1 Expression and Secretion of Recombinant Ovine Somatotropin in Escherichia coli A THESIS SUBMITTED TO THE UNIVERSITY OF THE PUNJAB IN FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN BIOLOGICAL SCIENCES By Faiza Gul School of Biological Sciences University of the Punjab Lahore, Pakistan 2012
193
Embed
prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7924/1/Faiza Gul full Final thesis.pdfprr.hec.gov.pk
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
Expression and Secretion of Recombinant
Ovine Somatotropin in
Escherichia coli
A THESIS SUBMITTED TO
THE UNIVERSITY OF THE PUNJAB
IN FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN
BIOLOGICAL SCIENCES
By
Faiza Gul
School of Biological Sciences
University of the Punjab
Lahore, Pakistan
2012
i
In the Name of Allah, the Merciful, the Compassionate.
Read! In the Name of Thy Lord. [Quran 96:1]
ii
Dedicated to My Dear loving Parents
Mr & Mrs M.Ajmal Khan
iii
CERTIFICATE
This is to certify that the research work described in this thesis is the original work of Faiza
Gul and has been carried out under my supervision. I have personally gone through all the
data/results/materials reported in the manuscript and certify their correctness/authenticity. I further
certify that the material included in this thesis have not been used in part or full in a manuscript
already submitted or in the process of submission in partial/complete fulfillment of the award of any
other degree from any other institution. I also certify that the thesis has been prepared under my
supervision according to prescribed format and I endorse its evaluation for the award of Ph.D. degree
through the official procedures of the University.
(Prof. Dr. M. Waheed Akhtar) Research Supervisor
iv
ACKNOWLEDGEMENT
All Praise Allah Subhanahu wa Tala, Master of this Universe, and Master of
all mankind, truly without Him, man is at loss. Without His guidance there is
no light, without His protection there is no sanctuary and without His
Knowledge there is no real knowledge. Without doubt, one can not praise Al
Khaliq enough. He says “And I did not create the jinn and mankind except to
worship Me.” [Quran 51:56] Without doubt, all praises and thanks are to
Allah, the Ever-Lasting.
The writing of this dissertation has been the most significant academic
challenge I have had to face. Without the support, patience and guidance of
the following people, this study would not have been completed. It is to them
that I owe my deepest gratitude.
Above all, my sincere gratitude to my honourable supervisor Prof. Dr. M.
Waheed Akhtar, whose unsurpassed knowledge and untiring guidance have
seen this thesis through. I have heartfelt gratefulness to him for giving me the
opportunity to work in his laboratory. His profound insight, patience,
dynamic supervision and encouraging approach have granted me the
confidence to face the challenges of the Ph.D. I’m also thankful to our
Director General Dr. M. Akhtar and all the directors of School of Biological
Sciences, University of the Punjab, Lahore for their invaluable help and
guidance .
v
I am deeply indebted to Dr. Saima Sadaf for her assistance and support. I also
appreciate the role Dr.Mahjabeen Saleem and Dr. Farhat Zaheer has played
in my PhD, for their moral support and help whenever I faced a problem. I
am also thankful to Dr.Naeem Rasheed for his valuable guidence specially for
primer designing.
I am thankful to (late) Dr. Mustaq Kaderbhai whose critical guidance,
suggestions and encouragement have been invaluable. It has been a great
pleasure to have guidence from such wonderful personality. His sudden
passing left me in great sorrow but his wife Dr.Naheed Kaderbhai supported
me and its all her continuous effort that I could finish the last part of my
work.as her numerous educational discussions, feedback and suggestions have
played a fundamental part in shaping my views, knowledge and
understanding. It has also been a pleasure to have worked with such
wonderful people. Sharing of ideas, thoughts and suggestions have vastly
contributed to the stance I have taken in this thesis. I thank both of them for
being a reflective and critical contributor.
My dear parents, who made me the very person I am, instilling core values of
hard-work, perseverance, resilience and patience - this PhD is really about
them and the fruits of their effort – for that I am forever indebted. My deepest
gratitude is also to my Ami Jan (Mrs.Neelam Durrani) for the support,
encouragement and comfort for when I needed it most. My loving husband
vi
Ali, without whose encouragement support and love ,this thesis could never
have continued – for the kind words, care and confidence in me, for this, my
mere expression of thanks does not suffice.
My brothers and sisters and their families have given me their unequivocal
support throughout. Rizwan, Arjumand, Rehan and Mehran, their enduring
comfort during all times is forever appreciated. The joyous times spent
together are the best memories. Special thanks to all my cousins, elders and
my in-laws in particular my new sister Sadia Durrani. Finally, to my late
dear grandparents especially my Daadi Jan, Masooma Khanum and late
father-in-law Mahmood Ahmed Khan Durrani, I know they would have been
proud of my accomplishments – thank you for the dreams and aspirations that
have enabled this work to have materialised.
I would also like to thank my dear friends, Roquyya “My twin” Gul, Sadaf
Zaidi, Nadia Azhar, Dr. Mahjabeen Saleem, Dr. Saadia Shazad Alam, Gul
Sher Muhammad Tahir , who have shown me tremendous support, above all,
they have been true friends, standing by me in all phases of my education and
career. I can never forget the tea time and walks on the jogging track.
Penultimately, I’d like to thank my little baby, Muhammad Ahmed who
taught me the skill of multi-tasking between nappy changes, feeds and my
write-up. I hope he too has learned something here.I am also appreciative of
all my other laboratory colleagues specially Annie, Hooria, Hina Farheen,
vii
Deeba, Altaf and Sajjad for the nice educational and fun time discussions. I
would also like to thank to all the technicians for their aid in anything I
needed. I am especially thankful to Muhammad “M.D. Sahib” Deen, Irfan
Sahab and Afzal for their timely support in the process of thesis submission.
I would like to end my acknowledgement with a supplication:
“My Lord! Inspire me and bestow upon me the power and ability that I may
be grateful for Your Favours which You have bestowed on me and on my
parents, and that I may do righteous good deeds that will please You and
admit me by Your Mercy among Your righteous slaves” (Quran 27:19)
FAIZA GUL
viii
SUMMARY
The current study involves cloning, sequence analysis, expression, secretion, purification and
different factors influencing the secretion of ovine growth hormone (oGH) gene isolated from
local ovine breed (Lohi). On the basis of conserved sequences, two forward and one reverse
primers were designed for the amplification of oGH gene. The forward primers contained NdeI,
NcoI restriction sites whereas the reverse primer contained a BamHI site at their 5’ end. Total
RNA was isolated from pituitary gland of Lohi by using Guanidium-thiocyanate-chloroform
extraction method. cDNA was synthesized by RT-PCR using gene specific primers. Moreover,
genomic DNA was isolated from the blood sample of Lohi and was amplified by using four sets
of primers designed on the basis of conserved sequence of the ovine growth hormone (oGH)
gene. These were ligated into pTZ57R/T by the dT. dA tailing technique and used to transform
into E. coli DH5α. The sequences of the DNA obtained from multiple colonies were compared
with already published ovine GH gene sequence using multiple sequence alignment software
“Clustal W”. The sequence analysis revealed only one amino acid change when compared to
previously reported OaST (Ovis aries somatotropin) or oGH gene sequences of Indian and
Australian breeds. It showed 99% homologies with bubaline, bovine and 100 percent homology
with caprine GH genes of the local breeds. The sequence of the GH of Lohi was submitted to
"Data bank of Japan" which bears an accession number AB244790.
In the present study, we report secretion of recombinant oGH into the periplasmic space and
inner membrane of E. coli under the influence of variant signal sequences. For periplasmic
translocation the recombinant proteins were expressed under the influence of pelB leader
sequence of pET 22b vector. The effect of different factors i.e., glycerol in the medium, use of E
.coli strain BL21 DE3 and pLys S ,chemical chaperon (ZnCl2) and IPTG concentration were
studied to enhance the expression while osmotic shock conditions were also optimized and
ix
studied the effect of glycerol and ZnCl2 concentration on the release of oGH by using freeze
thaw method. Best result of 22% expressed roGH on 12% SDS-PAGE was observed at 20M
(final concentration) IPTG after 4 hrs of fermentation at 370C in LB modified medium with
50µM ZnCl2 in BL21DE3 E. coli strain. The optimized freeze thaw method including 25%
glycerol with 50µM ZnCl2 enhanced the relase of oGH upto 24% in the periplasmic space of E.
coli. The oGH thus found was further purified by FPLC and authenticated by Western blot
analysis. Although the recovery of oGH was enhanced but still there was a need to enhance the
production of accurate size (22 kDa) growth hormone which was bit higher (25 kDa) by using
pelB leader sequence.
