COMPARISON OF THE IMMUNE RESPONSE AGAINST DIFFERENT PSEUDOMONAS AERUGINOSA STRAINS AND DIFFERENT P. AERUGINOSA PHAGES Liesl Phlypo Student number: 01503264 Supervisor: Prof. Dr. Mario Vaneechoutte Scientific guidance: Drs. Jonas Van Belleghem Department: Dept. Clinical Chemistry, Microbiology and Immunology (GE06), Laboratory of Bacteriology Research (LBR) A dissertation submitted to Ghent University in partial fulfilment of the requirements for the degree of Master of Science in the Biomedical Sciences Academic year: 2016-2017
65
Embed
PSEUDOMONAS AERUGINOSA STRAINS AND DIFFERENT P. …lib.ugent.be/fulltxt/RUG01/002/349/903/RUG01-002349903_2017_0001_AC.pdf · Bacteriophages, or short phages, are viruses that infect
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
I
COMPARISON OF THE IMMUNE RESPONSE AGAINST DIFFERENT
PSEUDOMONAS AERUGINOSA STRAINS AND
DIFFERENT P. AERUGINOSA PHAGES
Liesl Phlypo Student number: 01503264
Supervisor: Prof. Dr. Mario Vaneechoutte
Scientific guidance: Drs. Jonas Van Belleghem
Department: Dept. Clinical Chemistry, Microbiology and Immunology (GE06),
Laboratory of Bacteriology Research (LBR)
A dissertation submitted to Ghent University in partial fulfilment
of the requirements for the degree of
Master of Science in the Biomedical Sciences
Academic year: 2016-2017
I
Preface
Five years ago, I knew I wanted to work in the microbiological field. In this dissertation, I got the
chance to work not only with bacteria, but with phages as well, at the laboratory of Professor
Vaneechoutte: the Laboratory Bacteriology Research. In these two years, I have learned so many
things and I was supported by many people, so I would like to extend my gratitude.
Thanks to my promotor, Professor Vaneechoutte, for giving me the opportunity for this master
thesis, to teach me critical thinking and to dot the i's and cross the t's on my dissertation.
This work would not have been possible without the scientific guidance by Drs. Jonas Van
Belleghem. Many thanks for your advice, knowledge and patience. Thank you for helping me to
process the huge amount of samples and your support throughout the two years. I would also like to
thank everyone of the LBR for being the great team that you are. In short: thank you for helping me
to become a good scientist.
And finally, I would like to thank my friends and family. Thanks to roommates, my friends in
Aarschot, Hasselt and in Ghent for all the friendship you gave me. Many thanks to my parents and
sister for their continued support, understanding of me and to help me put things into perspective
throughout my life.
Liesl Phlypo, Ghent 16 May 2017
II
Table of contents
Preface ......................................................................................................................................... I
Table of contents..........................................................................................................................II
List of abbreviations .................................................................................................................... V
Samenvatting............................................................................................................................. VII
Achtergrond........................................................................................................................... VII
Methoden .............................................................................................................................. VII
Resultaten ............................................................................................................................. VII
Besluiten................................................................................................................................ VII
cRPMI 1640no antibiotics is cRPMI 1640complete without penicillin and streptomycin.
2.13 RNA extraction of peripheral blood mononuclear cells
After stimulation, the suspensions used for RNA extraction were stored in one ml Qiazol (Qiagen,
Antwerp, Belgium) at -80 °C until use. The nucleic acid extraction for the defrosted Qiazol cell
suspensions was performed by NucliSens EasyMag as described previously (2.4.2 Nucleic acid
extraction by NucliSens EasyMag). The nucleic acid extract was thereafter exposed to 0.2 U/µl RNA
qualified DNase I (Promega, Leiden, Netherlands) in the presence of a 10x reaction buffer
(Promega) for 30 min at 37 °C. DNase was inactivated by adding RQ1 DNase Stop Solution for
10 min at 65 °C as described by the manufacturer (Promega).
2.14 cDNA synthesis
The RNA was reverse transcribed by adding 10 U/µl RevertAid RT, 1 mM deoxynucleotide
triphosphate (dNTP) mix, 5 µM random hexamer primer, 1 U/µl Riboclock RNase Inhibitor and
reaction buffer in nuclease free water to 40 µl of RNA in triplicate. The suspensions were loaded on
the Veriti Thermal Cyler (Thermo Fisher Scientific) for 5 min at 25 °C followed by 60 min at 42 °C.
The cDNA synthesis reactions is terminated by heating the suspensions for 5 min at 70 °C. The
newly synthesized cDNA was stored at – 80 °C prior to use in an RT-qPCR.
2.15 Statistical analysis
Data were analyzed using the PC-statistical package JMP (Version 10. SAS Institute Inc., Cary, NC,
US). Data were analyzed with ANOVA and mean comparisons were performed for each parameter
by Student’s t-test. Error bars in graphs represent the standard error.
20
3 Results and discussion
In this master dissertation, the amount of bacteria and phages in presence of peripheral
mononuclear blood cells (PBMCs) were determined. First, the sensitivity of the bacterial strains for
the phages was tested (3.1 Host specificity) on different bacterial strains to determine phage
sensitive and phage insensitive bacterial strains (Table 3). Secondly, the DNA extraction efficacy
(3.2 DNA extraction efficacy for bacteria and phages) was determined for DNA extracted from the
bacterial strains or from the phages. Third, is quantity of phages and bacteria after PBMC
stimulation was determined (3.3 Stimulation of PBMCs by bacteria and phages) by culture and
qPCR. This last part is the main subject of this master dissertation.
3.1 Host specificity
The host specificity of phages was determined using different bacterial isolates (Table 3,Table S 1).
The phages used during this master dissertation are known to infect Staphylococcus aureus (ISP)
or Pseudomonas aeruginosa (LUZ19, vB_Pae-Kakheti25, 14-1 and PNM). For the S. aureus phage
and the four P. aeruginosa phages, we also used bacterial strains from closely related species as
negative controls, i.e. S. epidermidis, S. haemolyticus, S. saprophyticus, S. schleiferi, and P.
fluorescens, P. putida.
3.1.1 Identification of isolates
The isolates (Table S 1) were defrozen and spread on a TSA + 5% SB plate. After overnight
incubation at 37 °C, all isolates had formed visible colonies, except the P. fluorescens and P. putida
strains (Figure 6A): P. fluorescens PSE029 did not grow and P. fluorescens PSE028, PSE031 and
P. fluorescens PSE108 had a delayed growth (> 1 week incubation).
Figure 6: Plating strategy for P. fluorescens and P. putida that did not grow or had a delayed
growth. (A) First, all bacteria were plated on a TSA + 5% SB. (B) Pseudomonas fluorescens and P.
putida did not grow or had a delayed growth in A and were plated on a MacConkey and a new TSA + 5%
SB. (C) The colonies formed on the TSA + 5% SB plate in B were transferred on a P. aeruginosa
selective medium cetrimide and a new TSA + 5% SB plate. Colonies grown on cetrimide plates were
identified, if there were no colonies on cetrimide, the colonies on TSA + 5% SB were used.
21
Therefore, the complete suspension of the isolate, that was stored at – 80 °C, was defrosted and
half of the content was plated on a non-selective TSA + 5% sheep blood plate and a Gram-negative
selective MacConkey plate (Figure 6B). There were no colonies found on the MacConkey plates of
the samples after more than 2 days incubation, which might indicate that there were no Gram-
negative bacteria present, the growth was strongly delayed, or the bacteria were not viable anymore
after storage.
