psbA Mutation (valine219 to isoleucine) inPoa annua resistant to metribuzin and diuron

Pest Management Science Pest Manag Sci 56:209±217 (2000)

psbA Mutation (valine 219 to isoleucine) in Poaannua resistant to metribuzin and diuronLemma W Mengistu,1† George W Mueller-Warrant,2* Aaron Liston3 andReed E Barker21Crop and Soil Science Department, Oregon State University, Corvallis, OR 97330 USA2USDA-ARS, National Forage Seed Production Research Center, 3450 SW Campus Way, Corvallis, OR 97331-7102 USA3Botany and Plant Pathology Department, Oregon State University, Corvallis, OR 97330 USA

(Rec

* CoCorvE-ma† CurCont

# 2

Abstract: The herbicide-binding region of the chloroplast psbA gene from a total of 20 biotypes of Poa

annua L resistant and susceptible to metribuzin and diuron was selectively ampli®ed using PCR.

Sequence analysis of the fragment from six herbicide-resistant biotypes of P annua exhibited a

substitution from valine to isoleucine at position 219 of the D1 protein encoded by the psbA gene. This

is the same mutation as reported for Chlamydomonas and Synechococcus through site-directed

mutagenesis and in cell cultures of Chenopodium rubrum L. To our knowledge this is the ®rst report of

a higher plant exhibiting resistance in the ®eld to photosystem II inhibitors due to a psbA mutation

other than at position 264. The existence of additional biotypes of P annua resistant to diuron or

metribuzin but lacking mutation in the herbicide-binding region indicates that resistance to these

herbicides can also be attained by other mechanisms.

# 2000 Society of Chemical Industry

Keywords: herbicide resistance; grass-seed production; ®eld selection; diuron; metribuzin

1 INTRODUCTIONA range of herbicides, including s-triazines, substituted

ureas, and phenolic derivatives, block the photosyn-

thetic electron transport chain on the reducing side of

photosystem II (PS II).1,2 PS II herbicides act by

displacing the secondary plastoquinone QB from its

binding site in PS II.3 The protein target of the PS II

herbicides has been identi®ed as the D1 polypeptide

subunit of PS II, also called the herbicide or QB

binding protein.4 The D1 polypeptide is encoded by

the chloroplast psbA gene,5 and is highly conserved in

plants, algae and cyanobacteria.6 In higher plants the

chloroplast psbA gene is located in the large single copy

region close to the left junction of the inverted repeat.7

The ®rst report of herbicide resistance to a photo-

synthesis inhibitor involved a triazine herbicide,8 and

since then biotypes of more than 60 species have been

documented to possess triazine resistance.9 The 1995/

96 International Survey of Herbicide Resistant Weeds

revealed 183 herbicide-resistant weed biotypes (124

different species) in 42 countries, and 32% of these

were triazine-resistant.10 Resistance to triazine herbi-

cides has been attributed either to a rapid metabolic

detoxi®cation of the herbicide11 or to a modi®ed site of

action that prevents herbicide binding within the

chloroplast.12 Susceptible as well as resistant biotypes

eived 21 October 1999; accepted 1 November 1999)

rrespondence to: George W Mueller-Warrant, USDA-ARS, National Fallis, OR 97331-7102 USAil: [email protected] address: Department of Plant Sciences, North Dakota State Univract/grant sponsor: Oregon Seed Council

000 Society of Chemical Industry. Pest Manag Sci 1526±498X/2

of some weed species can rapidly metabolize atrazine

via hydroxylation reactions in the plant's metab-

olism.12 Triazine-resistant weeds, however, degrade

atrazine at a much lower rate than maize (Zea maysL).13

Triazine resistance is generally target-site based,

resulting from a modi®cation at the herbicide binding

site, the D1 protein of PS II.14 The substituted urea

herbicides, although chemically distinct from triazines,

are also potent PS II inhibitors14 and bind at

overlapping but not identical sites with the triazines.15

Biotypes highly resistant to triazine herbicides as a

result of a modi®ed D1 protein fail to show resistance

to substituted urea herbicides14 because mutation

Ser264 to Gly providing resistance to triazine herbicides

does not affect binding of substituted urea herbi-

cides.2,15 Triazine-resistant plants, however, have

been reported to show resistance to other PS II

inhibitors such as triazinones, uracils and pyridazi-

nones.16,17

The psbA gene from several organisms has been

sequenced, and, quite frequently, resistance by photo-

synthetic organisms to PS II herbicides, like triazi-

nones, triazines, and DCMU (diuron), results from

mutations in the psbA gene, leading to an amino acid

exchange in the QB binding protein. In higher plants a

orage Seed Production Research Center, 3450 SW Campus Way,

ersity, Fargo, ND 58105 USA

000/$17.50 209

LW Mengistu et al

mutation affecting amino acid 264 (serine) leads to

resistance against triazine herbicides, and in algae,

mutations in any of positions 215, 219, 255, 256 or

275 are known to confer resistance to several classes of

herbicides.18

Double and triple mutants of Chenopodium rubrum L

cell cultures were characterized where a valine to

isoleucine change at position 219 was decisive for

metribuzin resistance, although there were some other

changes between amino acid residues 209 and 291.

For example, metribuzin-resistant cell cultures pos-

sessed psbA mutations in most cases at 219 and 251, or

at 219, 251 and 256, or at 219, 229 and 270, or at 219,

220 and 270, or at 219, 251 and 272. All these changes

resulted in resistance to metribuzin. None of the

mutant cell cultures possessed the classical ®eld

mutation at residue 264.18 Most of the mutations in

the D1 protein leading to herbicide resistance in

cyanobacteria and green algae were identi®ed by

randomly induced mutagenesis or by site-directed

gene technology methods for the psbA gene.19

A detailed model of the herbicide-binding region in

PS II has been developed.20 Based on this model, 17

amino acids of the psbA gene are in contact with the QB

binding site. These include: Phe211, Met214, His215,

Leu218, Val219, Thr237, Ile248, Ala251, His252, Phe255,

Gly256, Ala263, Ser264, Phe265, Asn266, Ser268 and

Leu275. The eight site mutations including Val219 that

have been reported to cause resistance to herbicides all

involve residues that have contact with QB. The

relative importance of each residue in herbicide

binding has been further characterized.20 For exam-

ple, mutation Ser264 had greatest impact on binding of

most PS-II-inhibiting herbicides. Val219 and Leu275

were characterized as being located peripherally to the

QB binding site, as compared to the other amino acids

found nearer the center. Mutations to the more bulky

amino acids Ile219 or Phe275 will only touch those

inhibitors extending into this peripheral space. As a

result, the Val219 to Ile mutant showed R/S I50 ratios of

20, 2, 2, and 3 for metribuzin, atrazine, s-triazine and

s-thiazole, respectively.20

High levels of resistance to atrazine have been

correlated with a single amino acid substitution (Ser to

Gly) in higher plants at position 264 in the D1

protein.21±23 A change of Ser to Ala at the same

position in this protein is correlated with lower levels of

resistance to atrazine and diuron in algal mutants24

and a cyanobacterial transformant.25 In higher plants

spontaneous herbicide resistance has been found in

the ®eld in various weed plants.21,26,27 In all reported

cases involving the psbA gene, a Ser264 to Gly change is

responsible for the acquired resistance.28 This muta-

tion is reported for dicotyledenous species such as

Amaranthus hybridus L,21,29Solanum nigrum L,23 Che-nopodium album L,30,31 and Senecio vulgaris L.28 The

only monocotyledenous species with a psbA gene

mutation at residue 264 giving resistance to atrazine

is Poa annua L.32 This mutation in higher plants is

accompanied by a slowing down of electron transfer

210

between the primary QA and secondary QB quinones

of PS II reaction centers,33±35 leading to an increased

susceptibility to photoinhibition in the resistant

biotypes.36 The triazine-resistant mutants display a

marked decrease in growth rate at normal light

intensities37 and a reduction in competitive ®tness.38

However, mutations of the D1 at positions 219 and

275 have been demonstrated to have no role in

electron transfer system of PS II.6 A study conducted

on the molecular basis of resistance to atrazine and

cross-resistance to diuron used uniparental mutants of

Chlamydomonas reinhardi Dang resistant to diuron

(strain Dr2) and to atrazine (strain Ar207) that

possessed Val219 to Ile and Phe255 to Tyr, respec-

tively.6 Strain Dr2 showed a two-fold resistance to

atrazine and a 15-fold resistance to diuron, while strain

Ar207 had a 15-fold resistance to atrazine and a 0.5-

fold resistance (two-fold increased susceptibility) to

diuron. Electron transport for these two mutants was

normal, as opposed to Ser264 to Ala or Ser264 to Gly

mutations that alter the electron transport system.6 An

extended study of the mutant strain Dr-18 of Creinhardi 39 revealed that the mutant required 10-fold

higher concentrations of DCMU and CMU to show

the same degree of inhibition as the wild type. This

mutant was later sequenced, and determined to

consist of a Val219 to Ile exchange in the psbA gene.6

The resistance to PS II inhibitors due to alteration of

the psbA gene is maternally inherited. However,

hybrids with resistance from paternal plastids were

found at a frequency of 0.2 to 2%.40

Poa annua is one of the worst weed problems

confronting grass-seed growers in the Willamette

Valley of western Oregon. Its presence in harvested

seeds complicates seed cleaning and reduces crop

value if seed cannot be cleaned to `Poa-free' status.41

Over 20 populations of P annua in grass ®elds of

Oregon have been shown to be ethofumesate-resistant,

triazine-resistant and urea herbicide-resistant.10 Sev-

eral of the P annua populations have shown multiple

resistance to atrazine, diuron, terbacil and ethofume-

sate,41±43 with greenhouse experiments indicating a

10-fold increase in resistance to both atrazine and

diuron.42 Managing herbicide-resistant weeds requires

a good understanding of the genetics of resistance.

Understanding the mechanisms of resistance involved

in these populations of P annua for various herbicides

is vital. Wise management decisions will require full

understanding of the mechanisms of resistance, the

gene or genes involved, inheritance of resistance and

gene ¯ow, as well as the details of the biology of the

species. This study therefore was designed to ful®l the

objective of understanding the mechanism of resis-

tance involved in populations of P annua resistant to

diuron and metribuzin in western Oregon grass-seed

crops.

2 MATERIALS AND METHODSSeeds for these experiments were obtained from

Pest Manag Sci 56:209±217 (2000)

psbA mutation in Poa annua resistant to metribuzin and diuron

greenhouse-grown P annua plants collected in 1994

and 1995 from grass-seed ®elds of western Oregon for

studies of genetic diversity.44 Seeds of several addi-

tional herbicide-resistant types and one susceptible

type were obtained from Dr Carol Mallory-Smith

(Dept Crop & Soil Sci, Oregon State Univ, Corvallis,

OR).

2.1 Greenhouse experimentsIn the greenhouse experiments, we tested the tolerance

to ®eld rates of diuron and metribuzin using 225

accessions of P annua. Seeds from single plants of the

225 accessions were planted in rows using ¯ats in the

greenhouse. Every ¯at consisted of ten rows, and each

row was a single accession of P annua. Eighty of 225

accessions were tested for their reactions both to

metribuzin and diuron, while the other 145 accessions

were only tested for diuron resistance because quan-

tities of seed were limited.

Every accession's seedlings were counted after

emergence and recorded before herbicide treatment.

On 30 May 1997, seedlings in the two-leaf stage were

treated with diuron at 1.1kg AI haÿ1 for all 225

accessions and metribuzin at 0.37kg AI haÿ1 for 80

accessions. Two ¯ats from the metribuzin treatments

were divided into halves, and one half was covered

with a plastic sheet while spraying the herbicide, to

serve as an untreated control. Other untreated controls

from earlier plantings were also grown in the green-

house for comparisons. The treated seedlings were

kept in the greenhouse at 12h supplemental light,

21°C day, 15°C night and watered daily. Seedlings

were counted again at two and three weeks after

herbicide treatment, and the progeny classes and

accession classes were determined based on their

reaction to the herbicides as (R) resistant, (I) inter-

mediate and (S) susceptible. Progeny were scored as

resistant if uninjured by herbicide, intermediate if

injured but alive, and susceptible if killed. Accessions

were scored as resistant if any progeny were resistant,

susceptible if all progeny were killed, and otherwise

intermediate. After identifying the response of P annuaaccessions to diuron and metribuzin, the mechanism

of resistance was studied through DNA sequence

analysis of the psbA gene.

2.2 DNA extractionWe extracted total DNA using a modi®ed procedure of

Figure 1. A polyacrylamide gel electrophoresisindicating the amplified 933 base pair fragmentDNA of the herbicide-binding region of the psbAgene from Poa annua accessions. The two primersused to amplify this DNA fragment were 5'GGATGGTTTGGTGTTTTG 3' and 5'TAGAGGGAAGTTGTGAGC 3'. The PCR reactionconditions are explained in the text. Numbers (1–7)are P annua samples and M is the marker.

Pest Manag Sci 56:209±217 (2000)

a rapid one-step extraction of DNA (ROSE) buffer

[Tris HCl (pH 8; 10mM), EDTA (pH 8; 312mM),

lauryl sarkocyl (10g litreÿ1), PVPP (1% per 50ml ®nal

volume) and b-mercaptoethanol (2g litreÿ1)] as ex-

plained by Steiner et al. 45 The following steps were

added to clean DNA samples further and to quantify

the DNA yield. The supernatant was placed in clean

tubes, two-thirds volume (330ml) cold isopropanol

was added, each sample was then well mixed and held

at ÿ20°C for 10min. The samples were then

centrifuged for 10min at 12000rev minÿ1 and pellets

were carefully saved in the tube while the supernatant

was decanted. The pellets were washed with etha-

nol�water (80�20 by volume, 300ml) by spinning for

5min, then air-dried. The dried pellets were resus-

pended in Tris base�EDTA pH 8(TE; 400ml).

RNAse (0.5mgmlÿ1, 8ml; ®nal concentration

10mgmlÿ1) was added to the samples and incubated

for 30min at 37°C. The DNA was precipitated by

rocking the tubes after adding ammonium acetate

(7.5 M, 200ml) absolute ethanol (1.2 ml), and then

held for 10min at ÿ20°C. Samples were ®nally spun

for 10min, decanted, washed, and air-dried. The

pellets were then resuspended in TE (80ml) and kept

in storage at ÿ20°C until needed for ampli®cation.

DNA was quanti®ed for every sample using a

¯uorometer, and the DNA samples were diluted to

®nal concentrations of 10ngmlÿ1.

2.3 PCR conditions and DNA amplificationTwo primers were designed and synthesized based on

homologous regions of sequences available from

GenBank for the chloroplast psbA gene of Arabidopsisthaliana (GI:515373) and Nicotiana plumbaginifolia(GI:11754). These primers should amplify a 933 base

pair fragment of the chloroplast psbA gene including

the herbicide-binding region. The primer sequence 5'GGATGGTTTGGTGTTTTG 3' corresponded to

bases 91±108 of the psbA 5' region. The second primer

5' TAGAGGGAAGTTGTGAGC 3' corresponded to

bases 1006±1023 of the 3' region of the DNA

sequence. Both primers were used to PCR-amplify

the target region from total DNA (Fig 1). The same

two primers were also used for sequencing the

fragment in separate reactions, and results were

aligned during analysis. Another primer was synthe-

sized based on the speci®c sequence we obtained from

our P annua, and this primer was only used for

211

LW Mengistu et al

sequencing the fragment. The sequence of the third

primer was (5' CTCCTGTTGCAGCTGCTACT

3'), which starts just before the region of amino acid

residue 150 and corresponds to bases 446±465 of the

psb A sequence. This primer was designed to give a

very clear sequence of the herbicide-binding region.

PCR was performed in a 100ml reaction volume with

90ml of reaction mix [1� Stoffel buffer, 3.75mM

MgCl2, 50mM of each dNTP, 1.0pM of each primer,

and 1 unit Taq Stoffel fragment] aliquotted into a 96-

well assay plate and then overlaid with three drops of

mineral oil. Finally, 10ml of 10ngmlÿ1 diluted DNA

sample was added to the reaction mixture under the

oil. The thermal cycling program started with dena-

turation for 7min at 94°C followed by 43 cycles of 30-

s denaturation at 47C, a 1°C per 3-s ramp, and

extension at 72°C for 2min. A ®nal extension at 72°Cfor 5min concluded the DNA ampli®cation. After

ampli®cation the samples were kept at 4°C for a short

period (<24h) or at ÿ20°C for longer periods until

electrophoresis.