For this purpose different signal peptides i.e., DsbA, STII and natural oGH signal peptide were
utilized. Amongst the signal sequences the DsbA signal sequence was found to exhibit the best
expression, size and secretion of oGH into the inner membrane of E. coli. We further studied the
expression of oGH and targeting to the inner membrane using signal sequence (DsbA) in E. coli
cell. Factors such as temperature, IPTG induction, expression conditions were studied and
showed diverse optical density with different media compositions. The optimum expression level
of oGH in terrific broth medium was at 25ºC on induction with 20μM IPTG in early logarithmic
phase. SDS-PAGE analysis of expression and subcellular fractions of recombinant constructs
revealed the translocation of oGH to the inner membrane of E. coli with DsbA signal sequence
at the N terminus of roGH. The protein was easily solublized by 40% acetonitrile with ~90%
purity and was identified by Western blot and analysis on MALDI/TOF confirmed a size of
21059Da. Relatively high soluble protein yield of 65.3gm/L of oGH was obtained. The
biological function of oGH was confirmed by HeLa cell line proliferation. It was observed that
DsbA signal sequence on the basis of its hydrophobicity gave best results of 22kDa protein in
membrane bounded form as compared to pelB and reference native signal sequence of oGH
which resulted in 25kDa oGH secreted mainly into cytoplasm.
x
Despite of cost effective single step purification we encountered a problem with low yield. We
developed a novel strategy for the high yield of functional recombinant ovine growth hormone
(roGH) directed to the inner membrane of E. coli. In order to enhance the yield of soluble
fraction, bacterial cells were grown under osmotic stress (4% NaCl in terrific broth medium) and
effect of compatible solutes (sorbitol, glycine betine, glycylglycine and mannitol) were studied
on the soluble expression of roGH. Other factors; temperature, induction time, induction by
IPTG and lactose were also studied. It was observed that fermentation of roGH construct with
DsbAss was best achieved with 0.6M mannitol, 50μM ZnCl2, 50mM glycylglycine at the time of
induction with 50μM IPTG in the early logarithmic phase at OD600 ~3.10 in TB medium at 25ºC
in shaking flask culture at 150rpm. These optimized conditions resulted in very high expression
~32% of soluble roGH which was recovered by ultra centrifugation (density centrifugation) from
the inner membrane of E. coli. The unbelievably high yield, 443mg/L was obtained as compared
from previos yield. The roGH was confirmed by Western blot analysis .
Furthermore the effect of amino acid substitution in the tripartite structure of DsbA signal
sequence (DsbAss) on co-translation of recombinant oGH in E. coli was studied. Six amongst
the eight constructs were designed on the basis of increasing hydrophobicity in H domain of
DsbA signal sequence to make it more efficient for the translocation of oGH through SRP (signal
recognition particle) mechanism. For this purpose all the alanines in the hydrophobic domain of
DsbA signal sequence were replaced by Isoleucine one by one, while lysine in the N terminal
and serine in the C-terminal regions were substituted by arginine and cysteine respectively. The
substitution of arginine in the N-terminal resulted in very low expression and secretion while
cysteine substitution in the C region totally impaired the expression and secretion of the
recombinant protein. it was observed that not only the hydrophobicity but the position of amino
acid in the hydrophobic core also effects the cleavage of signal sequence from recombinant
product.
xi
The substitution of alanine with the isoleucine residue in H domain of DsbA signal sequence
resulted in; (a) at position 11 with respect to signal peptidase site in the H domain impaired the
correct processing of oGH protein while (b) isoleucine at position 9 resulted in correctly
processed recombinant oGH protein in the inner membrane.The results showed that the
replacement of alanine amino acid at position 11 with reference to signal peptidase site in the
hydrophobic core of the DsbA ss interferes with the binding of DsbA ss hydrophobic region to
Ffh protein of SRP. This resulted in weak or no binding of Ffh with DsbA ss and consequently
oGH protein was localised in the cytoplasmic fraction rather than membrane. Thus, the gene
mutation from alanine residue to isoleucine specifically at position 11 with respect to signal
peptidase site changed the whole mechanism of protein translocation through DsbA ss. It was
hypothesized that alanine at position number 11 with respect to the signal peptidase site is crucial
for SRP routing of recombinant proteins .
xii
Table of Contents
INTRODUCTION & LITERATURE REVIEW ............................................................................................ 1
1.2 Secretion of recombinant protein in E.coli ....................................................................................................................... 3
1.3 Ovine breed of Pakistan .................................................................................................................................................... 5
1.4 Impact of our study on the economy of Pakistan ............................................................................................................. 6
1.5 Review of Literature .......................................................................................................................................................... 7
1.5.1 Structural and functional aspects of GH ........................................................................................................... 7
1.5.2 Cloning and expression of GH in bacterial systems ..................................................................................... 9
1.5.3 Secretion of growth hormone in E.coli ...................................................................................................... 12
1.5.3.1 Type I secretion systems ................................................................................................................ 14
1.5.3.2 Type II secretion Mechanism ........................................................................................................ 14
1.5.4 Signal sequences ............................................................................................................................................ 18
1.5.5 Expression and Purification of secreted protein in E.coli. ............................................................................... 19
1.5.6. Advantages of getting soluble proteins ......................................................................................................... 24
1.6 AIMS AND OBJECTIVES .................................................................................................................................................... 26
MATERIALS AND METHODS.................................................................................................................. 28
2.1 Sample collection and storage ................................................................................................................................ 29
2.2 Chemicals and kits ................................................................................................................................................... 29
2.3 Isolation of total RNA from pituitary sample ......................................................................................................... 30
xiii
2.4 Formaldehyde agarose gel electrophoresis ............................................................................................................ 31
2.5.1 Primer designing.............................................................................................................................................. 32
2.6 DNA extraction from agarose gel .................................................................................................................................... 34
2.6.1 Purification of PCR product ............................................................................................................................. 34
2.7 Cloning in pTZ57R/T vector ............................................................................................................................................. 35
2.9.2 Analysis of Full-Length ST Gene....................................................................................................................... 40
2.9.2.1 Extraction of genomic DNA ............................................................................................................ 40
2.9.2.2 PCR amplification of GH gene ...................................................................................................... 42
2.10 Bioinformatics tools for sequence analysis................................................................................................................... 43
2.11 Mini-preparation of plasmid DNA ................................................................................................................................. 43
2.12 Restriction analysis of pTZ-oGH clones ......................................................................................................................... 44
2.13 Restriction analysis of pET22b (+) ................................................................................................................................. 45
2.14 Ligation and transformation in DH5α and BL21 Codon + strains ................................................................................. 45
2.15 Expression of poGH clones ............................................................................................................................................ 46
xiv
2.16 SDS-Polyacrylamide Gel Electrophoresis (PAGE) .......................................................................................................... 47
2.17 Western transfer and immunoblot analysis ................................................................................................................. 49
2.18 Protein estimation ......................................................................................................................................................... 50
2.19 Primer designing for translocation of Ovine ST gene into periplasmic space.............................................................. 50
2.20 Subcellular fractionation of oGH ................................................................................................................................... 52
3.1 Genetic Analysis of oGH gene.......................................................................................................................................... 58
3.1.1 Extraction of genomic DNA ............................................................................................................................. 58
3.1.2 PCR amplification of oGH gene ....................................................................................................................... 58
3.1.3 Sequence analysis of oGH ............................................................................................................................... 59
3.1.3.1 Sequence comparison of oGH at amino acid level......................................................................... 61
3.1.3.2 Comparison of oGH gene at Nucleotide level ................................................................................ 64
3.1.4 Secondary structure analysis of oGH .............................................................................................................. 66
3.1.5 Hydropathy profile of oGH .............................................................................................................................. 67
3.1.6 Three Dimensional structure of oGH............................................................................................................... 68
3.2 cDNA synthesis , cloning and Periplasmic Expression of oGH ...................................................................................... 69
3.2.1 Isolation and purity of total RNA ..................................................................................................................... 69
3.2.2 RT-PCR amplification of cDNA ........................................................................................................................ 70
3.2.3 T/A cloning of oGH ......................................................................................................................................... 71
3.3 Expression of poGH ......................................................................................................................................................... 72
3.3.1 Restriction analysis of pTZ-oGH ...................................................................................................................... 72
xv
3.3.2 Cloning in pET22 b ........................................................................................................................................... 73
3.3.3 colony PCR of poGH......................................................................................................................................... 73
3.3.4 Shake flask fermentation of poGH-1 construct .............................................................................................. 75
3.4 Periplasmic expression of oGH ........................................................................................................................................ 75
3.4.1 Expression of poGH-2 ...................................................................................................................................... 76
3.4.2 Effect of different factors on the expression of oGH ...................................................................................... 77
3.4.2.1 Effect of ZnCl2................................................................................................................................. 77
3.4.2.2 Effect of IPTG concentration .......................................................................................................... 77
3.4.2.3 Effect of Ecoli Strain on expression of ovine growth hormone...................................................... 78
3.4.2.4 Optimization of somotic shock conditions ..................................................................................... 79
3.4.2.5 Effect of Glycerol ............................................................................................................................ 80
3.4.2 Purification of poGH-2..................................................................................................................................... 81
3.5.3 T/A cloning and construction of expression plasmid poGH-3,4,5 ................................................................... 85
3.5.4 Transformation and selection of high expression strains ............................................................................... 86
3.5.5 Expression of poGH-3,4 and 5 ......................................................................................................................... 87
3.5.5.1 Subcellular fractionation of poGH-3-5 constructs ......................................................................... 88
3.5.6 Computational analysis of signal sequences of poGH-2,3,4& 5 constructs .................................................... 91
3.6 Effect of medium composition on expression of poGH-3 ............................................................................................... 94
3.6.1 Effect of LB,TB & M9NG medium on the expression of poGH-3 ..................................................................... 94
3.6. 2 Effect of temperature on poGH3 construct ................................................................................................... 96
3.6.3 Effect of induction time and IPTG concentration on poGH3 construct........................................................... 96
3.7 Enhanced production of roGH ......................................................................................................................................... 97
3.7.1 Effect of compatible solute on the expression of poGH-3 construct .............................................................. 99
xvi
3.7.1.1 Optimization of soluble roGH expression using compatible solutes(Glycylglycine , glycine
betaine,sorbitol and Mannitol ................................................................................................................... 99
3.7.2 Production of soluble roGH in TBC optimized medium................................................................................ 101
3.7.2.1 Effect of temperature .................................................................................................................. 102
3.7.2.2 Effect of IPTG and Lactose as an inducer .................................................................................... 103
3.7.2.3 Effect of induction time .............................................................................................................. 104
3.7.3 Subcellular fractionation of poGH-3 construct.............................................................................................. 104
3.8 Effect of amino acid alterations in DsbA signal sequence on poGH expression and secretion ................................... 107
3.8.1 PCR amplification and Cloning of pOaST varying constructs ......................................................................... 107
3.8.2 Construction of Expression plasmid poGH3-I-VIII ......................................................................................... 109
3.8.3 Expression of poGH-3-I-VIII ........................................................................................................................... 109
3.8.4 The expression of DsbA ss constructs with substitution of alanine with isoleucine in the H domain .......... 110
3.8.5 DsbA ss constructs with substitution of serine with cysteine in the C domain ............................................. 113
3.8.6 DsbA ss constructs with substitution of lysine with arginine in the N domain ............................................. 114
3.8.7 Purification of oGH from poGH-3-II construct............................................................................................... 115
4.1 Characterization of oGH gene........................................................................................................................................ 122
4.2 periplasmic Expression of roGH..................................................................................................................................... 124
4.3 Secretion of oGH into the inner membrane of E.Coli. .................................................................................................. 128
4.4 Effect of medium composition on the expression and secretion of oGH in E.coli ....................................................... 131
4.5 Effect of mutation in DsbA signal sequence on the expression and secretion of OaST .............................................. 135
4.6 Purification and Biological activity Assessment............................................................................................................ 138
Capital letters (exons) small letters (introns), mature peptide in green colour, red colour shows signal nucleotide region
and purple shows stop codon. It shows 5 exons and 4 introns
All the exons were united to get the amino acid sequence of oGH gene.which comprises of
217 amino acid in which first 26 are of signal sequence and rest of 191 are mRNA of oGH.