The overnight incubated TSA + 5% SB plates colonies were subsequently transferred to a new TSA
+ 5% SB plate and a cetrimide plate (Figure 6C). There was visible growth on the cetrimide plate
with PSE031 (reidentified as Stenotrophomonas maltophilia by 16S rRNA gene sequencing).
Cetrimide agar, containing the antibiotic cetyltrimethylammonium bromide, is a selective medium for
the isolation of P. aeruginosa. One colony from the TSA + 5 % plate was used for reidentification by
MALDI-TOF, but did not give conclusive results for two of the P. fluorescence strains, i.e. PSE031
and PSE028. Subsequently, these strains were further identified using 16S rRNA gene sequencing.
The sequencing results, after BLASTing the obtained sequences, revealed that the strains present
in the samples did not correspond to the names written on the tubes (Table 5). The P. fluorescens
strain PSE029 was reidentified as Streptococcus pneumoniae by MALDI-TOF. Pseudomonas putida
PSE108 was reidentified by MALDI-TOF as Micrococcus luteus. The P. fluorescens strains PSE031
and PSE028 could not be identified by MALDI-TOF and were reidentified by 16S rRNA gene
sequencing as Stenotrophomonas maltophilia. This indicates that either these samples were
contaminated or the initial identification was not reliable.
Table 5: Reidentification of Pseudomonas isolates.
Original number Bacterial
strain
Original identification Reidentification
LMG 02189 PSE029 P. fluorescens Streptococcus pneumoniaea
U91 04427 PSE031 P. fluorescens Stenotrophomonas maltophiliab
LMG 01794 PSE028 P. fluorescens Stenotrophomonas maltophiliac
LMG 02171 PSE108 P. putida Micrococcus luteusa
a: identified by MALDI-TOF after growth on TSA + 5% SB agar b: identified by 16S rRNA gene sequencing after growth on cetrimide agar b: identified by 16S rRNA gene sequencing after growth on TSA + 5% SB agar
3.1.2 Evaluation of the host specificity
The purpose of the evaluation of the host specificity of the phages, or the phage susceptibility of
the bacteria, was to determine which bacteria were sensitive to the phages and which were not to
select a phage insensitive strain for each species (Table 6). Previously, Vandersteegen et al.
(2011) tested the host specificity of S. aureus phage ISP for S. aureus and S. haemolyticus from
22
human and animal isolates. None of the S. haemolyticus isolates showed lysis when treated with S.
aureus phage ISP [59]. Together with S. haemolyticus, other isolates from other Staphylococcus
species were tested for phage infectivity (S. saprophyticus and S. schleiferi).
For the P. aeruginosa phages, negative controls were originally thought to be other Pseudomonas
species, i.e., P. fluorescens and P. putida. The isolates were S. maltophilia, S. pneumoniae and
M. luteus as described before. All negative controls showed no lysis for any of the phage dilutions
(106, 108 and 1010 PFU/ml). The host strains S. aureus strain SA6538 was susceptible for S. aureus
phage ISP and P. aeruginosa strain PA573 was susceptible for all four tested P. aeruginosa
phages (Table 6).
Table 6: Host specificity of 1010 PFU/ml S. aureus phage ISP and P. aeruginosa phages.
Legend: L: lysis, -: no lysis. The phage host strains are indicated in bold.
Bacteria Phage
Species Strain ISP LUZ 19 14-1 vB_Pae-
Kakheti25 PNM
S. aureus
JS257 L - - - -
STA04 - - - - -
STA06 - - - - -
STA11 L - - - -
STA12 L - - - -
STA56 - - - - -
SA6538 L - - - -
S. haemolyticus CNS051 - - - - -
S. saprophyticus CNS047 - - - - -
S. schleiferi CNS001 - - - - -
S. pneumoniae PSE029 - - - - -
P. aeruginosa
PSE156 - - L - -
PSE159 - L - L L
PSE162 - - - - -
PSE166 - - - - -
PSE174 - - - - -
PSE176 - - - - -
PA 573 - L L L L
M. luteus PSE108 - - - - -
S. maltophilia PSE031 - - - - -
PSE028 - - - - -
23
Most strains that were examined were insensitive for phages. For the tested S. aureus strains, three
out of six strains were lysed by the S. aureus phage ISP, i.e. JS257, STA11 and STA12. The only
susceptible strain for P. aeruginosa phage 14-1 was PSE156 and the only susceptible strain for P.
aeruginosa phages LUZ19, vB_Pae-Kakheti25 and PNM was PSE 159 (Table 6).
One phage insensitive strain was chosen for each of the two bacterial species, i.e. S. aureus strain
STA04 (insensitive to phage ISP) and P. aeruginosa strain PSE176 (insensitive against LUZ19,
14-1, vB_Pae-Kakheti25 and PNM). The host strains S. aureus strain SA6538 and P. aeruginosa
strain PA573 were used as the phage sensitive strains.
3.2 DNA extraction efficacy for bacteria and phages
To determine how many phages or bacterial cells are minimally needed to extract DNA, the
extraction efficacy was tested using tenfold dilution series of the S. aureus phage ISP or the
bacterial strain (i.e. S. aureus STA04 or SA6538 and P. aeruginosa strain PA573).
3.2.1 Primer specificity and annealing temperature
The tenfold dilution series were extracted by NucliSens EasyMag, the standard series was extracted
by the High Pure PCR Template Preparation Kit (Roche method). Before qPCRs were performed,
the optimal annealing temperature was determined using a gradient PCR (2.6 Gradient polymerase
chain reaction).
3.2.1.1 Staphylococcus aureus primer specificity and annealing temperature
In total, four S. aureus primer pairs (femA, nucB, SA0836 and SA442) were tested on STA04 and
SA6538. The femA primers amplify the gene transcribing for aminoacyltransferase femA, which
contributes to the stability of the peptidoglycan of S. aureus [60]. The nucB primers target the nucB
gene encoding for a nuclease [61]. Primer pair SA0836 (Table 1) corresponds to nucleotides
51409–51429 and 51981–51961 of the transcriptional regulator gene SA0836, uniquely present in
S. aureus [62]. The product of SA442 primers is a 178-bp fragment [63] that did not give any
alignments with the ISP genome on BLAST.
In the gradient PCR, the positive control for the primers was nucleic acid ext ract of the S. aureus
strain STA01 (ATCC 29213). An extract of S. haemolyticus served as a negative control (Figure 7).
The femA primer pair was more specific compared to the nucB primer pair, as there was
amplification at annealing temperatures ranging from 55 °C to 59 °C for S. haemolyticus (Figure 7).
For femA primers, there was only amplification at 57 °C for the S. haemolyticus negative control
strain. The optimal annealing temperature for femA primers was 59 °C. At this temperature, the
bands were most dense in the different technical replicates.
24
Figure 7: Gradient PCR for S. aureus primers femA and nucB.
Temperatures from 55 °C to 65 °C were included in the gradient PCR. Reference strain was S. aureus strain
ATCC 29213. The extracts were amplified by femA (black) and nucB (orange). L: 100 bp ladder.
For the gradient PCR for primer pair SA0836, two primer concentrations were tested. First, a final
concentration of 0.5 µM primers was tested, the same concentration used for the primers described
before. Subsequently, a final primer concentration of 1 µM was tested as described by the primer
developers [64]. The gradient PCR with a 0.5 µM primer concentration gave no visible amplification,
as no PCR products were visible on the agarose gel (Figure S 1 A). In the gradient PCR with 1 µM
SA0836 primer concentration, there was amplification for S. aureus strains but the S. aureus phage
ISP DNA was amplified as well (Figure S 1B). The optimal annealing temperature was determined by
gradient PCR as 59 °C.
Despite the alignment results, S. aureus phage ISP was still amplified by SA442 primers. An
annealing temperature of 65 °C was chosen because there was less amplification of S. aureus
phage ISP DNA and a high amplification of SA6538 DNA visible (Figure S 2).
3.2.1.2 Pseudomonas aeruginosa primer annealing temperature
For P. aeruginosa, the primer pair oprL was tested for host strain P. aeruginosa strain PA573
and for P. aeruginosa PA14 (which was used as a positive control).
The oprL primer pair amplifies the oprL gene encoding the peptidoglycan-associated lipoprotein
oprL specifically for P. aeruginosa strains [65]. The optimal annealing temperature was 59 °C as
well. For the positive control, high amplification (clear blue dots inside the bands) was seen for 59,
61 and 63 °C. In technical replicate PA573 II, there was high amplification at 57 and 59 °C. This
gradient PCRs revealed that the annealing temperature for femA, SA0836 and oprL primers were all
59 °C, whereas the annealing temperature for SA442 primers was 65 °C. The primer had already
been tested extensively by De Vos et al. (1997).
25
Figure 8: Gradient PCR for P. aeruginosa primer pair oprL.
Temperatures from 55 °C to 65 °C were included in the gradient PCR. Standard strain was P. aeruginosa
strain PA14. The extracts were amplified by oprL (blue). L: 100 bp ladder.
3.2.1.3 Staphylococcus aureus phage ISP primer specificity and annealing temperature
For phage primers, it is important that the specificity of the primers is sufficiently high to exclude
amplification of the host strain. Otherwise, possible host cell debris remaining after phage
propagation could create false positive results The S. aureus phage ISP primers were previously
developed by Stefan Vermeulen, Hans Duyvejonck performed the gradient PCR for these primers
on S. aureus phage ISP lysates directly added to the PCR mixture. The optimal annealing
temperature was 59 °C for all ISP primer pairs (data not shown).
The specificity of the four primer pairs with the most stabile melting curves, as determined by Hans
Duyvejonck (data not shown), were tested for specificity. All S. ISP primer pairs amplified S. aureus
phage ISP, as well as S. aureus strain STA04 and S. aureus strain SA6538 (Figure 9). The highest
amplification of S. aureus phage ISP was accomplished by ISP primer pair 5. ISP primer pair 6 had
the lowest amplification for the S. aureus strains. This primer pair was checked for other
Staphylococcus spp, i.e., S. haemolyticus, S. epidermidis and S. saprophyticus (Figure 10).
Figure 9: Primer specificity of S. aureus ISP primer pairs for phage sensitive (SA6538) and
phage insensitive (STA04) strains.
ISP primer pair (pp) 2, 5, 6 and 7 were used.
Legend: HPLC: negative control; L: 100 bp ladder.
26
Figure 10: Primer specificity of S. aureus phage ISP primer pairs for other Staphylococcus spp.
Bacterial nucleic acid extracts amplified by ISP pp 6 loaded on agarose gel.
Legend: L: 100 bp ladder; STAHAE: S. haemolyticus; STAEPI: S. epidermidis; STASAP: S. saprophyticus.
HPLC: negative control.
Staphylococcus haemolyticus, S. epidermidis and S. saprophyticus were amplified by ISP primer
pair 6 as well. It has to be noted that the extracts used for the PCR reactions using S. aureus
primers with positive results for S. aureus phage ISP contained high concentrations of nucleic acids
in the range of 1010 GEQ/ml (Figure 7, Figure 9, Figure 10). Therefore, we assumed that it is
possible that the problem of amplification of bacterial DNA by the phage primers was due to these
high amounts of bacterial DNA and would not pose a problem at lower concentrations of bacterial
DNA. Thus, the phage ISP qPCR was tested for amplification of different concentrations of
bacterial DNA.
3.2.2 DNA extraction efficacy of S. aureus and P. aeruginosa
First, the extraction efficacy for the four bacterial strains (STA04, SA6538, PSE176 and PA573) was
determined.
Tenfold bacterial dilution series were used for the DNA extraction by NucliSens EasyMag and
quantified by qPCR. The standard series for qPCR was extracted using the High Pure PCR
Template Preparation Kit (Roche).
The concentration of samples by qPCR can be calculated by interpolating the Cq values in the
standard curve equation. The standard curve equation (Figure 11) was obtained by plotting the log
transformed concentration of the standard dilutions (measured by Nanodrop and recalculated to
GEQ/ml as described in “2.4.4 Nucleic acid concentration determination of the standard series ”)
against the Cq value (obtained by qPCR). The coefficient of determination (R²) is a measure of
accuracy, i.e., how good a model explains and can predict outcomes, with 0 a bad fit and 1 a perfect
fit of linear regression.
27
Figure 11: Example of qPCR standard curve.
The standard curve equation is y= -0.2521 + 14.034.
Quantification of bacteria was possible by the standard dilutions of the bacteria ( Figure S 3). In
general, the bacterial extraction efficacy was relatively low (Figure 12). The S. aureus strains could
be extracted until 104 to 105 CFU/ml for STA04 and SA6538 respectively. The P. aeruginosa strains
could be extracted both until a range of 104 CFU/ml.
28
Phage resistant bacteria Phage sensitive bacteria
S.
au
reu
s
P.
aeru
gin
osa
Figure 12: Extraction efficacy of Staphylococcus aureus and Pseudomonas aeruginosa bacteria.
Bacterial concentration by culture (white) and bacteria quantification by qPCR (black):
S. aureus (A) STA04 and (B) SA6538, P. aeruginosa (C) PSE176 and (D) PA573. The concentration by
culture was theoretically determined by dividing the original concentration by 10. No bars indicates no Cq
value was obtained.
The concentration measured by qPCR was controlled by a theoretical concentration determined by
culture. The highest bacterial concentration was determined by culture. To create a theoretical
standard curve, the original concentration was divided by 10 for each tenfold dilution.
3.2.3 DNA extraction efficacy in presence of PBMCs
Improvements of the extraction efficacy by NucliSens EasyMag could be possible by including
carrier DNA. Carrier DNA is DNA originating from another species that serves as bulk DNA,
enhancing the adhesion of silica beads to DNA [67]. In the stimulation assay described in “3.3
Stimulation of PBMCs by bacteria and phages”, the bacteria will be added to human PBMCs before
extraction. Therefore it was decided to determine the extraction efficacy of the two host strains
29
S. aureus strain SA6538 and P. aeruginosa strain PA573 in the presence of PBMCs, so the DNA
from PBMCs could act as carrier DNA (Figure 13).
3.2.3.1 Extraction efficacy of S. aureus in presence of PBMCS
The quantification of S. aureus by qPCR revealed that the detection level was higher than the one
by culture, namely 5.50 x 102 CFU/ml compared to the S. aureus in presence of PBMCs. With qPCR
detection was possible until 9.40 x 103 GEQ/ml (corresponding to a Cq value of 42.3) (Figure 13).
Quantification of bacteria was possible through use of a standard series made using a tenfold
dilution of bacterial DNA (Figure S 4). The concentration obtained by qPCR remained constant from
the 5th dilution (9.40 x 103 GEQ/ml) onwards, whereas in theory the concentration would drop. This
indicates that the extraction limit of EasyMag extraction is 9.40 x 103 GEQ/ml which need to be
present in order to extract DNA.
A
B
Figure 13: Extraction efficacy of S. aureus and P. aeruginosa host strains in presence of PBMCs.
Bacteria (A) S. aureus SA6538 and (B) P. aeruginosa PA573 with 106 PBMCs were extracted together and
measured on qPCR. Plating was done as a control. No bar means no Cq value was obtained.
30
The standard curve of SA6538 in the qPCR with addition of PBMCs could measure concentrations
until 103 GEQ/ml, for 102 GEQ/ml, no Cq value was obtained. The highest Cq value was 43.22,
corresponding for with 1.43 x 103 GEQ/ml. In comparison with the standard curves, the extraction
efficacy of the bacteria with PBMCs was in the same range (4.66 x 103 GEQ/ml).
3.2.3.2 Extraction efficacy of P. aeruginosa in presence of PBMCS
Similar to the results of S. aureus, the difference of Cq values dropped in lower dilutions for both the
P. aeruginosa extracts and P. aeruginosa in presence of PBMCs extracts (Figure 13). The
concentration obtained by qPCR remained constant from the 6 th dilution (3.02 x 102 GEQ/ml)
onwards, whereas in theory the concentration would drop. When the results with deviant Cq values
were excluded, the efficacy was equal for concentration determination by culturing and by qPCR
(detection level was 102 GEQ/ml). The addition of PBMCs as carrier DNA did not have an influence
on the extraction efficacy of P. aeruginosa. The standard curve of PA573 in the qPCR with addition
of PBMCs could measure concentrations until 103 GEQ/ml, for 102 GEQ/ml, no Cq value was
obtained (Figure S 4). For the standard curve, the highest Cq value was 43.22, corresponding to
1.29 x 103 GEQ/ml. In comparison with the standard curves, the extraction efficacy of the bacteria
with PBMCs was lower (1.52 x 102 GEQ/ml). Extraction efficacy with this qPCR set-up could not be
improved any further.
3.2.4 Amplification efficiency of S. aureus in presence of phages and vice versa
We already hypothesize that high bacterial DNA concentration was a possible reason for false
positive amplification in S. aureus phage ISP qPCR (3.2.1.1 Staphylococcus aureus primer
specificity and annealing temperature). The concentration of bacterial nucleic acids was therefore
gradually decreased in presence of a constant high concentration of S. aureus phage ISP in a 1:1
mixture and measured by qPCR. Eight tenfold dilutions of S. aureus strain SA6538 nucleic acids
(ranging from 1.43 x 102 to 1.43 x 109) were added to a high concentration of ISP nucleic acid
extracts (4.31 x 1010 GEQ/ml). ). The eight tenfold dilutions of S. aureus STA04 (ranging from 4.72 x
102 to 4.72 x 109 GEQ/ml) were tested in the same concentration of ISP (Figure S 5). The reverse
was checked by qPCR as well: eight extracts of phage dilutions and a high concentration of S.
aureus nucleic acid extract (1.43 x 1010 GEQ/ml; Figure 14). Because of shortage of ISP nucleic
acids, the extraction efficacy of S. aureus STA04 was tested for two bacterial dilutions instead of
eight (Figure S 5). As a control, the standard dilutions (Figure S 7) were quantified by interpolating
the Cq values of the standard dilutions into the standard equation (Figure 14: dotted lines).
The detection threshold for S. aureus strain STA04 was 4.72 x 105 GEQ/ml and 1.43 x 105 GEQ/ml
for S. aureus strain SA6538. The standard dilutions of S. aureus strain SA6538 were detected as
low as 104 S. aureus strain STA04 and 104 S. aureus strain SA6538 GEQ/ml (Figure S 6,
Figure S 8).
31
Figure 14: Amplification efficacy of Staphylococcus aureus SA6538 and S. aureus phage ISP
for femA primers. Dilution series of bacteria or phage in presence of a high concentration of the phage
or bacterial template respectively. Theoretical concentrations of the dilutions ( and ) are the Cq
values of the standard dilution series interpolated into the standard equation by qPCR The theoretical
concentrations of the constant concentrations (white bars) were measured on Nanodrop.
(A) Tenfold dilutions of S. aureus phage ISP nucleic acid were mixed with a constant concentration of S.
aureus strain SA6538 nucleic acid (1010 GEQ/ml). S. aureus phage ISP was amplified by the ISP primer pair
6 () and S. aureus strain SA6538 was amplified by the femA primer pair (red bar).
(B) Tenfold dilutions of S. aureus strain SA6538 nucleic acid were mixed with a constant concentration of
ISP nucleic acid (4.31 x 1010 GEQ/ml). S. aureus phage ISP was amplified by the ISP primer pair 6 (blue bar)
and S. aureus strain SA6538 was amplified by the femA primer pair ().
The ISP primer pair 6 had little cross reactivity, since the low concentrations of measured S. aureus
phage ISP did match with the theoretical concentration in the presence of high amounts of bacterial
DNA to the lowest concentration of 5.08 x 105 GEQ/ml for S. aureus strain STA04 and 5.02 x 105
GEQ/ml for S. aureus strain SA6538 (Figure 14). The primers for S. aureus however, showed a
strong cross reactivity when a high constant concentration of ISP DNA was present. When the
concentration of SA6538 was lower than 106 GEQ/ml, the primers measured the present S. aureus
phage ISP instead of the lower concentration of S. aureus strain SA6538 (Figure 14).
Constant ISP concentration
Bacterial dilutions
Constant bacterial concentration
ISP dilutions
fem
A p
rim
ers
A B
32
To improve the amplification efficiency of S. aureus SA6538 from 103 GEQ/ml to 102 GEQ/ml, other
primer pairs were tested with the same qPCR set-up (Table 1, Figure 15). The detection level of S.
aureus strain SA6538 primers in presence of S. aureus phage ISP when SA0836 primers were used
was very low compared to other. For DNA of S. aureus strain STA04, measurements until
STA04 109 GEQ/ml were possible, for S. aureus strain SA6538 until 108 GEQ/ml (Figure 15 A & B).
The standard curves could measure DNA until a concentration of 105 GEQ/ml for S. aureus strain
STA04 and 104 GEQ/ml for S. aureus strain SA6538 (Figure S 6, Figure S 8), indicating the qPCR
protocol was not the cause of the low amplification efficiency, but the extraction product itself
(S. aureus extract combined with S. aureus phage ISP extract).
STA04 SA6538
SA
08
36
A
B
SA
44
2
C
D
Figure 15: Extraction efficacy of S. aureus primers in presence of a constant concentration of
ISP DNA. Dilution series of bacteria in presence of a high concentration of S. aureus phage ISP.
Theoretical concentrations of the dilutions () are the standard dilution series measured by qPCR. The
constant concentrations of ISP present in the samples (white bars) were measured on Nanodrop.
Tenfold dilutions of S. aureus strain SA6538 nucleic acid (B & D) and S. aureus strain STA04 (A & C) were
mixed with a constant concentration of S. aureus phage ISP nucleic acid (4.31 x 1010 GEQ/ml). S. aureus
phage ISP was amplified by the ISP PP 6 (blue bar in A & B) and the S. aureus strains were amplified by the
SA0836 pp (A & B) and SA442 (C & D) (). STA04 is S. aureus phage ISP insensitive, Staphylococcus
aureus SA6538 is S. aureus phage ISP sensitive.
33
The concentration of S. aureus phage ISP was not measured in the qPCR using SA442 primers for
S. aureus amplification, since there were no differences found in the previous measurements of
femA and SA0836 primer qPCRs (blue bars in Figure 14 A & B and Figure 15 A & B). The constant
concentration of S. aureus phage ISP was measured by Nanodrop (white bars in Figure 15) The
concentration of STA04 and SA6538 could be determined by qPCR up until 107 and 106 GEQ/ml
respectively when SA442 primers were used. In comparison to the standard curves of S. aureus
strain SA6538 (Figure S 7), the samples with mixed bacterial and phage nucleic acids had a lower
detection limit.
3.2.5 FemA primers qPCR product identification of samples with a constant
concentration of ISP and a S. aureus dilution
The qPCR products by femA primers of S. aureus strain SA6538 dilutions in a constant amount of
S. aureus phage ISP DNA extract (Figure 14) were put on an agarose gel to check the length of the
product (Figure 16). There were bands visible for all dilutions of S. aureus strain SA6538 DNA
together with S. aureus phage ISP DNA at the same length (approximately 300 bp). The femA
primers produce a 306-bp product [68], indicating that the femA gene could be present on S.
aureus phage ISP as alignment. The melting curves of the qPCR also confirmed that a single and
the same amplicon had been generated by qPCR because all qPCR products had the same melting
temperature (Figure S 9).
Figure 16: Agarose gel electrophoresis of qPCR products by femA primers of SA6538 tenfold
dilutions in presence of a constant concentration of ISP nucleic acids.
The qPCR products by femA primers from Figure 14A were loaded on an agarose gel.
The samples resulting in this qPCR products were amplified by 16S rRNA gene primers (Table 1)
and send for 16S rRNA sequencing to determine the source (bacterial or phage) of the qPCR
products. The sequencing results, after BLASTing the obtained sequences, revealed that all
products were originating from the S. aureus phage ISP.
34
3.3 Stimulation of PBMCs by bacteria and phages
The bacteria S. aureus strain STA04 and SA6538, and P. aeruginosa strain PA573 and/or S.
aureus phage ISP were used as stimulant for PBMCs. In the first stimulation assay, standard cRPMI
1640 cell medium that includes antibiotics penicillin and streptomycin was used and there was a
centrifugation (13,000g) step to remove the phages when the stimulations were cultured. In the
second stimulation assay, the centrifugation step was omitted and penicillin and streptomycin were
not included to the cRPMI 1640 cell medium.
3.3.1 Stimulation assay with standard cRPMI 1640complete cell medium
For bacterial quantification before stimulation (t0), the bacterial suspension used as stimulant was
quantified by culturing. The PBMCs in cRPMI medium were stimulated for 20 h (t20) and stored until
further use or plated immediately.
3.3.1.1 Quantification of bacteria after stimulation with cRPMI 1640complete cell medium
For bacterial quantification at t20, the stimulation condition was cultured and quantified by qPCR, to
determine whether there was a difference between culture and qPCR quantification . Before plating,
the suspensions were centrifuged and the supernatant containing the phages was removed to avoid
false negative results by phage infection as described previously [69]. The amount of bacteria
decreased significantly at t20 for all viable bacteria (Figure 17). According to the culturing results,
there was a decrease of 4.49 x 106 CFU when ISP was added to STA04, and a smaller decrease of
7.69 x 104 S. aureus strain SA6538 CFU when ISP and PBMCs were present.
These decreases could not be confirmed by qPCR, as S. aureus strain SA6538 and S. aureus
strain SA6538 for qPCR had non-significant differences (Figure 17, p-values > 0.05). There was no
significant difference for P. aeruginosa strain PA573, as expected (p-value > 0.05). The primers
used could not detect bacterial concentrations lower than 104 GEQ/ml (Figure 15).
35
3.3.1.2 Quantification of phages after stimulation with cRPMI 1640complete cell medium
The quantification of phages was done by qPCR (Figure 18). There was no difference in the
amount of phages before or after treatment. The p-values for the condition stimulated with S.
aureus phage ISP in comparison with stimulations with S. aureus phage ISP in combination with S.
aureus strain STA04 or SA6538, or P. aeruginosa strain PA573 were respectively 0.47, 0.46 and
0.72.
A
B
C
Figure 17: Bacterial quantification by culture and qPCR after 20 h PBMC stimulation in cRPMI 1640 complete cell medium. Bacterial suspensions of (A) STA04, (B) SA6538 and (C) PA573 used for stimulation on t 0 (white bars), stimulation suspensions
with bacteria or bacteria and ISP as stimulant at t20 concentrations measured by culturing (grey bars) and by qPCR (black bars).
The PBMCs were suspended in cRPMIcomplete. The SA442 and oprL primers were used for qPCR. S. aureus strain SA6538 is
S. aureus phage ISP sensitive, S. aureus strain STA04 and P. aeruginosa strain PA573 are S. aureus phage ISP insensitive.
36
3.3.2 Stimulation assay with cRPMI 1640no antibiotics cell medium
The stimulation assay was repeated with (cRPMI 1640complete) or without (cRPMI 1640no antibiotics ) the
addition of penicillin and streptomycin to the cRPMI 1640 cell medium, and without the centrifugation
step for the removal of phages. Only one donor was used instead of six to reduce labor intensity.
This was possible because the variability between the donors was low. Bacteria were added once to
PBMCs in cRPMI 1640 cell medium containing the antibiotics penicillin and streptomycin and once
without the antibiotics.
3.3.2.1 Quantification of bacteria after stimulation with cRPMI 1640no antibiotics cell medium
In the previous stimulation assay with a centrifugation step of 13,000g (Figure 17), the
concentration of S. aureus strain STA04 was 1.03 x 108 GEQ/ml measured by qPCR and 4.51 x 106
CFU/ml by culturing. The concentration for S. aureus strain STA04 for the assay with adjusted
cRMPI cell medium could not be determined by qPCR with cRPMI 1640complete cell medium
(Figure 19). This indicates that there was a technical error in adding S. aureus strain STA04 for
stimulation. We showed that S. aureus strain STA04 was phage ISP insensitive (Table 6), making
the centrifugation step unnecessary to prevent false negative results by phage infection. It has
been described that centrifugation (> 10,000g) could damage the bacterial cell surface by
centrifugal compaction [70] which could make the bacteria more susceptible to phage genome
injection, but there were no further indications this could reverse bacteria from resistant to sensitive
phages. The experiment should be repeated to clarify the effect of S. aureus strain STA04, but due
to time constraints this was not possible.
Figure 18: Phage quantification by qPCR after 20 h PBMC stimulation in cRPMI 1640complete cell
medium.
Stock ISP is the phage dilution before addition to the PBMCs (t0, white bar). The stimulation dilutions were
measured at t20 (black bars). The PBMCs were suspended in cRPMI 1640complete cell medium. Staphylococcus
aureus strain SA6538 is S. aureus phage ISP sensitive, S. aureus strain STA04 and P. aeruginosa strain
PA573 are S. aureus phage ISP insensitive. Primer pair 6 of ISP primers was used for the qPCR.
0
2
4
6
8
10
12
ISP ISP STA04 + ISP SA6538 + ISP PA573 + ISP
Log
co
nce
ntr
ati
on
(G
EQ
/106
PB
MC
s)
: t0
: t20
37
A
B
C
Figure 19: Bacterial quantification by culture and qPCR after 20 h PBMC stimulation in cRPMI
1640no antibiotics cell medium.The concentration at t0 was measured by qPCR before addition to PBMCs
(white bars). Concentrations determined by culture (grey bars) were the stimulations without centrifuge
step at t20. Bacteria with PBMCs in cRPMI 1640 no antibiotics cell medium, bacteria with S. aureus phage ISP
(6.61 x 109 GEQ/ml) and PBMCs in cRPMI 1640 no antibiotics cell medium and bacteria with PBMCs in
cRPMI 1640 complete cell medium (+ AB).