2.4 Electrophoresis, DNA extraction from gels andpurificationThe PCR product was run in both TBE (Tris

base�boric acid�EDTA) agarose gel electrophoresis

and polyacrylamide gel electrophoresis. Polyacryla-

mide gels were made from Tris-HCl (pH 8.8),

acrylamide (7.5% ®nal), ammonium persulfate, and

TEMED (N,N,N ',N '-tetramethylethylenediamine),

and resulted in the approximately 933 base pair single

fragment seen in Fig 1, along with several very faint

bands of lower molecular mass. DNA was extracted

from the 933 base pair fragment on the agarose gel,

and puri®ed for sequencing by following the QIAquick

Gel Extraction protocol (QIAGEN Inc, Valencia,

California 1997) and Kit (buffers, tubes, ®lters). The

puri®ed product for each sample was submitted to the

Central Services Laboratory at Oregon State Uni-

versity. Multiple sequences were obtained for most

accessions. Analyses of the sequences were made ®rst

by editing multiple sequences, and once a consensus

sequence was obtained homology tests were made with

known psbA sequences. Translation was made using

Expasy, an Internet translation tool [http://www.

expasy.ch/tools/dna.html].

3 RESULTS3.1 Poa annua accessions reaction to metribuzinand diuron in greenhouseA large number of P annua seedlings were susceptible

to diuron and metribuzin, with treatments causing 46

to 94% and 75 to 96% lethality, respectively (Table 1).

However, a large percentage of the accessions con-

tained at least one individual (out of approximately 50

tested) highly resistant to diuron. Some individual

accessions were relatively uniform in their response to

diuron, while others possessed resistant, intermediate,

and susceptible types, suggesting that many of these

212

populations were still segregating for resistance to

diuron. In general, these accessions were more

sensitive to metribuzin than to diuron. However, three

accessions from the Bowers farm near Harrisburg,

Oregon, possessed individuals highly resistant to

metribuzin, and several accessions at two other sites

were intermediate in their response to metribuzin.

Only one accession (#145) out of 80 tested was

resistant to both diuron and metribuzin. Its reaction

may have been maternally inherited because all the

progeny from the single plant parent showed uniform

reaction to the herbicides. Since all 225 of the

accessions were tested for diuron while only 80 were

also tested for metribuzin, we presume some of the

diuron-resistant accessions were also resistant to

metribuzin. The uniformity of their response to diuron

across the rows of progenies was similar to that of

accession #145, indicating that these other accessions

were similar to accession #145.

3.2 Sequence analysisInitial attempts to sequence the 933 base pair fragment

of the psbA gene from our accessions used either one or

the other of the two 18-mer primers from PCR

ampli®cation as their sequencing template. The

DNA sequencer used (ABI Prism2 Model 377) gave

no results in the template region. Nucleotide identi-

®cation became ambiguous somewhere between 300

and 600 bases after the primer in any individual run,

sometimes making it dif®cult to align the 5' and 3'sequences and be con®dent of the results in the

herbicide-binding region (amino acid residues 211 to

275, bases 541 to 735 from the 5' end or bases 199 to

393 from the 3' end of our fragment). In order to

obtain clearer results in this critical region, we

generated a new (nested) primer for use as a

sequencing template based on the sequence already

obtained for bases 446 to 465 of the psbA gene (bases

356 to 375 from the 5' end of our fragment). This third

primer usually gave good readings all the way out to

the 3' end of the fragment (psbA codon 1023).

The only detectable difference in the DNA se-

quences of the 20 accessions occurred at codon 655,

which changed from wild-type guanine to mutant

adenine. This mutation was present in samples

extracted from three separate plants grown out from

seed produced by accession #145. The mutation was

detectable in DNA sequence runs using each of the

three primer templates for four separate accessions.

The mutation was detected using the nested primer in

two other accessions. Wild-type in the herbicide-

binding region was con®rmed in nine accessions with

the nested primer, two accessions with the 3' primer,

and three accessions with the 5' primer. For the 15

accessions sequenced with the nested primer, the high

quality of the data strongly implies that there were no

psbA differences among these accessions from codon

469 to 1023, except for the mutation at 655. The seven

accessions sequenced using the 5' PCR primer were

reliably sequenced (and showed no differences) from

Pest Manag Sci 56:209±217 (2000)

Table 1. Progency testing herbicide tolerance classification

Accession source and herbicide treatment Accessions tested (number)

Progency tolerance

class a

Accession tolerance

class b

R I S R I S

(% of progeny) (% of accessions)

Diuron, 1.1kg ha ÿ1

Bowers farm perennial ryegrass 76 1.4 4.9 93.7 19.1 6.4 74.5

McLagan farm, Pugh Rd 33 6.4 35.6 57.9 66.7 15.2 18.2

McLagan farm, Bell Plain Rd 28 28.7 25.0 46.2 82.1 10.7 7.1

Glaser farm perennial ryegrass 50 16.6 33.9 49.5 66.0 22.6 11.3

Glaser farm meadowfoam 33 6.8 28.2 65.0 51.5 12.1 36.4

Pugh farm perennial ryegrass 1 5.1 41.0 53.8 100.0 0.0 0.0

Hyslop farm perennial ryegrass 4 1.9 14.7 83.3 25.0 25.0 50.0

Metribuzin, 0.37kg ha ÿ1

Bowers farm perennial ryegrass 28 4.4 2.6 93.0 10.7 3.6 85.7

McLagan farm, Pugh Rd 16 3.7 5.0 91.3 0.0 0.0 100.0

McLagan farm, Bell Plain Rd 10 15.8 8.7 75.5 0.0 30.0 70.0

Glaser farm perennial ryegrass 5 0.9 3.1 96.0 0.0 40.0 60.0

Glaser farm meadowfoam 21 0.1 5.4 94.5 0.0 4.8 95.2

a Progeny were scored as resistant if uninjured by herbicide, intermediate if injured but alive, and susceptible if killed.b Accessions were scored as resistant if any progeny were resistant, susceptible if all progeny were killed, and otherwise intermediate. Data shown are from ®rst

rating for progeny class (two weeks after treatment) and second rating for accession class (three weeks after treatment).

psbA mutation in Poa annua resistant to metribuzin and diuron

codon 136 to 548. From codon 549 to 670, these

sequencing runs included up to 15 unidenti®ed bases,

although there were no identi®ed differences except at

655.

Six accessions (including accession #145) out of the

20 that were sequenced exhibited a Val219 to Ile

substitution in the psbA gene (Table 2). Several

accessions were resistant to diuron or metribuzin but

did not possess the psbA mutation. Accessions

susceptible to diuron and metribuzin also did not

exhibit this mutation. None of the six mutants showed

the classical mutation of Ser264 to Gly, but rather

remained wild-type at that position and at all other

sites within the herbicide-binding region except for

residue 219 (Fig 2). GenBank accession numbers are

AF131886 (GI:4972677) for the herbicide-resistant

mutant possessing the Val219 to Ile change, and

AF131887 (GI:4972678) for the wild-type. The

888-base-pair consensus nucleotide sequence we

obtained for wild-type Poa annua was compared with

published psbA sequences for two dicotyledons and

three grasses. There were 76 base pair differences with

tobacco (Nicotiana plumbaginifolia), 72 with Arabidop-

Table 2. Herbicide reaction and psbAmutation status of 20 Poa annuabiotypes

Herbicide reaction of progeny

Diuron S and metribuzin S

Diuron S and metribuzin R

Diuron R and metribuzin unkn

Diuron R and metribuzin R

Diuron R and metribuzin S

a R=some or all progeny resistant, S

Pest Manag Sci 56:209±217 (2000)

sis thaliana (L) Heynh, 30 with maize, 26 with rice

(Oryza sativa L), and 13 with barley (Hordeum vulgareL). The deduced amino acid sequence for our

fragment was identical to those from corresponding

regions of the psbA genes of barley and maize except

for the Val219 to Ile change in the mutant. Amino acid

sequences for Arabidopsis, rice, and tobacco differed

from those for wild-type Poa annua only at residue

238, coding for arginine instead of lysine. The 13 silent

mutations between Poa annua and barley occurred at

nucleotides 153, 192, 198, 258, 409, 441, 504, 528,

624, 633, 732, 846 and 975. Homology at the nucleic

acid level is important for primer binding and

successful PCR ampli®cation. While our second (3'PCR) primer exactly matched the published nucleo-

tide sequences of tobacco, maize, rice, barley, and

Arabidopsis, the ninth position of our ®rst (5' PCR)

primer matched only the two dicotyledons, differing

from the three grasses (thymine in the primer vs

cytosine in the grasses). Because our 3' primer did not

give usable readings at a distance of 925 bases, we do

not know whether codon 99 of Poa annua psbA gene is

thymine or cytosine. Based on our fragment's overall

a

Number of

accessions

sequenced

Number with psbA

mutation (valine219

to isoleucine)

Number with

wild-type psbA

3 0 3

2 0 2

own 14 5 9

1 1 0

0 ± ±

=all progeny susceptible.

213

Figure 2. Consensus nucleotide sequence for psbA gene fragments of 14 wild-type Poa annua covering the herbicide-binding region of the D1 protein (middlelines), nucleotide sequence for the barley psbA gene where it differs from Poa annua (upper lines), and deduced amino acids (lower lines). The metribuzin- anddiuron-resistant mutant psbA sequence possessed a change of Val219 to Ile at the amino acid residue and nucleotide position (in the box) as a result of a changefrom GTA to ATA. Numbers at the right refer to the residue number of amino acids from the entire psbA gene. The underlined bases correspond to the third primer(5' CTCCTGTTGCAGCTGCTACT 3') we used for sequencing close to the herbicide binding region. We present here only the region that resulted in consistentsequences for all accessions, covering from amino acid residues 46 to 341 of the entire chloroplast psbA gene. Single letter amino acid code: A: alanine, C:cysteine, D: aspartate, E: glutamate, F: phenylalanine, G: glycine, H: histidine, I: isoleucine, K: lysine, L: leucine, M: methionine, N: asparagine, P: proline, Q:glutamine, R: arginine, S: serine, T: threonine, V: valine, Y: tyrosine, W: tryptophan.

LW Mengistu et al

closer homology to the grasses, however, and particu-

larly to barley, it seems probable that codon 99 in the

Poa annua psbA gene is cytosine, and that we had a

mismatch at the ninth position of our 5' PCR primer.

The six accessions that showed the Val219 to Ile

mutation came from two ®eld sites located 10 km

apart: two accessions from Glaser perennial ryegrass

and four from McLagan Bell Plain Rd perennial

214

ryegrass. These sites were well known for herbicide-

resistant P annua. Using randomly ampli®ed poly-

morphic DNA (RAPDs), we found that herbicide

selection pressure at these ®elds has reduced the

among population genetic variation in P annua.44 The

six accessions possessing the Val219 to Ile mutation

showed ®ve different RAPD banding patterns, with

the two accessions from Glaser perennial ryegrass

Pest Manag Sci 56:209±217 (2000)

psbA mutation in Poa annua resistant to metribuzin and diuron

having the same banding pattern.44 Interestingly, one

of the RAPD banding patterns was shared by a psbA

mutant at McLagan Bell Plain Rd perennial ryegrass

and psbA wild-types at Glaser perennial ryegrass and

McLagan Pugh Rd perennial ryegrass. RAPD banding

patterns of the six psbA mutants occurred in an

average of 14 individuals over the entire collection,

®ve time more frequently than those of the average

accession.44

4 DISCUSSIONFailure to ®nd psbA mutants of higher plants in the

®eld other than Ser264 to Gly has long puzzled

researchers. Our sequence analysis on herbicide-

resistant P annua accessions revealed that there are

biotypes of higher plants with site mutations other

than residue 264, and these biotypes resist PS II

inhibitors at ®eld rates. In addition to Poa annua's

short life cycle and signi®cant amount of outcrossing,

herbicide rates in western Oregon grass-seed crops

may have been nearly ideal for selection of this psbA

mutation. Grass-seed growers have applied 1 to

1.5kghaÿ1 atrazine, 2.2kghaÿ1 simazine and 1.1 to

2.2kg haÿ1 diuron for approximately 30 years. These

rates are limited by the tolerance of crops such as

perennial ryegrass to these herbicides. We do not yet

know whether the Val219 to Ile mutant accessions also

possessed additional resistance from the nuclear-

controlled mechanism of resistance apparently present

in other accessions. Selection in the ®eld may have

played a role in combining multiple resistant mechan-

isms into single individuals.

The number of mutant types within the accessions

we sequenced is far higher than expected by mutation

rates alone of about 10ÿ5 per generation. For example,

out of 20 P annua accessions we sequenced for psbA,

three were susceptible to metribuzin and diuron, 14

were resistant to diuron with reaction to metribuzin

untested, two were resistant to metribuzin but

susceptible to diuron, and one was resistant to both

metribuzin and diuron. Of the 14 diuron-resistant,

metribuzin-untested biotypes, ®ve exhibited a Val219

to Ile substitution in their psbA gene. Sequences from

the remaining nine diuron-resistant biotypes and the

two metribuzin-resistant biotypes were wild-type in

their psbA gene. The metribuzin-and diuron-resistant

biotype possessed the mutation at the position we have

indicated. It is likely that more psbA mutants would

have been found had we sequenced all diuron-resistant

accessions within our population. We suspect that the

rate and pattern of herbicide use by western Oregon

grass-seed growers must have provided suitable selec-

tion pressure to select these mutants. Higher rates

might have killed the mutants, while lower rates might

have allowed the susceptible types to survive.

The existence of both maternally inherited, single-

gene, site-mutation herbicide resistance and appar-

ently nuclear controlled resistance for the same

herbicides within populations of P annua in western

Pest Manag Sci 56:209±217 (2000)

Oregon grass-seed crops will complicate the problem

of addressing herbicide resistance. Gressel et al46

emphasized that `the tendency to cut dose rate is

increasing resistance due to multiple cumulative

events (polygenic, ampli®cation, or sequential muta-

tions within a gene).' The dilemma here is whether

crop rotation or rate of herbicide use should target the

major gene or minor genes with cumulative effects,

since both types exist in the same populations.

The mutation of the herbicide-binding D1 protein

at residue 264 has been characterized to cause

inhibition of the electron transport system, leading

the mutant to be less ®t than susceptible biotypes,

especially without herbicide use. However, the Val219

to Ile mutation we report now has been characterized

as causing resistance to herbicides but having no effect

on electron transfer. Because the mutant may be

equally ®t as the wild-type, use of no herbicide or low

selection pressure of herbicide may fail to reduce the

frequency of this mutant in the populations. Another

aspect of the mutation of Val219 to Ile is its capability of

resisting more than one kind of herbicide, as it is

reported to result in resistance to metribuzin, atrazine,

diuron and ioxynil in various organisms. Unlike the

Ser264 to Gly change in other weed species that exhibit

negative cross-resistance to diuron, the absence of this

in Val219 to Ile mutants is a problem to growers, as it

eliminates several alternative herbicides.

The degree of resistance by site mutation of Val219

to Ile has been reported to range from 10- to 20-fold

which is close to the level of resistance found via

detoxi®cation of herbicides by enzyme action through

polygenic effects. This would be an advantage if high

doses of herbicides could be used to delay herbicide

resistance due to minor genes with cumulative effects

and mutants of the kind we found. However, grass-

seed growers of western Oregon usually grow per-

ennial ryegrass or tall fescue that would be susceptible

to herbicides themselves should rates be increased

substantially above those currently used. One option

may be to rotate to crops like orchardgrass that better

tolerate those herbicides or tolerate other herbicides

such as pronamide, and use higher doses of herbicides

to eliminate resistant weeds from their ®elds. Alter-

native crops like meadowfoam (Limnanthes species) or

clovers (Trifolium species) are another option, allowing

use of herbicides with different modes of action. The

alternative is that continued increases in populations

of P annua biotypes with multiple herbicide resistance

in western Oregon grass-seed crops may affect seed

producers and companies, leading to shifts in produc-

tion, increased seed cleaning costs, and decreased

pro®tability.

We believe that more populations of P annua must

be studied to determine the level and type of resistance

in the speci®c ®elds. Monitoring is needed to avoid

contamination of non-infested ®elds. The procedure

we presented here could be further modi®ed and

simpli®ed for the ef®cient screening of a large number

of samples for speci®c mutations, such as Val to Ile.

215

LW Mengistu et al

ACKNOWLEDGEMENTSThe authors thank the Oregon Seed Council for partial

funding of this project. Contribution of the Agricul-

tural Research Service, USDA, in cooperation with the

Agricultural Experimental Station, Oregon State Uni-

versity Tech. Paper No. 11504 of the latter.

REFERENCES1 Trebst A, Inhibitors in electron ¯ow: Tools for the functional and

structural localization of carriers and energy conservation sites.

Methods Enzymol 69:675±715 (1980).

2 Arntzen CJ, P®ster K and Stienback KE, The mechanism of

chloroplast triazine resistance: Alterations in the site herbicide

action, in Herbicide Resistance in Plants, ed by LeBaron HM and

Gressel J, John Wiley & Sons, New York. pp 185±214 (1982).

3 Velthuys BR, Electron-dependent competition between plasto-

quinone and inhibitors for binding to photosystem II. FEBS

Lett 126:277±281 (1981).

4 P®ster K, Steinback KE, Gardner G and Arntzen CJ, Photo-

af®nity labelling of a herbicide receptor protein in chloroplast

membranes. Proc Natl Acad Sci USA 78:981±985 (1981).

5 Zurawski G, Bohnet H, Whitfeld P and Bottomley W, Nucleotide

sequence of the gene for the Mr 32000 thylakoid membrane

protein from Spinacia oleracea and Nicotinia debneyi predicts a

totally conserved primary translocation protein of Mr 38 950.

Proc Natl Acad Sci USA 79:7699±7703 (1982).

6 Erickson JM, Rahire M and Rochaix JD, Herbicide resistance

and cross-resistance: Changes at three distinct sites in the

herbicide binding protein. Science (Washington) 228:204±207

(1985).

7 Driesel AJ, Speirs J and Bohnert HJ, Spinach chloroplast mRNA

for a 32000 Dalton polypeptide. Size and localization on the

physical map of the chloroplast DNA. Biochem Biophys Acta

610:287±310 (1980).

8 Ryan GF, Resistance of common groundsel to simazine and

atrazine. Weed Sci 18:614±616 (1970).

9 LeBaron HM, Distribution and seriousness of herbicide-resistant

weed infestations worldwide, in Herbicide Resistance in Weeds

and Crops, ed by Caseley JC, Cussans GW and Atkin RK,

Butterworth-Heinemann, Oxford. pp 27±43 (1991).

10 Heap IM, The occurrence of herbicide-resistant weeds world-

wide. Pestic Sci 51:235±243 (1997).

11 Shimabukuro RH, Atrazine metabolism in resistant corn and

sorghum. Plant Physiol 43:1925±1930 (1968).

12 Ali A and Machado VS, A comparative analysis of leaf

chlorophyll ¯uorescence, Hill reaction activity and 14C-

atrazine tracer studies to explain differential triazine suscept-

ibility in wild turnip rape (Brassica campestris) biotypes. Can J

Plant Sci 644:707±713 (1984).

13 Gressel J, Herbicide tolerance and resistance: Alteration of site of

activity, in Weed Physiology, Vol II Herbicide Physiology, ed by

Duke SO, CRC Press, Boca Raton, Florida. pp 159±189

(1985).

14 Gronwald JW, Resistance to photosystem II inhibiting herbi-

cides, in Herbicide Resistance in Plants: Biology and Biochemistry,

ed by Powles SB and Holtum JAM, Lewis Publishers, Boca

Raton, Florida. pp 27±60 (1994).

15 Trebst A, The molecular basis of resistance to photosystem II

herbicides, in Herbicide Resistance in Weeds and Crops, ed by

Caseley JC, Cussans GW and Atkin RK, Butterworth-

Heinemann, Oxford. pp 145±164 (1991).

16 Oettmeier W, Masson K, Fedtke C, Konze J and Schmidt RR,

Effect of photosystem II inhibitors on chloroplasts from species

either susceptible or resistant towards s-triazine herbicides.

Pestic Biochem Physiol 18:357±367 (1982).

17 Fuerst EP, Arntzen CJ, P®ster K and Penner D, Herbicide cross-

resistance in triazine-resistant biotypes of four species. Weed

Sci 34:344±353 (1986).

18 Schwenger-Erger C, Thiemann J, Barz W, Johanningmeier U

216

and Naber D, Metribuzin resistance in photoautotrophic

Chenopodium rubrum cell cultures. Characterization of double

and triple mutations in the psbA gene. FEBS Lett 329:43±46

(1993).

19 Kless H, Shamir MO, Malkin S, McIntosh L and Edelman M,

The D-E region of the D1 protein is involved in multiple

quinone and herbicide interactions in photosystem II. Bio-

chemistry 33:10501±10507 (1994).

20 Tietjen KG, Kluth JF, Andree R, Haug M, Lindig M, MuÈller

KH, Wroblowsky HJ and Trebst A, The herbicide binding

niche of photosystem II ± A model. Pestic Sci 31:65±72 (1991).

21 Hirschberg J and McIntosh L, Molecular basis of herbicide

resistance in Amaranthus hybridus. Science (Washington).

222:1346±1349 (1983).

22 Hirschberg J, Bleecker A, Kyle DJ and McIntosh L, The

molecular basis of triazine herbicide resistance in higher plant

chloroplasts. Z Naturforsch 39:412±420 (1984).

23 GolouÈbinoff P, Edelman M and Hallick RB, Chloroplast coded

atrazine-resistance in Solanum nigrum: psbA loci from suscep-

tible and resistant biotypes are isogenic except for a single

codon change. Nucleic Acids Res 12:9489±9496 (1984).

24 Erickson JM, Rahire M, Bennoun MP, Delepelaire P, Dines B

and Rochaix JD, Herbicide resistance in C reinhardii results

from a mutation in the chloroplast gene for the 32 kiloDalton

protein in photosystem II. Proc Natl Acad Sci USA 81:3617±

3621 (1984).

25 Golden SS and Heselkorn R, Mutation to herbicide resistance

maps within the psbA gene of Anacystis nidulans R2. Science

(Washington) 229:1104±1107 (1985).

26 Van Oorschot JLP, Chloroplastic resistance of weeds to triazines

in Europe, in Herbicide Resistance in Weeds and Crops, ed by

Caseley JC, Cussans GW and Atkin RK, Butterworth-

Heinemann, Oxford. pp 87±101 (1991).

27 Rubin B, Herbicide resistance in weeds and crops, progress and

prospects, in Herbicide Resistance in Weeds and Crops, Vol II, ed

by Caseley JC, Cussans GW and Atkin RK, Butterworth-

Heinemann, Oxford. pp 387±414 (1991).

28 Trebst A, The molecular basis of plant resistance to photosystem

II herbicides, in Molecular Genetics and Evolution of Pesticide

Resistance, ed by Brown TM, ACS symposium series 645,

Washington, DC. pp 44±51 (1996).

29 McNally S, Bettini P, Sevignac M, Darmency H, Gasquez J and

Dron M, A rapid method to test for chloroplast DNA

involvement in atrazine resistance. Plant Physiol 83:248±250

(1987).

30 Gasquez J, Mouemar AAL and Darmency H, Triazine herbicide

resistance in Chenopodium album L. Occurrence and charac-

teristics of an intermediate biotype. Pestic Sci 16:390±395

(1985).

31 Bettini P, Sevignac M, McNally S, Darmency H, Gasquez J and

Dron M, Molecular mechanisms involved in the appearance of

atrazine resistance in Chenopodium album. J Cell Biochem 10:44

(1986).

32 Barros MDC and Dyer TA, Atrazine resistance in grass Poa

annua is due to a single base change in the chloroplast gene for

the D1 protein of photosystem II. Theor Appl Genet 75:610±

616 (1988).

33 Arntzen CJ, Ditto CL and Brewer PE, Chloroplast membrane in

triazine-resistant Amaranthus retro¯exus biotypes. Proc Natl

Acad Sci USA 76:278±282 (1979).

34 Bowes J, Crofts AR and Arntzen CJ, Redox reactions on the

reducing side of photosystem II in chloroplasts with altered

herbicide-binding properties. Arch Biochem Biophys 200:303±

308 (1980).

35 Ort OR, Ahrens WH, Martin B and Stoller EW, Comparison of

photosynthetic performance in triazine-resistant and suscep-

tible biotypes of Amaranthus hybridus. Plant Physiol 72:925±930

(1983).

36 Sundby C, Chow WS and Anderson JM, Effects on photosystem

II function, photoinhibition, and plant performance of the

spontaneous mutation of serine 264 in photosystem II reaction

Pest Manag Sci 56:209±217 (2000)

psbA mutation in Poa annua resistant to metribuzin and diuron

center D1 protein in triazine-resistant Brassica napus L. Plant

Physiol 103:105±113 (1993).

37 Hart JJ and Stemler A, Similar photosynthetic performance in

low light-grown isonuclear triazine-resistant and susceptible

Brassica napus L. Plant Physiol 94:1295±1300 (1990).

38 Holt JS and Thill DC, Growth and productivity of resistant

plants, in Herbicide Resistance in Plants: Biology and Biochem-

istry, ed by Powles SB and Holtum JAM, Lewis Publishers,

Boca Raton, Florida. pp 293±316 (1994).

39 Lien S, McBride JC, McBride AC, Togasaki RK and Pietro AS,

A comparative study of photosystem II speci®c inhibitors: The

differential action on a DCMU resistant mutant strain of C

reinhardi, in Photosynthetic Organelles, Plant & Cell Physiol

(Special Issue) 243±256 (1977).

40 Darmency H, Genetics of herbicide resistance in weeds and

crops, in Herbicide Resistance in Plants: Biology and Biochemistry,

ed by Powles SB and Holtum JAM, Lewis Publishers, Boca

Raton, Florida. pp 263±297 (1994).

41 Mueller-Warrant GW, Treatment of diuron-resistant annual

bluegrass in a perennial ryegrass seed crop, in 1996 Seed

Production Research at Oregon State University, USDA-ARS

Pest Manag Sci 56:209±217 (2000)

Cooperating, ed by Young III, WC, Department Crop and Soil

Science Ext/CrS 110. pp 29±32 (1997).

42 Heap IM, Multiple herbicide resistance in annual bluegrass (Poa

annua). WSSA Abstracts 42:56 (1995).

43 Gamroth DM, Brewster BD and Mallory-Smith CA, Herbicide

banding in grass-seed crops, in 1996 Seed Production Research at

Oregon State University, USDA-ARS Cooperating, ed by Young

III, WC, Department Crop and Soil Science Ext/CrS 110. p 33

(1997).

44 Mengistu LW, Genetic diversity and herbicide resistance in

annual bluegrass (Poa annua L). PhD Thesis, Oregon State

University, Corvallis, Oregon pp 1±122 (1999). Dissertation

abstract no. AAT 9842465.

45 Steiner JJ, Poklemba CJ, Fjellstrom RG, and Elliott LF, A rapid

one-step DNA extraction technique for PCR and RAPD

analysis. Nucleic Acids Res 23:2569±2570 (1995).

46 Gressel J, Gardner SN and Mangel M, Prevention versus

remediation in resistance management, in Molecular Genetics

and Evolution of Pesticide Resistance, ed by Brown TM, ACS

symposium series 645, Washington, DC. pp 169±186 (1996).

217