Figure 8.Amino acid sequence of oGH Amino acid sequence .oGH shows that it comprises of 217 amino acid.While mature hormone comprises 191 amino acids start
from AFPAM in first row.
61
(a)
(b)
Figure 9.amino acid sequence of oGH. (a) Amino acid sequence of oGH isolated from local ovine breed Lohi. (b) Nucleotide sequence of oGH.
3.1.3.1 Sequence comparison of oGH at amino acid level
Amino acid sequence of ovine growth hormone isolated from local breed (Lohi) showed
that it is comprises of 191 amino acids, calculated molecular weight of 21.85kDa while
isoelectric point was 7.86 when analyzed on( web.expasy.org/protparam/). This sequence was
than aligned with locally isolated growth hormone sequences of caprine and bubaline breeds of
Pakistan. It was analyzed that amino acid sequence of ovine Lohi breed is same for GH gene
isolated from local breed of caprine and has difference with local breed of bubaline at positions
9, 130 and 140 as shown in Fig.10.
62
Figure 10.Comparison of growth hormones of ovine capricorn and bubaline
Comparison of 3 locally isolated growth hormones of ovine, caprine and bubaline at amino acid level.
The amino acid sequence of Pakistani ovine breeds (Lohi) accession no. AB244790
showed difference with the amino acid sequence of growth hormone isolated from Australian
and Indian breeds when compared on Clustal W 1.81 for sequence alignment
(www.clustal.org/clustal2/). It showed variation of one amino acid at position 147 where
threonine is replaced with arginine as shown in Fig.11.
Figure 11,Amino acid sequence comparison. .Amino acid sequence comparison of Lohi (row 1) with Indian (row 2) accession number NM-001009315 and Australian accession
number S50877 (row3) breeds
63
Ovine growth hormone sequence was compared with the growth hormone sequence of the
species of family Bovidae and other species of class mammalian.
The secondary structure of ovine growth hormone predicted by chou-fasman rule. H is alpha helix, E is beta sheet and C
is coil
67
3.1.5 Hydropathy profile of oGH
The hydropathy profile of ovine growth hormone was analyzed by using kyte Doolittle
hydropathy plot . It showed that 60 % of the growth hormone is hydrophobic, while the rest were
those containing either a charged or an uncharged polar side chain as shown in Fig.15.
Figure 15.The hydropathy plot of oGH. The hydropathy plot of OST using window size 9, each peak above the central line shows that part of the hormone is
hydrophobic.
68
3.1.6 Three Dimensional structure of oGH
Further, predicted three-dimensional (3-D) structure of oGH showed the presence of four
α-helices, anti-parallel and tightly packed to form a four-helix bundle a structure (Fig.16). This
peculiar structure is very similar to known structures of ovine, caprine, bovine, porcine and
human STs.
Figure 16.3D structure of ovine growth hormone. 3D structure of ovine growth hormone was predicted by using Phyre server and taking human growth hormone as a basic
reference source. 1, 2, 3 & 4 depicts the helix and N & C terminals.
N
C
69
3.2 cDNA synthesis , cloning and Periplasmic Expression of oGH
3.2.1 Isolation and purity of total RNA
Total RNA was extracted from the anterior pituitary tissue of local ovine breed (Lohi) by
guanidium thiocyanate chloroform extraction method (Chomezynski and Sacchi, 1987). The
concentration of extracted RNA was found to be 1.94µg/mg of the pituitary tissue when
measured at λ260. The A260/A280 ratio for isolated RNA was found to be 1.82 (Fig.17), which
indicates sufficiently good purity of extracted RNA (Sambrook and Russell, 2001).
Figure 17.Absorption spectra of extracted RNA. Absorption spectra of extracted RNA from pituitary of local ovine "Lohi" at λ220 - λ300.
70
The extracted RNA was further analyzed on denaturing 1.2% formaldehyde agarose gel. Two
prominent bands of 18S and 28S ribosomal RNA could be seen on the gel indicating that the
extracted RNA is intact and has suffered no major degradations (Fig. 18).
Figure 18.Formaldehyde agarose gel of RNA Formaldehyde agarose gel of total RNA isolated from ovine pituitary tissue.
3.2.2 RT-PCR amplification of cDNA
The purified RNA was subjected to reverse transcription in order to get cDNA which was
amplified by PCR using gene specific primers as described in Materials and Methods. The RT-
PCR yielded a single product of approximately 0.6 kb which was expected size of OaST gene
(Fig. 19)
Figure 19.Analysis of the RT-PCR. Analysis of the RT-PCR amplified product resolved on 1% agarose gel. Lane M,
1kb DNA ladder used as marker; lane , 2, 3, 4 & 5 ~0.6kb amplified PCR products.
71
3.2.3 T/A cloning of oGH
The gel purified PCR products were cloned by using InsTAcloneTM PCR Product Cloning kit.
pTZ57R/T vector was designed for cloning of Taq DNA polymerase amplified PCR products, as the
enzyme adds up extra adenine residues to the 3’end of the PCR products. These single stranded A-
overhangs are required for the base pairing with the 5’-T overhangs in the pTZ57R/T vectors .(Fig.
20).
Figure 20.Restriction map of pTZ57R/T cloning vector .
The amplified oGH cDNA was purified, T/A cloned in pTZ57R/T vector and recombinant
plasmid (pTZ-oGH) thus obtained was used to transform in E. coli strain DH5α. The
recombinant clones were identified by blue/white screening, as vector is genetically marked
with LacZ gene. Several white colonies along with blue colonies appeared on LB-agar plates
supplemented with ampicillin, X-gal and IPTG. These white colonies were further analyzed by
colony PCR using gene specific primers. Six white colonies were picked up from the plate and
five of them gave positive result while one proved as false colony as shown in Fig.22. The four
72
recombinant pTZ-oGH colonies were selected for plasmid preparation and then subjected to
sequence analysis.
Figure 21.Analysis of colony PCR. Analysis of positive transformants by colony PCR. lane 1, DNA marker; lane 2, 3, 5, 6, 7 products of different colony
PCR reactions; Lane 4, colony no 4 indicates negative clone
3.3 Expression of poGH
3.3.1 Restriction analysis of pTZ-oGH
The single colony of recombinant pTZ-oGH construct confirmed by sequencing was used for the
further analysis. For this purpose the pTZ-oGH was amplified and double digested by Nde I and
BamH I restriction enzymes (Fig.22).
Figure 22.Double digestion of pTZ-oGH-1..
Double digestion of pTZ-oGH-1.M, DNA size markers;Lane1,plasmid pTZ-oGH-1after double digestion with
NdeI/BamHIrestriction endonucleases
73
3.3.2 Cloning in pET22 b
The amplified product was gel purified and cloned between Nde I and BamH I sites of pET-
22b(+) using restriction enzyme digestion and ligase mediated cloning. This generated an
expression plasmid designated as, poGH-1 (Fig.23.). The construct contained the native
sequence of OST mRNA and was predicted to encode a 191 amino acid oGH (MW ~22 kDa) in
frame with the translational initiator codon under the control of T7lac promoter.
Figure 23.Construction of recombinant plasmid poGH-1. Construction of recombinant plasmid poGH-1 by cloning a 0.6 kb long oGH cDNA in pET-22b(+) expression vector.
pT7lac, T7lac promoter; rbs, ribosome binding site; ori, origin of replication; fi ori, F1 origin of replication; lacI, Lac
repressor gene; ampr, ampicillin resistance gene.
3.3.3 colony PCR of poGH
poGH-expression plasmid was transformed into E. coli DH5α (cloning host) for vector
propagation and clone selection. Efficiency of transformation reaction was very high; almost 100
% of the screened colonies were positive for the insert as confirmed by colony PCR and/or
restriction digestion. The results obtained from a representative plasmid are presented as Fig. 25.