Measurements by qPCR with SA442 and oprL primers. Staphylococcus aureus strain SA6538 is S. aureus
phage ISP sensitive, S. aureus strain STA04 and P. aeruginosa PA573 are S. aureus phage ISP insensitive.
All bacteria, S. aureus strain STA04 (p-value < 0.0001), SA6538 (p-value < 0.0001) and PA573 (p-
value = 0.0002) were sensitive for antibiotics, but not all bacteria were killed at t 20 (Figure 19). For
culturing (Figure 19), there were significant decreases for SA6538 and PA573 when cRPMI
1640complete cell medium was added (p-value < 0.0001). There was no difference when S. aureus
phage ISP was added to S. aureus strain SA6538 (p-value = 0.58). For P. aeruginosa strain PA573,
there was no difference when S. aureus phage ISP was added as well (p-value = 0.051).
The quantification of bacteria by qPCR (Figure 19) did gave a significant difference for the phage
resistant S. aureus strain STA04 when S. aureus phage ISP was added (p-value = 0.0004). The
concentration of phage sensitive strain S. aureus strain SA6538 and the P. aeruginosa strain
PA573 is similar to the conditions where S. aureus phage ISP was added to the bacteria (p-value =
38
0
2
4
6
8
10
12
ISP ISP STA04 + ISP SA6538 + ISP PA573 + ISP
Log
con
cen
trat
ion
(1
06P
BM
Cs)
0.61 and 0.66 respectively). After t20, the bacterial count of the S. aureus strain increased, whereas
the P. aeruginosa strain remained the same as t0.
3.3.2.2 Quantification of phages after stimulation with cRPMI 1640no antibiotics cell medium
The quantification of phages was repeated for the stimulation suspensions without antibiotics
(Figure 20). The phages remained constant in PBMCs as in the first stimulation assay (Figure 18).
The difference between S. aureus phage ISP and S. aureus phage ISP with the bacteria S. aureus
strain STA04 and SA6538, and P. aeruginosa strain PA573 were not significant (p-value > 0.05).
The quantification by qPCR however cannot make a distinction between viable and nonviable
phages. It could be possible that phage DNA is present inside the PBMCs and is also being
quantified as the PBMCs were also lysed in the lysis step of the extraction procedure.
Figure 20: Phage quantification by qPCR after 20 h PBMC stimulation in cRPMI 1640 no antibiotics cell
medium.
Concentrations were determined by qPCR with ISP primer pair 6 after stimulation (t 20) with PBMCs in
cRPMI no antibiotics 1640 cell medium.
3.3.2.3 RNA expression of PBMCs after 20 h stimulation
The RNA expression by PBMCs was not determined because the few differences in bacterial and
phage concentration could indicate there are probably not many differences in RNA expression of
PBMCs either.
39
4 General conclusion
Traditionally, the studies on phages are focused on the interactions with bacterial cells. But more
and more investigations indicate that phages also could have an effect on human cells, most
importantly on immune cells [49,51,71]. The focus of the interaction of phages with the (human)
immune response is mostly directed towards the humoral responses, including the anti-phage-
neutralizing antibodies that can impede phage therapy. Cellular responses are far less
investigated [51]. An example of such a study is the one by Dean et al. (1975), using S. aureus
phage lysate (SPL), to stimulate lymphocyte (T and B) proliferation and to inhibit leukocyte
migration. However, SPL is a bacterial phage lysate, making it impossible to differentiate the effects
of bacterial cell debris and phage and thus to conclude that the observed effects were caused by
the phage. In this dissertation, PBMCs were stimulated by bacteria and by CsCl-purified phages to
investigate the outcome of each stimulant. We also used mixtures of both. Bacteria prevalent in
chronic burn wounds, S. aureus and P. aeruginosa were tested, as well as S. aureus phage ISP and
P. aeruginosa phage PNM, both components of the phage cocktail BFC-1 [57]. To assess the
effects of these stimulations on bacterial and phage loads, i.e. to assess lysis and phagocytosis of
bacteria and phages by PBMCs, an optimization was needed. The host specificity was determined of
the phages to select phage insensitive bacterial strains. The extraction efficacy and amplification
efficiency were determined of the bacteria and the phages to avoid false negative results in
quantification by qPCR.
Phage titration, the ‘golden standard’ for quantification of phages is a time consuming process, for
this reason we investigated the possibility of using a qPCR platform to determine the amount of
phage particles present in different sample types ( i.e. phage stocks and PBMC mixtures). Primers
for P. aeruginosa phage PNM were still in the development phase during this master dissertation,
and therefore only phage ISP qPCR was further studied. There are several hurdles in the
development of phage primers, e.g., phage genes could be acquired from their host, what could
produce false positive results [72]. The specificity of the S. aureus phage ISP primer pair 6 was
sufficiently high to use for the stimulation experiments where bacteria and phages were added
together because a concentration from 105 to 1011 GEQ/ml could be measured (3.2.4 Amplification
efficiency of S. aureus in presence of phages and vice versa). However, all the tested S. aureus
primers had a decreased amplification efficiency when DNA of the S. aureus phage ISP was added.
The binding of the S. aureus primers to bacterial DNA was too low to detect (detection limit:
105 GEQ/ml, Figure 14, Figure 15) in comparison with the unspecific binding to the S. aureus phage
ISP DNA present in high concentrations (1010 GEQ/ml, “3.2.4 Amplification efficiency of S. aureus in
presence of phages and vice versa” ). The explanation that this false positive reaction might be due
to the presence of ISP phage genes in the genome of S. aureus is unlikely since the S. aureus
phage ISP was extensively investigated earlier for lysogeny properties by scanning for known
40
lysogeny-related genes by genomic and proteomic analysis [57]. Another explanation might be that
there was environmental contamination with phage ISP.
In total, four S. aureus primer pairs (Table 1) were tested and we found that the primer pair with the
highest detection limit were femA primers (Figure 14). The P. aeruginosa primer pair oprL was not
tested for the specificity for P. aeruginosa phage PNM DNA because the stimulation assay was not
performed for this phage. It is therefore possible that oprL has the same issues in specificity as the
S. aureus primers.
Different quantification methods were compared in this dissertation, i.e. culturing versus qPCR. In
the stimulation assays, the concentrations of culturing were not consistent with the qPCR results
(p < 0.0001) (Figure 17, Figure 19). During DNA extraction efficacy testing however, there were no
great differences between culture and qPCR (3.2.3.1 Extraction efficacy of S. aureus in presence of
PBMCS and 3.2.3.2 Extraction efficacy of P. aeruginosa in presence of PBMCS). The detection limit
of culture method was 1 log higher for S. aureus strain SA6538 extracts and comparable with qPCR
results for P. aeruginosa PA573 extracts (Figure 13). If a high detection limit is preferred, culture is
recommended. This method is more sensitive, but also more time-consuming. The added
advantage is that by culturing the bacteria only the viable bacteria can be counted and the
disadvantage is that one colony could originate from one or more bacteria leading to an
underestimation of the amount of bacteria present. If numerous samples are included (e.g.
stimulation assay with standard cRPMI), culture is not recommended, because of time constraints.
The qPCR method is more rapid, does not depend on subjective interpretation but the primers used
in this dissertation had a low specificity. By designing a primer specific for the bacteria and
excluding phage genes, it could be possible to reach the same level of detection for S. aureus, with
continuous data (without subjective observation bias). In qPCR-based techniques, all DNA present
in the sample is measured, including dead cells, which might lead to an overestimation. This could
explain the difference in the results obtained between culturing and qPCR detection of the
bacteria (Figure 17).
The large decrease of bacteria after stimulation could be caused by the streptomycin and penicillin
present in the cRPMI 1640complete cell medium, this might be a contributing factor to the drop of the
bacteria after their addition to the PBMCs (Figure 17, Figure 19). The synergism of the two
antibiotics is associated with the stimulation of streptomycin uptake by the damage of the cell wall
caused by penicillin. Streptomycin could then interrupt the ribosomes, resulting in random protein
synthesis and ultimately killing the bacteria [73]. However, in a similar setup, adding S. aureus
(strain SA113) to macrophages in cRPMI 1640 with a higher concentration of penicillin and
streptomycin (100 µg/ml) did not cause a reported bacterial decrease. The stimulation however took
only 30 min [74]. Generally, phagocytosis takes 15 min to ingest the majority of the bacteria in
vitro [75].
41
The adsorption of S. aureus phage ISP on specifically S. aureus strain SA6538 was determined by
Vandersteegen et al. (2011). After one minute, approximately 50% of the S. aureus phage ISP
particles were adsorbed on S. aureus strain SA6538. A maximal adsorption of 85% was reached
after 25 minutes [59]. Although it has to be noted that time for adsorption depends on the host
density. The lytic cycle of S. aureus phage ISP in S. aureus strain SA6538 takes approximately 40
minutes [59]. These facts indicate that 20 h of stimulation should be ample to detect the effect of
PBMCs.
There were many misidentifications of bacteria, where one culturing result became interesting after
reidentification. Cetrimide medium is selective for P. aeruginosa, although one S. maltophilia strain
(PSE031) was able to grow in presence of this antiseptic. In 1973, there was a hospital outbreak of
S. maltophilia present in Savlon concentrate (what contains 15% cetrimide). Because cetrimide-
resistant S. maltophilia strains were described, this could be an explanation why S. maltophilia strain
PSE031 was able to grow on cetrimide and became misidentified as Pseudomonas [76].
Furthermore, a misidentification of S. maltophilia as P. fluorescens was described by Pinot et al.
(2011). They compared different methods to identify S. maltophilia isolates, including the biotyping
methods Biolog and Vitek-2. Biolog method utilizes an instrument testing the ability of bacteria to
use a range of 95 carbon sources. The Vitek-2 technology consists of 64 enzymatic and carbon
compound assimilation tests [77]. When the Biolog or Vitek-2 were used, some S. maltophilia
isolates were misidentified as P. fluorescens [77].
The S. aureus phage ISP insensitive strain S. aureus strain STA04 was tested for host specificity
previously [57]. In their experiment, there was confluent lysis visible when S. aureus phage ISP was
added. The strain JS257 was also tested in the study [57] and showed confluent lysis as identified in
this dissertation. The method to test host specificity differed: the agar was richer (2% LBA instead of
1% LBA) and a greater volume of phages (5 µl of 107 PFU/ml instead of 1 µl of 1010 PFU/ml ), with
less spotted phages in total [57].
The cytokine qPCR of the stimulated PBMCs was not performed in this master dissertation, this will
be performed in the future. The stimulation assay could be repeated in small-scale to quantify the
phages by phage titration to investigate if the phages are still viable after stimulation. The
stimulation assay could also include negative controls with phages and/or bacteria in cell medium
without PBMCs. Development of a S. aureus primer specific for the bacteria but not or less
amplifying the phage could solve the low detection limit of S. aureus primers. Phages could also be
directly enumerated by electron microscopy. This would control the intactness of the phage particles
and possibly the location of the phages (extracellular, intracellular of the bacteria or the immune
cells). Microscopy could be used as well to quantify the bacteria with visualization by Gram staining
and trypan blue to visualize dead cells. Microscopy bypasses the technical difficulties that PCR-
42
based methods are submitted to because of primer specificity. This implicates that the bacterial
strain cannot be identified. Furthermore, bacteria inside PBMCs could be quantified separately by
adding antibiotics after stimulation to kill extracellular bacteria [74].
Overall, there were no differences found after stimulation of PBMCs between the phage quantity
when bacteria were absent or not. There was a significant decrease of the phage resistant S.
aureus strain STA04 when S. aureus phage ISP was added, while in the host strain SA6538 there
were no differences in quantity. We expected that there was no influence of S. aureus phage ISP
when added to STA04 and a decrease when S. aureus phage was added. Further investigations
are needed to confirm and further explore the response of PBMCs on bacteria and phages.
43
5 References
1. Feiner, R. et al. A new perspective on lysogeny: prophages as active regulatory switches of
61. Kiedrowski, M. R. et al. Staphylococcus aureus Nuc2 is a functional, surface-attached
extracellular nuclease. PLoS One 9, e95574 (2014).
62. Liu, D., Lawrence, M. L. & Austin, F. W. Evaluation of PCR primers from putative transcriptional
regulator genes for identification of Staphylococcus aureus. Lett. Appl. Microbiol. 40, 69–73
(2005).
63. Grisold, A. J., Leitner, E., Mühlbauer, G., Marth, E. & Kessler, H. H. Detection of methicillin-
resistant Staphylococcus aureus and simultaneous confirmation by automated nucleic acid
extraction and real-time PCR. J. Clin. Microbiol. 40, 2392–7 (2002).
64. Goto, M. et al. Real-time PCR method for quantification of Staphylococcus aureus in milk. J.
Food Prot. 70, 90–6 (2007).
65. Matthijs, S. et al. Evaluation of oprI and oprL genes as molecular markers for the genus
Pseudomonas and their use in studying the biodiversity of a small Belgian River. Res. Microbiol.
164, 254–261 (2013).
66. De Vos, D. et al. Direct Detection and Identification of Pseudomonas aeruginosa in Clinical
Samples Such as Skin Biopsy Specimens and Expectorations by Multiplex PCR Based on Two
Outer Membrane Lipoprotein Genes, oprI and oprL. J. Clin. Microbiol. 35, 1295–1299 (1997).
67. Haddad, Y. et al. The Isolation of DNA by Polycharged Magnetic Particles: An Analysis of the
Interaction by Zeta Potential and Particle Size. Int. J. Mol. Sci. 17, (2016).
68. Paule, S. M. et al. Direct detection of Staphylococcus aureus from adult and neonate nasal
swab specimens using real-time polymerase chain reaction. J. Mol. Diagn. 6, 191–6 (2004).
69. Merabishvili, M. et al. Characterization of Newly Isolated Lytic Bacteriophages Active against
Acinetobacter baumannii. PLoS One 9, e104853 (2014).
70. Peterson, B. W., Sharma, P. K., van der Mei, H. C. & Busscher, H. J. Bacterial cell surface
damage due to centrifugal compaction. Appl. Environ. Microbiol. 78, 120–5 (2012).
71. Przerwa, A. et al. Effects of bacteriophages on free radical production and phagocytic functions.
Med. Microbiol. Immunol. 195, 143–150 (2006).
72. Clokie, M. PCR and Partial Sequencing of Bacteriophage Genomes. Methods Mol. Biol. 502,
47–55 (2009).
73. Moellering, R. C., Weinberg, A. N. & Weinberg, A. N. Studies on antibiotic syngerism against
enterococci. II. Effect of various antibiotics on the uptake of 14 C-labeled streptomycin by
enterococci. J. Clin. Invest. 50, 2580–4 (1971).
