Top Banner
Protein Synthesis
25

Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Dec 22, 2015

Download

Documents

Lilian Collins
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Protein Synthesis

Page 2: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Flow of Genetic Information

• Flow of genetic information from DNA to RNA to protein

• The DNA genetic code (genotype) is expressed as proteins which provide the physical traits (phenotype) of an organism

GCTGCTAACGTCAGCTAGCTCGTAGC GCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAG AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGC, cont.

RNA Proteins

Page 3: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

GCTGTAATTACGTAACTAGCTCGTAGCCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGGCTGTAATTACGTAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAGGCTGTAATTACGTAAAGCGCTTGCGTAGCTAAAGTCGAGCTGCTGTAATTACGTAAAGCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAGCGCTGTAATTACGTAAAGCGCTTGCGTAGCTAAAGTCGAGCTGCTGTAATTACGTAAAGCGCTTGCGTAGCTAAAGTCGAGCTGCTGTAATTACGTAA GCTGCTAACGTCAGCTAGCTCGTAGCGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAAGCTGTAATTACGTAA, cont.

RNA Proteins

Different DNA Sequence….

Page 4: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Protein Synthesis

• TranscriptionProcess in which a

molecule of DNA is copied into a complementary strand of RNA

• TranslationProcess in which the

message in RNA is made into a protein

Page 5: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Forms of RNA

3 Main Types of RNA1) mRNA (messenger RNA) – RNA that decodes

DNA in nucleusbrings DNA message out of nucleus to the cytoplasmEach 3 bases on mRNA is a “codon”

2) tRNA (transfer RNA) – RNA that has the “anticodon” for mRNA’s codon The anticodon matches with the codon from mRNA to determine which amino acid joins the protein chain

3) rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules

Page 7: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Transcription produces genetic messages in the form of RNA

Figure 10.9A

RNApolymerase

RNA nucleotide

Direction oftranscription

Newly made RNA

Templatestrand of DNA

Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

Page 8: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Transcription1. Initiation:

• RNA polymerase (enzyme) attaches to DNA at the promoter and “unzips” the two strands of DNA

2. