.

2) The previous episode of chest pain with compatible late

pericarditis causing scaring of the pericardial layer.

3) Appearances of a yellow-tan area in a cross-section of

heart suggestive minimum of 7- 10 days old myocardial

infarction.

4) Microscopic feature of pericarditis.

5) Old infarct appearing in TTC staining of heart suggestive

of old MI.

6) Unstained area of left ventricle suggesting transmural

infarction in TTC staining of heart with posterior

papillary muscle rupture leading to cardiac tamponade

(Figure 4).

Conflict of Interest : None declared.

Funding : None declared.

Ethical Approval :None declared.

REFERENCES :

1) Thiago Andrade Macedo, Roberto Nery Dantas Junior,

Pedro Gabriel Melo de Barros e Silva,1 and Marcio

Campos Sampaio, Dressler Syndrome: A Case Report.

Google Search [Internet]. [cited 2020 Dec 17].

210

2) Yash Lokhandwala, Gopi Krishna Panicker, Shantanu

Deshpande, Sudden cardiac death-an Indian perspective.

Google Search [Internet]. [cited 2020 Dec 17].

3) Rao D, Sood D, Pathak P, Dongre SD. A cause of Sudden

Cardiac Deaths on Autopsy Findings; a Four-Year Report.

Emerg (Tehran). 2014;2(1):12–7.

4) Kundal R, Bhullar DS, Kaur M. The autopsy diagnosis of

early myocardial infarction (MI) by triphenyltetrazolium

chloride (TTC) or nitrobluetetrazolium (NBT) dye test. J

Punjab Acad Forensic Med Toxicol. 2012 Jan 1;12:60–1.

5) Fishbein MC, Meerbaum S, Rit J, Lando U, Kanmatsuse

K, Mercier JC, et al. Early phase acute myocardial infarct

size quantification: Validation of the triphenyl tetrazolium

chloride tissue enzyme staining technique. Am Heart J.

1981 May 1;101(5):593–600.

6) Kloner RA, Darsee JR, DeBoer LW, Carlson N. Early

pathologic detection of acute myocardial infarction. Arch

Pathol Lab Med. 1981 Aug;105(8):403–6.

7) Jennings RB, Wartman WB. Reactions of the

Myocardium to Obstruction of the Coronary Arteries.

Medical Clinics of North America. 1957 Jan

1;41(1):3–15.

8) Varga M, Zsonda L. A simple method for postmortem

detection of acute myocardial infarction. Forensic Sci Int.

1988 Jun;37(4):259–63.

9) Dressler W. A Post myocardial- infarction syndrome:

Preliminary report of a complication resembling

idiopathic, recurrent benign pericarditis. Journal of the

American Medical association. 1956 Apr 21;160 (16):

1379–83.

10) Chiabrando JG, Bonaventura A, Vecchié A, Wohlford GF,

Mauro AG, Jordan JH, et al. Management of Acute and

Recurrent Pericarditis. Journalmof the American College

of Cardiology. 2020 Jan;75(1):76–92.

11) P Shenoy R, Bakkannavar S, Monappa V, Nb D, Bhat A,

Kumar M, et al. JPBMS Journal of Pharmaceutical and

biomedical sciences. Identification of Myocardial

Infarction in Human Autopsy Population Using TTC.

2011 Jan 1;09.

12) P. Vaideeswar, J. P. Chaudhari, and J. Butany,

“Mechanical complications of myocardial infarction,”

Diagnostic Histopathology, vol. 19, no. 1, pp. 13–19,

2013.

13) D. L. Mann, D. P. Zipes, P. Libby, R. O. Bonow, and E.

Braunwald, Braunwald's Heart Disease: A Textbook of

Cardiovascular Medicine, Elsevier Saunders ,

Philadelphia, Pa, USA, 2015.

14) D.H. Spodick, “Decreased recognition of the

postmyocardial infarction (Dressler) syndrome in the

postinfarct setting: does it masquerade as 'idiopathic

pericarditis' following silent infarcts?” Chest, vol. 126,

no. 5, pp. 1410–1411, 2004.

15) Imazio M, Hoit BD. Post-cardiac injury syndromes. An

emerging cause of pericardial diseases. Int J Cardiol. 2013

Sep 30;168(2):648-52.

16) Scheerder I, De, Buyzere M, De, Robbrecht J, De Lange

M, Delanghe J, Bogaert AM, Clement D. Postoperative

immunological response against contractile proteins after

coronary bypass surgery. Br Heart J. 1986 Nov;56(5):440-

4.

17) Nomura Y, Yoshinaga M, Haraguchi T, Oku S, Noda T,

Miyata K, Umebayashi Y, Taira A. Relationship between

the degree of injury at operation and the change in

antimyosin antibody titer in the postpericardiotomy

syndrome. Pediatr Cardiol. 1994 May-Jun;15(3):116-20.

211

212

Case Report


1. Vivek K. Chouksey, Senior Resident, Department of Forensic Medicine and Toxicology, AIIMS, Bhopal

2. Atul S. Keche, Associate Professor, Department of Forensic Medicine and Toxicology, AIIMS, Bhopal.

3. Daideepya C. Bhargava, Post Graduate student, Department of Forensic Medicine and Toxicology, AIIMS, Bhopal.

4. S. Mahaluxmi, Post Graduate student, Department of Forensic Medicine and Toxicology, AIIMS, Bhopal.

Key words: Drowning, Decomposition, Suspicious, Meticulous autopsy, Alcohol intoxication.


Dr.Atul S. Keche,


Department of Forensic Medicine and Toxicology, AIIMS,

Bhopal

Contact : +91 82080-72886


Article History :


Received in revised from : 26 June 2021



INTRODUCTION :

The definition adopted by the World Congress on drowning

that convened in Amsterdam in 2002 and endorsed by the

WHO defines drowning as “the process of experiencing

respiratory impairment from submersion/immersion in

liquid”. Drowning, which typically involves a watery

environment, remains a serious public health concern claiming

an estimated 362,000 lives per year worldwide across all

socioeconomic classifications. A significant number of water-

related deaths are attributed to accidental drowning. These

deaths are often prematurely, and at times subconsciously,

labelled as accidental drowning. Presumption that a body

recovered from within or near a body of water is an accidental

drowning can hinder timely recognition of indicators of foul (1)play. A thorough scene investigation must be undertaken to

determine if the location of the death and that of the body

recovery are the same. Once a body is removed from the water,

putrefaction will be accelerated. Post-mortem predation if

there should be interpreted with care. Establishing cause and

manner of death for bodies recovered from water, is

challenging enough with the interpretation of post-mortem

changes. Characteristic changes that occur to a body after

death follow a somewhat predictable timetable. The death

scene investigation and witness accounts, as available helps

the investigator to estimate time of death. On the other hand,

post-mortem changes alter the appearance of the body, making

wounds and other evidence of the body's interaction with the (2)environment more difficult to interpret or even recognize.

Mechanisms for death from drowning are complex. Major

factors seem to be osmotic and perhaps also hydrostatic effects

of the inhaled fluid once it reaches alveolar spaces and gains

access to semipermeable alveolar membranes where water and

electrolyte exchanges take place. This is influenced by the

tonicity of the inhaled fluid, fresh or salt water. Thus

hemodynamic and electrolyte changes develop very rapidly (3)over a few minutes in fresh water drowning.

CASE DETAILS:

A body of 35 years old male was retrieved from a shallow drain

(Nala) in early decomposed condition with partially

distinguishable facial features (Figure 1) on 08/06/2020 and

was brought for autopsy. According to the relatives, the person

was missing since 7/6/2020 afternoon. The autopsy was

conducted on 09/06/2020. Body had a scarf (gamchha) around

the neck in situ which was tightened due to bloating (Figure 2).

The surrounding circumstances like his footwear and empty

liquor bottle near the bank of the drain raised suspicion

Decomposition in Drowning bscures Cause and Manner of DeathO

ABSTRACT :

Establishing cause and manner of death for bodies recovered from water, is challenging enough with the interpretation of post-

mortem changes.Decomposition alters the appearance of the body, making wounds and other evidence of the body's interaction

with the environment more difficult to interpret or even recognize and vice versa. We report a case of drowning and decomposition,

a 35 years male whose body was retrieved from a shallow drain with suspicious surroundings. His footwear and empty liquor bottle

was found on the bank with a scarf tied around his neck tightened by bloating of the body due to decomposition. History and

meticulous autopsy revealed the facts.

213

regarding cause and manner of death (Figure 3 & 4).

External examination- Body was bloated and swollen with

blood stained fluid oozing from mouth and nostrils. Marbling,

peeling of skin (over neck area also) and blisters were evident

(Figure 5). Tongue was clenched between teeth. Scalp hair

were easily pluckable.

Internal examination- After dissection of neck no injuries were

found in the tissues underlying the scarf (Figure 6). Mud

mixed with mucous, and silt was present at places in the

luminal surface of trachea up to terminal bronchi which

confirmed drowning. Sample was not sent for diatom test

(Figure 7 & 8). Both lungs were voluminous, distended and

congested, right- 620 and left- 505 grams. All organs were in

early stage of decomposition. Smell of alcohol was

appreciable in stomach. Viscera was sent for chemical

analysis.

Figure 1: Body lying in water body.

Figure 2: Gamcha present around neck.

Figure 3&4: Footwear and empty liquor bottle lying nearby.

Figure 5 : Peeling of skin over neck area.

Figure 6 : Dissected neck showing underlying structures.


214

DISCUSSION :

The diagnosis of the cause and manner of death for bodies

retrieved from water is considered a challenge for forensic

pathologists. When a body found in water is investigated, a

wide range of possibilities other than drowning have to be

considered. Autopsy findings must be evaluated within the

framework of circumstances, individual factors, and

environmental aspects. A body recovered from water will

rapidly decompose and this will obscure findings of

significance and make determination of the cause and manner (4-6)of death more difficult.

During COVID time, traditional gamchha was used to cover

mouth and nose as an effective precautionary measure. The

deceased was also wearing gamchha and due to bloating it had

tightened around the neck mimicking ligature strangulation.

Although suicide by drowning is well recognized, dumping a

body into water is not uncommon. For this reason, dissection of

the neck muscles is mandatory to exclude injury by

strangulation or other forms of pressure on the neck, especially

when any ligature like material is found around the neck in situ.

A mark may appear on the neck of an obese subject resembling

that produced by a ligature. Tight neckwear, putrefaction by

causing swelling of the tissues can yield appearance which

simulates ligature mark. However, if death had been due to

pressure on the neck, the mark is not necessarily obliterated by

putrefaction. Compressed skin in the mark tends to be better

preserved and even when obscured, subcutaneous (7-9)haemorrhages in relation to the mark may still be found.

It must be emphasized that there is no single finding that is

specific for drowning and all findings commonly associated

with drowning must be interpreted within the context of the

history and death circumstances. The skin and hair may be wet,

damp, or dry. Pallor with wrinkling of palms, soles, fingers,

and toes (washerwoman's hands), skin discoloration,

sloughing, marbling, purge fluid, bloating and corresponding

soft tissue changes may be noted. Post-mortem travel injuries

on exposed body surfaces such as forehead, backs of the hands,

knees, and tops of the feet can appear as the body is dragged

against the bottom surface. Bilateral haemorrhages within the (1)petrous temporal bones occur randomly. The association of

frothy fluid in airways with the overlap of margins of (10)voluminous lungs strongly suggests a death in water.

Drowning victims frequently have fluid collections in the

pleural cavities at autopsy, some of which may represent true

effusion occurring as part of the drowning process. As a result

of overexpansion with rupture of alveolar capillaries, blotchy

areas of haemorrhage (Paltauf's spots) may be visible on the

pleural surface. Extravasated blood resulting from alveolar

capillary rupture is the likely source of the pink or red-tinged

froth. Typically, copious white, pink, or red froth and fluid

exude from the lumen of the sectioned larynx, trachea, bronchi

and cut surfaces of lung parenchyma. Aspiration of foreign

material, silt, dirt, vegetation, and mud is found in lower

respiratory tract or up to terminal bronchioles during (2, 11, 12)drowning.

In the study by B. Kringsholm, among the total of 219

autopsied drowning cases 30% were females and 70% were

males. Most cases occurred in the age-interval 40-49years in

both sexes. In 53% of the investigated cases a blood-alcohol (13)concentration> 0.1% was present. Driscoll T observed that

nearly 80% of the deaths occurred in males and the average age (14)was about 42 years. Alcohol appeared to contribute to about

21% of drowning deaths but it may actually be even higher.

Testing for BAC should be an essential part of drowning

investigations. Alcohol may influence risk-taking behaviours.

Figure 7 : Mud in trachea.

Figure 8 : Silt in lower bronchi.


215

In many cases, the victims of such accidents were not familiar

with the environment and uncertain of the depth. 70% of

drowning accidents occurred as a result of activity around

shallow water (less than 4 ft). It is important that the

community is aware of the specific risks involved in misuse of (15)alcohol around water.

CONCLUSIONS :

The post-mortem examination should not be delayed after a

body is recovered from water. The post mortem changes may

be affected by any personal effects on the body.

Circumstances, history, external examination and in situ

dissection of the neck will resolve the issue in dubious cases.

As there is tendency to presume that a water-related death has

occurred due to accidental drowning, accurate cause of death is

ensured which unearths any criminality.

Determining if the autopsy findings are consistent with the

circumstances is important.

Increasing community awareness, especially in young people

and Legislation to reduce incidents of drowning associated

with alcohol is needed.

REFERENCES:

1. Armstrong EJ, Erskine KL. Investigation of Drowning

Deaths: A Practical Review. Acad Forensic Pathol. 2018

Mar;8(1):8-43.

2. Caruso JL. Decomposition Changes in Bodies Recovered

from Water: Acad Forensic Pathol [Internet]. 2016 Mar 1

[ c i t e d 2 0 2 0 J u l 2 7 ] ; Av a i l a b l e f r o m :

https://journals.sagepub.com/doi/10.23907/2016.003

3. Lawler W. Bodies recovered from water: a personal

approach and consideration of difficulties. J Clin Pathol.

1992 Aug;45(8):654.

4. Saukko P, Knight B. Knight's Forensic Pathology. 4

edition. Boca Raton: CRC Press; 2015. 680 p.

5. Davis JH. Bodies found in the water. An investigative

approach. Am J Forensic Med Pathol. 1986 Dec;7(4):291-

97.

6. Davis JH. Bodies in water. Solving the puzzle. J Fla Med

Assoc. 1992 Sep;79(9):630-32.

7. Sadler DW. Concealed homicidal strangulation first

discovered at necropsy. J Clin Pathol. 1994 Jul;47(7):679-

80.

8. Sharma B.R SP. Ligature mark on neck: How

informative?-Indian Journals [Internet]. [cited 2020 Jul

27]. Available from:

http://www.indianjournals.com/ijor.aspx?target=ijor:jiaf

m&volume=27&issue=1&article=002

9. Reh H. [Early postmortem course of washerwoman's skin

of the fingers]. Z Rechtsmed. 1984;92(3):183-88.

10. Lunetta P, Penttilüa A, Sajantila A. Circumstances and

Macropathologic Findings in 1590 Consecutive Cases of

Bodies Found in Water. Am J Forensic Med Pathol. 2002

Dec;23(4):371-76.

11. Ambade VN, Kukde HG, Malani A, Tumram NK, Borkar

JL, Batra AK, et al. Decomposed and non-decomposed

bodies retrieved from water: a comparative approach:

Med Sci Law [Internet]. 2012 Nov 15 [cited 2020 Jul 27];

Available from:

https://journals.sagepub.com / doi /10.1258/ msl.

2012.012037

12. Karhunen PJ, Goebeler S, Winberg O, Tuominen M. Time

of death of victims found in cold water environment.

Forensic Sci Int. 2008 Apr 7;176(23):e17-22.

13. Kringsholm B, Filskov A, Kock K. Autopsied cases of

drowning in Denmark 1987-1989. Forensic Sci Int. 1991

Dec 1;52(1):85-92

14. Driscoll T, Harrison J, Steenkamp M. Review of the role of

alcohol in drowning associated with recreational aquatic

activity. Inj Prev. 2004 Apr;10(2):107-13.

15. Bell NS, Amoroso PJ, Yore MM, Senier L, Williams JO,

Smith GS, et al. Alcohol and other risk factors for

drowning among male active duty U.S. army soldiers.

Aviat Space Environ Med. 2001 Dec;72(12):1086-95.


Case Report

INTRODUCTION:th thRenal cancer is the 9 most common cancer in males and 14

[1]most common cancer in females. Renal cell carcinoma th th(RCC) is most commonly seen in 5 and 6 decade of life in

[2-3] India, with male:female ratio 3.5:1. Smoking, hypertension

and obesity are associated with increased incidence of renal [4]cancer.

The use of histopathology and molecular diagnosis helped in

identifying more than ten types and subtypes of renal

carcinoma. Among these, clear cell renal carcinoma is the

commonest type followed by non-clear cell carcinoma,

papillary renal cell carcinoma, chromophobe cell carcinoma [2,5]etc.

Classically, renal cancer presents with symptoms of hematuria, [3]abdominal mass and flank pain. Rarely, there may be upper

GI bleeding due to invasion of the tumor to the second part of [6] duodenum. Majority of the renal cancers are diagnosed at a

later stage of disease where the patient experiences symptoms

of pressure effect on surrounding organs or with metastases to [3] distant organs. Lung is the most common site of metastasis

7 followed by lymph nodes, bones and liver. Rarely, it may

metastasize to pancreas and cause portal vein thrombosis and [8]portal hypertension.

It is a common practice in developing countries where the

patient ignores some of early symptoms of renal carcinoma

and consults the doctor at a late stage. Sometimes it may be

detected incidentally in the surgical and medico-legal [9] specimens. Hereby, we report an incidental case of renal cell

carcinoma detected during a medico-legal autopsy.

CASE REPORT:

A 61-year-old man was hit by a rashly driven scooter while

walking on a pavement and was admitted to a hospital with

injuries. Patient was brought to hospital in an unconscious

state. On examination, patient's Glasgow Coma Scale was 5/15

with non-reacting pupils, bleeding from nose, mouth and right

ear. CT scan head showed diffuse cerebral oedema with

traumatic subarachnoid haemorrhage and multiple

haemorrhagic contusions in frontal and temporal lobes on both

sides. Patient was treated conservatively with ventilator

support. As there was no improvement of patient's condition,

ventilator support was removed and declared dead. The total

survival period was 54 hours. As per the protocol, the body was

subjected to a medicolegal autopsy.

At autopsy, the external examination showed contusion

measuring 6x5 cm over anterior surface of the chest, contusion

measuring 8x4 cm over medial surface of the left leg, abrasion

measuring 4x3 cm over the left shoulder, and abrasion

measuring 10x2 cm over anterior surface of the left arm. The

occipital region was diffusely swollen with an abrasion

measuring 2x2 cm in the midline, 8 cm above the external

occipital protruberance. The internal examination showed

diffuse contusion of the brain in the left parietotemporal

region, occipital region, and bases of the right frontal and both

temporal lobes. Brain weighed 1350 gm and edematous.

Subarachnoid hemorrhage was present over the both cerebral

hemispheres and the cerebellum. Multiple petechial

haemohages were present in the pons. Both lungs and the heart


Dr. K.R. Nagesh,

Professor and Head,

Department of Forensic Medicine, Father Muller Medical

College, Mangalore, India.

Contact : +91 9845775907


KEYWORDS : Sudden natural death, Renal Cancer, Renal carcinoma, Renal neoplasm.

Article History:Received: 30 July 2020Received in revised form: 23 December 2020 Accepted on: 23 December 2020Available online: 30 August 2021

ABSTRACT :

Papillary renal cell carcinoma (PRCC) is the second most common type of renal cell carcinoma. It accounts for about 10-15% of all

renal epithelial neoplasms. It has characteristic gross and histologic features that distinguish it from other types of renal cell

carcinoma. We report a case of PRCC which was detected as an incidental finding during autopsy of a patient who was involved in a

road traffic accident. PRCC may be considered as one of the rare causes of death in a medicolegal autopsy of sudden natural death.

1. Niranjan P. Khadilkar, Associate Professor, Department of Pathology, Kanachur Institute of Medical Sciences, Mangalore, India.

2. K.R. Nagesh, Professor and Head, Department of Forensic Medicine, Father Muller Medical College, Mangalore, India.

Papillary Renal Cell Carcinoma - an Incidental Finding at Autopsy


216

were grossly normal. A submucosal hematoma measuring 15x

3 cm was present over the lower half of the esophagus. The

corresponding mucosal surface of the esophagus showed

esophageal varices with multiple mucosal tears (Figure 1).

Stomach contained about 100 ml of blood. The intestines, liver

and spleen were grossly normal. Both kidneys weighed 140

gm each. The right kidney showed a pale yellowish-gray

colored lesion measuring 1x1x1 cm protruding from external

surface of the cortex of the kidney on lateral side. The cut

section of the lesion showed a well-demarcated area with

yellowish-gray colour (Figure 2). The other kidney was

grossly normal.

Tissue sections were submitted for histopathological

examination. Sections from the gastroesophageal junction

showed hemorrhage and blood clots below the mucosa.

Sections from the esophagus showed hemorrhage and blood

clots below the mucosa suggestive of rupture of esophageal

varices. Sections from the lesion in the kidney showed a well

demarcated tumor composed of numerous papillary and

tubular structures lined by a single layer of flat to columnar

cells with small to ovoid nuclei. Some of the cells showed

spherical nuclei with conspicuous nucleoli. Some of the

papillae had fibrovascular cores with mild edema and an

occasional macrophage. The histological features were

suggestive of Papillary renal cell carcinoma (Figures 3 and 4).

Sections from the other areas of the kidneys showed mild

congestion of capillaries. The cause of death was intra-cranial

hemorrhage.

217

Figure 1: Cut open specimen of esophagus and stomach shows submucosal haematoma and varices in esophagus.

Figure 2: Formalin fixed specimen of Kidney with a lesion (shown by arrow).

Figure 4: Photomicrograph shows papillary renal cell carcinoma with papillary structures lined by cuboidal to columnar epithelium with hyperchromatic, pleomorphic nuclei (H&E, 40X).

Figure 3: Photomicrograph shows papillary renal cell carcinoma with papillary structures lined by cuboidal to columnar epithelium (H&E, 10X).


DISCUSSION:

According to the current WHO classification of kidney

tumors, the papillary renal cell carcinoma (PRCC)is a

malignant renal parenchymal tumor with papillary or

tubulopapillary architecture. They comprise approximately [10,11] 10% of all the renal cell carcinomas. The age and sex

distribution of PRCC is quite similar to the clear cell

carcinoma with mean age ranges from 52-66 years and [10,12-14] male:female incidence ranges from 1.8:1 to 3.8:1. Our

reported case is that of a 61 year old male.

The clinical presentation of PRCC is similar to clear cell 14 carcinoma. Majority of these cancers clinically presents in an

advanced stage and classically it presents as haematuria, 3abdominal mass and flank pain. Radiological investigations

are non-specific though renal angiography shows relative [11] hypovascularity for PRCC. In the present case, it was an

incidental finding at postmortem examination and relatives

revealed that the deceased did not complain of any of these

symptoms during his life time.

P R C C i s a w e l l - c i r c u m s c r i b e d t u m o r w i t h a [12,14] pseudocapsule. Two morphological types of PRCC are

described. Type I tumors are usually multifocal and have

papillae covered by small cells with scanty cytoplasm,

arranged in a single layer of the papillary basement membrane.

Type II tumor cells are often of a higher nuclear grade with

eosinophilic cytoplasm and pseudostratified nuclei on

papillary cores. Sarcomatoid dedifferentiation is seen in

approximately 5% of PRCC and has been associated with both [15]type I and type II tumors.

Microscopic examination of PRCC shows malignant

epithelial cells forming varying proportions of tubules and

papillae. Tumor lined cysts with papillary excrescences may [11,14,15] be seen. Tumor papillae contain a delicate fibrovascular

core and aggregates of foamy macrophages and cholesterol

crystals may be present. Occasionally papillary cores are [10,15]expanded by edema or hyalinized connective tissue.

Necrosis and hemorrhage is frequently seen along with [14] calcified concretions. In the present case, lesion in the kidney

showed flat to columnar cells with small to ovoid nuclei,

spherical nuclei with conspicuous nucleoli, fibrovascular cores

and macrophage. However, there was no evidence of

sarcomatous dedifferentiation. These features were suggestive

of type II PRCC.

The fatality depends on the factors such as tumor size, nuclear

grade, and stage in the assessment of prognosis of renal [16] carcinoma. The prognosis is good in cases of organ confined

tumors. And the prognosis is bad in cases of metastases to [2] lymph node or distant organs. In an Indian study, the 5-year

survival with renal carcinoma in stages 1, 2, 3, and 4 was found

[3]to be 92.7%, 72.9%, 54.6%, and 11.5%, respectively. In the

present case, there was no evidence of metastases to distant

organs and so has not affected the overall prognosis.

Incidental renal carcinoma in surgical and medicolegal

specimens is not uncommon. Careful observation during gross

examination with high index of suspicion may help in 9detecting such conditions in histopathological diagnosis. In

the present case, a small nodular lesion over the renal surface

was found during a medicolegal autopsy which was confirmed

to be renal papillary carcinoma in the histopathological

examination. In a medicolegal case involving sudden natural

death, renal cell carcinoma should be considered in the

differential diagnosis in the absence of other significant causes

of death.

In the present case, there is no relationship between trauma and

tumor as the subject developed a head injury and died of

intracranial hemorrhage. Esophageal varices or trauma could

not have contributed to the cause of death as the amount of

blood found in the stomach was only about 100 ml which will

not lead to hypovolemic shock. Also, renal cell carcinoma was

found to be restricted to only the kidney without any significant

metastases so might have not been the main cause of death but

only an incidental finding.

CONCLUSION:

Determining the cause of death is one of the important

objectives of any medicolegal autopsy. In a case of sudden

natural death that was brought dead to hospital, a meticulous

autopsy including investigations such as chemical analysis,

histopathology and microbiology examinations may give a

clue about the cause of death. In the present case, we report an

incidental detection of papillary renal cell carcinoma (PRCC).

PRCC with increased tumor size and/or distant metastasis can

be fatal. Hence, the PRCC should be considered as one of the

differential diagnosis of sudden natural deaths.

REFERENCES:

1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA,

Jemal A. Global cancer statistics 2018: GLOBOCAN

estimates of incidence and mortality worldwide for 36

cancers in 185 countries. C A Cancer J Clin.

2018;68(6):394-424. Erratum in: CA Cancer J Clin.

2020;70(4):313.

2. Ray RP, Mahapatra RS, Khullar S, Pal DK, Kundu AK.

Clinical characteristics of renal cell carcinoma: Five years

review from a tertiary hospital in Eastern India. Indian J

Cancer. 2016;53(1):114-117.

3. Tiwari P, Kumar L, Singh G, Seth A, Thulkar S. Renal cell

cancer: Clinicopathological profile and survival

outcomes. Indian J Med Paediatr Oncol. 2018;39(1):23-

218


27.

4. Capitanio U, Bensalah K, Bex A, Boorjian SA, Bray F,

Coleman J et al.Epidemiology of Renal Cell Carcinoma.

Eur Urol. 2019;75(1):74-84.

5. Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L,

Schmidinger M et al. Renal cell carcinoma. Nat Rev Dis

Primers. 2017;3:17009.

6. Soin S, Verkhovsky E. Locally advanced renal cell

carcinoma: cause of upper gastrointestinal bleeding. BMJ

Case Rep. 2019; 12(4): e229992.

7. Sadler GJ, Anderson MR, Moss MS, Wilson PG.

Metastases from renal cell carcinoma presenting as

gastrointestinal bleeding: two case reports and a review of

the literature. BMC Gastroenterol. 2007; 7(1):4-8.

8. Shrikhande SV, Büchler P, Esposito I, Loos M, Büchler

MW, Friess H. Splenic and portal vein thrombosis in

pancreatic metastasis from Renal cell carcinoma. World J

Surg Oncol. 2006; 4(1):25-27.

9. Lavekar A, Chandran S, Ram D, Sadar A, Manjari KS.

Awareness about Irritable Bowel Syndrome among

Interns of Medical College. J Med Sci Health. 2018; 4(3):

13-19.

10. del Vecchio MT, Lazzi S, Bruni A, Mangiavacchi P,

Cevenini G, Luzi P. DNA ploidy pattern in papillary renal

cell carcinoma. Correlation with clinicopathological

pa rame te r s and su rv iva l . Pa tho l Res P rac t .

1998;194(5):325-33.

11. Mydlo JH, Bard RH. Analysis of papillary renal

adenocarcinoma. Urology. 1987;30(6):529-34.

12. Amin MB, Corless CL, Renshaw AA, Tickoo SK, Kubus

J, Schultz DS. Papillary (chromophil) renal cell

carcinoma: histomorphologic characteristics and

evaluation of conventional pathologic prognostic

pa rame te r s i n 62 ca se s . Am J Su rg Pa tho l .

1997;21(6):621-35.

13. Delahunt B, Eble JN, McCredie MR, Bethwaite PB,

Stewart JH, Bilous AM. Morphologic typing of papillary

renal cell carcinoma: comparison of growth kinetics and

patient survival in 66 cases. Hum Pathol. 2001;32(6):590-

5.

14. Mancilla-Jimenez R, Stanley RJ, Blath RA. Papillary

renal cell carcinoma: a clinical, radiologic, and pathologic

study of 34 cases. Cancer. 1976;38(6):2469-80.

15. Delahunt B, Eble JN. Papillary renal cell carcinoma: a

clinicopathologic and immunohistochemical study of 105

tumors. Mod Pathol. 1997;10(6):537-44.

16. Abraham GP, Cherian T, Mahadevan P, Avinash TS,

George D, Manuel E. Detailed study of survival of

patients with renal cell carcinoma in India. Indian J

Cancer. 2016;53(4):572-4.

219


220

Case Report


1. Majji. Sai Sudha Rani, M.Sc. Forensic Science Student*

2. Chintan Singh, M.Sc. Forensic Science Student*

3. Amarnath Mishra, Assistant Professor & Program Leader*

* Amity Institute of Forensic Sciences, Amity University, Noida (U.P), India.

Key words: Forensictoxicology,Imidacloprid,biological sample, dispersive solid phase extraction method, LC-MS/MS.


Dr.Amarnath Mishra,

Assistant Professor & Program Leader,

Amity Institute of Forensic Sciences, Amity University, Noida

(U.P), India.

Contact : +91 9818978527

Email : [email protected], [email protected]

Article History :

Received : 29 April 2020

Received in revised from : 14 July 2020



INTRODUCTION :

In forensic toxicology the dispersive solid phase extraction

(DSPE) method has wide use due to the increase in cases

reported on intake of pesticides by accidental or homicidal or

suicidal to the forensic laboratories, the drastic use of

pesticides to increase the yield of crop became one of the major

problem in causing severe health issues in human. To decrease

the deaths caused by pesticides, new compounds are developed

with low toxicity and high effect. Imidacloprid comes under [1]this group which is newly developed with least toxicity .

Imidacloprid comes under the class of neonicotinoids that acts [2]on the vertebrate . But in recent years this insecticide also

shows severe health effects in mammals I.e., human and birds

and also nervous system of insects. These chemicals mainly

block the neuronal pathway and also interferes in the stimuli

transmission in insect's nervous system. This results in

preventing the impulses transmission by acetylcholine that [3]leads to paralysis . Imidacloprid (1-(6-chloro- 3-

pyridylmethyl)-N- nitroimadozolidin- 2 ylideneamine) is a

chloro-nicitnyl in figure 1 which is a neonicotinoid which have

reversibility towards intoxication and have safety in mammals

and human. Birds which eat the grains or seeds that are

obtained from these insecticides sprayed plants or crops shows

severe health problems like kidney damage and the

malfunction of reproductive system. These insecticide [4]residues are detected from the liver and kidney of birds . In

Development of an analytical method for detection of Imidacloprid Insecticide from Biological Matrix using LC-MS/MS

ABSTRACT :

Introduction : The aim of this paper is to develop an accurate and rapid method to extract neonicotinoid insecticide from

biological matrices. There is increase in number of cases reported in forensic laboratories due to the intake of insecticides by

accidental or homicidal or suicidal manner. In these cases, dispersive solid-phase extraction method helps to give accurate and

rapid results. In forensic toxicology, there will be wide use of this method to extract insecticides from the viscera samples.

Imidacloprid is a neonicotinoid insecticide used in agriculture to kill insects and mites etc. In humans, it is moderately toxic. This

insecticide mainly acts on the central nervous system of insects but, it does not show effects in mammals. Some studies reported

that Imidacloprid causes severe gastrointestinal problems along with respiratory distress and neuropsychiatric issues when it is

ingested or inhaled.

The chickenmeatwastakenas biologicalsampleinwhich20ppbconcentrationof Imidacloprid insecticide is spiked. The dispersive

solid-phase extraction method is used to extract the insecticide from the biological matrix, and further this is analyzed in the LC-

MS/MS for the detection and quantification of insecticide. For the detection, standard temperature, flow rate, suitable solvent

system and pressure are maintained. Graphs are obtained, and the concentration of Imidacloprid insecticide obtained from chicken

meat sample is 19.206ppb andthe retentiontimeis5.018 . Itshowsthattheextraction process used gave the better recovery of 99. max

88% and is between LOD I.e., 70-120%. it proves all the validation parameters I.e., Limit of quantification, recovery, precision,

and selectivity. Hence it is proved that dispersive solid-phase extraction method used gave the good recovery in extraction of

Imidacloprid insecticide from biological matrix.

221

some studies, it is also shown that this insecticide also causes

gastrointestinal problems, respiratory problems and also [5]causes neuropsychiatric issues in human when it is inhaled .

Imidacloprid shows different level of toxicity based on its

toxicity when it is through dermal exposure it shows less [6]toxicity when it is ingested it shows moderate toxicity. If it is

[7]in the form of aerosol it is highly toxic it also causes vomiting, [8-9]drowsy and dizzy feeling .

The DSPE method is mainly used for the better recovery of the

pesticide samples. Imidacloprid is a polar pesticide which

causes difficulty in detection and extraction of it and it also

causes more difficulty due to interference of compounds i.e.,

fats etc., in meat samples in this case, DSPE method helps in

better extraction which is further detected by using LC-[10]MS/MS . DSPE method is used as the pretreatment method

analysis of compounds. This method mainly involves the steps

like the dispersion of a solid sorbent in liquid samples in the

extraction, isolation and cleanup of different analytes which

are of complex or biological matrices. The samples are injected

into the liquid chromatography and further these samples are

analyzed by using mass spectrometer detector. LC-MS/MS is

also used for the fractionation and analysis of the samples.

Quantitative precision is achieved with the help of triple

quadrupole system which breaks sensitivity and size barriers

of analytes in LC-MS/MS. LC-MS/MS is used to detect the

compounds like organic and inorganic compounds, drugs,

pesticides analysis in food samples, veterinary drugs analysis.

LC-MS/MS is better than GC-MS because it can detect polar

compounds also it is mainly used for better recovery and better

detection


CHEMICALS AND REAGENTS USED: Chemicals and

reagents used in extraction and diluents used to dilute the

Imidacloprid are 10ml of milli Q water, 10ml of acetonitrile

acts as diluent for Imidacloprid and salts like sodium chloride

and sodium Sulphate of 2g weight.

Reagents and chemicals used in cleanup process are 250mg of

primary and secondary amine is used to break the bonds

between compounds, 150mg of C is used to extract non polar 18

or neutral compounds from biological matrices, 600 mg of

magnesium sulphate is used to remove moisture and water

molecules from the meat sample.

For mobile phase in LC-MS/MS chemicals and reagents used

are 1 milli molar ammonium formate, 0.1% formic acid in

water.

For mobile phase B 0.1% formic acid in acetonitrile is used.

For the sample vial preparation solvent system used is 0.1%

formic acid in acetonitrile and water in the ratio of 20:80.

Imidacloprid standard is taken from the sima laboratory.

individual stock standard solution and working standard

solution were prepared with acetonitrile and is freshly

prepared.

INSTRUMENTATION: LC-MS/MS is the instrument from

the Agilent series mass spectrometer that analyses and detects

the compounds contain the electron spray interface operating

in positive mode was used. The vials that are kept in instrument

from which samples are taken by the injector and then it is

injected into the column. The column contains the c18 coating

and also contains silica beads that is in hydrophobic in nature

helps in movement of sample. Column is 5cm long and the

inner diameter of column is 2.1mm and silica bead size is

1.9μm due to the small bead size high pressure is required and

also contain less gaps between silica beads. Mobile phase A of

1mM ammonium formate and 0.1%formic acid in water is run

with the flow rate of 0.5ml/min. and mobile phase B that is

0.1% formic acid in acetonitrile is used to run in the column.

The volume of injection is 5μl. Mass spectrometer-mass

spectrometer which is mainly worked on the principle of mass

by charge ratio and it contains triple quadrupole and a detector.

The mass spectrometric analysis of sample is done with the

electron spray in the positive ionization form. The mass

spectrometer should contain the following parameters i.e., the

oven temperature is 550°c. Nitrogen gas is used as the

nebulizer and collision gas. The pressure of nitrogen as [11]nebulizer is of 550psi . After analyzed in the LC the

molecules move to mass spectrometer through a column it

contains oven and ionization is done and in this positive mode

is present that repel positive ions electron spray ionizer sprays

these ions and moves through a filter and then these ions are

further fragmented based on mass by charge ratio of ions these

ions are called precursor ions and further the ions are again

fragmented based on mass by charge ratio and gives the

product ions this occurs in the triple quadrupole that are

detected by the detector of MS-MS and it contains the software

that have library that helps in detecting the ions present in the

sample and gives a result as graph that is shown on system.

LOQ -limit of quantification is the lowest amount of analyte in

a sample that can be quantitatively determined with suitable

precision and accuracy. The LOQ of spiked Imidacloprid

sample is 5μg/l

VALIDATION: validation is required to prove whether the

sample gave better result or better recovery or not. To prove

validation three main parameters are most important i.e.,

recovery and precision, LOQ, selectivity. These parameters

help to know the used process is good or not to get better

recovery of the analyte in the meat sample. Matrix also shows

effect by interfering in the detection of analyte these all are


222

seen and then conclusion should be given whether the better [12]recovery is obtained or not .

SAMPLE PREPARATION: chicken sample is taken and it is

homogenized by grinding it in mixer and then sample is

weighed. 5g of meat sample is weighed by using measuring

balance. Two portions of two 5g samples is weighed one is

used as spiked sample and one is used as bank sample.

Standard Imidacloprid of 20ppb (parts per billion) volume is

spiked into the 5g meat sample. The meat sample is mixed

thoroughly by using vortex shaker and keep it overnight under

sterilized conditions. For the extraction, In the spiked meat

sample add 10ml of water for uniform mixing and 10 ml of

acetonitrile is added as diluent to dilute the pesticide in meat

sample and it is mixed with the help of vortex shaker for 2min

as vortex shaker helps to mix the sample uniformly.

Acetonitrile acts as a diluent for the Imidacloprid insecticide.

And then it is kept in wrist action shaker for 10mins to

homogenize the meat sample. 2g of NaCl is weighed by using

measuring balance and add it in the sample mixture. 2mins

sample is mixed by using vortex shaker and then for 10 mins

sample is mixed by using wrist action shaker. This sample

mixture is centrifuged with the help of refrigerated centrifuge

of 5000 rpm for 5mins. The supernatant layer is taken from the

centrifuge because supernatant layer contains insecticide

residues that is diluted in the acetonitrile and in this add 250mg

of PSA, 150mg of C18 and 600 mg of MgSo4 is weighed in this

supernatant layer is added and mixed for 2mins in vortex

shaker this step is called cleanup. Keep this tube in wrist action

shaker for 10mins. Centrifuge the sample mixture by keeping it

in refrigerated centrifuge for 5000rpm for 5mins. 2ml of

supernatant layer is taken and is kept in nitrogen concentrator

at 45°c until the sample is dried. Allow it for dryness. This step

helps to get only pesticide residue in the test tube by removing

all the water and diluents from the sample. Reconstitute the

sample by adding 1ml of solvent system in the ratio of 80:20 of

water and 0.1%formic acid in acetonitrile. Now the sample is

prepared and the vials are prepared for detection of meat

sample in LC/MS-MS.

SAMPLE VIAL PREPARATION: Three vials are prepared

one for the standard sample which is used for comparison and

checking and another is the spiked chicken meat sample with

known concentration of 20ppb of Imidacloprid and last vial is

of blank chicken meat sample to know whether it contain any

amount of insecticides. Sample vials are prepared by adding

1ml of reconstitute in the vial and 1ml of solvent system i.e.,

80:20 ratio of water and 0.1%formic acid in acetonitrile. These

sample vial are mixed by using vortex shaker for 2mins this

helps in uniform mixing. Now the samples are ready to keep for

the detection.

CASE REPORT:

Chicken sample is taken as biological sample and these

samples are kept in the vials which are kept in the vial case and

these are taken by the injector and is injected into the column

and column do not contain the oven. The analyte runs through

the column and is analyzed in the LC. The analyzed analytes

are sent to the MS-MS through the column which contains

oven the total run time of the sample is 16 minutes and

retention time is calculated. Linearity is plotted at 5, 10, 20, 30,

40, 50 etc., Three graphs are obtained one graph is of standard

insecticide sample another graph is of spiked chicken meat

sample and last graph is of blank chicken meat sample in which

matrix interference is seen.

In figure 1 linearity is plotted by taking the sample at 5, 10, 20,

50, 100, etc., by taking the standard Imidacloprid sample. This

helps in the comparison of the graphs of spiked and blank

samples. Linearity plot of standard sample is very important

for the validation of the analytes in the chicken meat sample.

In figure 2 the graph showed the Imidacloprid peak of spiked

chicken meat sample. The graph is obtained at 5.018 of

retention time. The graph also shows the quantity of

Imidacloprid obtained from the chicken meat sample. The

concentration of Imidacloprid sample obtained is 19.206ppb

which means a good recovery.

In figure 3 the graph shows the noise peaks that is the peaks are

obtained due to the matrix interference of the chicken meat

sample. The blank meat sample is analyzed to know whether

the blank sample contains pesticides or not and this also helps

to study the spiked sample clearly. The blank meat sample also

shows a peaks these are mainly due to matrix effects in sample.

These peaks don't match with the peak of the Imidacloprid ions

hence these peaks are noise peaks that are due to matrix

interface of meat sample. MATRIX EFFECT: the matrix effect

values are acceptable for the Imidacloprid insecticide.it shows

only minimal values and low matrix effect on the sample. so

this matrix effect is acceptable. Hence the matrix matched

process is preferred for the quantification of Imidacloprid

insecticide.

LOQ- limit of quantification is set at 5μl and peak of

Imidacloprid contain the S/N which is greater than 10.

SELECTIVITY: In the spiked meat sample the interference

peaks are observed which is less than 1/3 area of the peak

which is compared with the Imidacloprid insecticide due to the

cleanup process in extraction process helps to reduce

interference peaks.

RECOVERY AND PRECISION: Recovery of the

Imidacloprid insecticide is observed and the tested sample is

seen. The analyte is recovered for 19.206 and the limit of


223

detection should be between 70-120% hence the total sample

detected and recovered is 99.88%. this value is between the

limit of detection hence the precision and recovery is good for

the Imidacloprid insecticide in meat sample. So the extraction

process used for the extraction gave the accurate result and

better recovery of insecticides. These parameters help in

validating the extraction process of insecticide in the spiked

meat sample. Validation helps to know whether the process

gave better recovery or not. In this paper, Imidacloprid spiked

meat sample meets all the characteristics of validation process

hence it confirms that the sample process gave the better

recovery i.e., of 99.8%. and this value is also between 70-120%

of limit of detection.

DISCUSSION:

In the chemical examiner laboratories, the extraction methods

that are used generally are liquid-liquid extraction method [13](LLE), solid phase extraction method (SPE) , solid phase

micro extraction method (SPME), and in some laboratories

supercritical fluid extraction (SFE) method is also used. The

SPE, SPME and LLE methods are the conventional methods

which are having several limitations as these require additional

pretreatments and also have the filtration and precipitation [14]steps which are removed in DSPE method . The SPE method

has limitations like less accuracy and low reliability. The SFE

method has several limitations. it is costly due to the usage of

carbondioxide as solvent due to this it is limited in dissolving [15]mainly for polar compounds like Imidacloprid. In

comparison with conventional and modern methods, DSPE

method gives better recovery, accuracy and low cost due to less [16]intake of solvents and also gives ample limit of detection .

thus it can be used in forensic and various chemical examiner

laboratories.This extraction method gives better recovery for

high polarity compounds i.e., Imidacloprid and it gives

accurate results and better recovery when it is detected under [17]LC-MS/MS when compared with GC-MS .

CONCLUSION:

In this paper, it concludes that the dispersive solid phase

extraction method gave the better recovery of the analyte

i.e.,99.8% and also gave better results in both qualitatively and

quantitatively. This analyte recovered also meets the LOD and

LOQ which proves that it gives better results when it is

detected under LC/MS-MS. This method acts effectively in

extraction, isolation and cleanup. This paper mainly concludes

that the DSPE method used for extraction of insecticides is an

accurate process and also gives the better recovery of the

analyte i.e., Imidacloprid. Hence, this extraction method has

wide use in forensic laboratories for the extraction of pesticides

from the viscera samples as this method also costs very low.

This method helps to give accurate and rapid results from the

viscera samples. This concludes that this extraction method

and the detection of analytes using LC/MS-MS has wide use in

forensic medicine and forensic toxicology.

REFERENCES :

1. EPA U. Pesticide fact sheet: imidacloprid. Washington,

DC. 1994.

2. Matsuda K, Buckingham SD, Kleier D, Rauh JJ, Grauso

M, Sattelle DB. Neonicotinoids: insecticides acting on

insect nicotinic acetylcholine receptors. Trends in

pharmacological sciences. 2001 Nov 1;22(11):573-80.

3. Tomizawa M, Casida JE. Neonicotinoid insecticide

toxicology: mechanisms of selective action. Annu. Rev.

Pharmacol. Toxicol.. 2005 Feb 10;45:247-68.

4. Berny PJ, Buronfosse F, Videmann B, Buronfosse T.

Evaluation of the toxicity of imidacloprid in wild birds. A

new high performance thin layer chromatography

(HPTLC) method for the analysis of liver and crop

samples in suspected poisoning cases. Journal of liquid

chromatography & related technologies. 1999 Jan

1;22(10):1547-59.

5. Kumar A, Verma A, Kumar A. Accidental human

poisoning with a neonicotinoid insecticide, imidacloprid:

A rare case report from rural India with a brief review of

literature. Egyptian Journal of Forensic Sciences. 2013

Dec 1;3(4):123-6.

6. Bais SS. An Overview on Imidacloprid Pesticide

Inducing Oxidative Stress.

7. Reigart JR, Roberts JR. Recognition and management of

pesticide poisonings. US Environmental Protection

Agency; 1999.

8. Wu IW, Lin JL, Cheng ET. Acute poisoning with the

neonicotinoid insecticide imidacloprid in N-methyl

pyrrolidone. Journal of Toxicology: Clinical Toxicology.

2001 Jan 1;39(6):617-21.

9. Shadnia, S., & Moghaddam, H. H. (2008). Fatal

intoxication with imidacloprid insecticide. The American

journal of emergency medicine, 26(5), 634-e1.

10. Matsuoka, T, Akiyama Y, Mitsuhashi T. Validation of

multi-residue method for determination of pesticides in

meat products using official guideline of analytical

methods in Japan. Journal of Pesticide Science.

2010:1011050169.

11. Ferrer C, Martínez-Bueno MJ, Lozano A, Fernández-

Alba AR. Pesticide residue analysis of fruit juices by

LC–MS/MS direct injection. One year pilot survey.

Talanta. 2011 Feb 15;83(5):1552-61.

12. European Food Safety Authority. Use of the EFSA


224

Standard Sample Description for the reporting of data on

the control of pesticide residues in food and feed

according to Regulation (EC) No 396/2005 (revision 1).

EFSA Journal. 2013 Jan;11(1):3076.

13. Singh C, Rani MS, Mishra A. Development of analytical

method for detection of monocrotophos insecticide from

biological matrix using lc-ms/ms. International Journal of

Medical Toxicology & Legal Medicine. 2020;23

(1and2):210-9.

14. Malone EM, Elliott CT, Kennedy DG, Regan L. Rapid

confirmatory method for the determination of sixteen

synthetic growth promoters and bisphenol A in bovine

milk using dispersive solid-phase extraction and

liquid chromatography–tandem mass spectrometry.

Journal of Chromatography B. 2010 May 1;878(15-

16):1077-84.

15. Friedrich JP, Pryde EH. Supercritical CO2 extraction of

lipid‐bearing materials and characterization of the

products. Journal of the American Oil Chemists' Society.

1984 Feb;61(2):223-8.

16. Diez C, Traag WA, Zommer P, Marinero P, Atienza J.

Comparison of an acetonitrile extraction/partitioning and

“dispersive solid-phase extraction” method with

classical multi-residue methods for the extraction of

herbicide residues in barley samples. Journal of

Chromatography A. 2006 Oct 27;1131(1-2):11-23.

17. Pang GF, Cao YZ, Zhang JJ, Fan CL, Liu YM, Li XM, Jia

GQ, Li ZY, Shi YQ, Wu YP, Guo TT. Validation

study on 660 pesticide residues in animal tissues by gel

permeat ion chromatography c leanup/gas

chromatography–mass spectrometry and liquid

chromatography–tandem mass spectrometry. Journal

of Chromatography A. 2006 Aug 25;1125(1):1-30.

Figure 1 : Linearity graph of Standard Imida cloprid Insecticide Sample


225

Figure 2: Chromatogram of Imidacloprid peak in Spiked Chicken Meat Sample

Figure 3: Chromatogram showing matrix interference in Blank Meat Sample


226

Review Article


1. Anvita Ahuja, MBBS Student*

2. Jasmeen Kaur, MBBS Student*

3. Prateek Rastogi, Professor and Head, Department of Forensic Medicine and Toxicology*

*Kasturba Medical College Mangalore, Manipal Academy of Higher Education Manipal, India

Key words: Keywords: Covid-19, Vaccine Hesitancy, Vaccine Refusal


Dr. Prateek Rastogi,

Professor and Head, Dept. of Forensic Medicine and

Toxicology, Kasturba Medical College Mangalore, Manipal

Academy of Higher Education Manipal, India

Contact : +91 9448501376


Article History :

Received : 27 April 2021

Received in revised from : 28 May 2021

Accepted on : 28 May 2021


INTRODUCTION:

As we continue to battle with a staggering death toll and

innumerable covid-19 cases, there emerges at long last a ray of

hope for humanity. Based on the most fundamental and basic

principles of immunology, a vaccine is a simple yet

tremendously efficacious tool employed for controlling the

spread of communicable diseases. To say that it was a

Herculean task to concoct vaccines for a novel virus

threatening the entire world- at such a short notice; would

admittedly be a gross understatement. Nevertheless, with an

army of highly competent researchers, billions of dollars of

funding and clinical trials; numerous contenders have arrived

in the market now:Johnson & Johnson's Janssen Covid-19 1 1Vaccine , Pfizer-BioNTech's vaccine , The Moderna 1 2 2Vaccine, Oxford's AstraZeneca , Bharat BioTech' Covaxin

and so on.All the aforementioned vaccines of-course must

have been subjected to stringent trials and scientific standards

and the findings must have been reassuring. But despite such

promising outcomes, there is little a vaccine can achieve if the

vial is never opened. It is now a widely held belief that

containment and barrier measures may stop the disease from

spreading but eradication would necessitate the use of a

vaccine.

This paper will explore not the therapeutic parameters and/or

the results/effects of these vaccines, but rather the public

initiative and willingness to get vaccinated; along with

relevant precedents, the need for appropriate legislature and

ethical concerns.

Problem Statement:

With a mountain of conspiracy theories and misinformation

floating around the internet, more and more people are opting

out of vaccination- a phenomenon known as “vaccine refusal”.

This reluctance to take the shot is not newfound and is certainly

not limited to the Covid vaccines. WHO listed “vaccine

hesitancy”- the unwillingness to get vaccinated despite

sufficient availability of vaccines- as one of the 10 global 3health threats in 2019 . This vaccine hesitancy and/or the

vaccine refusal, in the instant case of Covid-19 vaccine may be

a game changer, losing a surely winnable game or at least

delaying the much sought after win. An individual's choice (of

hesitancy or refusal) may cost, in unfathomable proportions,

the entire society, nation or even the world. The question is

how to and whether to surmount this problem with or without

the force of legislation?

Covid-19 Vaccination Hesitancy: Causes, Legislation And Ethics

ABSTRACT :

Covid-19 vaccines have now been around for quite some time and inoculation is in progress all around the world. However, some

apprehensions with regards to efficacy do seem to be existing for some founded/unfounded reasons, and at the same time, a

substantial reluctance (“Vaccine Hesitancy”) and/or non-acceptance (“Vaccine Refusal”) of the vaccine basedlargely on personal

choice seems to be emerging as a major cause of concern. This matter of individual choice apparently has the potential of

compromising success of the entire vaccination drive both qualitatively as well as quantitatively, that is; not only the desired results

of near total success evade us but the expected outcome may get inordinately delayed as well. This article, while looking into

historical as well as recent impediments to Vaccination (Hesitancy and Refusal), is an effort to analyze the reasons for the same and

bring out some remedial measures.

227

The Historical Scenario and now:

Any vaccine is bound to fail in achieving the desired outcome

if the uptake is below the threshold required to usher-in herd 4immunity . In a study by Jerome NyhalahDinga,

LeontineKouemouSinda, and Vincent P. K. Titanji on the

assessment of vaccine hesitancy to a covid-19 vaccine in

Cameroonian adults, the prevalence of Vaccine Hesitancy was

found to be 84.6% and their research states that for the vaccines

to achieve their intended goal, this figure has to brought down 5to around 30-25%.

Most of us are familiar with the phrase “prevention is better

than cure”. While we do not (and realistically, may not, in the

near future) have the cure for covid-19, we have been fortunate

enough to survive the pandemic long enough to see the birth of

vaccines against it. Reluctance to get vaccinated endangers the

progress made in combating diseases that are vaccine

preventable. A vaccine does not only confer individual

immunity, but also disrupts the transmission of disease as the

number of susceptible hosts are decreased. This promotes herd

immunity. In some cases- such as the Oral Polio Vaccine- the

mutant vaccine virus multiplying in the gut of the vaccinee is

shed into feces and is transmitted to other people of the same

community via feco-oral route, thus imparting immunity to 6them . It is clear as crystal that although the decision to get

vaccinated is personal, the consequences of the said decision

are community wide or nation-wide or even the world-wide.

In a paper on the society's response to the risks of vaccine

rejection, the author has compared vaccine refusal as

equivalent to drunk driving, smoking in closed spaces and

having unprotected intercourse with others despite being 7diagnosed with a venereal disease , as in all these situations,

people are making conscious choices which are also putting

other members of the community in danger.From an ethical

point of view, it is important to note that some-if not all- of

these are choices that they, as individuals, do reserve the right

to make, however risky and/or unsocial those may be. This 8warrants mention of John Stuart Mill's Harm Principle which

states “people should be free to act however they wish unless

their actions cause harm to somebody else” or, more crassly,

“your freedom to swing your fists ends where my nose begins”.

In the same article, the consequences of declining vaccination

have been briefly described; namely, spread of vaccine-

preventable diseases not only among the ones refusing

vaccination, but also among those in whom the vaccine has

differing degrees of effectiveness, the immunocompromised

and the ones who are too young to be vaccinated. Besides, the

authors make a good point that vaccine denial costs billions of

dollars of taxpayer's money- both in direct and an indirect

fashion. Direct expenditure would be the healthcare costs that

would accrue from spread of the disease (Which, note, would

otherwise have been controlled by the vaccine) public health

care facilities including infrastructure, material costs for PPEs,

masks, hospital tools and equipment, disinfectants, sterilizers,

ventilators, beds and so on. The indirect costs would include

money spent on research and development and production of

the vaccines. Finally, yet importantly, due to subjective and

largely irrational risk perception, vaccine anxiety remains 7immune to all the evidences of vaccine safety.

What causes vaccine hesitancy/refusal?

There has existed a community of myriads of people who do

not believe in and have emphatically rejected vaccines- since

before the pandemic- and they call themselves as

“antivaxxers.”When questioned as to why anyone would reject

vaccines, different answers come to light:religious sentiments,

misguided information, anti-vaccination propaganda as well

as the abundance of conspiracy theorists and universal

antagonistics. Few other contributing factors might be lack of 9confidence and complacent behavior . Tremillia Hobbs- a

nursing staffer feels overwhelmed by how quickly the vaccines

were brought into being and fears long term complications and 10possible driving political agendas. In general, vaccine

opponents have not been found to hold any single common

unifying notion.

Reeling back in, let's have a look at 2 stories that changed

the course of vaccination drastically:

1. 1998; Lancet publishes a paper by a British

gastroenterologist Andrew Wakefield who became fixated

on the prospect of a potential association between the 11measles virus and autism. While studying inflammatory

bowel disease, he hypothesizes a “leaky gut” that lets the

measles virus molecule from the MMR vaccines escape

digestion and reach the brain causing autism.Wakefield

used the media to his own advantage- garnering publicity

after airing his flawed views; while also covering up

possible conflicts of interests that he had. The publication 12was later retracted.

2. July 9, 1999; American Academy of Pediatrics and the

Centers for Disease Control and Prevention (CDC) release

a joint statement on the removal of vaccines containing a

mercury based preservative 'thimerosal'; despite no hard

evidence of any real damage induced by it, but rather

based only on speculations of mercury based compounds

causing autism and concerns raised by the Environmental

Protection Agency regarding the deleterious effects of 13mercury.

Such events later influenced environment lawyer Robert F. 12Kennedy , thereby creatinga most outspoken proponent of the

modern anti-vaccination movement.


228

Fueling the anti-vaccine drive, in 2005, a grief ridden parent

'Sarah Bridges' goes over to Kennedy's house with piles of

paper containing theories of links between autism and

thimerosal containing vaccines- right after her son gets

diagnosed with autism. Kennedy gets alarmed and wages a

proverbial war against the vaccines and vaccine advocates. He

starts a column called “deadly immunity”- in print and on

digital platforms- it was rife with inaccuracies and misquotes.

Kennedy went on to earn a reputation as he facilitated the

making of and produced several anti-vaccination

“documentaries”.He became rather notorious and is said to

have wrongly quoted expert opinions and even recruited fake

experts on purpose. He managed to steer the issue away from

that of public health, morphing itinto a typical political

squabble- he wasn't beneath dragging race in between,

launching the concept of “medical racism” through his movie

“Medical Racism: The New Apartheid” which showcased a

combination of very real and saddening manifestations of

racism encountered in healthcare (which, in the authors'

opinion, warrants a discussion by itself) along with anti-

vaccination myths to impose the agenda on a vulnerable 12population.

This becomes concerning when one takes into consideration

the fact that there exists already a feeling of discomfort and

mistrust amongst the marginalized community of people of

color regarding the government, science and research; all

rooted in the abuse, some of them may have had to face in the

name of research: for instance, the Tuskegee Syphilis Study,

Henrietta Lacks' cells being used for research without proper 14consent and compensation , and in a later case where blood

samples from Havasupai Tribe members were inappropriately 15used for testing. The combination of this valid skepticism and

animosity- that has been germinating in the minds of black

people-with the influence exerted by Robert Kennedy, has

resulted in most black people now believing that the vaccine is

more of a threat to them than covid-19. One person even

compared the vaccination drive to the Tuskegee tragedy and 12exclaimed that he won't be anyone's guinea pig. According to

new CDC data, 5.4 percent of those who have had at least the

first dose of a vaccine are Black, compared to 60.4 percent who 16are white.

How to overcome vaccine rejection/ increase vaccine

uptake:

Given the dire and cascading effects of poor vaccine uptake, it

appears reasonable to opine that some effort is required to

ensure adequate uptake. We may also opine that, given the

deep roots of vaccine apprehension, some strong steps may be

needed to improve vaccine acceptance.

A Reddit user going by the name of “mishyfishy25” writes

“Vaccines need a rebrand. From now on, let's just start calling

them gluten-free, all natural nucleotides, specifically 17formulated to bolster immunity” the humorous implication

being people are more inclined to embrace a fad (even if it is

not backed by science) than they are to accept a well-

researched commodity in which billions of dollars have been

invested, lots of efforts put-in and a myriad of checks and

controls performed. Although it is not as simple as

mishyfishy25 proposes, it seems to be a viable suggestion.

Vaccines can be endorsed by celebrities and influencers just

like they would any other commodity. And it has also been

done; with polio. “do boondzindagigi” ads endorsing the

“Pulse Polio Program” used to blare on the media all day

long,seeking to keep India polio-free.

Other measures that may help improving vaccine uptake

includea positive attitude on the part of the physician,

educative seminars, honesty about the risks and benefits as

well as patient counselling. A doctor, for example, may say “I

have taken the vaccine and I think you should too”- as a result,

obtaining the patient's confidence by demonstrating that they-

as a doctor believe in the vaccine, and so the patient should as

well. These measures- though effective at an individual level,

are only practicable in a clinical setting where the physician

has direct access to the patient. Hence, at a large scale, the

results of this approach may remain limited.

Another initiative which may gather more willing vaccine

recipients is the incentivization of vaccines. This can be done

in a number of ways- offering certain financial incentives or

perks like discounts and health insurance related offers and so

on. While incentivization will bring about an air of positivity

around the topic, it may backfire as well on ethical grounds.

Over-incentivisation may be seen as “undue inducement”-

where a reward is so high, that it may be unduly enticing,

leading to someone disregarding risks.

On the contrary, under-incentivisation may be seen as

exploitative- where people in a vulnerable situation can agree

to get vaccinated because they believe they have little other

choice, and even a small reward would provide a great deal of

relief. This way, offering the incentive may get projected as 18taking advantage of a person who is in a tough spot.

Another option that one might consider is to deincentivise

vaccine rejection. This approach too has been in practice since

long. One cannot enter certain countries in Africa without 19appropriate yellow fever shots school admissions are difficult

for unvaccinated children in various states of the USA. The

immunization laws varyby state.Some state senates have

removed exemptions based on religious beliefs (example: New

York Senate Bill 2994) etc. Virginia House Bill 1090 states that

The Immunization Schedule created and reported by the


229

Centers for Disease Control and Prevention, the Advisory

Committee on Immunization Practices, the American

Academy of Pediatrics, and the American Academy of Family

Physicians is to be followed by the Board of Health's 20Regulations for the Immunization of School Children.

A rather drastic measure which may be taken subject to

rigorous ethical examinations and considerations- is to

mandate the vaccine by law. The mandate could be of 2 stages.

One where defaulters are subjected to mild punishment;

probably some sort of fine, and another where vaccine refusal

leads to more serious consequences like imprisonment. There

has been a historical precedent, although not without a

resounding ethical backlash. To stop Smallpox outbreak, the

British Government in India passed the Vaccination Act in

1880, followed by the Compulsory Vaccination Act in 1892.

Non-vaccination without justification resulted in

incarceration. Some of these legislations were overturned as 19recently as in 2001. The authors of this paper acknowledge

that attempts to make vaccination mandatory could be an

ethical miscarriage of justice in view of laws and legislations

of a country,and further clarify that mandatory vaccination

may not at all be required particularly wherever there is

sufficient voluntary vaccination or improvement in vaccine

acceptance is achievable by other, far less drastic methods.

This paper is merely an effort at exploring some of the options

one might like to choose from.

In favor of mandating vaccination by law, Jason Brennan, in

his paper describes how the state can coercively enforce at

least some-if not all- moral duties on its citizens. He makes his

case by giving various analogies, one of which is; that whilst

the state might not be able to prevent him from writing a book

promoting genocide, it can coerce him into refraining from

carrying it out. It is not clear why some morals are coercively 21enforceable and some are not. How this applies in the real

world; Jason Brennan implies; is that the state can use force

and/or intimidation to prevent an individual from actively

spreading an infection.Besides, there might be a compelling

argument to make any vaccine mandatory if the following four 22conditions are met :

— The public's welfare is in great danger: (the larger the

probability and/or extent of harm, the more it favors 18mandatory vaccination .

— The vaccine has been shown to be both safe and reliable.

— When compared to other options, mandatory vaccine has a

better cost-benefit profile.

— The amount of coercion is appropriate

— Each condition merits appropriate value and the state may

choose to act as considered appropriate in the larger interest of

the humanity.

—CONCLUSION:

Any Vaccination program is founded in painstaking research

with the expense of large quantum of vital resources. One of

the most critical aspect taken care of, during the development

phase of any vaccine is, eliminating possibilities of any harm to

the recipients, while ensuring the sought after protection/

benefits. This, to our opinion, hardly leaves any reason for an

individual to go in the denial mode. Still, individual's choice

may be an issue worth overlooking and permissible, as long as

it doesn't infringe upon essential protection- (like the law does

against unsocial/criminal elements)- and benefits of the state

sponsored programs that the residents of the state are entitled

to. In a situation where such an infringement has occurred,

should the state use force of law, or use the stick and carrot

policy or any other inclusion/exclusion policy, to ensure that

larger section of the society does not suffer and/or lose benefits

due to non-cooperation by a few- is the opinion point this

article leaves you at.

REFERENCES:

1. Centers for Disease Control and Prevention. Different

COVID-19 Vaccines. [Online]. Available from:

h t t p s : / / w w w . c d c . g o v / c o r o n a v i r u s / 2 0 1 9 -

ncov/vaccines/different-vaccines.html [Accessed 23

April 2021].

2. Times of India. Coronavirus vaccines in India: Here's a list

of all the COVID-19 vaccines being made in India.

[Online]. Available from:

https://timesofindia.indiatimes.com/life-style/health-

fitness/health-news/coronavirus-vaccines-in-india-heres-

a-l is t-of-al l-covid-19-vaccines-made-in-india/

photostory/79463339.cms [Accessed 23 April 2021].

3. World health organization. Ten threats to global health in

2019. [Online]. Available from:

https://www.who.int/news-room/spotlight/ten-threats-to-

global-health-in-2019 [Accessed 23 April 2021].

4. Mayo clinic. Herd immunity and COVID-19

(coronavirus): What you need to know. [Online].

Available from: https://www.mayoclinic.org/diseases-

conditions/coronavirus/in-depth/herd-immunity-and-

coronavirus/art-20486808 [Accessed 23 April 2021].

5. Dinga JN, Sinda LK, Titanji VPK. Assessment of vaccine

hesitancy to a COVID-19 vaccine in Cameroonian adults

and its global implication. Vaccines. 2021;9(2):175

6. Holubar, M., Troy, S., Nathoo, K., Stranix-Chibanda, L.,

Musingwini, G., Srinivas, N., Huang, C., Junn, A.,

Halpern, M. and Maldonado, Y., 2016. Shedding of Oral


230

Poliovirus Vaccine (OPV) by HIV-Infected and -

Uninfected Mothers of OPV-Vaccinated Zimbabwean

Infants. Journal of the Pediatric Infectious Diseases

Society, 6(1), pp.105-108.

7. Ropeik D. How society should respond to the risk of

vaccine rejection. Human Vaccines & Immun other

apeutics. 2013;9(8):1815-1818.

8. What is The Harm Principle? Ethics Explainer by The

Ethics Centre [Internet]. THE ETHICS CENTRE. 2016

[cited 23 April 2021]. Available from:

https://ethics.org.au/ethics-explainer-the-harm-principle/

9. Alvira X. Vaccine hesitancy is a global public health

threat. Are we doing enough about it? [Internet]. Elsevier

Connect. 2019 [cited 23 April 2021]. Available from:

https://www.elsevier.com/connect/vaccine-hesitancy-is-

a-global-public-health-threat-are-we-doing-enough-

about-it

10. Pattani A. Vaccine Hesitancy vs. Vaccine Refusal:

Nursing Home Staffers Say There's a Difference

[Internet]. Kaiser Health News. 2021 [cited 23 April

2021]. Available from:

https://khn.org/news/article/vaccine-hesitancy-vs-

vaccine-refusal-nursing-home-staffers-say-theres-a-

difference/

11. Larson H.J, Mnookin S. Chapter 27 - Trust and

Confidence in Vaccines: Tales of Three Vaccines, Lessons

for Others. In: Bloom, B.R, Lambert, P.H (eds.) The

Vaccine Book. : Academic Press; 2016. p. 529-540.

12. Jarry, J. The Anti-Vaccine Propaganda of Robert F

Kennedy, Jr Or how an environmental lawyer led a

crusade against vaccines and spread lies to marginalized

c o m m u n i t i e s . [ O n l i n e ] . Av a i l a b l e f r o m :

https://www.mcgill.ca/oss/article/covid-19-health-

pseudoscience/anti-vaccine-propaganda-robert-f-

kennedy-jr [Accessed 23 April 2021]

13. Baker J. Mercury, Vaccines, and Autism. American

Journal of Public Health. 2008;98(2):244-253

14. Young S. Black Vaccine Hesitancy Rooted in Mistrust,

Doubts [Internet]. WebMD. 2021 [cited 23 April 2021].

Available from:

h t tp s : / /www.webmd.com/vacc ines / cov id -19 -

vaccine/news/20210202/black-vaccine-hesitancy-

rooted-in-mistrust-doubts

15. Quinn S, Andrasik M. Addressing Vaccine Hesitancy in

BIPOC Communities Toward Trustworthiness,

Partnership, and Reciprocity | NEJM [Internet]. New

England Journal of Medicine. 2021 [cited 23 April 2021].

Available from:

https://www.nejm.org/doi/full/10.1056/NEJMp2103104

?query=infectious-disease

16. Painter EM, Ussery EN, Patel A, et al. Demographic

Characteristics of Persons Vaccinated During the First

Month of the COVID-19 Vaccination Program United

States, December 14, 2020January 14, 2021. MMWR

Morbidity and Mortality Weekly Report2021;70:174177.

17. RandomThoughts [Internet]. Reddit.com. 2021 [cited 23

April 2021]. Available from:

https://www.reddit.com/r/RandomThoughts/comments/

mpxohr/vaccines_need_a_rebrand_from_now_on_lets_j

ust/

18. Savulescu J, Giubilini A, Danchin M. Global Ethical

Considerations Regarding Mandatory Vaccination in

Children. The Journal of Pediatrics. 2021;231:10-16.

19. Dubey R. State activism: Should COVID-19 vaccination

be compulsory? [Internet]. Bar and Bench - Indian Legal

news. 2021 [cited 23 April 2021]. Available from:

https://www.barandbench.com/columns/state-activism-

should-covid-19-vaccination-be-compulsory

20. States With Religious and Philosophical Exemptions

From School Immunization Requirements [Internet].

Ncsl.org. 2021 [cited 23 April 2021]. Available from:

h t tps : / /www.ncs l .o rg / research /hea l th / school -

immunization-exemption-state-laws.aspx

21. Brennan JA libertarian case for mandatory vaccination.

Journal of Medical Ethics.2018;44:37-43.

22. Savulescu J. Good reasons to vaccinate: mandatory or

payment for risk? Journal of Medical Ethics.2021;47:78-

85


231

Review Article


Review on Bioremediation of Carbofuran & Different Factors Influencing the Process

1. Suryapratap Ray, M Sc Forensic Sciences Lovely Professional University, Jalandhar, Punjab India (144411)

2. Shikha Choudhary, Assistant Professor, Department of Forensic Science, Lovely Professional University, Jalandhar

ABSTRACT :

Carbofuran is a carbamate pesticide, which is used widely in agriculture production. We can consider carbofuran as one of the most

toxic carbamate pesticides. Usually we can encounter this pesticide in market as FURADAN (FMC corporation), CURATERR 10

GR (Bayer). The degradation of carbofuran is very important as it is toxic to environment which ultimately affects the living

organisms. It is extremely lethal because of its anticholinesterase activity, which inhibits acetylcholinesterase and

butyrylcholinesterse activity. Apart from carbofuran other carbamates such as Carbaryl, Aldicarb, Methomyl, Carbofuran, and

Propoxur etc are also needs to be degraded. Several conventional technologies are used for the removal of carbofuran

includingphysicochemical processing like photo-catalysis, ozonation/UV- irradiation, membrane filtration, adsorption and Fenton

degradation. However, none of these technologies is feasible and cost effective for complete mineralization of carbofuran pollution

from the environment. In such case, microbial degradation found to be the most effective, feasible and eco-friendly method. The

degradation process also relies on various other ecological factors such as hydrolysis, oxidation etc along with naturally occurring

microbes. This review point outs various microbes that can be helpful in degradation of carbamates, their metabolism and other

ecological factors involved in this process.

Key words: Carbofuran, Carbamate pesticide, Carbofuran degradation, Carbamate degradation, CURATERR 10 GR, Metabolic

pathway, Microbial degradation.


Dr. Shikha Choudhary,


Department of Forensic Science, Lovely Professional

University, Jalandhar

Contact : +91


Article History :

Received : 20 November 2020


Accepted on :6 December 2020


INTRODUCTION :

Pesticide in simple terms refers to the substance or chemical

formulation that helps in controlling pests by preventing and

destroying them. We can consider weeds, birds, insects,

microorganisms or mammals as pests, as they interfere or

destroy valuable things. We can categorize pesticides into

Inorganic Pesticide, Synthetic Pesticide and biological

pesticide based on their chemical structure, physical form and

their target species. Various types of pesticide that are being

used now a days very commonly includes- organophosphate,

pyrethroid, organochlorine and carbamate pesticides.This is

further classified by various researchers. That is rodenticides,

weedicides, fungicide, herbicide, and insecticide. Carbamate

insecticides are basically derivative of carbamic acids. The

first carbamate insecticide is Carbazyl. It was introduced in

1956. They inhibit the AChE (Acetylcholinesterase) enzyme

and cause over stimulation of nervous system. Considering

their chemical structures and biological actions carbamate

pesticides are basically categorized into two parts. One is N-

methyl-carbamate insecticides and the other one is N-allyl-[1]carbamate herbicides . Carbamates are highly toxic to plants

and animals as well. It is useful when we consider its

insecticide properties. But various non-targeted living

organisms are suffering due to its high toxicity nature. So, it is

very much necessary to degrade this pesticide after getting the

targeted work done.Various technologies are introduced for

the removal of carbofuran including physicochemical

processing like photo-catalysis, ozonation/UV- irradiation,

membrane filtration, adsorption and Fenton degradation. But

none of those technologies are feasible and price effective for

complete degradation of carbofuran pollution from the

environment in a eco-friendly manner. Carbamate pesticides

are converted to various products applying various chemical

processes, such as oxidation, biotransformation, hydrolysis,

bio-augmentation, photolysis, biodegradationand metabolic [2]reactions in living organisms (microbial degradation) .

Biodegradation of various pesticides by bacterial activity

under certain physiological condition have already been

observed by various researchers. Even in many cases it is

observed that, various soil microbes which are frequently

getting exposed to such pesticides developed new capabilities

in order to survive in that hazardous condition. They can

actually degrade these toxic pesticides. There are some soil

microbes that can degrade carbamates. Some microbes that are

found in soil got the ability to use carbofuran as the only source

of carbon dioxide and energy. So, they can easily adapt to that

condition. However, carbamates pesticide and their [3]metabolites can affect the micro flora and soil productivity .

Degradation of Carbamate pesticide using microbes can be

considered as a conventional technique. Microbial degradation

found to be the most effective, feasible and eco-friendly

method.

Structure and properties of carbofuran

Carbofuran is marketed under the trade name FURADAN

(FMC corporation), CURATERR 10 GR (Bayer),

FURACARB. The IUPAC name is- 2,2-dimethyl-2,3-

dihydro-1-benzofuran-7-yl methylcarbamate. The chemical

formula can be written as C H NO . It appears as white 12 15 3

-1crystalline solid with molar mass 221.256 g.mol . It is soluble

in water with solubility 320mg/L and highly soluble in N-

methyl-2-pyrrolidone, Dimethylformamide, Acetone,

Acetonitrile etc. The structure (Figure 1 Structure of

Carbofuran) is given below:

Carbofuran pesticide is banned in Canada and European

Union. The main concern is obviously the toxicity to mammals

and environment. It is having LD of 8-14 mg/kg body weight 50

(as observed in dog). Carbofuran, which possesses high acute

toxic effect retain itself in the soil in the form of organic

compounds. So, the process of metabolism or breakdown may [4]take weeks or more duration . Carbamates are basically

insecticides, herbicides, and fungicides that act similarly as

organophosphates pesticides. It acts by inhibiting AChE

(Acetylcholinesterase) enzyme, exception is that the action is

reversible. The toxicity generally varies from different

derivates, wherein aldicarb is very toxic. Carbamate pesticide

plays a vital role in agriculture because of its broad-spectrum

nature and varied degree of compounds which are degradable [5]in soil . We generally consider carbofuran as a plant systemic

pesticide.It acts through phloem sap against piercing-sucking

pests of rice crop like Nephotettixvirescens(green

leafhoppers), Nilaparvatalugens(brown plant hopper), stem [6]borers and whorl maggots . This pesticide is also applied on

potatoes, strawberries, grapes, wheat, corn, soybeans and alfa-

alfa for controlling corn rootworm, wireworms, aphids, white

grubs etc. When we use this pesticide in form of liquid or

powder, it generally gets absorbed by the plant and

translocated to different plant parts. Although carbofuran

pesticide was used in liquid and granular form but USEPA and

European Union completely banned its use in both the forms [7]because of its toxicity on the birds . The granular form of

carbofuran usually looksimilar to the seeds and mistakenly

eaten by birds as grit or food that causes toxicity leading to

death. However, liquid formulations of carbofuran are still

used in various countries including India, Kenya, China, [8]Thailand, Pakistan and Sri Lanka

Sources of toxicity

Direct applications in agricultural fields and industries or

indirectly through drifting andvolatilization from the treated

fields can be the main source of carbofuran contamination to

environmentcontaminating air, soil and water eco system, [8]nontarget plants, animals as well .The exact quantity of any

kind of pesticide that is applied on to any agriculture fields,

never ever completely reaches to the targeted organisms and

most of its amount is dispersed into the environment. This

amount of unused pesticide cause aircontamination, along with

soil and water ecosystems. Evert in 2000 and Donovan2012

studied the environmental fate, chemistry and detection of

carbofuran insoil and water in a very good manner, which

explains this particular thing in details.

Mechanism of toxicity[3,9]The toxicities related to carbofuran is documented . It is

highly toxic to non-targeted organisms such as birds, rodents,

honeybees, fishes and other water organisms through direct

inhalation, ingestionor dermal absorption. Although it is not

considered as carcinogen but can cause genotoxic, mutagenic,

carcinogenic and teratogenic effects (according to

WHO,2009). Carbofuran causes acute and chronic toxicities

byinhibiting acetylcholinesterase in synapses of central

nervous system (CNS) that is the main toxicological property

of this pesticide (FAO/WHO, 2009). Carbofuran also causes

severe developmental and reproductive issues in maternal-

placental-fetal unit by crossing placental barrier. Various

s tud ies conc luded tha t , th i s pes t i c ide causes

significantdecrease in isoenzyme-I and isoenzyme-II in [9]mother and foetus . Research on the same concluded the toxic

concentration of carbofuran in biological tissues. This is found

to be ranging from 0.4-18μg/mL inblood, in bile it is 0.4-60

232

Structure of carbofuran


μ/mL, in liver 2.2 μg/gand 0.3-300 μ/g in stomach [10]contents/stomachin a homicidal case .Carbofuran toxicity

mechanism is based on reversible competitive inhibition of

acetylcholinesterase enzyme (AChE) in the central and

pe r iphera l ne rvous sys tems (PNS) .Carbofuran

affectscarbamylation or modification of serine residue active

site withincarboxylesterase and butyrylcholinesterases [9]enzymes . The inhibition of AChEase enzymes causes

successive accumulation of acetylcholine (Ach) insynapses

thatbreaks into choline and acetate residues leading to clinical.

Considering the stimulation Ach receptor, there are two types

of acuteclinical manifestations occurs. Namely Nicotinic and

Muscarinic. Nicotinic effects result in muscleweakness and

tremors whereas muscarinic effects can damage cardiac,

gastrointestinal andrespiratory systems resulting in

defecation, increased salivation, gastroenteritis, bradycardia [3]andobstruction of airways .

Effect of carbofuran on aquatic ecosystem

Water bodies such as river, ponds etc are highly prone to

carbofuran toxicity as indicated by its groundwaterubiquity

score (GUS) index of 4.5, showing a relatively high risk of

being transported from the targeted site to adjacent water

bodies after raining or by any other method. Carbofuran can

cause acute and chronic toxicities to aquatic organisms by

interrupting in hematological, biochemical and enzymatic

activities. Detrimental effect of this pesticide carbofuran has

been reported in several algal species, such as

Chlorellavulgarius, and Raphidocelissubcapitataand rotifers

(Philodina roseola). Among Pocecilia reticulate, Daphina

Magna and Rhapidocelissubcapitata(green alga), Daphnia

magna is considered to be the most sensitive towards [10]carbofuran acutetoxicity with EC50= 0.187 mg/L after 48 h .

Carbofuran acts as a neuro-toxicant and Acetylcholinesterase

inhibitor in brain, liver and muscles of fish especially.

Cyprinicarpioand Oreochromis niloticusare fresh water fishes

helpful in toxicity model organisms and play animportant role

to observe and moniter the toxicity profile of aquatic

environments. Carbofuran exposure also leads to functional

abnormalities in fish such as change in body colour, balance

loss, in some cases they fail to feed, growth rate reduction and

reduction in swimming performance. These studies reveals

that fish are the most appropriate and feasible biomarker to

study and moniter acute effects of the carbofuran in aquatic [11]environments .

Effect of carbofuran on soil and plant

Commercial formulations of carbofuran residues can easily

contaminate soil ecosystems and plants through direct

spraying, surface-runoff, flooding or accidental

exposure.Considerable experiments had been carried out

about the efficacy of carbofuran against pests, insectsand soil

nematodes. Carbofuran uses result in life-threatening soil

contamination that can harshly affect soil fertility, respiration,

microbial biomass and diversity, nitrogen and phosphate

mineralization capacity, and enzymatic activities of plants and [12]microbes . Itactually inhibits dehydrogenases.This represent

[13]soil microbial activity . Due to the barrier in microbial

growth, dehydrogenase and alkaline phosphatase activity in

fertilized soil is significantly decreasing with increasing

carbofuran doses (0.02-1.0 kg/ha to 5.0 kg/ha) in comparison

to controls. Contamination of soil and water due to carbofuran

pesticide.He found high environmental contamination of

carbofuran and its two toxic metabolites 3-ketocarbofuran and

3-hydrocarbofuran in dry surface soil (0.010-1.009 mg/kg) and

watersamples that was taken (0.005-0.495 mg/L). High

concentrations of carbofuran pesticide and metabolites

ranging 0.04-1.328 mg/kg of dry Maize plant tissues have been

reported as well. The experiment demonstratedlocal exposure

and impact of carbofuran by domestic applications. Hence, the

extensive use of carbamatepesticides in agricultural soils

results in serious ecological consequences.

Effect of carbofuran on humans and other animals

Carbofuran is found to have very high mammalian toxicity,

oral LD50 8-11 mg/kg in rats and is dangerously lethal to [14]invertebrates, birds as well . Environmental Protection

Agency (EPA) considered it in “Toxicity Category I'', that is the

most toxic category based on hazardous effects via oral and

inhalation exposures. Carbofuran basically causes acute

toxicities and fatalities in humans through accidental exposure

whereas continuous exposures result in chronic toxicities.

According to Environmental Protection Agency, California,

drinking water which is carbofuran contaminated can produce

detrimental effects on reproductive function in humans, as

reported in “Public Health Goals for Chemicals in Drinking [15]Water” . Long-term carbofuran pesticide exposures to

farmers, industrial workers and animals results in chronic

toxicity. It includes dermal, endocrine, cytotoxic, mutagenic,

reproductive, neurotoxic, genotoxic, disrupting, embryo-toxic [16]and dermal-skin problems . basically, it is not considered as

carcinogen but Bonner in 2005 indicated that carbofuran

pesticide exposure is positively associated with increased

cancer risk in lungs. It basically enters human and animal body [15]by inhalation, ingestion and dermal absorption . Wherein

dermal exposure is less toxic with respect to direct inhalation

or ingestion of carbofuran. High concentration or volume of

carbofuran exposures to humans primarily cause weakness in

muscles, dizziness, sweating and body discomfort and

headache, salivation, nausea, vomiting, abdominal pain,

diarrhoea. Dilated pupils and blurred vision, incoordination,

233


and muscle twitching and slurred speech have also been [16]studied after short-term carbofuran exposure . Carbofuran

intoxication extensively causes significant decrease in

haemoglobin content, total red blood cells (RBC) count,

platelets, erythrocyte sedimentation rate (ESR) and

haematocrit value in body.

Metabolism of carbamate pesticide

In mammals, insects, and plants the metabolic product of

carbamates pesticide is generally very similar. This pesticide is

absorbed in the body by respiratory tract, dermal contact and

mucous membrane. Usually, carbamate metabolites after

degradation are less toxic as compared to their parent

compounds. In some circumstances, the metabolites of

degraded carbamate or any other pesticide found to be more [16]toxic than the original compound . Hydrolysis is the primary

phase of metabolic degradation of carbamate pesticide in soil.

This process ultimately leads to formation of the carbamic

acid. Again, the breakdown process will form the carbon [17]dioxide and similar amines . N-methyl carbamate and N-

dimethyl derivatives both are having different hydrolysis

mechanism. The N-methyl carbamates pass through an

isocyanatemetabolite. Wherein the hydrolysis of Ndimethyl

carbamates, a product containing hydroxyl ion is formed. This

ultimately results in alcohol and N-dimethyl replaced acid [18]formation . Keeping aside hydrolysis, oxidation also happen.

Thisinvolves hydroxylation of the aromatic ring, N-

dealkylation, oxidation of aliphatic side chains, O-[19]dealkylation, N-methyl hydroxylation, and sulfoxidation .

Degradation studies in soil contaminated with the

insecticidecarbofuran and its metabolites (3-ketocarbofuran

and 3-hydroxycarbofuran) were performed using laboratory

systems with controlled conditions (temperature, water

content, light). Bacterial abundance and the concentration of

the different chemicals were assessed by adding the

insecticides to soil samples and subsamples of the soil were

analysed at different times. The epifluorescence direct count

method was applied here to the samples to point out

microorganism numbers (N=g soil). Evaluation of the effects

of the application of the insecticides on microbial abundance

done by using the untreated samples of soil as control sample.

Subsamples treated with the pesticides then analysed using

HPLC and the DT50s or the half-life of the different

compounds studied were analysed.

Carbofuran and its microbial degradation

2,3-Dihydro-2,2-dimethylbenzofuran-7-yl methylcarbamate

is the chemical name of carbofuran and it is a broad-spectrum

insecticide commonly used in agriculture sector. Carbofuran is

basically soluble in water and highly mobile in soil. This is the [16]reason of ground water contamination in different regions .

The table presented as TABLE-1 shows the microbes that can

be helpful in degradation of Carbofuran.

Degradation of any pesticide implicating microbes is not at all

a newly introduced method. Micro-organisms usually supply

the energy required for the chemical reactions that needs to be

take place in order to carry out their metabolism as well as the [17]biodegradation . A number of factors are involved in

pesticide biodegradation using microbes or microbial activity.

Microbial strain consortia that metabolize the carbofuran and

other carbamates and helps in degradation process has been [20]studied . The pesticide is commonly used for over decades.

This caused the tolerance in some microbes to that particular

pesticide, wherein in some other cases some microbes started

to develop mechanism, enzymatic pathways to degrade the

pesticide. In 1973 the bacteria that degrades organophosphate

was first isolated in Philippines in a paddy field area.

Frequently afterwards many different microbes were isolated

by different researchers which can degrade different pesticides [21]as per report . Pesticides are directly implicated tom the soil

for the protection of plants from pests. After the application of

such pesticides they usually undergo various processes. Some

process such as volatilization, degradation, sorption, or surface [22]transport are studied . Various researches conducted on these

topics explains that the soil of those agriculture fields which

have a history of pesticide application is found to be have less

half-life as compare to the soil which is not having any such [23]pesticide application history . Other microbial sources apart

from soilincludes; pesticide industry, drainage water, activated

sludge, sewage, even surface waters and their sediments can be

considered, area which is close proximity to pesticide

industries. We can categorise microbes based on their growth [24]and ability to degrade pesticides . There are various microbe

species which are involved in pesticide degradation. Such as

234

Pesticide

Carbofuran

Microbes

Consortia

Pseudomonas sp.

Pseudomonas and

Alcaligenes

Mucor

Ramannianus

Novosphin-gobium sp

Aspergillus sp.

Environ-mentaction

References

Tien et al. (2017)

Devi et al. (2017)

Omolo et al. (2012)

Fareed et al. (2017)

Seo et al. (2007)

Fareed et al. (2017) Seo et al. (2007)

Fareed et al. (2017) Seo et al. (2007)

Soi

lD

egra

dati

on


Pseudomonas, Flavobacterium, Achromobacterium sp.,

Sphingomonas sp., Arthrobacter and Bacillus speciesas

mentioned in the table-1. Thesehave been isolated and

characterized in various reserches. This helped researchers to

get knowledge regarding pesticide degradation mechanism.

Carbofuran phenol and subsequently degraded to 2-hydroxy-

3- (3-methylpropan-2-ol) phenol by Sphingomonassp. and [25]Arthrobacter sp. strains in the degradation of Carbofuran.

Carbofuran phenol formation is the first step in the

degradation. The table-1 contains various microbes that are

useful in degradation of carbamate pesticides. It is very much

essential to understand the biochemical bases involved in

micro-organisms inorder to develop various degradation [26]capabilities in them . Enzyme based degradation is mostly

recommended in the bio remediation over the traditional [27]method . Various enzymes thatactually hydrolyse carbamate

compounds are either esterase or amidases in most of the cases.

The chemical structure of the side chains and substrate [28]influence the hydrolysis of carbamate pesticides .

Detoxification of the original carbamates takes place by

hydrolysis reaction. This process of hydrolysis results in the

formation of an alcohol and methylamine along with carbon-[28]dioxide gas . There are many enzymes that are involved in

degradation and formation of carboxylesterases are already [29]reported .

GMOs in biodegradation of carbofuran

GMO stands for genetically modified organisms. In various

cases we can use genetically engineered microbes for

bioremediation. This is economically feasible alternate for the [27]removal of contaminants in soil . The recombinant DNA and

RNA technology helped in constructing various types of

genetically modified microbes, which are actually found to be

result oriented when it comes to degradation of pollutants in [30]various polluted sites . Here, the technique that is used is to

change or modify certain regions in DNA to produce desired

enzyme which will degrade the carbofuran. We can also

modify the specificity of the catabolic genes that was present

earlier. The genes of microbes always try to modify the

metabolic pathway, so as to increase the degradation ability.

Genetically modified microorganisms can be a best suitable

tool for biodegradation of any pesticide because of the unique

features of their metabolic pathways. Various research studies

found the way to create a genetically modified organism

(GMO) with a better metabolic pathway for the degradation of

organic compounds such as carbamates which includes [31]carbofuran and many others .

CONCLUSION :

After considering all the methods that can be implicated for

degradation process of pesticide, we can clearly consider the

microbial bio-remediation as a feasible and eco-friendly

method. Various microbes can be used for this purpose. Some

are mentioned above. Apart from this we can genetically

modify organisms so as to get a desirable GMO which can be

helpful in degrading various pesticides. In certain case we can

observe the metabolites of microbial degradation found to be

even more toxic due to various factors. Although various

researches done on this area but still research needs to be done

for such metabolites and development of GMOs.

REFERENCES :

1. Mohamed A Abo-El-Seoud AE-MMRA. Stimulating of

biodegradation of oxamyl pesticide by low dose gamma

irradiated fungi. J Plant PatholMicrobiol [Internet].

2013;04(09).

2. Alvarez A, Saez JM, Davila Costa JS, Colin VL, Fuentes

MS, Cuozzo SA, et al. Actinobacteria: Current research

and perspectives for bioremediation of pesticides and

heavy metals. Chemosphere. 2017;166:4162.

3. Anguiano OL, Vacca M, Rodriguez Araujo ME,

Montagna M, Venturino A, Ferrari A. Acute toxicity and

esterase response to carbaryl exposure in two different

populations of amphipods Hyalellacurvispina.

AquatToxicol. 2017;188:729.

4. Berman T T, Göen T, Novack L, Beacher L, Grinshpan L,

Segev D, et al. Corrigendum to Urinary concentrations of

organophosphate and carbamate pesticides in residents of

a vegetarian community [Environment International

volume 96 (2016) 34-40]. Environ Int. 2017;106:267.

5. Cai Z, Wang J, Ma J, Zhu X, Cai J, Yang G. Anaerobic

degradation pathway of the novel chiral insecticide

Paichongding and its impact on bacterial communities in

soils. J Agric Food Chem. 2015;63(32):715160.

6. Chan-Cupul W, Heredia-Abarca G, Rodríguez-Vázquez

R. Atrazine degradation by fungal co-culture enzyme

extracts under different soil conditions. J Environ Sci

Health B. 2016;51(5):298308.

7. Chanika E, Georgiadou D, Soueref E, Karas P, Karanasios

E, Tsiropoulos NG, et al. Isolation of soil bacteria able to

hydrolyze both organophosphate and carbamate

pesticides. Bioresour Technol. 2011;102(3):318492.

8. Chapalamadugu S, Chaudhry GR. Microbiological and

biotechnological aspects of metabolism of carbamates

and organophosphates. Crit Rev Biotechnol.

1992;12(56):35789.

9. Doddamani HP, Ninnekar HZ. Biodegradation of carbaryl

by a Micrococcus spec ies . CurrMicrobio l .

2001;43(1):6973.

235


10. Fang H, Wang Y, Gao C, Yan H, Dong B, Yu Y. Isolation

and characterization of Pseudomonas sp. CBW capable of

d e g r a d i n g c a r b e n d a z i m . B i o d e g r a d a t i o n .

2010;21(6):93946.

11. Fareed A, Zaffar H, Rashid A, Maroof Shah M, Naqvi TA.

Biodegradation of N-methylated carbamates by free and

immobilized cells of newly isolated strain Enterobacter

c l o a c a e s t r a i n T A 7 . B i o r e m e d i a t J .

2017;21(34):11927.

12. Felsot A, Maddox JV, Bruce W. Enhanced microbial

degradation of carbofuran in soils with histories of

Furadan® use. Bull Environ ContamToxicol.

1981;26(1):7818.

13. Gupta RC. Carbofuran toxicity. J Toxicol Environ Health.

1994;43(4):383418.

14. Gupta M, Mathur S, Sharma TK, Rana M, Gairola A,

Navani NK, et al. A study on metabolic prowess of

Pseudomonas sp. RPT 52 to degrade imidacloprid,

endosulfan and coragen. J Hazard Mater. 2016;301:2508.

15. Head IM, Cain RB, Suett DL. Characterization of a

carbofuran-degrading bacterium and investigation of the

role of plasmids in catabolism of the insecticide

carbofuran. Arch Microbiol. 1992;158(4):3028.

16. Jury WA, Focht DD, Farmer WJ. Evaluation of pesticide

groundwater pollution potential from standard indices of

soil-chemical adsorption and biodegradation. J Environ

Qual. 1987;16(4):4228.

17. Lalah JO, Wandiga SO, Dauterman WC. Mineralization,

volatilization, and degradation of carbofuran in soil

samples from Kenya. Bull Environ ContamToxicol.

1996;56(1):3741.

18. Han X, Balakrishnan VK, Buncel E. Alkaline degradation

of the organophosphorus pesticide fenitrothion as

mediated by cationic C12, C14, C16, and C18 surfactants.

Langmuir. 2007;23(12):651925.

19. Kazumi J, Capone DG. Microbial aldicarb transformation

in aquifer, lake, and salt marsh sediments. Appl Environ

Microbiol. 1995;61(8):28209.

20. Moorman TB. Adaptation of microorganisms in

subsurface environments: Significance to pesticide

degradation. In: ACS Symposium Series. Washington,

DC: American Chemical Society; 1990. p. 16780.

21. Moye HA, Miles CJ. Aldicarb contamination of

g roundwater. Rev Envi ron ContamToxico l .

1988;105:99146.

22. Bano N, Musarrat J. Characterization of a novel

carbofuran degrading Pseudomonas sp. with collateral

biocontrol and plant growth promoting potential. FEMS

Microbiol Lett. 2004;231(1):137.

23. Ou L-T, Rao PSC, Edvardsson KSV, Jessup RE, Hornsby

AG, Jones RL. Aldicarb degradation in sandy soils from

different depths. Pestic Sci. 1988;23(1):112.

24. Onunga DO, Kowino IO, Ngigi AN, Osogo A, Orata F,

Getenga ZM, et al. Biodegradation of carbofuran in soils

within Nzoia River Basin, Kenya. J Environ Sci Health B.

2015;50(6):38797.

25. Otieno PO, Lalah JO, Virani M, Jondiko IO, Schramm K-

W. Carbofuran and its toxic metabolites provide forensic

evidence for furadan exposure in vultures (Gyps

africanus) in Kenya. Bull Environ ContamToxicol.

2010;84(5):53644.

26. Öztürk B, Ghequire M, Nguyen TPO, De Mot R, Wattiez

R, Springael D. Expanded insecticide catabolic activity

gained by a single nucleotide substitution in a bacterial

carbamate hydrolase gene. Environ Microbiol.

2016;18(12):487887.

27. Pandey G, Dorrian SJ, Russell RJ, Brearley C, Kotsonis S,

Oakeshott JG. Cloning and biochemical characterization

of a novel carbendazim (methyl-1H-benzimidazol-2-

ylcarbamate)-hydrolyzing esterase from the newly

isolated Nocardioides sp. strain SG-4G and its potential

for use in enzymatic bioremediation. Appl Environ

Microbiol. 2010;76(9):29405.

28. Parks P, Lipman J, Eidelman J. Carbamate toxicity. A case

report. S Afr Med J. 1987;72(3):222.

29. Plangklang P, Reungsang A. Bioaugmentation of

carbofuran residues in soil using Burkholderiacepacia

PCL3 adsorbed on agricultural residues. Int Biodeterior

Biodegradation. 2009;63(4):51522.

30. Plangklang P, Reungsang A. Effects of rhizosphere

remediation and bioaugmentation on carbofuran removal

f r o m s o i l . Wo r l d J M i c r o b i o l B i o t e c h n o l .

2008;24(7):9839.

31. Chaudhry GR, Ali AN. Bacterial metabolism of

carbofuran. Appl Environ Microbiol. 1988;54(6):14149.

32. Trotter DM PhD, Kent RA BSc, Wong MP MSc. Aquatic

fate and effect of Carbofuran. Crit Rev Environ Contr.

1991;21(2):13776.

33. Liu Z, Hong Q, Xu J-H, Jun W, Li S-P. Construction of a

genetically engineered microorganism for degrading

organophosphate and carbamate pesticides. Int

Biodeterior Biodegradation. 2006;58(2):659.

34. Mahboob S, Al-Ghanim KA, Al-Misned F, Ahmed Z.

Determination of pesticide residues in muscle

236


ofCyprinuscarpiofrom River Ravi. Toxicol Environ

Chem. 2014;96(5):799807.

35. Li X, Li Y, Zhang X, Zhao X, Sun Y, Weng L, et al. Long-

term effect of biochar amendment on the biodegradation

of petroleum hydrocarbons in soil microbial fuel cells. Sci

Total Environ. 2018;651(Pt 1):796806.

36. Sakunthala Tennakoon DAS, Karunarathna WDV,

Udugampala USS. Carbofuran concentrations in blood,

bile and tissues in fatal cases of homicide and suicide.

Forensic Sci Int. 2013;227(13):10610.

37. Hesselsoe M, Boysen S, Iversen N, Jørgensen L, Murrell

JC, McDonald I, et al. Degradation of organic pollutants

by methane grown microbial consortia. Biodegradation.

2005;16(5):43548.

38. Cycoń M, Mrozik A, Pio t rowska-Seget Z.

Bioaugmentation as a strategy for the remediation of

pesticide-polluted soil: A review. Chemosphere.

2017;172:5271.

39. Hsu C-A, Wen T-N, Su Y-C, Jiang Z-B, Chen C-W, Shyur

L-F. Biological degradation of anthroquinone and azo

dyes by a novel laccase from Lentinus sp. Environ Sci

Technol. 2012;46(9):510917.

40. Beklová M, Dobšiková R, Pikula J. 642 Toxicity of

carbofuran for aquatic and terrestrial organisms. Toxicol

Lett. 2003;144:s172.

41. Ghazala, Mahboob S, Ahmad L, Sultana S, Alghanim K,

Al-Misned F, et al. Fish cholinesterases as biomarkers of

sublethal effects of organophosphorus and carbamates in

tissues of Labeorohita: Cholinergic biomarkers for

pesticides. J Biochem Mol Toxicol. 2014;28(3):13742.

42. Mohd-Nor D, Ramli N, Sharuddin SS, Hassan MA,

Mustapha NA, Ariffin H, et al. Dynamics of microbial

populations responsible for biodegradation during the

full-scale treatment of palm oil mill effluent. Microbes

Environ. 2019;34(2):1218.

43. Kalam A, Mukherjee AK. Influence of hexaconazole,

carbofuran and ethion on soil microflora and

dehydrogenase activities in soil and intact cell. Indian J

Exp Biol. 2001;39(1):904.

44. Sharma P, Dube D, Sinha M, Mishra B, Dey S, Mal G, et

al. Multiligand specificity of pathogen-associated

molecular pattern-binding site in peptidoglycan

recognition protein. J Biol Chem. 2011;286(36):3172330.

45. Lado-Abeal J, Hickox JR, Cheung TL, Veldhuis JD,

Hardy DM, Norman RL. Neuroendocrine consequences

of fasting in adult male macaques: effects of recombinant

rhesus macaque leptin infusion. Neuroendocrinology.

2000;71(3):196208.

46. Hudson A. Reviews. Notes Queries. 1984;31(3):4112.

47. Rosman Y, Makarovsky I, Bentur Y, Shrot S, Dushnistky

T, Krivoy A. Carbamate poisoning: treatment

recommendations in the setting of a mass casualties event.

Am J Emerg Med. 2009;27(9):111724.

48. Bedada SK, Boga PK. Influence of diosmin on the

metabolism and disposition of carbamazepine in healthy

subjects. Xenobiotica. 2017;47(10):87984.

49. Gong T, Liu R, Che Y, Xu X, Zhao F, Yu H, et al.

Engineer ingPseudomonas put idaKT2440 for

simultaneous degradation of carbofuran and chlorpyrifos.

MicrobBiotechnol. 2016;9(6):792800.

50. Ishag AESA, Abdelbagi AO, Hammad AMA, Elsheikh

EAE, Elsaid OE, Hur J-H, et al. Biodegradation of

chlorpyrifos, malathion, and dimethoate by three strains

of bacteria isolated from pesticide-polluted soils in Sudan.

J Agric Food Chem. 2016;64(45):84918.

51. Choudhary MI, Musharraf SG, Mukhmoor T, Shaheen F,

Ali S, Rahman A-U. Isolation of Bioactive Compounds

from Aspergillus terreus. Z Naturforsch B J Chem Sci.

2004;59(3):3248.

52. Sogorb MA, Vilanova E. Enzymes involved in the

detoxification of organophosphorus, carbamate and

pyrethroid insecticides through hydrolysis. Toxicol Lett.

2002;128(13):21528.

53. Nguyen TPO, Helbling DE, Bers K, Fida TT, Wattiez R,

Kohler H-PE, et al. Genetic and metabolic analysis of the

carbofuran catabolic pathway in Novosphingobium sp.

K N 6 5 . 2 . A p p l M i c r o b i o l B i o t e c h n o l .

2014;98(19):823552.

54. Li Z, Qu S, Cui L, Zhang S. Detection of carbofuran

pesticide in seawater by using an enzyme biosensor. J

Coast Res. 2017;80:15.

55. Ufarté L, Laville E, Duquesne S, Morgavi D, Robe P,

Klopp C, et al. Discovery of carbamate degrading

enzymes by functional metagenomics. PLoS One.

2017;12(12):e0189201.

56. Yang T, Lin C, Fu H, Jiang Y, Zhao Y. Copper-catalyzed

synthesis of medium- and large-sized nitrogen

heterocycles via N-arylation of phosphoramidates and

carbamates. Org Lett. 2005;7(21):47814.

237


Review Article

INTRODUCTION:

Skin, hair and blood are conventional sources of DNA in

forensic analysis; however in multiple cases, identification of

deceased individuals is difficult due to accidents, explosions,

plane crash, mass disasters, brutal murders, decaying body,

war crimes, terrorist attacks, etc. The chances of cross

contamination and decomposition are high and this makes the

conventional sources a poor choice for DNA extraction.

Owing to their high protective structure in such cases, bones

and teeth are the only available sources of DNA. (Hervella et

al. 2015; Jakubowska et al. 2012; Malaver et al 2003;

Gaytmenn et al.2003 ). DNA analysis of evidence samples

such as teeth and bones from cadavers have major role in

identification of dead body which is devoid of any other

potential source of DNA (Ferreira et al. 2013). In criminal

cases it is used for identification of culprit, victim and suspect.

Bones and teeth are considered as the most significant

evidences for DNA analysis owing to their ability in sustaining

harsh environmental conditions. The degradation of soft

tissues (i.e., blood samples and muscle tissue) carried out by

bacteria is relatively faster as compared to tooth and bone

tissues (Kitayama et al. 2010). In spite of several methods

being available for DNA extraction from bones and teeth,

these are not widely used as a standard protocols, since they are

time consuming, expensive and equally complex (Anderung et

al. 2008). Working with such ancient samples for DNA

extraction remains a delicate and challenging task.

An anthropological study proposes the use of bones and teeth

in determination of sex, age and identification of cadaver from

previous/historical medical records. DNA extraction from

ancient human skeletal remains can provide vital information

of prehistoric human civilization. Curators and museum

authorities are highly concerned about the integrity of skeletal

remains to reconstruct the life history of an individual; forensic

Corresponding Author : Dr Arun D Ghuge, M.Sc., M. Phil.

Assistant Professor and Head ,

Department of Forensic Biology, Government Institute of

Forensic Science, Government of Maharashtra, Nipat Niranjan

Nagar, Caves road, Aurangabad 431004, India

Contact : +91 82752-19852

Email : [email protected]/[email protected]

KEYWORDS : Non-destructive; Destructive; Bones; Teeth; Enamel; Pulp.

Article History:Received: 21 November 2019Received in revised form: 15 May 2020Accepted on: 15 May 2020Available online: 31 August 2021

1. Ghuge Arun, M.Sc., M. Phil. Assistant Professor & Head*2. Verma Pratibha, M.Sc. Research Scholar, Gamete Immunobiology Division, National Institute for Research in Reproductive

Health, ICMR, Mumbai 400012, India 3. Sangle Sandeep, M.Sc. Assistant Professor*,

4. Gaiki Shweta, M.Sc. Assistant Chemical Analyzer, Regional Forensic Science Laboratory, Government of Maharashtra, Nagpur

5. Paikrao Hariprasad, M.Sc., Ph.D. Assistant Professor* *Department of Forensic Biology, Government Institute of Forensic Science, Government of Maharashtra, Nipat Niranjan

Nagar, Caves road, Aurangabad 431004, India

Switching Gears of DNA Extraction: From Destructive to Non- Destructive


238

ABSTRACT :

In many cases where samples such as historical remains, museum samples, missing person and criminal sample needs to be

preserved for years; DNA extraction by destructive methods is not feasible due to loss of precious samples. Hard tissue and

mineralised body parts like bones and teeth are only accessible sources of DNA in mass disasters like earthquakes, floods,

tornadoes, aircraft crashes, train wreck, derailments, and building fires with disfigured and decomposed bodies. The protective

composition of teeth and bones provides an extra protection over soft tissue and thus its high resistance to the action of physical and

chemical agents makes them the only choice for DNA extraction. This review summarises the previous and current methods of

DNA extraction from tooth and bone, emphasizing its effect on DNA yield, efficiency to yield amplifiable amount of mitochondrial

DNA and nuclear DNA, PCR amplification, PCR inhibition and its morphology. The likelihood to recover DNA from ancient teeth

and bones in short time, with little contamination is the need of the hour and future thrust area of forensic biology. It will not only

benefit forensic field but will be equally insightful in solving, archaeological and medical questions.

scientists regularly strive to supersede the destructive

extraction analysis method so that evidences can be retained

until conviction, to overcome these problems in legal justice

system (Rohland et al 2004; Bolnick et al. 2012).

Every DNA analysis method requires biological sample from

which DNA can be extracted. The amount and quality of

starting material depicts the success of DNA extraction and

genotyping from teeth. Structural and morphological

information of bones and teeth would aid in the selection of a

proper extraction protocol to access the pulp and cellular

region. This can be achieved by considering their future

importance in scaling down the identification of person by

anthropological methods. The destructive methods which are

used to access dental tissues for DNA isolation include

crushing the entire tooth, endodontic access, horizontal section

and vertical section of the tooth (Malaver et al 2003; Presecki

et al. 2000) grinding and pulverising. While numerous

methods have been developed for extracting DNA from

skeletal remains and odonatological evidences, virtually all

protocols require the destruction of some portion of the

specimen, usually by powdering a part of tooth or bone, which

could aid in identification (Dennis et al 2000; Kaestle et al

2002). Many DNA extraction protocols in forensic science

laboratory follow destructive methods, which makes bones

and teeth samples unavailable for further proceedings.

Fortunately in past few many new non-destructive techniques

with amplifiable amount of DNA are developed. (Rohland et

al. 2004; Cobb 2002) Comparison between destructive and

non-destructive DNA extraction technique from bones and

teeth provides a valuable insight in DNA profiling, also

balancing the demands of molecular biologists, morphologists

and museum curators (Hofreiter 2012). In archaic bone, teeth

and other such samples, the time between actual crime and

identification of evidences is prolonged, resulting in DNA

fragmentation which leads to drop out in STR amplification.

Thus to tackle these problems there is a demand for

comparative study of available destructive, non-destructive

and non-powdered DNA extraction methods from bone and

tooth samples.

Teeth structure and DNA distribution

Microanatomy of teeth sample can assist us to choose the

extraction protocol, which can help to increase the DNA yield.

Complete understanding of the morphology, anatomy and

histology of teeth is required for optimal sampling method for

DNA extraction. Morphologically the teeth has crown with

cusps in molars and edges in canine and incisors' with two to

four roots according to types of teeth. Anatomy of the teeth

reveals the crown covered with enamel and dentine below up

to root. Histology of tooth shows dentine, enamel, pulp cavity,

pulp and cementum. Enamel is a hardest tissue in the human

body mainly composed of minerals, making entire teeth

resistant to damage and protects the inner enamel along with

pulp (Figure: 1) (Pötsch et al. 1992; Higgins 2011). The root

body contains higher amounts of DNA than the crown body or

the root tip (Gaytmenn et al 2003).

Bone structure and distribution of DNA

Bone consists of osteoblasts, osteocytes (bone forming cells),

osteoclasts, matrix of non-collagenous and collagen proteins

which are non-mineral in nature. Osteoclasts are

multinucleated hematopoietic lineage derived cells exhibiting

macrophagic activity, and are major sources of DNA in cases

of ancient sample. These all cells are covered with bone matrix

osteoid, which is a crystal structured complex made up of

calcium and phosphate type-1 collagen termed as

hydroxyapatite, that provides protective covering to bone, thus

preserving the DNA in harsh environment (Figure: 2).

DNA extraction from evidence based sources

239

Figure 1: Structure of teeth and distribution of DNA. Crown tip contains least amount of DNA; Pulp region of root body contains maximum DNA followed by crown body and root tip.

Figure 2 : Structure of bone and distribution of DNA. Maximum amount of DNA can be recovered from osteoclast region as compared to osteoblast.


To gain a better understanding of different DNA extraction

methods one needs to acquire the in-depth knowledge of

evidences used. The main problem of DNA extraction from

bones is DNA degradation due to environmental factors and

soil-derived inhibitors (Davoren et al. 2007). While new

methods are still being searched for and improvised, till date

there is no such universal method reported for DNA extraction

from materials of degraded samples with good quality DNA.

One of the new methods of DNA extraction from aggregates

(EA), which assumes extraction of DNA, fixed in bone

crystals aggregates (Jakubowska et al. 2012). Intergrown

crystal aggregates can preserve DNA within fossil bones that

cannot be disaggregated by oxidation with sodium

hypochlorite (NaOCl), even though bone is grinded into a fine

powder (Weiner and Price 1986; Salamon et al. 2005).

Salamon reported that NaOCl-treated aggregates enhance the

ability to differentiate between contaminant DNA, highly

damaged DNA, and better preserved DNA.

Pusch used collagenase and dispase as proteases in addition

muramidase to isolate good quality DNA from small quantities

of bone meal (Pusch and Scholz 1997). Extensive

mineralization within the bone and teeth result in a physical

barrier to the extraction reagents, thus preventing the release of

DNA molecules (Loreille et al 2007). Lyavoo described DNA

extraction from bone samples using silica-based extraction kit ChargeSwitch gDNA Plant Kit (Life Technologies), DNA

IQTM system kit (Promega), DNeasy blood and tissue kit (Qiagen) and PrepFilerBTA forensic DNA extraction kit (Life

Technologies) along with conventional phenol-chloroform

method. The comparative study showed that the phenol-

chloroform extraction method (PCI) yields more DNA than

the silica-based extraction methods (Iyavoo et al 2013).

Excluding yield, PCI method is laborious, time consuming,

with direct chemical exposure and can only be done if either

abundant or ample amount of sample is available (Manjunath

et al 2011).

Protocols used for sampling and extraction of tooth tissues

predominantly shows those which are used for bone even

though the two tissues are morphologically and biochemically

different. Hence no standard protocol has explained the proper

handling, sampling and DNA extraction from teeth. For

example the protocols for teeth used by the International

Commission of Missing Persons (ICMP) are identical to those

used for bone with the exception of pre-treatment to the outer

surface of bone (Davoren et al. 2007). The DNA extraction

practice, which involves grinding of entire teeth, does not take

into consideration the tooth morphology or the relative

distribution of mineral, protein and DNA in teeth.

Furthermore, grinding of whole teeth (Alonso et al. 2005;

Marjanović et al. 2015) does not consider that these tissues

may be useful to other disciplines involved in the identification

process. Grinding of whole teeth also inordinately adds excess

mineral into the extraction process necessitating the use of

large volume of reagents. Tooth tissues contain large quantities

of calcium (especially enamel) and collagen, which if co-

extracted with the DNA can be problematic for DNA

amplification via polymerase chain reaction (PCR). Thus tooth

extraction and sampling protocols should aim to target DNA

rich tissues, minimal sampling of high-mineral/ low-DNA

tissue and reduction in co-extraction of inhibitory substances

with the DNA (Rohland and Hofreiter 2007).

Conventional sampling of teeth for DNA analysis generally

follows one of the two pathways, either targeted sampling of

the pulp (the DNA-rich soft tissue component of the tooth) by

splitting or by drilling through the crown or non-targeted

sampling of the entire tooth (root). Grinding of the entire tooth

provides access to the largest amount of DNA but also contains

a large amount of mineral (cementum is 45%, dentine 70% and

enamel 97% composed of mineral) that must be removed prior

to downstream analysis (Higgins et al 2013). Most of the

current DNA extraction protocols for bones and teeth are based

on the incubation of powdered material in extraction buffer

containing ethylene diamine tetracetic acid (EDTA). EDTA is

generally accepted as the most effective chelating agent in

endodontic technique (Loreille et al. 2007) and when coupled

with proteinase-K digestion, EDTA maximises the efficiency

of DNA extraction (Caputo et al. 2013; Hossain et al. 2014). It

is used to enlarge root canal and expose dentin (Tabatabaei et

al. 2016). The phenol-chloroform method works on an initial

digestion to break down the minerals, proteins, and lipids

present in the sample mixture (Barnett and Larson 2012).

Further processing detaches the DNA portion from other

protein components by solvent extraction into aqueous and

hydrophobic phases respectively. Finally filtration through

membrane filter concentrates DNA in the sample.

Methods of DNA extraction1. DNAzol Method (Betancor et al. 2011)

2. PrepFiler BTAMethod (Betancor et al. 2011)3. Bolnick DNA extraction (Non-destructive) (Bolnick et

al. 2012)4. GuSCN based Non-destructive extraction protocol

(Rohland et al. 2004)5. New experimental kit DNA extraction (Kitayama et al.

2010)6. Grinding-free method for DNA extraction from teeth

(Hughes-Stamm et al. 2016)7. Silica-based DNA extraction (Davoren et al. 2007)8. Phenol-Chloroform DNA extraction (Davoren et al.

2007)9. DNA extraction from aggregates [EA] (Salamon et al.

2005)

240


241

*Amplifiable amount of DNATable 1: Comparison of destructive and non-destructive methods of DNA extraction from tooth and bone samples (Amongst all the compared methods non-destructive DNA extraction protocols gave amplifiable amount of DNA and retained the morphology of questioned sample).


Silica-based method has yielded maximum DNA in

destructive extraction protocol category which ranges 0.25-

9.58ng/gm. surpassing both DNAzol and Prep Filer BTA

Method. In non-destructive category new kit method has yield

of 11.18ng/mg, Considering above studies non-destructive

DNA extraction is best for tooth and bone samples which are

intact and has further study prospective for forensic analysis.

It is very evident from recent studies that mechanism of DNA

extraction from crushed teeth has been well established. But

mechanism explained till date regarding the DNA extraction

from teeth sample by non-destructive method is still unclear.

As per Rohland and Hofreiter's Protocol GuSCN extraction

buffer has EDTA which de-mineralises the teeth/bone

samples, giving accessibility to nucleated cells of o

pulp/Osteoid. GuSCN is a strong protein-denaturing agent

and, when used in combination with a reducing agent like DTT

has also been shown to bring cross-linked proteins back into

solution (Rohland et al.2004). It is possible that GuSCN as a

chemical agent is more efficient in denaturing proteins if these

are bound to the hydroxyapatite matrix of the bone than

proteinase K. Moreover, GuSCN may break certain chemical

cross-links even in the absence of reducing agents; Triton X-

100 has similar but more efficient anionic surfactant than SDS,

which breaks the cell wall of cells present in pulp of teeth and

hydroxyapatite matrix of bone, last in the list EDTA which

demineralise the enamel, dentin and hydroxyapatite matrix to

elute cells and DNA from samples (Steadman et al.2012).

Challenges in DNA amplification

Working with DNA extracted from degraded teeth and bone

samples from crime scene requires more comprehensive

knowledge and precaution to carry out successful PCR

amplification.While damaged DNA is repaired in living cells

but not in dead, this result in very few intact copy of DNA in

sample While due to hydroxyapatite matrix teeth and bones .

can sustain for long time, which makes analyst easy to work on

it for STR profiling. Though some external environmental

factors affect DNA and cause damage, to avoid this tooth and

bone samples as recovered must be decontaminated and stored

in cold condition to minimize further damage.

PCR amplification of extracted DNA from mass disaster or

burning cases samples always poses a major problem due to

co-extracted products which inhibits reaction. Extracting

DNA from samples also co-extract some proteins and enzymes

like humic acid, fulvic acid, hematin, collagen type-1 which

are termed as Maillard products. It does not inactivate

polymerase, but they can be considered as inhibitors because

the DNA trapped in these sugar derived condensation products

is inaccessible to polymerase. Number of approaches has been

developed to remove the co-extracted Maillard products such

as: Manipulating PCR reaction component or by removing it

during DNA extraction procedure. Manipulation of PCR

reaction component involves dilution of template DNA, so

inhibitors get diluted to an extent that results in inability to

inhibit reaction. Some inhibitors block Taq polymerase, to

counter-balance it. Taq-polymerase unit can be increased and

also the inhibitors can be blocked by adding BSA enhancing

the polymerase activity. Using different chemicals during

extraction of DNA removes these inhibitors leading to 2+successful reaction. Ca is commonly found in bone and teeth

2+and is known to interfere with Mg concentration, which in

turn may affect the activity of Taq polymerase during PCR

amplifications.

Several chemicals have been used during DNA extraction to

remove PCR inhibitors, for example Cetyl Trimethyl

Ammonium Bromide (CTAB) to increase the yield of DNA

extracted from burned bones (Ye et al. 2004).

In case of DNA extraction based on size, DNA is extracted

from agarose blocks leading to co-extraction of inhibitors

along with it. This has been overcome by washing it with lysis

buffer followed by TE buffer which readily diffuses out small

size inhibitors compared to DNA. DNA precipitation with

isopropanol shows less inhibition compared to precipitation

c a r r i e d o u t u s i n g e t h a n o l . T h e a d d i t i o n o f N -

phenacylthiazolium bromide (PTB) during DNA extraction

process cleaves Maillard products. Several studies have shown

successful extraction of both nuclear and mitochondrial DNA

using PTB from 20,000 years old samples.

Non-destructive methods of DNA extraction: Driving force

to future forensic studies

DNA analysis for individuals has a major role in forensic

investigation, mass disaster cases etc. In the present review

nine different extraction protocols were compared for best

DNA yield, quality and sustained sample integrity. The five

destructive extraction protocols are as follows: DNAzol

Method, PrepFiler BTA method, Silica-based method,

Phenol/chloroform method and DNA extraction from

aggregates [EA]. The rest four non-destructive protocols are as

follows: New experimental kit DNA extraction, Grinding-free

method for DNA extraction, new kit method and GuSCN non-

destructive DNA extraction protocol used by Rohland and

Hofreiter's.

In destructive protocol, samples are pulverized. In case of teeth

and bone a part or complete sample is crushed to be used in

extraction buffer. Grinding of entire teeth for extraction

process requires extensive demineralisation steps and these are

difficult to automate thus increasing the chance of

contamination. Since tooth and bone samples are available in

small quantities this can lead to sample integrity issues.

242


Destruction of such precise samples increases waste products

and also affects amplification of DNA, also limiting the

analysis only up to DNA profiling (Hervella et al. 2015). In

case of deceased unidentified dead body it is hard to get

reference sample for comparison. This problem can be solved

by using non- destructive DNA extraction protocol which

makes sample available for further anthropological analysis,

after using it for extraction with no visible and morphological

damage to sample, thus helping in individualization.

But most of the present DNA extraction protocols are

destructive in nature which limits studies only to DNA

profiling. This is considered as major drawback in cases where

no reference DNA sample is available due to unavailability of

any commanding clue required for individual identification.

In such cases non-destructive extraction method makes it

possible to analyse the sample for further anthropological

studies which aids in narrowing down the individual from

mass sample that can be reused for consecutive extraction

many times. Especially In cases where reference DNA sample

is available from relatives or belongings or individual STR

profile. In non-destructive methods the morphology remains

intact for prehistoric studies and no effect of demineralisation

on PCR amplifications is seen.

CONCLUSION:

The battle between destructive and non-destructive methods of

DNA extraction from bone and teeth samples continues,

researchers would probably come up with refinement of

protocol for non-destructive method due sample preservations

of forensically important samples like teeth and bones for

individual identification covering all possible obstacles and

solutions to aid in forensic analysis.

Abbreviations:

NaOCl: Sodium Hypochlorite

PCI: Phenol-Chloroform Extraction Method

ICMP: International Commission of Missing Persons

EDTA: Ethylene Diamine Tetracetic Acid

GuSCN: Guanidinium Thiocyanate

CTAB: CetylTrimethylAmmonium Bromide

PTB: N-Phenacylthiazolium Bromide

REFERENCES:

1. Anderung C, Persson P, Bouwman A (2008) Fishing for

ancient DNA. J. Forensic Sci. Int. Genet 2:104–107.

doi:10.1016/j.fsigen.2007.09.004.

2. Alonso A, Martin P, Albarrán C, Garcia P, Fernandez de

Simon L, Jesús Iturralde M, Fernández-Rodriguez A,

Atienza I, Capilla J, García-Hirschfeld J, Martinez P,

Vallejo G, García O, García E, Real P, Alvarez D, León A,

Sancho M (2005) Challenges of DNA profiling in mass

disaster investigations. Croat. Med. J. 46:540–548.

3. Barnett R, Larson G (2012) A phenol-chloroform

protocol for extracting DNA from ancient samples,

Methods Mol Biol.840:13-9. doi: 10.1007/978-1-61779-

516-9_2

4. Betancor E, et al., (2011) An Efficient Method of

Extracting DNA from Bone Remains from the Spanish

Civil War—A Comparative Study of Two Methods:

PrepFiler BTA™ and DNAzol® Methods. Forensic

News January; [Internet]

5. Bolnick DA, Bonine HM, Mata-Míguez J, Kemp BM,

Snow MH, Leblanc SA (2012) Nondestructive sampling

of human skeletal remains yields ancient nuclear and

mitochondrial D N A. Am. J. Phys. Anthropol.

147:293–300. doi:10.1002/ajpa.21647.

6. Caputo M, Irisarri M, Alechine E, Corach D (2013) A

DNA extraction method of small quantities of bone for

high-quality genotyping. Forensic Sci. Int. Genet.

7:488–493. doi:10.1016/j.fsigen.2013.05.002.

7. Cobb JC (2002) Ancient DNA Recovered by a Non-

destructive Method., Anc. Biomol. 4:169-172.

doi:10.1080/1358612021000028461.

8. Davoren J, Vanek D, Konjhodzić R, Crews J, Parsons

TJ (2007) Highly Effective DNA Extraction Method for

Nuclear Short Tandem Repeat Testing of Skeletal

Remains from Mass Graves.Croat Med J. 48(4):478–485.

9. Dennis H. O'Rourke M. Geoffrey Hayes and Shawn W.

Carlyle (2000) Ancient DNA studies in physical

anthropology, Annual Review of Anthropology 29(1):

217-42. DOI: 10.1146/annurev.anthro.29.1.217

10. Ferreira S.TG, Paula KA, Maia FA, Moraes AV, (2013) A

comparative study between two protocols for DNA

extraction from bones, Forensic Sci. Int. Genet. Suppl.

Ser. 4:374–375. doi:10.1016/j.fsigss.2013.10.190.

11. Gaytmenn R, Sweet D, (2003) Quantification of Forensic

DNA from Various Regions of Human Teeth,J Forensic

Sci 48:1–4.Paper ID JFS2002372_483.

12. Hervella M, Iñiguez MG, Izagirre N, Anta A, De-la-Rúa

C (2015) Nondestructive Methods for Recovery of

Biological Material from Human Teeth for DNA

E x t r a c t i o n . J . F o r e n s i c S c i . 6 0 : 1 3 6 – 1 4 1 .

doi:10.1111/1556-4029.12568.

13. Higgins D, Kaidonis J, Townsend G, Hughes T, Austin JJ

(2013) Targeted sampling of cementum for recovery of

nuclear DNA from human teeth and the impact of

243


common decontamination measures. Investig. Genet.

4:18. doi:10.1186/2041-2223-4-18.

14. Higgins D, Kaidonis J, Austin J, Townsend G, James H,

Hughes T (2011) Dentine and cementum as sources of

nuclear DNA for use in human identification, Aust. J.

F o r e n s i c S c i . 4 3 : 2 8 7 – 2 9 5 .

doi:10.1080/00450618.2011.583278.

15. Hofreiter M (2012) Special issue ancient DNA, Ann.

Anat. 194:1–2. doi: 10.1016/.2011.04.011.

16. Hossain HM, Kumar T, Majumder A, Momtaz P, Sharmin

T, Sufian A, Akhteruzzamani S (2014) National Forensic

DNA Profiling Laboratory, Dhaka Medical College

Campus, Dhaka ‐ 1000. Bangladesh Key words:,

23:101–107.

17. Hughes-Stamm S, Warnke F, van Daal (2016) A An

a l t e r n a t e m e t h o d f o r e x t r a c t i n g D N A f r o m

environmentally challenged teeth for improved DNA

a n a l y s i s . L e g . M e d . 1 8 : 3 1 – 3 6 .

doi:10.1016/j.legalmed.2015.11.008.

18. Iyavoo S, Hadi S, Goodwin W (2013) Evaluation of five

DNA extraction systems for recovery of DNA from bone.

Forensic Sci. Int. Genet. Suppl. Ser. 4:e174–e175.

doi:10.1016/j.fsigss.2013.10.090.

19. Jakubowska J, Maciejewska A, Pawłowski R (2012)

Comparison of three methods of DNA extraction from

human bones with different degrees of degradation, Int. J.

Legal Med. 126:173–178. doi:10.1007/s00414-011-

0590-5.

20. Kaestle FA, Horsburgh KA (2002) Ancient DNA in

anthropology: Methods, applications, and ethics, Yearb.

Phys. Anthropol. 45: 92–130. doi:10.1002/ajpa.10179.

21. Kitayama T, Ogawa Y, Fujii K, Nakahara H, Mizuno N,

Sekiguchi K, Kasai K, Yurino N, Yokoi T, Fukuma Y,

Yamamoto K, Oki T, Asamura H, Fukushima H, (2010)

Evaluation of a new experimental kit for the extraction of

DNA from bones and teeth using a non-powder method,

L e g .

Med.12:84–89.doi:10.1016/j.legalmed.2009.12.004.

22. Loreille OM, Diegoli TM, Irwin JA, Coble MD,

Parsons TJ (2007) High efficiency DNA extraction from

bone by total demineralization, Forensic Sci. Int. Genet.

1:191–195. doi:10.1016/j.fsigen.2007.02.006.

23. Malaver P, Yunis J (2003) Different dental tissues as

source of DNA for human identification in forensic cases.,

Croat. Med. J. 44:306–309.

24. Manjunath BC, Chandrashekar BR, Mahesh M, Vatchala

Rani RM (2011) DNA profiling and forensic dentistry - A

review of the recent concepts and trends. J. Forensic Leg.

Med. 18:191–197. doi:10.1016/j.jflm.2011.02.005.

25. Marjanović D, Hadžić Metjahić N, Čakar J, Džehverović

M, Dogan S, Ferić E, Džijan S, Škaro V, Projić P, Madžar

T, Rod E, Primorac D, Iyavoo S, Hadi S, Goodwin W

(2015) Identification of human remains from the Second

World War mass graves uncovered in Bosnia and

Herzegovina. Croat . Med. J . 56:257–62. doi:

10.3325/cmj.2015.56.257

26. Pötsch L, Meyer U, Rothschild S, Schneider PM,

Rittner C (1992) Application of DNA techniques for

identification using human dental pulp as a source of

D N A . I n t J L e g . M e d . 1 0 5 : 1 3 9 – 1 4 3 .

http://www.ncbi.nlm.nih.gov/pubmed/1419874.

27. Presecki Z, Brkic H, Primorac D, Drmic I (2000)

Methods of Preparing the Tooth for DNA Isolation. Acta

Stomatol Croat. 34:21–24.

28. Pusch C, Scholz M (1997) DNA extraction from ancient

human bones via enzymatic treatment. Tech. Tips Online.

2:160–163. doi:10.1016/S1366-2120(08)70072-2

29. Rohland N, Hofreiter M (2007) Ancient DNA extraction

from bones and teeth, Nat. Protoc. 2 :1756–1762.

doi:10.1038/nprot.2007.247.

30. Rohland N, Siedel H, Hofreiter M. (2004)

Nondes t ruc t ive D N A ex t rac t ion me thod fo r

mitochondrial DNA analyses of museum specimens.

Biotechniques. 36(5):814-818

31. Salamon M, Tuross N, Arensburg B, Weiner S (2005)

Relatively well preserved DNA is present in the crystal

aggregates of fossil bones. Proc Natl Acad Sci USA

102:13783–13788.

32. Steadman DW, Pack FL, Algee-hewitt B.FB, Hulsey BI,

Cabana GS (2012) Validation of a Non-Destructive DNA

Recovery Method in Forensic-Age Samples.

33. Tabatabaei FS, Tatari S, Samadi R, Moharamzadeh K

(2016) Different methods of dentin processing for

application in bone tissue engineering: A systematic

review, Journal of Biomedical Material Research

doi.org/10.1002/jbm.a.35790.

34. Weiner S, Price P (1986) Disaggregation of Bone Into

C r y s t a l s . C a l c i f . T i s s u e I n t . 3 9 : 3 6 5 – 3 7 5 .

https://doi.org/10.1007/BF02555173.

35. Ye J, Ji A, Parra EJ, Zheng X, Jiang C, Zhao X, Hu L, Tu Z

(2004) A Simple and Efficient Method for Extracting

DNA From Old and Burned Bone. J. Forensic Sci. 49:1–6.

doi:10.1520/JFS2003275

244


Review article

INTRODUCTION :

A person being useful even after their demise is an emerging

notion amongst people. Even though many people have used

dead bodies for understanding the human body since time

immemorial, instead of appreciation, they faced blasphemy,

were called heretics and were shunned by priests and other

holy men. In literal sense, if no cadavers were ever taken for

study and research, we would not have known our basic body

structure at all. Previously, a dead body was considered as non-

viable, but now, with further research, we are able to harvest

organs from such bodies, within a stipulated time after

declared dead. This advent has helped many patients suffering

from end stage organ failures as they had to wait to get an organ

transplant from a donor, who inevitably had to be brain dead or

a living person and finding these donors was not very common,

which led to people dying whilst waiting for a donor. Even

though this procedure is being practiced extensively in the

western world, not many cases are seen in India where only 8transplantation from living donors is being done. It is due to

many prejudiced people who do not accept the concept of

getting an organ from a dead patient into a living person, but

awareness has to be created.

Transplantation and its types

Transplantation is a procedure where a living viable organ,

tissues or a group of cells are removed from its original site or

donor site and surgically placed at a new specified site or 1recipient site for the benefit of the recipient. It can be an

autograft, allograft or a xenograft. In an autograft, the donor

and recipient is the same individual, used in skin, bone and

nerve grafting commonly. An allograft is where the donor and

recipient are two different individuals but of the same species,

which is used in all hollow viscous organ transplants.

Xenograft is where the donor and recipient are of two different

species, where the use of heart valves of pigs for human heart is

the most common.

The donors and recipients

Generally, the recipients are the patients who suffer from end

stage organ failure and are in need for a new organ whereas the

donor either can be a healthy living person or a deceased

person. The former includes living related donors, spousal 7donors and other than living related donors. The latter


Dr Jagadish Rao Padubidri,

Associate Professor, Department of Forensic Medicine,

Kasturba Medical College, Mangalore,

Manipal Academy of Higher Education, Manipal, India

Contact : +91-9900405085

Email : [email protected], [email protected]

KEYWORDS : Cadaver, Transplantation, Irreversible brain damage, donor, recipient, Ethical, Legal


ABSTRACT :

Using parts of a cadaver to treat the living has been a topic of interest amongst emerging medical professionals to treat irreversible

organ damage. Transplantation is an approach where living tissues or organs are taken from their original site or donor site and 1 placed surgically at a new specified site or recipient site for the benefit of the recipient. It is of three types which are autograft,

allograft and xenograft. The recipient is the one who is the victim of end stage organ failure and the donor is the one who either be

living or dead, who will provide the organ. Since this procedure has been introduced for treatment, there was a lot of demand to

procure organs with limited supply, which in turn gave stimulus to research the cadaveric transplantation. Hence, there have been

studies and research being done to meet the demand and reduce complications as this procedure is a boon to patients suffering from

end stage organ failure. There are complications with the procedure which include graft rejection and ischemia-reperfusion injury.

This article focuses on legal procedure for procurement of organs after a person has been declared brain dead or cardiac dead by

THOTA in India and various Ethical issues related to consent, myths, religious reasons and notions related with cadaveric

transplantation have been discussed.

1. J.S.R.G. Saran, Undergraduate Medical Trainee, Kasturba Medical College, Mangalore, Manipal Academy of Higher

Education, Manipal, India

2. Jagadish Rao Padubidri, District Medicolegal Consultant & Associate Professor, Department of Forensic Medicine,

Kasturba Medical College, Mangalore, Manipal Academy of Higher Education, Manipal, India

Cadaveric Transplantation-The legal and Ethical issues


245

7includes brain dead individuals and cardiac dead individuals.

There are very limited organs that can be procured from a

living person, which most commonly include one kidney, one

lung, piece of liver, pancreas or intestine. Most of the other

organs like the heart, both the kidneys, both the lungs, liver,

pancreas and other organs require a brain dead person.

Recently, hand and face transplantation, which come under

vascularized composite allograft (VCA) have been added to 10the donor list. But in case of a cardiac dead person, bone, skin,

heart valves and corneas can be harvested within 24 hours of

death.

The need for cadaveric transplant

Initially, the age of transplantation started with the advent of

kidney transplant between identical twins by Joseph Murray in 41954. Then, other organ transplants were experimented on

with live individuals and only limited organs could be

transplanted. With the advent of heart and liver transplantation

procedures which were transplanted from vegetative patients,

along with use of combination of immunosuppressive drug

therapy to prevent rejection, there was an increased demand for 4organs but limited supply. This created a paradox. Hence,

more and more research on cadaveric transplantation is being

done to meet the demand.

Legal importance and procedure

In India, before the laws for human organ transplantation were

not present, as early as 1962, even though it was being done, 7they were unregulated and organ trafficking was quite high.

Later, the Transplantation of Human Organs Act, 1994

(THOA) came into place which states that the donor can be a

deceased donor, who can be a brain dead or a cardiac dead 7 person, who can serve as a source for organ donation. This was

brought about by a few collective sates initially and later was

adopted to all the states with the exception of Andhra Pradesh

and Jammu and Kashmir. The law also states that the donor

should be a near relative, which is being used a s a loophole by

many doctors to illegally do transplantations from the poor to

the rich. There was a case back in 2004, where a doctor, a

nephrologist, who would procure the kidneys to the patients

through agents, who in turn go to the poor, fabricate documents

that the donors were far relatives or friends to the recipient and

would receive large amounts of money for it but the recipients

get charged triple or quadruple times the initial amount, 13making illegal profits, was later arrested and found guilty.

Many similar incidents kept happening everywhere, which led

to the exposure of the loopholes in the laws and due to the

insufficiencies in the effectiveness, applicability and effects of

the act , an amendment was proposed in 2009 by the states of

Goa, Himachal Pradesh and West Bengal, which was legally

amended in 2011 and the rules made clear in 2014, which is

now called the Transplantation of Human Organs and Tissues 7Act, 2014 (THOTA). In case of a brain stem death, it is

certified by a panel of medical experts comprising of four

members, namely a medical superintendent of the hospital, a

specialist appointed by him belonging to the same hospital, a

neurology specialist and the doctor who was in charge of the 5 patient. Then, confirmatory tests should be done with 6 hour

14interlude and later declared as brain dead. After the

declaration of brain stem death, the transplant coordinator asks

the deceased individuals' immediate related family members

for consent of organ transplantation. If they agree, then they are

made to sign a form documenting which organs they will be 6donating. Even if the deceased had committed to donate his or

her organs, a consent from their near relative has to be taken for 7lawful documentation. Organ extraction from expired donors

require a lot of hospitals and transplant teams should make sure

that the donated organs are as close a match to the recipient as

possible. In case of a MLC (Medico-Legal Case), a post-

mortem will be necessary and will require the police as well as 14 a Forensic expert. In case a person suffers severe brain injuries

but not brain dead, he or she can also consider to be an organ

donor if the family agrees to removal of life support system. In

this case, they wait for 2 to 5 minutes and when there is no more

circulation of blood, then he or she is pronounced dead and 5viable organs will be harvested. Just before removing the

organs from the donor, each one is cleared of blood by flushing

them with a specially prepared ice-cold preservation solution.

The organs are then placed in sterile containers, packed in wet

ice, and are transported to the recipients' transplant centre.

Different organs have different time ranges for preservation 6 before they become non-viable. Heart must be transplanted by

4 to 6 hours of retrieval from the donor, lung between 4 to 8

hours, liver between 12 to 15 hours, pancreas between 12 to 24

hours, intestines between 6 to 10 hours and lastly kidneys can 14be stored between 1 to 2 days. Now, the central government

has introduced network which keeps a check on the organ and

tissue removal and its storage throughout the country, known

as National Organ and Tissue Transplant Organisation

(NOTTO), which is further subdivided into 5 regional

networks, i.e. Regional Organ and Tissue Transplant

Organisations (ROTTO) and each region further comprising

of state networks, i.e. State Organ and Tissue Transplant

Organisations (SOTTO) to which every hospital in the state is

linked . NOTTO functions by maintaining national registries,

which include the organ transplantation registry, organ

donation registry, tissue registry and organ donor pledge

registry by which they keep a check on all the transplant

procedures occurring within the country and prevent any form 14of malpractice.

246


Complications

The most common complication is graft rejection by the

recipient body. This is due to incompatibility of the HLA

haplotypes of the donor tissue with that of recipient body. It can 9be host vs. graft or graft vs. host reaction. In host vs. graft ,

there can be hyper acute, acute or chronic. In hyper acute, the

rejection occurs within first 24 hours due to preexisting

antibodies against the donor antigens. In acute, it usually

occurs within the initial few weeks, where it is a cell mediated

immunological destruction of the donor tissue. In chronic, it 9occurs over many years. In graft vs. host type, antibodies

present on donor tissue proliferate and attack recipient body,

leading to clinical manifestations like rash, diarrhoea and 9jaundice, commonly seen in bone marrow transplants.

Another complication known to arise is ischaemia-reperfusion

injury. This happens due to reperfusion of an organ, which has

accumulated metabloites, which cause oxidative injury to

recipient tissues.

Ethical issues

There have been many issues regarding the concept of

presumed consent where, when a patient is brain dead,

irrespective of his family wishes, he becomes a candidate for

donating organs. It can only be opposed by that person when he

was in his usual healthy self before the unforetold incident.

This was being done in several countries in Asia and Europe, 8mainly in Spain and Singapore. There were no oppositions

from the factions of Christianity, Judaism and Islam. But there

were some people against it as they wanted an intact body

burial due to social, cultural and religious norms and beliefs 8and also considered this rule as a means for body snatching.

Also, in China, organs were being harvested from people who 8were issued a death warrant immediately after execution. The

next issue came with allocation of organs to people. In the

Unites States of America, they followed a criteria by the name

United Network of Organ Sharing (UNOS) which is based on

geographical area of the donor with respect to recipient, blood

group compatibility and a point system for the waiting list

candidates in which time of waiting, immunological

compatibility, age of recipient and medical urgency are 8compared. Generally, paediatric patients less than 11 years are

given most priority. Similarly, use of organs from foetuses, as

in cases from anencephaly also caused major ethical 8problems. Also due to the increasing demand for organs and

the supply not able to meet the needs, black market for organ

selling has become a very big business where the dealers

procure organs from unknown sources, mostly by illegal

means and malpractices in exchange for high monetary

benefit.

In India, organ donation rate is 0.36 per million, which is a very

11low value. This is due to lack of awareness regarding donation

of organs and transplantation, a major reason being associated

with various myths, which include; brain dead person is not

dead but still alive, diagnosis of brain death is very complex

and exorbitant, donation of organs after the same is not legal,

religious reasons, notions that if they donate an organ, they

might be born without the same organ when they are reborn in

another life and so on, which just proves on to say that very

little knowledge and awareness has been created regarding this 12 process.

CONCLUSION :

Cadaveric transplantation is still being researched for

shortening the gap between demand and harvest. Research is

being done to reduce the potential complications like using

combination therapy of immunosuppressants decreases the

chances for graft rejection. A recent study showed that the

solution to ischaemia-reperfusion injury is preconditioning of

the organ before surgery.2 Also, in recent study done in Japan,

in case where the waiting time for renal transplant patients is

more, extended hours hemodialysis in long term renal

transplant patients may improve transplant outcomes. Hence,

many techniques to improve procedure outcomes are being

done. People should be encouraged to donate organs for saving

the lives of others who very much require them.

REFERENCES:

1. Department of Health & Human Services. Organ and

tissue transplantation [Internet]. Better Health Channel.

Department of Health & Human Services; 2015 [cited

2021May16]. Available from:

https://www.betterhealth.vic.gov.au/health/ConditionsA

ndTreatments/organ-and-tissue-transplantation

2. Tavares-da-Silva E, Figueiredo A. Renal Procurement:

Techniques for Optimizing the Quality of the Graft in the

Cadaveric Setting [Internet]. Current urology reports.

U.S. National Library of Medicine; 2020 [cited


https://www.ncbi.nlm.nih.gov/pubmed/32166407

3. Yamazaki T, Shirai H, Yashima J, Tojimbara T. Successful

cadaveric kidney transplantation in an extended-hours

hemodialysis patient with long-term hemodialysis vintage

for 297 months [Internet]. Urology case reports. Elsevier;

2 0 2 0 [ c i t e d 2 0 2 1 M a y 1 6 ] . Av a i l a b l e f r o m :


4. Sade RM. Brain death, cardiac death, and the dead donor

rule [Internet]. Journal of the South Carolina Medical

Association (1975). U.S. National Library of Medicine;

2 0 11 [ c i t e d 2 0 2 1 M a y 1 6 ] . Av a i l a b l e f r o m :


2/

247


5. Saran J, Padubidri JR. Brain stem death - an overview

[Internet]. The Medico-legal journal. U.S. National

Library of Medicine; 2019 [cited 2021May16]. Available

from: https://www.ncbi.nlm.nih.gov/pubmed/30785835

6. Cadaver Organ Donation: The Biru Kumars Of India

[Internet]. Organ Donation India. 2015 [cited

2 0 2 1 M a y 1 6 ] . A v a i l a b l e f r o m :

h t t p s : / / w w w . o r g a n i n d i a . o r g / O R G A N -

DONATION/cadaver-organ-donation-the-biru-kumars-

of-india/

7. Sahay M. Transplantation of human organs and tissues

Act-“Simplified.” Indian Journal of Transplantation.

2018;12(2):84.

8. Abouna GM. Ethical issues in organ transplantation

[Internet]. Medical principles and practice : international

journal of the Kuwait University, Health Science Centre.

U.S. National Library of Medicine; 2003 [cited



9. Kloc M, Ghobrial RM. Chronic allograft rejection: A

significant hurdle to transplant success [Internet]. Burns

& trauma. BioMed Central; 2014 [cited 2021May16].

Available from:

h t t p s : / / w w w. n c b i . n l m . n i h . g o v / p m c / a r t i c l e s /

PMC4994504/

10. What Can Be Donated [Internet]. Organ Donor. 2020

[cited 2021May16]. Available from:

https://www.organdonor.gov/about/what.html

11. Palaniswamy V, Sadashivam S, Selvakumaran C, Jayabal

P, Ananth SR. Organ donation after brain death in India: A

trained intensivist is the key to success. Indian J Crit Care

Med. 2016;20(10):593-6.

12. Singh K. Expert blog: Myths associated with brain death

and organ donation in India [Internet]. Ndtv.com. 2017

[cited 2021 May 16]. Available from:

https://sites.ndtv.com/moretogive/expert-blog-myths-

associated-with-brain-death-and-organ-donation-in-

india-2072/

13. Mudur G. Kidney trade arrest exposes loopholes in India's

transplant laws. BMJ. 2004;328(7434):246.

14. FAQs: NOTTO [Internet]. Gov.in. [cited 2021 May 16].

Available from: https://notto.gov.in/faqs.htm

248


Review Article

INTRODUCTION :

Accreditation is the formal approval for a stated period of an

institution and its program by a recognised body after self-

review and external evaluation and based on predetermined (1)standards. Accreditation is not same as Regulation.

Regulation is a system of controlling institutions by rules, laws

or restrictions often made by government or its elected people

who get their power from the laws. In India MCI is a

regulatory body for medical profession which ensures entry

level standard of students, quality of education being

imparted, curriculum and its impact on society.

Accreditation has got its own objectives. Institutions know

about their strengths and weaknesses through an informed

review process. It understands the collegiality on the campus

and provides information to allocated resources in deficient

areas as well as to know areas of strength so that research and

development can be strengthened. It provides feedback upon

innovative pedagogy. It provides opportunity for institution to

work upon inter-university collaboration in research and

training inside country and outside both. It also provides a

platform for society which wants to know comparisons among

institutions available; reliable information on quality

education. It also informs employer about reliable institutions

about prospective campus recruitment as per their

(2)requirement. It also provides adequate information to

funding agencies for prospective collaborations having known

required availability of structure in organization. Accreditation

also provides characteristic of institution e.g. Tuberculosis

research centre of India. It clearly tells inside medical

circumference, it's a special institution for tuberculosis

research and care.

Many countries have established bodies responsible for

regulating the medical and other healthcare professions.

Examples include the General Medical Council, UK, the (3)Australian Medical Council & the Medical Council of India.

WHO and WFME strongly recommend accreditation of

medical education. But, there is no uniformity across the

countries. Some countries have regulation and accreditation

both while others have one of the two or none. Some countries

have well regulation for private institutions while others have

not.

This study mainly focuses at Indian context. NAAC is one of

the accrediting bodies and its accreditation gives many benefits

to institution or university. There are more than 400 medical (4)colleges in India and 950 universities. Accreditation is

something being newly adapted by universities. But there are

many organizations who don't know how to initiate the process


Dr. Vijay Pratap Singh,


Department of Physiotherapy, Kasturba Medical College,

Mangalore, Manipal Academy of Higher Education, Manipal

Contact : +91 89670-35789


KEYWORDS : Accreditation, Education, University, Health


ABSTRACT :

Accreditation of institutions and universities are important for visibility and showcase of quality. In India NAAC is one of the

accrediting agency which institutions aspire for. With diverse geography and limited resources all organizations are not aware of

how to make a roadmap to achieve accreditation. Institutional leaders have also different leadership styles. This study puts forward a

roadmap to initiate accreditation, team building and galvanize among a common goal even if institution heads or Deans adapt

different leadership styles.

1. Vijay Pratap Singh, Associate Professor, Department of Physiotherapy, Kasturba Medical College, Mangalore, Manipal Academy of Higher Education, Manipal

2. Bidita Khandelwal, Professor and Ex-Head, Associate Dean-Research, Department of Medicine, Sikkim Manipal Institute of Medical Sciences, Sikkim Manipal University, 5 Mile, Tadong,Gangtok-737102

3. Parmod Kumar Goyal, Professor and Head, Department of Forensic Medicine, Adesh Institute of Medical Sciences & Research Bathinda

Developing and building high performance teams to achieve Accreditation through different Leadership styles


249

and how such mammoth work can be accomplished. Faculties

in institution have reported that their Dean or leaders are of

different work style and its difficult to understand how leaders

of different styles can achieve it through team work, self-

review and external review. This study elaborates a step-by-

step process of achieving accreditation to enable institutions

and universities to achieve accreditation by simple steps of

team work even if Institution heads have different leadership

styles.

Approaches of Two Deans with different Leadership styles

:

Imagine a scenario where there are two medical universities

with two different styles of leaders. Dean A wants to assert a

personal management style and lead from front in achieving

NAAC accreditation. But he wants to keep a group of senior

faculties who would have an opportunity to galvanize along a

strong leader. Senior team will have freedom to work, put

forward their views but in line with Dean's goals. Non working

and ingratiated faculties of the group may be replaced.

Dean B wants to go by Laissez-faire style of leadership where

senior team takes over and works together to manage the

project and deliver the strategy. The team would report to the

Dean, but would bring all their creativity to the task and

execute it in their way. It was suggested that there would be

benefits to the team in terms of their own development, which

would aid the later delivery of the plan.

Dean A leadership style appears to be assertive leadership.

Assertive leaders are those who are convinced by their goal

setting and they stand for themselves and people around them

without being aggressive or passively accepting wrong.

Townend A. (2007) reported Assertive leaders are confident,

validate other's feelings, good listeners, problem-solving, and

know-how to manage others' feelings to persuade them to (5)understand the organizational goal. A recent study reported

that assertive leaders must also exercise some caution.

Assertive leaders are perceived as honest and integrated but (6)they are also perceived as aggressive.

Assertive leaders have to be very intelligent in the

communication. Dean must manage to give honest feedback.

Feedbacks can build a broken castle or destroy the strongest (7)castle. Sensitivity and privacy in giving feedback help both

classes of employees. Decision making is another crucial

thing. Here dean wants to galvanize senior members. In this

style members get a chance to criticize, and voice their

concerns to make better decisions emerge and at the same time

members feel accountable and empowered. Therefore.

Assertive leaders use this as an opportunity while making

decisions, they go by facts, analysis, and trends, and

consultations to reach a decision.

Dean B seemingly relates to Laissez-faire style of leadership.

This type of leadership is the opposite of authoritarian

leadership and autocratic style. Laissez-faire is a French word

that means 'let it be' or 'leave alone'. This style is delegative

kind of leadership. Here the leader believes in building a highly

capable team that often puts up the goal in front of the team but

leaves the team with their own devices. Leaders who subscribe

to such style do it based on trust and leader has always read that

the team is highly experienced, skilled, and motivated. The

leader intervenes minimum and allows members with freedom

of choice. There is a controversy that a leader does not

intervene and is absent from the work scene until the result is (8)achieved but it can sometimes lead to a mess.

After all, its individual choice and a consultant can only advise.

Other popular styles of leadership Dean may like are derived

from Goleman(2000) study; autocratic, authoritative,

pacesetting, democratic, coaching and affiliative. The

autocratic style is 'do as I say' and is a command and control

approach with almost no scope for followers to opine.

Authoritative leadership is visionary and 'follow me' style.

Unlike autocratic, the leader here explains its vision and keeps

followers energized and engaged. Pacesetting style is 'do as I

do'. Here leader leads by example but followers may get

fatigued. Democratic style depends on what do you think? It

consults and reaches to a shared objective. The coaching style

is mainly unlocking people's potential where they have low

confidence despite having talent or they need someone to show

some light. Whereas affiliative leadership is premised on

'people come first' approach. The success of this style depends

on attention and support to members by forming a meaningful (9)collaborative relationship.

For them to do this, pioneers inside associations need to have a

solid feeling of what their identity is, and what driving with

uprightness intends to them. This requires bringing their "best

selves" to their initiative, monitoring the effect of their conduct

on others inside and remotely to the association. This not only

helps to achieve the goal but prepares a future leader inside the

organization. Next time, organization need not hire a leader (10)from outside instead it can rely on its own pool of leaders.

The concerns are both leadership as well as management. It's a

blend of issues. There are two types of issues that have surfaced

after internal and external reviews. Dean has classified them

under two headings. One set of issues are infrastructural,

logistic, information technology (IT), and clerical. Whereas

other sets of issues are motivation among faculty members,

lack of awareness about accreditation, resistance to moving out

of comfort zone, overshooting time frame or non-compliance,

and inability to bring junior faculties in a loop. Dean realizes

that the first set of issues are management task and second is

250

(11)leadership demands. He thinks of bringing a competent

human resource manager (HR) for managerial tasks while

leadership issues he wishes to carry on his own with the help of

senior faculties who have galvanized around him and are ready

to take the vision forward.

Dean has voiced his concern that unless both the works go

parallel and in tandem, goals can not be achieved. There were a

lot of publications made by faculties but it could not be brought

in to one data set when it was sent to the external review. When

Dean went into depth of such an issue he found trivial things

and could have been solved. It was clerical support, issues of

printers and cartridges supply, formatting, and IT support.

DISCUSSION :

Dean after suggestions from other senior faculties of college

decided to handle the second set of issues by themselves. He

believed that those were leadership issues and can be solved by

persuasion and gaining the confidence of non-contributors.

When Dean enquired from junior faculties as to why they are

not cooperating with some Heads of departments. Various

comments came out which were seemingly true on further

triangulation. Some junior faculties of a department pointed

out that their HOD delegates all surgeries and operation

theatre (OT) works to them while HOD never takes up any

surgery. He is not available on the days of his call-duty and

absconds during important works. There is no encouragement

from HOD for any work or publication by juniors while he

keeps nit-picking faults and is trivial. Juniors of the ENT

department felt that they are primarily physicians and research

is not their primary work. They looked very supportive to their

HOD and their track record revealed that even HOD has got no

publication on record and gives the least important to research

while he is a good clinician. Juniors of one more department

from clinical subjects revealed that teaching of students is not

required and students are supposed to learn on their own and

from clinical experiences of ward posting. One pre-clinical

department reported that they are underestimated by clinical

departments and they wanted to implement horizontal and

vertical integration of teaching but got no support from allied

departments. Dean found that this department has got the best

track records of teaching and is eager to take up teaching

challenges. Department of community medicine reflected that

researches and publications are the only ways to showcase the

brand visibility of colleges. Nobody bothers how teaching is

happening but a good paper makes them visible at the

international level. Some inquiries revealed that teaching in

the community medicine department is most lackadaisical and

students are overloaded with research. Often they are

intimidated if they do not carry out research responsibilities

and are judged based on publications only. After such feedback

Dean concluded that faculty development programs are

important where thrust will be to make faculties understand

teaching, research and clinics are three wheels of the same cart

which must move together at the same speed. Accelerating one

by decelerating others will fail institutional vision. Dean also

figured out external experts for FDP and briefed them

problems of different departments, where they felt self

internalization tasks to be given during workshops and groups

will be mixed of each thinking. One who thinks research is

important, others who think teaching is important, and the who

thinks clinical work is only work of a doctor should

intermingle and sit in one group and reflect. It may have some

argument initially but Dean decided to preside personally such

meetings as 'Guide on the side' to moderate and boil down to

the vision of the institution and work together and give equal (2,12)importance to each important work.

Change involves humans and their reactions. People just don't

accept change without a strong purpose. Things involved in

managing change would range from decision making,

problem-solving, handling disputes, consultations, hierarchy,

and mutual respect to resource allocation. In this context, there (13)are several levels of change. Strategic changes are to bring

change in organizational vision, mission, and objectives by

making senior faculties and all levels to understand the

importance of accreditation and working as a group. Structural

changes like pending promotions and bringing a change of

some head of departments who are in place for a very long time

as per the policy and have brought no change but second-in-

line is more driving, capable, and enthusiast. Change in the

process of delivering the outcome of work at the right time and

showing compliance to reviews. Bringing personnel and

technological changes with the inclusion of skilled

information technologists who can handle data and solve

problems of departments with newer methods of technology.

Having an app in the place where all data can be entered and

generated centrally at any point in time rather than floating

notices each time when data is required.

But, Dean must approach it with reactions of people in mind.

The leader here dean is responsible to get the vision across for

change and change for good. The need for change must be

realized across all levels of stakeholders. Dean can have a

before-hand preparation with some tools available for

managing the change. It will require the first attitudes and

behaviors of different people at all levels and in each area.

Dean may take the help of some trusted people but not many as

the thought may leak and resistances may start developing

before time. These tools are 'People chart' and Force field (14)analysis. These tools have a grid where analysis can be jotted

down for clarity.

251

Dean may call all stakeholders meeting in an auditorium and

explain his vision once before beginning the process. This will

gain the confidence of many if not all as stakeholders would be

aware that its an informed change. While Dean can use a

simple slide as below in Figure 3 for the sake of understanding

of all stakeholders.

Next, Dean will face challenges on the ground when the

change will start taking place. To tackle the resistance of

change and still manage people, it will be a good idea to have ( 15)Blake and Mouton's (1985) grid in mind .

There are four approaches in this tool to manage conflict. The

right lower down is Turtle approach, if task and relationship

with the person are both of low priority then the leader can be in

withdrawal mode and the issue is not worth fighting. The

country club management is accommodating, Teddy bear

model, where a person is of high concern and is not dispensable

while the task is trivial. Leaders should comfort the person

involved and keep him on the boat. The left lower grid is a

Shark model, authority obedience management where the task

is of very high concern and relationship is not very important.

Leader can get it done in an authoritative style by delegating

the work as, must be done. The left side upper quadrant is a

team management quadrant where the owl approach works.

Here relationship and task both are of great importance. Leader

must have more resilience to person, persuasive, and get the

work done without being offended. The middle area is a fox

area, where compromise and negotiation works. It's a moderate

path. Saying that a leader can adopt any one of the models out

of five quadrants is not a solution rather a blended approach

seeing what is important in each context, a leader may decide

the course of action.

CONCLUSION:

Now, there is a clear road map, a vision, a galvanized group of

faculties, people chart and force field analysis, and igniting

presentation to begin and a Blake-Mounton grid to manage

conflicts. These are enough weapons in the armamentarium to

begin the change. Dean may adapt here Kotter's(1996) eight-

stage model to start the change . Establish a sense of urgency by

having all people meet with a simple presentation like Fig.3.

This is an example of how the dean may choose drivers of

change, what is involved in change, what are tools to manage

and sustain change.

REFERENCES :

1. Greenfield D, Braithwaite J. Health sector accreditation

research: A systematic review. Int J Qual Health Care.

2008 Jul 1;20:172–83.

2. Hinchcliff R, Greenfield D, Moldovan M, Westbrook JI,

Pawsey M, Mumford V, et al. Narrative synthesis of health

service accreditation literature. BMJ Qual Saf. 2012

Dec;21(12):979–91.

3. International Association of Medical Regulatory

Authorities - About Us [Internet]. [cited 2020 Sep 14].

Available from: https://www.iamra.com/

4. (No Title) [Internet]. [cited 2020 Sep 16]. Available from:

https://www.ugc.ac.in/oldpdf/Consolidated list of All

Universities.pdf

5. A. T. No Title [Internet]. 1st ed. A T, editor. London:

Palgrave Macmillan; 2007. 212–217 p. Available from:

https://link.springer.com/chapter/10.1057%2F97802305

82019_23#citeas

6. Mumford V, Forde K, Greenfield D, Hinchcliff R,

252

Person/Group

Figure 1 : People chart grid

Importance Direct influence

Indirect influence

Positive forces

1-Reason-

1-Reason-

2-Reason-

2-Reason-

Negative forces

Figure 2 : Force field analysis

Figure 3 : A simplified vision of Dean for presentation

Figure 4: Blake and Mouton's (1985)

Braithwaite J. Health services accreditation: what is the

evidence that the benefits justify the costs? Int J Qual

H e a l c a r e J I n t S o c Q u a l H e a l C a r e . 2 0 1 3

Oct;25(5):606–20.

7. Carman AL, Scutchfield FD, McGladrey ML, Vorbeck J.

Pursuing Public Health Accreditation: A Focus on HOW.

J Public Health Manag Pract. 2019;25(5):431–9.

8. The 7 Most Common Leadership Styles (and How to Find

Your Own) [Internet]. [cited 2020 Aug 18]. Available

f rom: h t tps : / /www.amer icanexpress . com/en-

us/business/trends-and-insights/articles/the-7-most-

common-leadership-styles-and-how-to-find-your-own/

9. Goleman D, Boyatzis R. Social intelligence and the

biology of leadership. Harv Bus Rev. 2008 Sep;86(9):74-

81,136.

10. Greenfield D, Debono D, Hogden A, Hinchcliff R,

Mumford V, Pawsey M, et al. Examining challenges to

reliability of health service accreditation during a period

of healthcare reform in Australia. J Health Organ Manag.

2015;29(7):912–24.

11. Toor S-R, Ofori G. Leadership versus Management: How

They Are Different, and Why. Leadersh Manag Eng. 2008

Apr 1;8.

12. Greenfield D, Lawrence SA, Kellner A, Townsend K,

Wilkinson A. Health service accreditation stimulating

change in clinical care and human resource management

processes: A study of 311 Australian hospitals. Health

Policy. 2019 Jul;123(7):661–5.

13. Frich JC, Brewster AL, Cherlin EJ, Bradley EH.

Leadership development programs for physicians: a

sys temat ic rev iew. J Gen In te rn Med. 2015

May;30(5):656–74.

14. Bozak MG. Using Lewin's force field analysis in

implementing a nursing information system. Comput

Inform Nurs. 2003;21(2):80–7.

15. The Blake Mouton Manager ia l Gr id - From

MindTools.com [Internet]. [cited 2020 Aug 21]. Available

from:

https://www.mindtools.com/pages/article/newLDR_73.

htm

253

254

Scientific Correspondence


1. Mahipal Singh Sankhla, Research Scholar, Department of Forensic Science, School of Basic and Applied Sciences,

Galgotias University, Greater Noida, U.P. India.

2. Rajeev Kumar, Associate Professor, Department of Forensic Science, School of Basic and Applied Sciences, Galgotias

University, Greater Noida, U.P. India.

3. Lalit Prasad, Associate Professor, Department of Chemistry, School of Basic and Applied Sciences, Galgotais University,

Greater Noida, U.P. India.

Key words: Key-Words: - Zinc, Yamuna River, Water, Toxicity, Human, etc.


Dr. Rajeev Kumar,


Department of Forensic Science, School of Basic and Applied

Sciences, Galgotias University, Greater Noida.

Contact : +91 9411923188


Article History :





INTRODUCTION :

Water is vital for human existence. There's no life without

water. To survive man has to go to several extents to search for

water. Water can be obtained from oceans, rain, streams, lakes, [1]glacier, or underground . Water is essential for life and life

without it, as we know it would have not been possible. Though

its precious it brings disease and disabilities to the public.

Water already contains minerals and organisms that may cause

harm to humans as well as animals because of their [2]concentration and contents . Rivers are a vital source for

human civilizations as they meet water demand for rivers are

important resources for human various uses apart from

supporting flora and fauna, improving aesthetic and landscape

quality, moderating climate and providing resources for

[3]hydropower .

The river Yamuna passes through a distance of about 1370 km

in the basic from Saharanpur district of Uttar Pradesh to the

flowing together with river Ganga at Prayagraj. The major

streams of the river are Tons, Betwa, Chambal, Ken, and

Sindh, and these altogether contribute 70.9% of the catchment

area and sense of balance 29.1% is the direct drainage of main

River and smaller streams. Based on the area, the catchment

basin of Yamuna volumes to 40.2% of the Ganga Basin and [4]10.7% of the nation . The Yamuna river is one of the most

polluted rivers in India. The capital of the nation, Delhi is the

major contributor to pollution in the Yamuna River, followed [5]by Agra and Mathura .

Zinc is found in the physical background on earth's crust and

Estimation of Zinc Concentration in Yamuna River (Delhi) Water Due to Climatic Changes

ABSTRACT :

Introduction: Water is increasingly becoming an unusual resource, both in the relation to quantity and quality. Yamuna river water

may become contaminated by the accumulation of Zinc through emissions from the rapidly expanding industrial areas, disposal of

high element wastes, fertilizers, animal manures, sewage sludge, pesticides, and wastewater irrigation.

Material and Methods: Samples of water were collected from the five different sampling sites. Samples collected in the duration

of 8 months from January to August with the gap of 20-25 days keeping the climatic change as a major parameter. The

concentration of Zinc (Zn) in water from River Yamuna, Delhi was determined by Inductively Coupled Plasma Mass Spectrometry

(ICP-MS).

Result and Discussion: It was found that the concentration of zinc (Zn) is higher than the permissible limits of WHO and lower

than permissible limits only in the month of August. This can be established that the concentration increases with rising

temperature and reducing humidity.

Conclusions: It is universally-known that zinc is majorly toxic in nature and humans & animals. Exposure of zinc through water

may produce chronic toxicity that could be quite harmful to human life.

255

can consequently enter water sources through natural

procedures and the example of sometimes heavy rains and [6]water can leach zinc out of natural sources . Zinc

insufficiently has been recognized by several experts as an

important public health issue, especially in developing

countries. The prevalence and clinical consequences of zinc

deficiency on growth delay, diarrhea, pneumonia, disturbed

neuropsychological performance, and abnormalities of fetal [7]development .

Zinc has naturally originated either from geological and

chemical variance or tailings site. Zinc indicates an

anthropogenic source due to the sulfide minerals oxidation in

mine waste disposal sites. Over the past year's environmental

principles have developed more stringent, necessitating an

enhanced better quality of removing toxic waste for treatment

and zinc material to the defense of the environment, human [8]health, and aquatic life . The zinc (Zn) enters the environment

through aquatic life systems and plants and animals [9]surrounding the river . Zinc is a very communal pollutant in

the environment; its occurrence may be impeding the water's

ecological environment. Consequently, much study effort has

been directed toward the spreading of Zn in the water

environment. Anthropogenic actions counting municipal

wastewater releases, coal-burning power plants; industrial

methods involving metals; and the atmospheric outcome are [10]the main source of Zn contamination . Extreme discharge of

zinc contaminates the surface water and subsurface

environment and contribute to groundwater pollution.

Groundwater is often extremely polluted near mines of sulfide [11]minerals .

In natural waters, zinc can be found in some chemical methods,

such as hydrated ions, metal-inorganic complexes, or metal-

organic complexes. Hydrated zinc cations may be hydrolyzed

to form zinc hydroxide or zinc oxide. In anaerobic [12]environments, Zinc sulfide may be formed .

The environmental contaminations by the toxic substances are

increasing which is causing a major threat to the local users. A

wide range of pollutants are endlessly introduced into the

aquatic environment mainly due to enlarged industrialization,

technological growth, increasing human populace and misuse

of agricultural, natural resources, and domestic wastes run-off.

Among these pollutants, heavy metals constitute one of the

most unsafe groups because of their persistent toxicity, nature,

and tendency to gather in organisms and undergo food chain [13]amplification, and more still, they are non-degradable .

Polluted water of Yamuna River is a matter of concern as the

population of Delhi is dependent on the water of Yamuna. The

hazard of biomagnification and bioaccumulation of the Zn [14]causes extreme harm to human health and welfare . Citizens

might experience during disease on drinking water with a high

concentration of heavy metals. They might contain

physiological effect as on kidney, digestive system, circulatory

system, nervous system, etc. different additional organs and [15]diverse systems of the body .

This research study noted that dissolved zinc concentration

was more in the rise in environmental temperature and

humidity. Zinc toxicity has established to be a major risk and

there are several health threats related to humans and animals.

The toxic effects of zinc, even though they do not have any

organic role, persist current in approximately or the other form

damaging for the people's body and its suitable working.

Consequently, the present study aimed to measure the

concentration of zinc from the Yamuna River climate changes

to appreciate the change in dissolved zinc concentrations.


Samples Collection :The water samples were collected from

the five different Sites of Yamuna River in Delhi, India.

Site 1: Okhala Bird Sanctuary

Site 2: Kalindi Kunj Ghat

Site 3: Okhala Barrage

Site 4: Yamuna Bridge

Site 5: Yamuna Bank

All sampling sites were used for farming and drinking purpose.

Water samples were collected for analysis from each Site. All

samples were collected in 1.5 liters of sterile polyethylene

bottles, which were pre-washed with 10% nitric acid and de-

ionized water. Before sampling, the bottles were rinsed at least

three times with water from the sampling site. The bottles were

immersed to about 20 cm below the water surface to prevent

contamination of trace elements from the air also collected for

analysis from each site.

All water samples were immediately brought to the laboratory

where they filtered through Whatman No.41 (0.45 μm pore

size) filter paper. The samples were acidified with 2 ml

concentrated Nitric acid to prevent precipitation of Zinc,

reduce adsorption of the analyses onto the walls of containers

and to avoid microbial activity, then water samples were stored [16]at 4°C until the analysis .

The concentration of Zinc (Zn) in water collected in every 20-

25 days during four months from January to August 2019 from

Yamuna river, Delhi were Zinc (Zn) measured and compared

with the permissible limits as set by the World Health

Organization (WHO).

Instrumentation

The concentrations of heavy metals were determined in all

samples by Inductively Coupled Plasma Mass Spectrometry


256

(ICP-MS). It is a standard laboratory analytical tool for metal

analysis.

RESULTS & DISCUSSION :

The concentration of Zinc in Water samples :

In the month of January, the concentration of zinc (Zn) in water

samples was 5.4 ppm followed by a slight decrease in February

concentration was 5.7 ppm whereas there was an increase in

the March 6.0 and increases in the month of April 6.2 ppm and

further it increases in the month of May, the concentration of

zinc in water was 7.0 ppm and decrease in the month of June

5.3 ppm and July 5.0 ppm or month of august 4.5 ppm

According to the WHO guidelines, the maximum permissible

limit of zinc is 5.00ppm. We found that the concentration of

zinc is very high as compared to the permissible limit, and

almost 1.4 times higher than the WHO limit in the month of

May and month of August concertation is lower than WHO

Permissible Limit. There were significant differences between

the concentration of WHO limit and Zn levels measured during

these months. On comparison of the concentration of Zn

among the different months, we found significant differences

in concentration of Zn with temperature and humidity result

shows that in the month of April or May can be established that

the concentration increases with rising temperature and

reducing humidity (Figure 1)

CONCLUSION :

The concentrations of zinc (Zn) have already crossed or are at

the borderline of the permissible limit as declared by the World

Health Organization in most river bodies. Although some

previous data suggests that somewhere the elemental

concentrations are still below the permissible limit. Human

health is directly affected by the consumption of polluted

water, sediment, fishes, fruits, vegetables, plants, etc. Studies

show that Industrial wastes, Sewage, Natural source,

anthropogenic source, and Agricultural actions that have

contaminated dangerous and toxic constituents in the Yamuna

River water thereby, led to pollution of drinking water in near

areas. Diseases like Neurotoxicity, Carcinogenicity related to

contamination of Zinc in water in such areas. The practice of

trace element detection should be continued to lower the

possible consumption of contaminated eatables. People should

be aware of the hazardous effects of the consumption of

polluted water and eatables. On account of the research of the

drinking water samples, contain Heavy metal concentration

more than the admissible and desirable levels (WHO). Most of

the water samples were highly contaminated, which are not

possible to use for drinking purposes.

REFERENCES :

1. Chege MW, Hashim NO, Merenga AS, Tschiersch J. Lead

contamination of traditional hand-dug wells in parts of

Kwale County, Kenya. International Journal of Physical

Sciences. 2013 May 9;8(17):835-9.

2. Fagoyinbo CV, Dairo VA. Groundwater Contamination

and Effective Ways of Rectification. International Journal

of Information Research and Review. 2016;3:1749-56.

3. Sharma MP, Singal SK, Patra S. Water quality profile of

Yamuna river, India. Hydro Nepal: Journal of Water,

Energy and Environment. 2008;3:19-24.

4. Central Water Commission, Yamuna Basin Organization,

New Delhi, (2007); 1-127.

5. Misra AK. A river about to die: Yamuna. Journal of water

resource and protection. (2010);1, 2(5):489.

6. Sankhla MS, Kumari M, Nandan M, Kumar R, Agrawal P.

Heavy metals contamination in water and their hazardous

effect on human health-a review. Int. J. Curr. Microbiol.

App. Sci (2016). 22;5(10):759-66. Bhowmik D, Chiranjib

KP, Kumar S. A potential medicinal importance of zinc in

human health and chronic. Int J Pharm. (2010);1(1):05-11.

8. Sankhla MS, Kumar R, Prasad L. Zinc Impurity in

Drinking Water and Its Toxic Effect on Human Health.

Indian Internet Journal of Forensic Medicine &

Toxicology. 2019;17(4):84-7.

9. Malik D, Singh S, Thakur J, Singh RK, Kaur A, Nijhawan

S. Heavy metal pollution of the Yamuna River: An

introspection. Int. J. Curr. Microbiol. App. Sci.

2014;3(10):856-63.

10. Toli K, Misailidis P, Godelitsas A. Distribution of heavy

metals in the aquatic environment of the Kerkini lake (N.

Greece): An exploratory study. Fresenius Environmental

Bulletin. (1997);6:605-10.

11. Ghadimi F, Ghomi M, Hajati A. Identification of

groundwater contamination sources of Lakan lead and

zinc mine, Khomain, Iran. Journal of Mining and

Figure 1: Climatic changes and Concertation of Zinc in water.


257

Environment. 2012;3(2):121-34.

12. Callahan MA. Water-related environmental fate of 129

priority pollutants. Office of Water Planning and

Standards, Office of Water and Waste Management, US

Environmental Protection Agency; (1979); (1).

13. USGAO, Health Effect of lead in drinking water. U.S.

General Accounting Office reports (2000); (1).

14. Sankhla MS, Kumari M, Sharma K, Kushwah RS, Kumar

R. Heavy metal pollution of Holy River Ganga: A review.

Int. J. Res. 2018 Jan;5(1):421-36.

15. Parihar K, Sankhla MS, Kumar R. Water Quality Status of

Yamuna River and its Toxic Effects on Humans. (2019); 6

(1):597-601.

16. Sankhla MS, Kumar R, Biswas A. Dynamic nature of

heavy metal toxicity in water and sediments of Ayad River

with climatic change. Int J Hydro. 2019;3(5):339-43.


Scientific Correspondence


Dr Parmod Kumar Goyal,

Professor and Head,

Department of Forensic Medicine, Adesh Institute of Medical

Sciences and Research, Bathinda

Contact : +91-9876005211


KEYWORDS : Graduate Medical Education Regulations 1997, 2019, Forensic Medicine


1. Parmod Kumar Goyal, Professor and Head, Department of Forensic Medicine, Adesh Institute of Medical Sciences and

Research, Bathinda

2. Monika Gupta, Professor and Head, Department of Anatomy, Adesh Institute of Medical Sciences and Research, Bathinda

Differences between Graduate Medical Education Regulations 1997 (GMER 1997)

and Graduate Medical Education Regulations 2019 (GMER 2019) in respect to

teaching and assessment of subject of Forensic Medicine and Toxicology


258

S.No

1

2

3

4

40 100

Salient Feature GMER 1997 GMER 2019

Starting of Teaching and assessment

University summative examination

Marks for the theory paper

Pattern of Theory Paper

ndIn 2 professional MBBS rd th(3 to 5 semester)

ndShall start in 2 phase and rdwill continue in 3 phase

ndAt the end of 2 Professional MBBS

along with Pathology. Microbiology

and Pharmacology

rdat the end of 3 phase along with

ophthalmology, community medicine

and otorhinolaryngology

One paper with Two Parts I & II

of 20 marks each

One paper with Two parts I & II of

50 marks each

Each Part has one long question of

5 marks and rest short questions varying

from 2-3 marks*

Some Universities do have MCQ

Part I shall consists of MCQ. But MCQs shall be accorded a weightage of not more than 20% of the total theory marks. That means in Forensic Medicine we can have MCQ of 20 marks in the form of 20 MCQ of one mark each or 10 MCQ of 2 marks each. At our university, we have decided to keep 10 MCQ of one mark each only.One Structured Scenario based long question-10 marks, Six questions of 5 marks each*

Part II shall consist of two structured scenario based Long Questions of 10 marks each, Six questions of 5 marks each*MCQ shall preferably be scenario and image based*

All Questions shall preferably be of higher thinking order instead of simple recall based (Application/Analysis/Synthesis /Evaluation as per Bloom taxonomy)

259

Usually consisted of Hyothetical writing

of postmortem and injury report followed

by viva of 15 marks, 10 spots of one mark

each, Grand Viva and Record book

assessment*

Shall consists of documentation and

certification of trauma (living and dead),

diagnosis and certification of death,

l e g a l d o c u m e n t a t i o n r e l a t e d t o

emergency cases, certification of age

estimation, certification of sexual assault

v i c t i m / a c c u s e d , e s t a b l i s h i n g

communication in medicolegal cases

with police, public health authorities and

o t h e r c o n c e r n e d d e p a r t m e n t s ,

Spotting/Objective Structured Practical

Examination (OSPE)

Viva marks added in Theory No Viva marks as such

10 for Theory, 10 for Practical 100 for Theory, 100 for Practical

Three Class Tests,

One Send Up,

10 % marks for Attendance,

10 % marks for Extracurricular

performance

Internal Assessment will include:

(a) Written tests comprising of short

n o t e s a n d c r e a t i v e w r i t i n g

experiences,

(b) OSCE based clinical scenarios /

viva voce.

Eligibility to appear for

University Examinations

in respect of Attendance

ATTENDANCE: 75% attendance in a

subject for appearing in the examination

is compulsory inclusive of attendance in

non-lecture teaching i.e. seminars, group

discussions, tutorials, demonstrations,

practicals, hospital (Teritary Secondary,

Primary) posting and bed side clinics

etc.”

Attendance requirements are 75% in

theory and 80% in ractical /clinical for

eligibility to appear for the examinations

in that subject. In subjects that are taught

in more than one phase – the learner must

have 75% attendance in theory and 80%

in practical in each phase of instruction

in that subject. 75% attendance in

Professional Development Programme

(AETCOM Module) is required for

e l i g i b i l i t y t o a p p e a r f o r fi n a l

examination in each professional year.

Marks for the Practical paper

Pattern of Practical Paper

Viva marks added in

Internal Assessment marks

Calculation of Internal Assessment (IA) marks

S.No

5

6

7

8

9

10


Marks=30 Marks=100


260

Minimum Number of IA

Tests to be conducted(i) It shall be based on day to day

assessment ( see note), evaluation of

student assignment, preparation for

seminar, clinical case presentation etc.:

(ii) Regular periodical examinations

shall be conducted throughout the

course. The questions of number of

examinations is left to the institution:

(iii) Day to day records should be given

importance during internal assessment :

( iv ) Weigh tage fo r the in te rna l

assessment shall be 20% of the total

marks in each subject

Regular periodic examinations shall be

conducted throughout the course. There

shall be no less than three internal

assessment examinations

the internal assessment must be done in

Phase II and Phase III contribute

proportionately to final assessment.

Eligibility to appear for

University

Examinations in respect

of Internal Assessment

student must secure atleast 35% marks

of the total marks fixed for internal

assessment

Learners must secure at least 50%

marks of the total marks (combined in

theory and practical and not less than 40

% marks in theory and practical

separately Internal assessment marks

will reflect as separate head of passing

at the summative examination.

Criteria for passing

in a subjecta candidate must obtain 50% in aggregate

with a minimum of 50% in Theory

including orals and minimum of 50% in

Practicals.

Aggregate means Theory + viva+

practical+ Internal Assessment marks

University Examination:

Mandatory 50% marks

separately in theory and

practical (practical = practical/

clinical + viva)

Grace Marks The grace marks up to a maximum of five

marks may be awarded at the discretion

of the University to a student who has

failed only in one subject but has passed

in all other subjects

The grace marks up to a maximum of five marks may be awarded at the discretion of the University to a learner for clearing the examination as a whole but not for clearing a subject resulting in exemption.

Log Book No such requirementMandatory Requirement.

Day to day records and log book

(including required skill certifications)

should be given importance in internal

assessment.

Internal assessment should be based on

competencies and skills.

S.No

11

12

13

14

15



19

20

Number of Teaching hours 100125 divided as 50 hours in Phase II and

75 Hours in Phase III

Methods of Teaching Didactic lectures should not exceed one

third of the time schedule. two third

schedule should include practicals,

clinicals or/and group discussions.

Learning process should include living

experiences, problem oriented approach,

case studies and community health care

activities.

Didactic lectures shall not exceed one hird of the schedule; two third of the schedule shall include interactive sessions, practicals, clinical or/and group iscussions. The learning process should include clinical experiences, problem oriented approach, case studies and community health care activities. Greater emphasis is to be laid on hands-on training, symposia, seminars, small group discussions, problem-oriented and problem-based discussions and self-directed learning. Learners must be encouraged to take active part in and shared responsibility for their learning

21 SDL as method

of teachingNot mentioned

5 hours each are specifically earmarked for SDL in Phase II and Phase III part I

22 Integration Department shall provide an integrated

approach towards allied disciplines

like Pathology, Radiology, Forensic

Sciences, Hospital Administration etc. to

impart training regarding medicolegal

responsibilities of physicians at all levels

of health care. Integration with relevant

disciplines will provide scientific

basis of clinical toxicology e.g. medicine,

pharmacology etc.

Integration must be horizontal (i.e.

across disciplines in a given phase of the

c o u r s e ) a n d v e r t i c a l ( a c r o s s

different phases of the course). As far as

p o s s i b l e , i t i s d e s i r a b l e t h a t

eaching/learning occurs in each phase

through study of organ systems or

disease blocks in order to align the

learning process. Clinical cases must be

used to integrate and link learning across

disciplines.

The teaching should be aligned and

integrated horizontally and vertically

recognizing the importance of medico-

legal, ethical and toxicological issues as

they relate to the practice of medicine.

S.No

16

17

18


Record Book Required Required

Number of examiners

during Practical for

150 MBBS candidates

Ranged from 4-6 but usually 4.

Two external and two internal4 for 100 MBBS candidates

Where candidates appearing are more

than 100, two additional examiners (one

external & one internal) for every

additional 50 or part there of candidates

appearing, be appointed.

Eligibility as Examiner Associate Professor and above Assistant Professor with 4 years of

teaching experience as Assistant

Professor can be appointed as examiner

261


262

S.No

23

24

25


Attitude, Ethics and Communication (Aetcom) Module

No formal Teaching At least one question in each paper of the

c l in ica l spec ia l t i es should tes t

knowledge - competencies acquired

during the professional development

programme (AETCOM module); Skills

competencies acquired during the

Professional Development programme

(AETCOM module) must be tested

during clinical, practical and viva.**

Limit of Teaching

Foundation Course

Observation of Autopsy cases

ndTo 2 Professional MBBS and optional postings in Internship

Not there

Not specifically mentioned

With Aetcom, we can start teaching from Phase I till internship.

One month foundation course has specific skill component 2 F as “Documentation”

FM 14.15 specifically mentions that Conduct & prepare post-mortem examination report of varied etiologies (at least 15) in a simulated/ supervised environment

*Distribution of marks may vary slightly from University to University

** Aetcom Module is a good opportunity for the faculty of forensic medicine as many topics directly relate to our branch so we

must grab this opportunity and own it. It will definitely increase the importance of the subject of forensic medicine. Following

Modules can be taught by faculty of forensic medicine :

Module 2.7 : Case studies on autonomy and decision making

Module 3.4 : Case studies in bioethics-confidentiality

Module 4.2: Case studies in medico-legal and ethical Situations

Module 4.3: Case studies in medico-legal and ethical Situations

Module 4.9: Medical Negligence

REFERENCES:

1. Medical Council of India (MCI). Competency Based Undergraduate Curriculum for the Indian Medical Graduate. Vol. 1.

MCI; Medical Council of India (MCI); 2018. p. 28-258. Available from:

https://www.nmc.org.in/wp-content/uploads/2020/01/UG-Curriculum-Vol-I-III.pdf. [Last accessed on 2021 August 30].

2. Medical Council of India (MCI). Aetcom Booklet Available from:

https://www.nmc.org.in/information-desk/for-colleges/ug-curriculum/[Last accessed on 2021 August 30].

3. Medical Council of India (MCI). Skill Training Module Booklet Available from:

https://www.nmc.org.in/information-desk/for-colleges/ug-curriculum/[Last accessed on 2021 August 30]

4. Regulations on Graduate Medical Education (Amendment) 2019. Available from:

https://egazette.nic.in/WriteReadData/2019/213805.pdf[Last accessed on 2021 August 30]


INSTRUCTIONS TO AUTHORS

•Unpublished, Ethical, Un-Plagiarised original manuscript written in English should be sent to: Dr. Parmod Kumar Goyal,

Editor-in-Chief, Journal of Punjab Academy of Forensic Medicine and Toxicology by email at:

[email protected]

•Images (Good quality) should be sent separately in JPEG format.

•References should be in Vancouver Style only.

The Publication Particulars

The JPAFMAT is the official publication of the Punjab Academy of Forensic Medicine & Toxicology, published since 2001.

The Contents of the Journal

The journal accepts a range of articles of interest, under several feature sections as follows:

Original Papers: Includes conventional observational and experimental research.

Commentary: Intended for Reviews, Case Reports, Preliminary Report and Scientific Correspondences.

Letter to the Editor

Designed to be an avenue for dialogue between the authors of the papers published in the journal and the readers restricted to the

options expressing reviews, criticisms etc. It could also publish letters on behalf of the current affairs in the field of Forensic

Medicine in the country.

Editorial

Intended as a platform, for the Editor-in-Chief and for others with a keen interest in forensic medicine that wished to comment on the

current affairs.

Special Features

In the History of Indian Forensic Medicine, Book Review, Abstracts, Announcement etc, which appear frequently,

but not necessarily in every issue.

News and Notes

Intended for providing information of members and activities of the Academy and other such other organizations affiliated to the

Academy may appear frequently and not in every issue.

General Principles

The text of observational and experimental articles is usually (but not necessarily) divided into the following sections: Introduction,

Methods, Results, and Discussion. This so-called “IMRAD” structure is not an arbitrary publication format but rather a direct

reflection of the process of scientific discovery. Long articles may need subheadings within some sections (especially Results and

Discussion) to clarify their content. Other types of articles, such as case reports, reviews, and editorials, probably need to be

formatted differently. Electronic formats have created opportunities for adding details or whole sections, layering information,

cross linking or extracting portions of articles, and the like only in the electronic version. Double spacing all portions of the

manuscript— including the title page, abstract, text, acknowledgments, references, individual tables, and legends—and generous

margins make it possible for editors and reviewers to edit the text line by line and add comments and queries directly on the paper

copy. If manuscripts are submitted electronically, the files should be double-spaced to facilitate printing for reviewing and editing.

Authors should number all of the pages of the manuscript consecutively, beginning with the title page, to facilitate the editorial

process.

International Uniform Requirements

Please visit http://www.icmje.org/ for detailed instructions for manuscript submission.

Note : Manuscript handling charges Rs. 1500/- to be paid after acceptance for Indian Authors.

J Punjab Acad Forensic Med Toxicol 2021;21(1) ISSN : 0972-5687

263

1 Dr. R.K. Gorea

2 Late Dr. Sat Pal Garg

3 Dr. D.S. Bhullar

4 Late Dr. A.S. Thind

5 Dr. Hakumat Rai

6 Dr. K.K. Aggarwal

7 Dr. Jaswinder Singh

8 Dr. Karamjit Singh

9 Dr. Harjinder Singh

10 Dr. Virender Pal Singh

11 Dr. Ashok Chanana

12 Dr. J.S. Dalal

13 Dr. Jagdish Gargi

14 Dr. R.S. Parsad

15 Late Dr. Ajit Singh

16 Dr. Harish Tuli

17 Dr. S.K. Bal

18 Dr. S.S. Sandhu

19 Dr. Akashdeep Aggarwal

20 Dr. Kuldeep Singh

21 Dr. Vishal Garg

22 Dr. S.S. Oberoi

23 Late Dr. Ram Lubhaya

24 Dr. Amandeep Singh

25 Dr. Harkirat Singh

26 Dr. I.S. Bagga

27 Dr. Harpreet Singh

28 Dr. Parminder Singh

29 Dr. Anil Garg

30 Dr. O.P. Aggarwal

31 Dr. Gaurav Sharma

32 Late Dr. Madhur Tayal

33 Dr. Gurmanjit Rai Mann

34 Dr. Didar Singh

35 Dr. Kuldeep Singh

36 Dr. Pankaj Gupta

37 Dr. Karam Singh

38 Dr. Baljit Singh

39 Dr. Puneet Khurana

40 Dr. Puneet Arora

41 Dr. Prabhsharan Singh

42 Dr. Dildar Singh

43 Dr. Mian Abdur Rashid

44 Dr. Shilekh Mittal

45 Dr. B.R. Sharma

46 Dr. D.Harish

47 Dr. Krishna D. Chavali

48 Dr. Ashwani Kumar

49 Dr. Vikram Bains

50 Late Dr. Kirpal Singh

51 Dr. Gurbachan Singh

52 Dr. Sangeet Dhillon

53 Dr. Sukhbir Singh Chauhan

54 Dr. Parminder Singh Bhatti

55 Dr. Rakesh Kumar

56 Dr. Jagbir Singh

57 Dr. Karnveer Singh

58 Dr. Rajiv K. Chowdhary

59 Dr. Parmod Kumar Goyal

60 Dr. Ajay Kumar

61 Dr RK Sharma

62 Dr Brij M. Gupta

63 Dr Sunil Gambhi

64 Dr Vijal Pal Khangwal

65 Dr Rajiv Joshi

66 Dr Manpreet Kaul

67 Dr Sheikh AnayatUllah

68 Dr Satinder Pal Singh

69 Dr Preetinder Singh Chahal

70 Dr Kulbhushan Garg

71 Dr Imran Sabri

72 Dr Bindu Aggarwal

73 Dr Adish Goyal

74 Dr Charak Sangwan

75 Dr Pardeep Singh

76 Dr Ishwer Tayal

77 Dr Ripan Chanana

78 Dr Gurvinder Singh Kakkar

79 Dr Ravdeep Singh

80 Dr Rohit Kumar Singal

81 Dr Prabhdeep Singh

82 Dr Jasbir Singh

83 Dr Jatinder Pal Singh

84 Dr Alok Kandpal

No. Name No. Name85 Dr Iram Khan

86 Dr Charanpreet K. Pawar

87 Dr Mukul Chopra

88 Dr Mohit Gupta

89 Dr Rahul Chawla

90 Dr Maneel Grover

91 Dr Y.S. Bansal

92 Dr C.S. Gautam

93 Dr S.P. Mandal

94 Dr Murli . G

95 Dr Anil Kumar Mittal

96 Dr G.A. Sunil Kumar Sharma

97 Dr Abhishek Yadav

98 Dr Jagdev Kullar

99 Dr Gurpreet Kaur Randhawa

100 Dr Gursirat Singh Khokhar

101 Dr Saginder Samara

102 Dr Saginder Samaraj

103 Dr Neha Sharma

104 Dr Sunil Mahajan

105 Dr Harshdeep Kashyap

106 Dr Kiran Kumar

107 Dr Swati Tyagi

108 Dr Mini

109 Dr Mandeep Kaur

110 Dr Gurinder Singh

111 Dr Minal

112 Dr Kanchan Jyoti Heera

113 Dr Manpinder Kaur Bhullar

114 Dr Arashdeep Singh

115 Dr Chamandeep Singh Bains

116 Dr Maninder Singh

117 Dr Akhilesh Agarwal

118 Dr Guneet

119 Dr Hitesh Bhatia

120 Dr. Deep Rattan Mittal

121 Dr. Arun Kumar Maria

122 Dr. S Valliappan

123 Dr. Preet Inder Singh

124 Dr. Harvinder Singh Chhabra

125 Dr. Bhoj Kumar Sahu

126 Dr. Amarnath Mishra

No. Name

264

Life Members (PAFMAT)


127 Dr. Shekhar Chumber

128 Dr. Navroz Goyal

129 Dr. Gurjeet Singh

130 Dr. Deepika Kanwar

131 Dr. Mohd. Amjad Bhatt

132 Dr. Nikhil Mehta

133 Dr. Charan Kamal

134 Dr. Amit Singla

135 Dr. Sukhdeep Singh

136 Dr. Munish Kumar

137 Dr. Arindam Chatterjee

138 Dr. Ranjodh Jeet Singh

139 Dr. Kanika Kohli

140 Dr. Vinka Maini

141 Dr. Ravi Tejpal

142 Dr. Preet Mohinder Singh

143 Dr. Satbir Singh

144 Dr. Kamaljit Singh

145 Dr. Mrinal Kanti Jha

146 Dr. Vijay Arora

147 Dr. Vivek Srivastava

148 Dr. Pankaj Chhikara

149 Dr. Lalit Kumar

150 Dr. Prem Chandra

Srivastava

151 Dr. Niraj Kumar

152 Dr. Om Parkash Saini

153 Dr. Rajesh Kumar Verma

154 Dr. Shailender Kumar

155 Dr. B.L. Chaudhary

156 Dr. Parmod Kumar Saini

157 Dr. Rajendra Singh Kulhari

158 Dr. Nidhi Sachdeva

Agarwal

159 Dr. Rajeev Varma

160 Dr. Pragnesh Bharatkumar

Parmar

161 Dr. Yatiraj Singi

162 Dr. Navpreet Kaur

163 Dr. Kunal Khanna

164 Dr. Smitha Rani Shetty

165 Dr. Vivekanshu Verma

166 Dr. B.V. Naga Mohan Rao

167 Dr. Anju Gupta

168 Dr. Guriqbal Singh

169 Dr. Prashanthi Krishna Dharma

170 Dr. Amarjit Singh

171 Dr. Keshav Soni

172 Dr. Faisal Nasim Gilani

173 Dr. Ashok Sagar

174 Dr. Suresh Chand

175 Dr. Jaswinder Singh

176 Dr. Prateek Rastogi

177 Dr. Varun Garg

178 Dr. Hitesh Chawla

179 Dr. Sanjeev Buri

180 Dr. Sunil M Doshi

181 Dr. Sanjay Kumar

182 Dr. Akhilesh Pathak

183 Dr. Raghvendra Kumar Vidua

184 Dr. Jitendra Kumar Gupta

185 Dr. Manoj Kumar Pathak

186 Dr. Surendra Kumar Pandey

187 Dr. Mayank Gupta

188 Dr. Amandeep Kaur

189 Dr. Mukesh Kumar Meena

190 Dr. Jitender Kumar Jakhar

191 Dr. Kamal Singla

192 Dr. Rajender Kumar Saini

193 Dr. Chandra Pal

194 Dr. Rattan Singh

195 Dr. Jyoti Barwa

196 Dr. Chaitanya Mittal

197 Dr. Atul Shankarrao Keche

198 Dr. Niranjan Sahoo

199 Dr. Vanshikha

200 Dr. Pulkit Girdhar

201 Dr. Alwin Varghese

202 Dr. Karan Pramod

203 Dr. Balbir Kaur

204 Dr. Malvika Lal

205 Dr. Shashank Shekhar Jha

No. Name No. Name

Life Members (PAFMAT)

265



Undertaking format for organizing PAFMATCON/Any Other CME/Workshop

under the banner of PAFMAT

To

The President / General Secretary


Subject : Consent for Holding the Conference.

Dear Sir

As discussed and decided in the general / executive body meeting of the academy dated ……………………….at

……..……………………………………(name the venue), I give my consent to hold the ………………annual conference of

Punjab Academy of Forensic Medicine & Toxicology on ..……………………...................……(Tentative date) in

……………………………………… (Name of the medical college / venue)

Subject to the following:-

a. The conference and / or the CME programme shall be under the auspices of Punjab Academy of Forensic Medicine &

Toxicology. The banner showing the same will be displayed at a suitable area on the main venue.

b. The President and the General Secretary of the Academy will be suitably seated on the dais during the inaugural

programme. The President will address the gathering about the policies, programs or other relevant aspects of the

Academy. The General Secretary will read out the annual report.

c. The registration of the President, General Secretary, Secretary Finance and the Editor-in-Chief of the Academy will be

complimentary.

d. The conference will get accredited with at least 4 CME Credit hours from Punjab Medical Council.

e. The President and / or General Secretary of the Academy along with one member of Punjab Medical Council will be the

signatory to the certificate issued to delegate attending the conference / CME / workshop.

f. The organizing committee will send formal invitation to all the office bearers of the academy.

g. The Journal of the Academy will be released during the inaugural programme. The Editor-in-Chief and the Joint Editor

will be invited to the dais for the release ceremony.

h. The Organizing Secretary of the programme will hand over the list of the delegates to the General Secretary of the

Academy at the end of the conference.

i. The Organizing Committee will collect Rs. 100/- ( Rupees one hundred only) per delegate of the programme and will

deposit the collected amount in the account of the Journal of PAFMAT / hand over the Cheque for the collected amount

favoring Journal of Pb. Aca. Of Forensic Med. & Toxicology to the Editor-in-Chief after the conference.

Sd/-

Organizing Chairman / Secretary

Name:

PAFMATCON :

266


Format of Application for Subscription of Journal

To

The Editor-in-Chief

Journal of Punjab Academy of Forensic Medicine & Toxicology (JPAFMAT)

Dear Sir,

I wish to Subscribe the Journal of Punjab Academy of Forensic Medicine & Toxicology. I am furnishing the required

particulars below with a request to subscribe the Journal. The fee for Journal of Punjab Academy of Forensic Medicine is enclosed.

PARTICULARS

1. Full Name ( in block letters )

2. Father's / Husband's name

3. Date of Birth

4. Qualification ( with name of university & date of passing )

5. Official Designation & Place of Posting

6. Permanent Address

7. Address for Correspondence ( subsequent change of address to be intimated)

8. Phone No. & Email

9. Photo

10. Copy of Medical Council Registration Certificate

Place Yours Sincerely

Date

(Signature)

Note : 1. Payment can be made through online transfer in the Journal Account. For any query related to subscription of the

Journal, feel free to talk/whattsapp on mobile no. 98760-05211

2. The above information can be sent by email to editor-in-chief

3. Subscribers of the Journal are entitled for Five (5) CME credit hours per year as per CME Accredition Guidelines

issued by Punjab Medical Council.

267


268


Glimpse of PAFMATCON-2021


Editorial Board

NationalAdvisoryBoardDr T.D. DograDr J.S. DalalDr R.K. GoreaDr O P AggarwalDr K K AggarwalDr Balbir KaurDr K. VijDr Dalbir SinghDr Sanjoy DassDr E.J. RodrigeusDr Gurudatta PawarDr D.S. BadkurDr Jagadeesh. N.Dr Pramod KumarDr C.B. JaniDr. Vijal Pal Khanagwal

EditorialCommittee:Dr S. S. OberoiDr Sangeet DhillonDr Ishwar TayalDr Kuldeep SinghDr Harjinder SinghDr Harpreet SinghDr Parul KherDr Antara DebBarmanDr Gurpreet S. SandhuDr S K DhattarwalDr Jaskaran SinghDr Manoj PathakDr Jaswinder SinghDr PC SrivastavaDr Om Parkash SainiDr OP MurtiDr V. V. PillayDr. Ranjit Immanuel JamesDr Shiv KochharDr Mukesh Yadav

Dr R.K. SharmaDr N K AggarwalDr Amitabh ShrivastvaDr Shankar M. BakkannavarDr. Samita SinhaDr. Manjot KaurMrs. Ritika Gupta, FSL BathindaDr. Nidhi SachdevaDr. Sindhu Sudha SahooDr. Virendar Pal SinghDr. Shilekh MittalDr. Puneet KhuranaDr. Manpreet KaulDr. Rajvinder SinghDr. Priyamvada KurvetiDr. Amarnath MishraDr. Anupama RainaDr. Balbir KaurDr. ShruthiDr. Vijay Kautilaya

SubscriptionratesforYear2021

Personal: Rs. 1,000/- Institutions: Rs. 5,000/-

PostalChargesExtra

l Subscription request be sent on email to [email protected]

l Payments be made in Bank Account of Journal of Punjab Academy of Forensic Medicine (A/c No. 65075504236, State Bank of India, Branch Rajindra Hospital Patiala, IFS Code SBIN0050263

Printed&Publishedby:Dr Parmod Kumar Goyal

Professor & Head,Department of Forensic Medicine & ToxicologyAdesh Institute of Medical Sciences & Research,

Bathinda (Pb.) India M. 9876005211, 0164-5055073E-mail: [email protected]

Printedat:Subhash Mittal Printing Press

Hospital Bazar, BathindaM. 99880-11022

e-mail: [email protected]

Editor-in-ChiefDr Parmod Kumar Goyal

Joint EditorDr Amandeep Singh

Dr. Vivek SrivastavaDr. Pardeep SinghDr. Monika GuptaDr. Tanvir Kaur SidhuDr. Sandeep KaurDr. Priti ChaudharyDr. Vijay SuriDr. Saranpal SinghDr. Tanuj KanchanDr. Raghuvendra K. ViduaDr. Vivek Kumar (Siliguri)Dr. Pragnesh ParmarDr. Imran SabriDr. Meenakshi AggarwalDr. Anupama RainaDr. Chaitanya MittalDr. Krishan Dutt ChavaliDr. Rajendra SinghDr. Yatriraj SingiDr. Vikram Palimar

ManuscriptReviewCommittee