When resolved on 1 % agarose gel, colony PCR amplification products yielded a single band of
~0.6 kb length (Fig.24)
74
Figure 24.Colony PCR of poGH-1 Colony PCR,lane M,marker;lane 1,2,,3,4 recombinant clone s of poGH-1
In order to confirm the in frame cloning of oGH in poGH-1 construct the clone was double
digested again with NdeI and BamHI and hence showed 573kb band of oGHand 5.4kb band of
pET expression vector when analyzed on 1% agarose gel (Fig.25) which showed successful
cloning of oGH in pET expression vector. Four colonies were picked and spotted on the plate
.The desired oGH band of approximately 0.6kb was confirmed with the colony PCR of poGH -1
clone.
Figure 25.Double digestion of poGH-1.
M, DNA size markers;Lane1,plasmid poGH-1 after double digestion with NdeI/BamHIrestriction endonucleases
75
3.3.4 Shake flask fermentation of poGH-1 construct
The E. coli BL21 were transformed with recombinant plasmid poGH-1. The transformants in set
of four were grown in LB medium at 37 ̊C, induced with 0.2mM IPTG when growth of the cell
reached 0.6 at OD600. The cells were collected from each transformants and were treated with
lysis buffer to check total cell protein as explained in material and methods. The SDS-PAGE
analysis of total cell protein of poGH-1 construct revealed no visible expression (Fig. 26)
Figure 26.SDS-PAGE analysis of poGH-1 expression.. SDS-PAGE analyses of poGH-01 plasmid ..M is commercially available bovine growth hormone used as a marker .lane
1,induce pOaST-1 plasmids total cell protein after 4 hrs of 0.5mM induction of IPTG in LB medium
3.4 Periplasmic expression of oGH
The very low levels of expression of GH gene have been treated with several strategies
(secondary structure changes, bicistrone methods, changes at N terminal of GH gene and lot
more). We tried to use leader sequence of pET vector in order to get expression of oGH gene.
For this purpose a plasmid was constructed with oGH gene at NcoI and BamHI sites of pET 22b
vector so that to attach leader sequence at N terminal site of oGH gene as shown in Fig. 27.
76
Figure 27.construction of poGH-2 construct
3.4.1 Expression of poGH-2
When the leader sequence of pET22b was used in reference construct (poGH-1) and
expressed in E. coli BL21, the construct (poGH-2) showed visible expression of oGH but at
25kDa. The expected size of ovine growth hormone calculated from its amino acid sequence is
approximately 22kDa, while the band appeared on SDS-PAGE showed extra 3kDa.
Figure 28.SDS-PAGE analysis of poGh-2 expression in LB medium. SDS PAGE analysis of poGH-2 expression in LB medium.. Lane 1, induced post-2colony no1; lane 2, induced poGH-2colony no2;
lane 3, induced poGH-2colony no1; Lane 4, uninduced poGH-2colony no2; Lane 5, induced poGH -2 colony no2; lane M,Marker.
pelB leader
77
3.4.2 Effect of different factors on the expression of oGH
3.4.2.1 Effect of ZnCl2
The ZnCl2 is being used to reduce the proteolytic degradation of periplasmic protein.The
different combination of ZnCl2 were used in the pre-culture in order to see its effect on the
production of recombinant oGH protein . For this purpose 0.1mM,0.5mM,1mM,5mM , 10mM
and 50mM concentrations of ZnCl2 were used and it was observed that by increasing the amount
of ZnCl2 from 0.1 to 1mM the cell growth enhances while increasing it upto 50 mM reduces
the cell growth. The best selected concentration was observed at 0.5 mM as shown in graph.
Figure 29.effect of ZnCl2. A graph representing the effect of ZnCl2 on the protein content of expressed cells in LBmedium
3.4.2.2 Effect of IPTG concentration
The IPTG as an inducer was used in the shake flask fermentation of roGH-2 construct
with above optimized conditions. a study of the effect of IPTG concentration (10uM to 1mM)
showed that beyond 20uM there was no increase in the expression levels (Fig. 30).We observed
a constant expression of roGH by adding IPTG 20uM,40,60,80uM,0.1mM,0.5,1mM A
progressive decrease in expression levels was observed below 20uM IPTG concentration as
shown in fig.
78
( a ) ( b )
Figure 30,SDS-PAGE analysis of effect of IPTG. SDS-PAGE analysis of effect of IPTG concentration on the expression of oGH-2(a).:lane M ;marker,lane C,control pET22b ,lane
U,uninduced,lane 1-&,IPTG concn 20,40,60,80,100,1000 and 2000uM (b) effect of IPTG concentrattion less than 10uM on the
expression;lane M,markaer,U uninduced,lane 1-3,IPTG concn 2,5 and 10 uM respectively
3.4.2.3 Effect of Ecoli Strain on expression of ovine growth hormone
OGH1-pET22b construct was transformed into BL21 DE3 and P Lysis strains of E.coli. The
protein expression was observed on 15% SDS-PAGE.It was observed that BL21-DE3 results in
better expression of roGH as shown in fig.We observed the subcellular fractions in both strains
as well .The cytoplasmic fraction in the case of Plysis appeared to have more roGH as compared
to BL21 DE3,but the periplasmic fraction in both strains appeared to be same 10% as shown in
fig 31.
Figure 31.Effect of E.Coli strains on the periplasmic expression of poGH-2. SDS-PAGE analysis of expressed protein of poGH-2(lane1-4,expression in BL21DE3 strain & lane6-8 exspression in PLysis) Lane 1, sonicated sample for cytoplasmic fraction cf; lane 2,shock fluid for periplasmic fraction pf; lane 3,induced poGH-2 ; lane 4,un- induced
pET 22b; lane 5,SDS protein marker, lane 6, cytoplasmic fraction cf , lane7 shock fluid for periplasmic fraction pf, lane,8 induced
poGH-2,
79
3.4.2.4 Optimization of somotic shock conditions
The construct poGH-2 was used for further analysis.As this constitute PelB leader sequence
of PET22b which translocate recombinant protein into the periplasmic space. The destination of
recombinant protein was checked by the analysis of periplasmic and cytoplasmic fractions. For
this purpose 10ml sample was taken after the above optimized fermentation conditions in LB
medium. Already optimized osmotic conditions for the release of oGH into the periplasmic space
were used. I used 3ml each for the each osmotic shock procedure in seperate falcon tubes. These
were proceeded for subcellular fractionations as explained in the material and methods. The
protein content in the periplasmic and cytoplasmic samples was analyzed by Bradford method
explained earlier.The samples were loaded on 15% SDS-PAGE and analysed the result(fig 32 ).
The graphical representation shown (fig 32 a ,b and c) that we obtained the best release of oGH
in osmotic shock when treated with our optimized freeze thaw method as the release was
3.12ug/ml as compared to other protocols where it was achieved much lower.
Figure 32. graphical representation of effect of different osmotic shock conditions on oGH.
.
The SDS-PAGE analysis of above three osmotic shock procedures showed the clear difference
on the release of oGH in periplasmic fraction.Fig a and b showed negligible oGH when treated
80
with osmotic shock conditions stated in graphs a and b (fig 33 ) while the periplasmic and
cytoplasmic fraction in freeze thaw method showed a visible 20% molecular weight band.
Figure 33.SDS-PAGE analysis of subcellular fractions of poGH. 2 SDS-PAGE analysis of cytoplasmic and periplasmic fraction of roGH by using different osmotic shock methods .Cf is
cytoplasmic fraction,Pf is periplasmic fraction and Tcp is total cell protein.(a) osmotic shock conditions described
by(Koshland ,1980) and its effect on release of oGH( b ) osmotic shock conditions narrated by( Ramakrishnan et al., 2010) and its effect on release of oGH( c ) Freeze thaw conditions explained by (Barth et al., 2000) and its effect on
release of oGH.
3.4.2.5 Effect of Glycerol
We studied the effect of glycerol addition in the growth medium and in the osmotic shock
procedure. In LB medium the addition of glycerol enhanced the expression level of oGH from
18% to 22% when observed a on SDS-PAGE .
Figure 34. SDS-PAGE analysis of poGH-2 in LBmodified medium. Lane 1, M; lane 2,uninduced poGH-2; lane 3 induced poGH-2 after 3 hrs of induction, Lane 4, induced poGH-2 after 4
hrs of induction ;lane 5, uninduced poGH-2;lane 6, induced poGH-2 after 6 hrs of induction ;lane 7, induced poGH-2
after 8 hrs of induction
81
As freeze thaw method resulted in best release of oGH (20%) as shown (fig 32& 33). We further
optimized its condition in order to enhance the roGH release in periplasmic space. For this
purpose we used 9 different falcon tubes with 5ml each sample of fermented cells in above stated
optimized conditions.The glycerol was added in a range of (10,15,20,25,30,35,40,45,50%).The
protein content after osmotic shock was calculated by Bradford method.It was observed that the
protein content was highest 110ug/ml when treated with 25% glycerol in freeze thaw
method.The release of oGh in the specific sample was analysed on SDS-PAge and observed
24%band as shown in fig 35.
Figure 35. effect of Glycerol. A graphical representation of the effect of glycerol on the release of oGH into the shock fluid
3.4.2 Purification of poGH-2
The oGHT band was also confirmed by western blot by using specific antibody. The gene linked
with pelB signal peptide is destined for the secretion into periplasmic space of E. coli. In order to
see the fate of this expressed oGHgene with an extra 3kDa, total cell protein was proceeded for
cytoplasmic and periplasmic fractions as explained in the materials and methods. The fractions
were analyzed on SDS-PAGE and showed 25kDa oGH gene band both in cytoplasmic and
periplasmic fraction. Fig. 36 a. The use of glycerol in the osmotic shock procedure enhanced the
release of oGH in shock fluid as shown in fig below .we recovered 24% roGH from the shock
fluid which was aunthenticated by western blot analysis ( fig 36 b )
82
( a ) ( b ) Figure 36.SDS-PAGE analysis of subcellular fractions of roGH-2& western blot analysis. (a)SDS-PAGe analysis of periplasmic and cytoplasmic fraction of roGH by using optimized freeze thaw method ,Tcp is total cell protein,Pf is periplasmic fraction,Cf is cytoplasmic fraction.(b) western blot analysis of roGH
83
3.4.3 FPLC chromatography
The 80% purified ovine growth hormone was further purified by anion exchange,Q sepharose
FPLC chromatography. For this purpose 2M NaCl2 gradient was established and the peak was
observed at 0.5M concentration .The tube were collected with absorbance at 280 attached with
FPLC equipment. The purified product resulted in single sharp peak as shown in figure 37.
Pooled fractions were run on 12 % SDS-PAGE to visualize the purified protein. Further, they were
dialyzed against 20 mM Tris-Cl (pH 8.3) to remove salt traces
Figure 38.Agarose gel analysis of PCR. .Agarose gel analysis of amplified PCR products of primers ,pF2,pF3,pF4. Lane M, DNA marker; lane 2 PCR product of
primer set 2; lane 3, PCR product of primer set 3; lane 4, PCR product of primer set 3
3.5.3 T/A cloning and construction of expression plasmid poGH-3,4,5
These PCR products were than T/A cloned to pTZ57RT vector as explained in material
and methods. The recombinant clones were confirmed by colony PCR as shown in (Fig.39)
Figure 39.Colony PCR analysis of poGH-3-4-5. Agarose gel analysis of Colony PCR of pTZoGH-3,4 and 5 .M,marker; Lane 1, pTZ-oGH-3construct; Lane 3, pTZ-oGH-4 construct; lane 4, pTZ-oGH-5 construct
The amplified products were gel purified and cloned between Nde I and BamH I sites of
pET-22b(+) using restriction enzyme digestion and ligase mediated cloning. This generated
series of expression plasmid designated as, pOaST-3,4 and 5 (Fig.40). The construct contained
86
the native sequence of oGH mRNA with the signal sequence of DsbA, native signal sequence of
ovine growth hormone and signal sequence of ST-II and was predicted to encode a 191 amino
acid oGH (MW ~22 kDa) in frame with the translational initiator codon under the control of
T7lac promoter.
Figure 40.construction of expression plasmic poGH-3,4&5
3.5.4 Transformation and selection of high expression strains
All poGH-series expression plasmids were transformed into E. coli DH5α (cloning host)
for vector propagation and clone selection. Efficiency of transformation reaction was very high;
almost 100 % of the screened colonies were positive for the insert as confirmed by colony PCR
and by restriction digestion.
Figure 41.colony PCR analysis. Colony PCR of recombinant clones. lane M, DNA marker, lane 1, poGH-3 construct, lane 2,poGH-4 construct;lane 3, poGH-5 construct.
87
The results obtained from a representative plasmid are presented (Fig. 34). When resolved
on 1 % agarose gel, colony PCR amplification products yielded a single band of ~0.6 kb length,
while restriction digestion products generated two bands corresponding to 5.5 kb vector and 0.6
kb insert DNA (Fig. 42). The data thus confirmed the presence of insert in all poGH-series
plasmids.
Figure 42.Double digestion of recombinant clones. Agarose gel analysis showing double digestion of recombinant clones, M, DNA marker, lane 2, uncut plasmid pET22b
with insert, , lane 3,4 & 5, double digested pOST-3,4,5 constructs respectively.
3.5.5 Expression of poGH-3,4 and 5
E. coli transformed with poGH-series vectors (poGH-3 to -5) were grown in LB-ampicillin
broth and induced with 0.5 mM IPTG at an OD600 of 0.6. After 4 hours of induction, equal
amounts of cells (based on OD600 values) were lysed and the protein expression was analyzed by
15% SDS-PAGE as shown in Fig. 43.
88
Figure 43.SDS-PAGE analysis of protein expression of construct poGH-3,4&5. SDS PAGE analysis of total cell proteins of poGHconstructs. lane 1, poGH-5; lane 2 uninduced poGHT-5; lane 3, poGH-3; lane 4,
poGH-4; M , protein marker.
3.5.5.1 Subcellular fractionation of poGH-3-5 constructs
The fate of the expressed oGH was analysed by subcellular fractionation of the fermented
cells.The scheme of subcellular fractionation was as explained in materials and method.To
devise an appropriate strategy for downstream processing, the relative distribution of the
expressed oGH was examined in soluble and insoluble fractions. Cells expressing oGH were
lysed and then centrifuged as described under materials and methods. The supernatant and pellet
fractions thus obtained were analyzed by 15 % SDS-PAGE. When the cells were lysed under
native conditions, virtually all the expressed oGH was found in the supernatant representing the
soluble fraction while no or very little traces were found associated with the pellet .The total
cells were analyzed for the periplasmic, cytoplasmic and membrane fractions of the cell as
explained in materials and method. The subcellular fractionation was proceeded as shown in
following flow chart.
89
Figure 44.Schematic representation of subcellular fractionation of cells.
The destination of the expressed roGH was analyzed by subcellular fractionation of the
bacterial cells of each poGH3-5construct. The scheme of subcellular fractionation as shown in
Fig. 44 was devised for downstream processing and relative distribution of the expressed roGH
in soluble and insoluble fractions. Cells expressing roGH in each construct (poGH3-5)was lysed,
centrifuged and then TCP, P (Periplasmic), C (Cytoplasmic) and MF (Membrane fraction) were
analyzed on 12% SDS-PAGE (Fig. 45a,b,c,d).
90
The results of subcellular fractions of all four constructs showed variable outcomes; in construct
poGH1, roGH was expressed at 25kD though expected molecular weight for GH was 22kD.
However, western blot analysis of the gel showed the authenticity of roGH (data not shown). It
was assessed that the additional 3 kD was due to attached signal peptide as the approximate
molecular weight of pelB leader sequence is ~3 kD. During the secretion process, this signal
sequence did not get cleaved from the roGH. The sub-cellular fractions of this construct showed
that half of the roGH was found in soluble form as in the periplasmic fraction while half was
detected in the cytoplasmic fraction and no trace was found in membrane fraction (Fig. 44a).
Similar results were observed for constructs poGH2 and poGH4 showing roGH of 25 kD with
the attached signal sequence.
However, construct poGH2 showed roGH protein in the cytoplasmic fraction while very little
amount was found in periplasmic fraction(Fig. 44b). Construct poGH4 showed no trace of roGH,
suggesting lack of expression and/or protein degradation(Fig. 44d).Importantly, the subcellular
fractionation of the construct poGH3 showed complete translocation of roGH into the inner
membrane (MF) of E. coli. Here the molecular weight of the expressed roGH was 22kD and was
in complete accordance with the molecular weight of the other GH reported (Paladini et al.,
1983). . Furthermore, it was observed that none or very minute traces of roGH were found in the
C or P fractions as shown in Fig. 44C. Construct poGH3 was used for optimization studies and
the roGH production.
91
Figure 45.SDS-PAGE analysis of subcellular fractionations of poGH-3,4 & 5 constructsSDS PAGE . 12% of sub-cellular fractionation of poGH1-4 constructs. Rectangle box showing expression in all the constructs. (A) SDS PAGE
analysis of subcellular fractions of poGH-5. Lane MF, Membrane fraction; lane C, Cytoplasmic fraction; lane P, Periplasmic fraction; lane TCP, Total cell protein. (B) SDS PAGE analysis of subcellular fractions of poGH-4. Lane C, Cytoplasmic fraction; lane P,
Periplasmic fraction; lane TCP, Total cell protein; lane MF, Membrane fraction. (C) SDS PAGE analysis of subcellular fractions of
poGH-3. Lane MF, Membrane fraction; lane C, Cytoplasmic fraction; lane P, Periplasmic fraction; lane TCP, Total cell protein. (D)
SDS PAGE analysis of subcellular fractions of poGH-2. Lane MF, Membrane fraction; lane C, Cytoplasmic fraction; lane TCP, Total cell protein; lane P, Periplasmic fraction; lane M, Protein marker.
3.5.6 Computational analysis of signal sequences of poGH-2,3,4& 5 constructs
In order to understand the reason of varying behavior of these four signal sequences. Each
signal sequence used in this study; DsbA ss ,ovine growth hormone signal sequence, STII and
pelB leader sequence were compared on the basis of probability of signal sequence by signalp3.0
server (results attached in appendix), hydropathy plot by kytedoolittle method and their
secondary structure by polyview prediction server. The data showed that all of them are good
structured signal sequences. However the hydropathies of these signal sequences gave variable
results as shown below (Fig 46).
92
Figure 46.Kytedoolittle analysis of hydrophobicity of all four signal sequences. (a) pET signal sequence (b) DsbA signal sequence (c) ST11 signal sequence (d) ovine growth hormone signal sequence.
Table 3.Hydropathies of poGHconstructs
Constructs
(signal
sequence)
Nucleotide Sequence (5'-3') Hydropa
thy
poGH2 (pelB) CATATGAAATACCTGCTGCCGACCGCTGCTG
CTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCG
ATGGCCATGGCCTTCCCAGCCATGTCC
1.157
poGH3 (DsbA) CATATGAAAAAGATTTGGCTGGCGCTGGCTG
GTTTAGTTTTAGCGTTTAGCGCATCGGCGGCC
TTCCCAGCCATGTCC
1.389
poGH4 (oGH) CATATGCATGCCCCCGGACCTCCCTGCTCCT
GGCTTTCA
1.840
poGH5 (STII) CATATGAAAAAGATTTGGCTGGCGCTGGCTG
GTTTAGTTTTAGCGTTTAGCGCATCGGCGGCC
TTCCCAGCCATGTCC
0.986
The above table shows that there is an optimal range of hydropathy value, above or below which
the signal sequence does not function properly .The secondry structure of these signal sequence
(DsbA, ST-11, pelB and ovine growth hormone signal sequence)were also analysed.They
93
showed that they have varying charges in their N terminal and C terminal regions. The presence
of Beta sheet especially in case of ST-11 signal sequence was a prominent difference among
these signal sequences.
Figure 47.Secondary structure analysisof poGH2,3,4&5.. Secondary structure of all four signal sequences. (a) pET signal sequence (b) DsbA signal sequence (c) ST11 signal sequence (d) ovine growth hormone signal sequence.
The construct with DsbA signal sequence (poGH-3) was chosen best among all four signal
sequences used in this study as it resulted in the accurate size (22 kDa) of recombinant ovine
growth hormone as compared to rest of the rest of the constructs.
94
3.6 Effect of medium composition on expression of poGH-3
3.6.1 Effect of LB,TB & M9NG medium on the expression of poGH-3
On the basis of our results the poGH-3 construct was selected for the further studies. The first
objective was to enhance the production of Soluble recombinant oGH. For this purpose we
studied 9 different medium compositions in 2 sets as listed in table.The first one constitue effect
of LB,M9NG and TB medium while second set constitute seven mediums based on different
carbon and nitrogen source(LB, LB modified, GM-1, GM-2, UM, TB, TBC) to analyze their
effect on the bacterial growth and expression of roGH .All the experiments were proceeded in
shake flask fermentation. The composition of these mediums were as follows ( Table .4)
We proceeded these experiments in (2 sets 1;LB,TB & M9NG and second set LB-1GM-1GM-
2,UM &TBC on roGH production.The construct poGH3 transformed in BL21 Codon Plus (DE3)
95
RIPL cells was grown in First set ( TB, LB, and M9NG media ) for enhanced production of
roGH. The post-induction cell growth was monitored for up to 14hrs in LB, TB and M9NG
media. The (250ml) fermentations were carried out at 37°C, induction by 1mM IPTG in the
logarithmic phase and aeration of 5 times in 1L Erlenmayer shake flask. All fermentations were
performed at least in triplicates and the results presented were the averages. The cells were
harvested at pre and at 2hrs post-induction for each fermentation. All the total cellular protein
samples were processed for analysis in 12% SDS-PAGE and the expression in each medium was
observed as shown in Fig. 47a, b & c. It was found that expression level of roGH was enhanced
up to 18% in TB medium while in LB and M9NG media 10% expression.The growth pattern in
each medium was observed to be different as in LB, M9NG and TB media the maximum cell
growth reached up to OD600 1.2, 2.3 and 5.6, respectively (Fig. 48 d). Moreover, it was
observed that in TB medium, 65.3mg/L of roGH was obtained as compared to 13mg/l in LB and
16mg/l in M9NG (Table 2).
Figure 48.SDS-PAGE analysis and graphical representation of effect of medium on poGH-3 SDS PAGE (12%) showing effect of different media composition (TB, LB, M9NG) on poGH3 construct. (A) SDS PAGE analysis of poGH3 expression in TB medium. Lane M, Protein marker; lane U, un-induced poGH3 construct; lane 1, induced poGH3 sample at
10hrs post induction; lane 2, induced poGH3 sample at 12hrs post induction; lane 3, induced poGH3 sample at 14hrs post induction.
(B) SDS PAGE analysis of poGH3 expression in LB medium. Lane 1, induced poGH3 sample at 12hrs post induction; lane 2, induced
poGH3 sample at 14hrs post induction. (C) SDS PAGE analysis of poGH3 expressed in M9NG medium. Lane 1, induced poGH3 sample at 12hrs post induction; lane 2, induced poGH3 sample at 14hrs post induction. (D) Effect of OD600 on cell growth (hrs) of
poGH3 construct fermented in TB, LB and M9NG media.
96
Table 5.Effect of medium composition on production of oGH
Medium Maximum
OD600
Dry cell mass
(g/L)
Total cell
proteina
(mg/L)
roGH
(%age of total
protein)
roGH
(mg/L)
TB 5.6 2.7 390 18 65.3
LB 1.2 1.3 135 10 13
M9NG 2.3 1.6 167 10 16
Protein concentration was determined by absorbance measurements at A280.
These results suggested further optimization of fermentation conditions in TB medium such as
the effect of lowering temperature, concentration of IPTG and induction time in cell growth
cycle.
3.6. 2 Effect of temperature on poGH3 construct
As periplasmic protein processing occurs better at low temperature as stated by Novagen;
variable range of temperatures i.e. 20, 25, 28, 30, 35 and 370 C in shake flask cultures were
applied. It was observed that cell growth was maximum when fermentation was carried out at
25ºC, it reached up to OD600 5.6 while at 28ºC and 20ºC final OD600 reached up to 5 and 4.8,
respectively suggesting that the optimum temperature is between these two ranges. However,
fermentation at elevated temperatures of 30ºC, 35ºC and 37ºC resulted in reduced cell growth
and recombinant protein with OD600 of 4.1, 3.6 and 2.8 respectively and almost half in the case
of 37ºC grown culture. In conclusion, the best soluble expression of roGH was obtained at 25ºC as
shown in (Fig. 48,A).
3.6.3 Effect of induction time and IPTG concentration on poGH3 construct
The expression of soluble recombinant proteins enhances with lowering amount of inducer
(Novagen) and in the current study, IPTG concentrations ranging from 10μM to 1mM were used
for expression level of roGH and analysed in 12% SDS-PAGE. The roGH was best expressed
with 18% protein in total cell protein at 20μM IPTG while at 1mM IPTG, 14% expression was
observed (Fig. 49 B)The induction time with 20μM. IPTG was also studied .It was found that
97
induction at absorbance 0.5, 1.0 and 1.5, resulted in maximum cell growth of 2.8, 3.5 and 4.2
respectively at OD600. Induction at OD600 2.0 resulted in the best maximum cell growth i.e. 5.6
as shown in Fig. 49C. The induction at later stages like 2.5, 3.0, 3.5 and 4.0 resulted in decrease
cell growth which eventually turned at OD600 1.8 (Fig. 49C). These results showed that
induction time is best in the initial log phase of the cell cycle.
Figure 49.effect of temperature,induction time and IPTG concn. on poGH-3. Graphs showing the cell growth of poGH3 construct in TB medium at variable temperatures, induction time and IPTG concentration.
(A) Effect of temperature on cell growth of poGH3 construct fermented in terrific broth medium. (B) Effect of IPTG concentration on
cell growth of poGH3 construct fermented in terrific broth medium. (C) Effect of IPTG induction time on cell growth of poGH3
construct fermented in terrific broth medium.
3.7 Enhanced production of roGH
After achieving above optimized expression we further studied more medium inorder to
enhance the soluble production of roGH.There was still need to enhance the yield of this soluble
growth hormone. For this purpose we used combination of seven mediums based on different
carbon and nitrogen source(LB, LB modified, GM-1, GM-2, UM, and, TBC) to analyze their
effect on the bacterial growth and expression of roGH .All the experiments were proceeded in
shake flask fermentation. The composition of these mediums were as follows ( Table .4)For this
98
purpose all the mediums were inoculated with roGH as explained in materials and methods. The
samples were taken after every 2 hrs from each medium flask until it reached the final OD600.
The results were analyzed on 12% SDS-PAGE (data not shown). The graphical representation of
results showed that TBC resulted in the best bacterial growth of 10.4 while rest of the mediums
reached up to maximum 5.6 (Figure 50). In TBC medium we followed the same concentrations
of all the medium components as stated by (Barth et al, 2000) From this it was decided to study
the effect of different components on TBC medium for the enhanced production of roGH and on
this basis following parameters were studied; effect of different compatible solutes on the
bacterial growth, chemical chaperon for the stability of recombinant proteins, temperature,
inducer concentration and the time of induction. In order to understand the behavior of the
compatible solute, constant concentration of NaCl (4%) was used.
Figure 50. Growth of poGH-3 in different medium.
The T.B medium supplemented with compatible solute was used for the further analysis. For this
purpose all the variables which can effect the production and expression of recombinant OaST
were analysed. For this purpose the effect of ZnCl2, temperature, induction time, effect of IPTG
or lactose as inducer and variable combinations of compatible solute.
99
3.7.1 Effect of compatible solute on the expression of poGH-3 construct
As per our results (Fig.50) we decided to use T.B with varying combinations of compatible
solute in order to further enhance the production of recombinant oGH. The compatible solute
which was previously used was namely ( glycerol, sorbitol, glycine betaine, and hydroxyectoine)
during the production phase. In this study we have used 2 different sets (Glycylglycine ,glycine
betaine) and (sorbitol and Mannitol) of compatible solutes in production phase of recombinant
ovine growth hormone construct poGH-3.
3.7.1.1 Optimization of soluble roGH expression using compatible solutes(Glycylglycine ,
glycine betaine,sorbitol and Mannitol
In the present work we used different concentrations of each compatible solutes ( sorbitol,
mannitol, glycylglycine and glycine betaine) and compared their effect on the final absorbance
of the growing culture. It was observed that all these components increase the final OD of the
growing culture. We found that glycylglycine results in higher final density of growing culture
as compared to glycine betaine and so mannitol gives the better results as compared to sorbitol as
shown in graphs. We further studied the effect of glycylglycine and mannitol on the soluble
expression of roGH. The concentration of Glycylglycine effects the cell growth as by increasing
the concentration of Glycylglycine from 10 to 50mM. The cell growth also reached at the
maximum OD600 of 13.0. Mannitol also enhanced the cell growth and found the maximum
growth at 13.5 with optimized concentration of 0.6M as shown in Table 6. The results were also
observed on 12%SDS-PAGE separately for each of them (data not shown) and graphically
summarized in (Figure 51).
100
Table 6. Effect of compatible solutes inTB medium on the growth of poGH-3
The optimized concentration of Glycylglycine (50mM) and Mannitol (0.6M) enhanced the
percentage expression of roGH. The subcellular fractionation [periplasmic (P), cytoplasmic (C),
membrane fraction (MF)] of recombinant cells grown in above optimized conditions of TB were
proceeded as explained in materials and methods and were analyzed on 12% SDS-PAGE (Figure
52 a, b, c ). Figure 51 (a) shows the expression of roGH in TB medium supplemented with no
glycylglycine and Mannitol .we observed a good expression of roGH in total cell protein but we
could nt get the good yield of soluble roGH from membrane fraction . As we found some part of
the recombinant protein in periplasmic fraction and very diminished in the membrane fraction
while didn't receive any protein in the cytoplasmic fraction.
Figure 51.Graphical representation of the effect of 2 sets of compatible solutes on the growth of poGH-3 in TB medium
However, Figure 52 (b) shows TB medium supplemented with Mannitol but no glycylglycine
and the total cell expression of roGH was observed to be good and at least half of the
recombinant protein in membrane fraction was found which was then easily solubilized by use of
40% acetonitrile. Moreover, some protein was also observed in periplasmic and cytoplasmic
fractions. While Figure 52 (c) shows TB medium supplemented with the optimized concentration
of glycylglycine and a very good expression of roGH as total cell protein was observed with
almost all of it transferred to the membrane fraction and no visible fraction was observed in
periplasmic or cytoplasmic fractions..On the basis of above observation we found that
glycylglycine and mannitol both effects the soluble expression of recombinant
( a ) ( b ) ( c )
Figure 52.effect of compatible solutes on the solublr expression of poGH-3 in TB medium . (a) shows the expression of roGH in TB medium supplemented with no glycylglycine and Mannitol.( b ) shows TB medium supplemented with Mannitol but no glycylglycine.(c) shows TB medium supplemented with the optimized concentration of
glycylglycine
3.7.2 Production of soluble roGH in TBC optimized medium
From the above observations we selected the optimized concentrations of Glycylglycine (50mM),
Mannitol (0.5M) and used it with optimized conditions of temperature (25ºC), IPTG (20μM),
induction at early logarithmic phase i.e. OD600 ~3.0 with 0.5mM of ZnCl2 and 4% NaCl in TB
medium for the batch of shake flask fermentation. Continued growth of bacterial cells was observed
up to 20 hrs post-induction. For expression studies 1ml sample was collected from the culture after
every 2hrs as explained in the materials and methods and samples were analyzed on 12% SDS-
PAGE. The optimized compatible solutes in TB medium enhanced the expression and solubility of
roGH with ~32% expression at 18hrs post-induction as shown in (Figure 53). The analysis on 15%
SDS-PAGE shows 32% expression of recombinant oGH.
102
Figure 53.SDS-PAGE analysis of optimized compatible solte in TB medium on expression of poGH-3. SDS PAGE analysis of poGH-3 expressed in compatible solute supported terrific broth medium. Lane M, prestained protein
marker;lane 2,un induced poGH-3;lane 3,induced poGH-3 after 4 hrs of induction ; lane 3,induced poGH-3 after 4 hrs of induction;
lane 4,induced poGH-3 after 8 hrs of induction; lane 5 ,induced poGH-3 after 10 hrs of induction; lane 6,induced poGH-3 after 12 hrs of induction ; lane 7,induced poGH-3 after 14hrs of induction ; lane 8,induced poGH-3 after 16 hrs of induction ; lane 9,induced
poGH-3 after 18 hrs of induction lane 10,induced poGH-3 after 20 hrs of induction .lane,11,western blot of recombinant oGH
3.7.2.1 Effect of temperature
As periplasmic protein process better at low temperature as stated by Novagen. The range
of temperatures 20̊C,25̊C,28̊C,30 ̊C and 37̊C in shake flask culture were applied .It was observed
that at low temperature conditions 20̊C, 25̊C and 28̊C the cell growth was very slow in the
beginnig till it reached upto 3.0 at O.D600 at which medium is supplemented with compatible
solute and 0.1mMIPTG ,the cell growth speeds up and continued growing after 16-20 hours of
induction. while by increasing the temperature from 28 to 30 and 37̊C the cell growth takes 5 hrs
to reach upto 3 at O.D600 and induction was given, the cell growth enhances quickly but it lasts
upto 8-9hours after induction. At lower temperature 25̊C the O.D600 of cell growth reached upto
17.2 while increasing the temperature 37̊C it reached upto 10.2 as shown in the graph (figure 54).
103
Figure 54.Effect of temperature.. Effect of temperature on cell growth of poGH-3 construct fermented in terrific broth medium supplemented with compatible solute
.
3.7.2.2 Effect of IPTG and Lactose as an inducer
The lactose and IPTG as an inducer were used seperately in the shake flask fermentation
of poGH-3 construct with above optimized conditions. a study of the effect of IPTG
concentration (10µm to 0.1mM) showed that beyond 20µM, there was no significance increase
in the expression levels (Fig. 55). A progressive decrease in expression levels was observed
following addition of IPTG till a final concentration of 0.5mM. Further increase in inducer
concentration up to 0.1 mM, however, did not result in any improvement in poGH-3 production.
20µM IPTG, therefore, was found optimal for maximal expression of poGH-3. Lactose-based
auto-induction strategy was employed to poGH-3 construct in terrific broth medium
supplemented with compatible solute. In this methodology, inducer (lactose) is added right at the
beginning of inoculation but the induction is completely repressed due to the presence of glucose
in the cultivation medium. Upon glucose depletion, induction and hence the production of
recombinant protein starts, automatically. This is advantageous, as unlike IPTG induction,
culture growth is not required to be monitored prior to induction.
104
Figure 55.effect of IPTG and lactose.. (a)SDS-PAGE analysis of poGH-3 construct in terrific broth medium with different concentrations of IPTG (b) SDS-PAGE analysis
of poGH-3 construct in terrific broth medium with lactose as an inducer
3.7.2.3 Effect of induction time
When induced at OD600 0.5-1.0,the cell growth enhanced quickly but it dropped after
reaching 4.3 at O.D600 . While by increasing the induction stage 1.5 ,2,2.5 and 3 the cell growth
enhances quickly after induction and it continued growing after 14-18 hrs of induction .As
compatible solutes has 4% NaCl2 which gives stress to the medium so its better if induction is
given in early logarithmic phase. The best induction of recombinant E. coli by IPTG, therefore,
was obtained at logarithmic phase, i.e., between OD600 of 2.5 to 3.
3.7.3 Subcellular fractionation of poGH-3 construct
The fate of the expressed was analysed by subcellular fractionation of the fermented
cells.The scheme of subcellular fractionation was as explained in materials and method .To
devise an appropriate strategy for downstream processing, the relative distribution of the
expressed oGH was examined in soluble and insoluble fractions. Cells expressing oGH were
lysed and then centrifuged as described under materials and methods. The supernatant and pellet
fractions thus obtained were analyzed by 15 % SDS-PAGE. When the cells were lysed under
native conditions, virtually all the expressed oGH was found in the supernatant representing the
105
soluble fraction while no or very little traces were found associated with the pellet .The total
cells were analyzed for the periplasmic, cytoplasmic and membrane fractions of the cell as
explained in materials and method. The subcellular fractionation was proceeded as shown in the
flow chart.The above strategy was used for the analysis of poGH-3 construct expressed under
optimized fermentation conditions of T.B medium supplemented with compatible solute. The
oGH was found in the membrane bounded form which was than solubilized with 40% of
acetonitrile. The recombianant oGH was also confirmed by western blot as shown in Fig.56.
Figure 56.Subcellular fractionation of poGH-3. SDS PAGE analysis of sub cellular fractionation of pOaST-3 construct expressed in T.B medium supplememnted with compatible
solute. lane 1, western blot of OaST. lane 2, soluble fraction . lane 3, membrane fraction..lane 4, periplasmic expression 5, cytoplasmic protein. lane, lane 6, total cell protein.
We studied the effect of sorbitol plus glycine betaine as compatible solute in the terrific broth on the
expression and final yield of recombinant oGH.we found that TB with above combination of
compatible solute produces a final yield of 189mg/L which is 3 times more than the yield obtained
from simple terrific broth medium.The results were extraordinarily high when we used Glycylglycine
plus mannitol in terrific broth medium.The glycylglycine and mannitol proved to be the better option
than sorbitol and glycine betaine as they resulted in final yield of 443mg/L which is about 9 times
higher when using TB simply without compatible solute.as shown in table
106
Table 7.Effect of compatible solute in TB medium on yield of soluble oGH
Medium Maximum
OD600
Dry cell
mass
(g/L)
Total cell
proteina
(mg/L)
roGH
(%age of
total
protein)
roGH
(mg/L)
TB
5.6
2.7
389
18
65.3
TB with
(Sorbitol and
Glycine
betaine)
10.4
4.1
1020
18
189
TB with (glycylglycine
and mannitol
17
6.4
1380
32
443
107
3.8 Effect of amino acid alterations in DsbA signal sequence on poGH
expression and secretion
The role of amino acid substitution in the tripartite structure of DsbA signal sequence in
targeting recombinant ovine growth hormone to the inner membrane of Escherichia coli cell was
investigated. Construct’s were designed by altering amino acids in the H, C and N domain of
DsbA signal sequence (DsbA ss) and for this purpose alanine, serine and lysine were replaced by
isoleucine, cysteine and arginine residues respectively.
3.8.1 PCR amplification and Cloning of pOaST varying constructs
We designed basically three types of mutant DsbA constructs
1. Mutant construct of DsbA with varying hydrophobic region
2. Mutant construct of DsbA with varying N terminal region
3. Mutant constructs of DsbA with varying C terminal region
The primer were designed for each construct as explained in materials and method. These
forward primers with one reverse primer PBGH3 (5`TAG GAT CCG CAA CTA GAA GGC
AGC 3`) were used for the PCR amplification. The wild-type growth hormone sequence in the
construct pTZoGH-1 was amplified using each of the forward and the reverse primers (Fp1-
Fp8)as shown in the (Table 7). The oGH gene was PCR amplified and analysed on 1% agarose
gel as shown in figure. All the primers resulted in 573bp oGH amplified product.
108
.Figure 57.PCR amplification of poGH-3-I-VIII. lane M; marker, lane 1-7 poGH-3 a-g constructs
These PCR products were then T/A cloned into pTZ57RT vector. The recombinant
colonies were chosen and confirmed by colony PCR analysis.
( a ) ( b )
Figure 58.colony PCR and double digestion of poGH-3-I-VIII.
(a) colony PCR of poGH-3a-g constructs.Lane 1-7 colony PCR of pOaST3a-g constructs.(b)Agarose gel analysis of double digested
T/A clone recombinant pTZ-oGH-3a-g
These (pTZoGH-3-I-VIII) series of recombinant plasmids were digested with NdeI and
BamHI (figure )and ligated at the NdeI/ BamHI site of pET22b thus generating a series of
recombinant plasmids ( poGH-3-I-VIII).
109
3.8.2 Construction of Expression plasmid poGH3-I-VIII
Figure 59.Construction of recombinant pET for poGH-3-I-VIII constructs .
3.8.3 Expression of poGH-3-I-VIII
oGH expression analysis. The recombinant plasmids of poGH-3 were transferred into E. coli
BL21 CodonPlus (DE3) RIPL strain. The transformants were grown in LB medium at 25 C and
induced with 20µM IPTG when OD600 reached 0.6. Lysates of E. coli cells of the various
transformants, after IPTG induction for 6 hrs, cells were treated with lysis buffer, and the total
cell protein was analyzed by SDS-PAGE. Equal amounts of cells (based on OD600 values) were
lysed from each culture and the protein expression was analyzed by SDS-PAGE. The expected
molecular mass of oGH is ~22 kDa, variations were observed both in mass and expression levels
when the total protein in lysates of the E. coli, transformed with different poGH constructs, were
compared (Fig. 60).
Figure 60.SDS-PAGE analysis of poGH-3-I-VIII constructs in LB medium. lane 1, oGH -3I; lane 2 , oGH-3II; lane3, oGH -3-IV; lane 4, OaST -3VI; lane 5, OaST -3VII, lane 6, OaST-3V; lane 7, OaST-3III; lane 8, OaST-3VIII; Pre-stained protein molecular markers, lane 9.
The new constructs with variations in DsbA signal peptide gave variable results. The
poGH-3 constructs III, V and VIII resulted in 25kDa of ovine growth hormone and rest of the
constructs resulted in 22kDa of band on 15% SDS-PAGE as shown in figure 60. Since, the
approximate size of 18 amino acids long DsbAss is ~2 kDa, the higher molecular mass of oGH
in these constructs is likely to be the result of incomplete processing of DsbAss.
In the case of poGH-3-IV construct, size of expressed oGH was 22 kDa but the expression level
was barely detectable on SDS-gel and therefore it was confirmed by western blot analysis (data
not shown).
3.8.4 The expression of DsbA ss constructs with substitution of alanine with
isoleucine in the H domain
The DsbAss has four Ala residues in its H- and near H-domain region, which are present at
position I, IV, IX and XI with respect to the signal peptidase cleavage site. In the present study
these alanine residues were replaced by Isoleucine in poGH-3-II to -VI constructs and the impact
of substitutions was observed on oGH expression and export in E. coli. When analysed by SDS-
1 2 3 4 5 6 7 8 9
25kDa 22kDa
kDa
250
130 100
70
55
35 25
15
111
PAGE, expression levels of oGH in these constructs ranged from undetectable (poGH-3-IV) to
up to 25 % (poGH-3-V) of the total E. coli cellular proteins. Variations in molecular mass were
also observed in the case of poGH-3-III and -V (~25 kDa) and poGH-3-II, -IV and -VI proteins
(~22 kDa).
In order to understand the behavior of expressed oGHs, the hydropathy index of each
DsbAss mutant construct was analyzed using the Swiss ExPASy Protparam tool (Table 2).
poGH-3-II and -V having the same hydropathy indices but variable molecular weight of
expressed oGH were the most interesting constructs. The subcellular fractionation of proteins
from the cells transformed with these constructs showed that in case of poGH-3-II, DsbAss
directs oGH-II into the inner-membrane of E. coli (Fig. 61). While in the case of poGH-3-V,
more than 75 % of the expressed protein remains in the cytoplasmic fraction with no traces in the
membrane fraction. Thus, Ala13 of DsbAss when substituted with Ile13 somehow hampered the
export and processing of oGH in E. coli. This suggests that it is not the hydropathy but the nature
of amino acid substitution at specific position, which influences the mechanism of protein
translocation.
In the present study, oGH-3-II, the one which is highly expressed (up to 20 % of the total E.
coli cellular proteins) with complete processing of DsbAss, was purified by employing FPLC
chromatography for further confirmation of size using the MALDI-TOF mass spectrometry. The
mass of purified oGH-II-2 was almost the same as the theoretically calculated mass of mature
oGH (data not shown), reflecting the complete processing of DsbAss.
112
(a) (b)
(c)
Figure 61.SDS-PAGE analysis of poGH-3-II-VI&I SDS PAGE analysis of subcellular fractions of construct poGH-3-I,II,VI ,in terrific broth medium.lane1,(a) SDS PAGE analysis of
subcellular fractions of construct poST-3-I;lane,M, marker;lane 2,total cell protein; lane 3,periplasmic fraction;lane 4, membrane fraction ;lane 5, cytoplasmic fraction. ,(b) SDS PAGE analysis of subcellular fractions of construct poST-3-ii;lane,1 ,membrane
fraction; lane 2, cytoplasmic fraction; lane 3,periplasmic fraction;lane 4, total cell protein; lane,M, marker. ,(c) SDS PAGE analysis of
subcellular fractions of construct poST-3-Vi;lane,1 , total cell protein; lane 2, cytoplasmic fraction; lane 3,periplasmic fraction;lane 4,
While the fractions poGH-3,III and V resulted in 25kDa protein found in both cytoplasmic and
periplasmic spaces as shown in( Fig 62).
113
(a) (b)
.Figure 62.SDS-PAGE analysis of poGH-3-III&V. SDS-PAGE analysis of sub cellular fractionation of pOST-3,III and V constructs. (a)subcellular fractions of pOaST-3-d;Lane 1 membrane fraction,M ,marker,lane-3 cytoplasmic fraction,lane 4,periplasmic fraction.,lane 5, total cell protein of pOST-3,b
construct,.(b)subcellular fraction of pOaST-3c; lane 1,membrane fraction , lane 2,periplasmic , lane 3,total cell protein ,lane
4,cytoplasmic fraction, lane 4 ,SDS marker.
The plasmid constructs poGH-3, III and V showed variation in the sub cellular localization
of the recombinant growth hormone. These constructs showed extra 3kDa size in the expected
band and it was very slightly translocated into cytoplasmic and periplasmic space while most of
it is being lost.
3.8.5 DsbA ss constructs with substitution of serine with cysteine in the C domain
In this construct two serine residues at C domain of DsbA ss were substituted with two
cysteine residues. The replacement of serine by cysteine residue in clone ( pOaST-3VIII)
affected the translocation process and the expressed recombinant ovine growth hormone was
found in the cytoplasmic fraction with 25kDa molecular weight when analyzed by SDS-PAGE
and Western blot analysis. This result is in accordance with the already reported importance of
polar C terminus which is essential for recognition of signal peptidase. The change of serine to
cysteine residue impaired the signal peptidase activity( Fig.63).
114
Figure 63,SDS-PAGE analyis of poGH-3 VIII.
SDS_PAGE analysis of poGH-3, VIII constructs. Lane 1 SDS marker, lane 2 total cell
3.8.7 Purification of oGH from poGH-3-II construct
Ovine growth hormone was purified by simple procedure of subcellular fractionation and
it was found in membrane bounded form. This membrane bounded growth hormone was
solubilzed by 40% acetonitrile and was observed on SDS gel. Western blot analysis of
membrane bounded growth hormone confirmed it as growth hormone (Fig.65)and MALDI TOF
analysis proved its molecular weight(Fig.66).
Figure 65.Subcellular fractionation of poGH-3II and western blot analysis. SDS PAGE analysis of sub cellular fractionation of pOaST-3-II construct expressed in T.B medium supplememnted with compatible