74. Wolf, A. J. et al. Phagosomal degradation increases TLR access to bacterial ligands and
enhances macrophage sensitivity to bacteria. J. Immunol. 187, 6002–10 (2011).
75. Lamers, M. C., de Groot, E. R. & Roos, D. Phagocytosis and degradation of DNA-anti-DNA
complexes by human phagocytes I. Assay conditions, quantitative aspects and differences
between human blood monocytes and neutrophils. Eur. J. Immunol. 11, 757–764 (1981).
76. Wishart, M. M. & Riley, T. V. Infection with Pseudomonas maltophilia hospital outbreak due to
contaminated disinfectant. Med. J. Aust. 2, 710–2 (1976).
77. Pinot, C. et al. Identification of Stenotrophomonas maltophilia strains isolated from environmental
and clinical samples: a rapid and efficient procedure. J. Appl. Microbiol. 111, 1185–1193 (2011).
i
6 Addendum
6.1 Support information: Host specificity
Legend: /: no labnumber.
Bacterial species Lab number Original number
S. aureus
STA04 H90 11139
JS257 99 07 3838
STA11 V92 01563
STA56 SAU20
STA06 S90 03891
STA12 V92 02350
S. epidermidis / EJ N860069
S. haemolyticus / EJ N870222
S. saprophyticus / EJ N850206
S. schleiferi / H90 10625
P. aeruginosa
PSE156 PA01
PSE159 TUD47
PSE162 BR257
PSE166 LO049
PSE174 BR735
PSE176 LW1048
P. fluorescens
PSE029 LMG 02189
PSE031 U91 04427
PSE028 LMG 01794
P. putida PSE108 LMG 02171
Table S 1: Original identification of bacterial strains in -80 °C storage.
ii
6.2 Support information: DNA extraction efficacy for bacteria and phages
6.2.1 Primer specificity and annealing temperature
Table S 2: Primers used on DNA of PBMCs.
Species Primer Sequence
(5’ to 3’)
Annealing
Temperature (°C)
Homo sapiens B-actin-F976 GGATGCAGAAGGAGATCACTG
59 B-actin-R1065 CGATCCACACGGAGTACTTG
Homo sapiens CD14_F CGCTCCGAGATGCATGTG
59 CD14_R TTGGCTGGCAGTCCTTTAGG
Homo sapiens CXCL1_F GGAAAGAGAGACACAGCTGCA
59 CXCL1_R AGAAGACTTCTCCTAAGCGATGC
Homo sapiens CXCL5_F ATCTGCAAGTGTTCGCCATAG
59 CXCL5_R ACAAATTTCCTTCCCGTTCTTC
Homo sapiens IL10 F409 CATCGATTTCTTCCCTGTGAA
59 IL10 R482 TCTTGGAGCTTATTAAAGGCATTC
Homo sapiens IL1A_F CGCCAATGACTCAGAGGAAGA
59 IL1A_R AGGGCGTCATTCAGGATGAA
Homo sapiens IL1B_F GGCCACATTTGGTTCTAAGAA-A
59 IL1B_R TAAATAGGGAAGCGGTTGCTC
Homo sapiens IL1RN_F GAAGATGTGCCTGTCCTGTGT
59 IL1RN_R CGCTCAGGTCAGTGATGTTAA
Homo sapiens IL6_F GGTACATCCTCGACGGCATC
59 IL6_R GCCTCTTTGCTGCTTTCACAC
Homo sapiens LYZ_F AAAACCCCAGGAGCAGTTAAT
59 LYZ_R CAACCCTCTTTGCACAAGCT
Homo sapiens SOCS3_Fw GGCCACTCTTCAGCATCTC
59 SOCS3_Rv ATCGTACTGGTCCAGGAACTC
Homo sapiens TGFBI_F GAAGGGAGACAATCGCTTTAGC
59 TGFBI_R TGTAGACTCCTTCCCGGTTGAG
Homo sapiens TNFa-F275 CCCAGGGACCTCTCTCTAATC
59 TNFa-R358 ATGGGCTACAGGCTTGTCACT
iii
A
B
Figure S 1: Gradient PCR with SA0836 primers.
(A) A primer concentration of 0.5 µM was used. (B) A primer concentration of 1 µM was used.
iv
Figure S 2: Gradient PCR for S. aureus SA6538 and S. aureus phage ISP with SA442 primers. L: 100bp ladder, HPLC: negative control.
v
6.2.2 DNA extraction efficacy of S. aureus and P. aeruginosa
Phage resistant Phage sensitive
S.
au
reu
s
A B
P.
ae
rug
ino
sa
C D
Figure S 3: Standard curves of bacterial strains used for determination extraction efficacy in Figure 12.
The femA primer pair was used for amplification of S. aureus, and the oprL primer pair for P. aeruginosa.
vi
6.2.3 DNA extraction efficacy in presence of PBMCs
A
B
Figure S 4: Standard curves of bacterial strains used for determination extraction efficacy in
presence of PBMCs in Figure 13.
(A) The femA primer pair was used for amplification of S. aureus SA6538, and (B) the oprL primer pair for
P. aeruginosa.
vii
6.2.4 Amplification efficiency of S. aureus in presence of phages and vice versa
Constant bacteria
ISP dilutions
Constant ISP
Bacterial dilutions
ST
A0
4
A
0
2
4
6
8
10
12
1 2 3 4 5 6 7 8
Log
conc
entr
atio
n(G
EQ/m
l)
ISP dilutions (-log)
B
0
2
4
6
8
10
12
1 2
Log
conc
entr
atio
n (G
EQ/m
l)
STA04 dilutions (-log)
Figure S 5: Extraction efficacy of S. aureus STA04 and S. aureus phage ISP using primer pair
femA primers and ISP primer pair 6.
Theoretical concentrations of the phage () and bacterial () dilutions are the standard dilution series
measured by qPCR. The theoretical concentrations of the constant concentrations (white bars ) were
measured on Nanodrop. (A) Tenfold dilutions of S. aureus phage ISP nucleic acid were mixed with a constant
concentration of S. aureus STA04 nucleic acid (4.72 x 1010 GEQ/ml). (B) Tenfold dilutions of S. aureus
STA04 nucleic acid were mixed with a constant concentration of S. aureus phage ISP nucleic acid (4.31 x
1010 GEQ/ml). ISP was amplified by the ISP primer pair 6 ( and blue bars) and the S. aureus strains were
amplified by femA primers ( and red bars).
viii
STA04 SA6538 ISP
fem
A p
rim
ers
SA
08
36
pri
me
rs
Figure S 6: Standard curves for S. aureus STA04, SA6538 and S. aureus phage ISP using femA and SA0836 primers for qPCR in Figure 14 and Figure 15 A & B.
ix
STA04 SA6538 ISP
SA
44
2 p
rim
ers
Figure S 7: Standard curves for S. aureus STA04, SA6538 and S. aureus phage ISP using SA442 primers for qPCR in Figure 15 C & D.
x
Figure 14
Figure 15 A & B
Figure S 8: Standard curves for S. aureus phage ISP using ISP primer pair 6 for qPCR in Figure
12 and Figure 13 A & B.
xi
6.2.5 FemA primers qPCR product identification of samples with a constant
concentration of ISP and a S. aureus dilution
Figure S 9: Melting curves of S. aureus SA6538 dilution with a constant S. aureus phage ISP concentration
amplified by femA primers.
Melting curves of the samples from qPCR with SA6538 dilutions amplified by femA primers (Figure 12A)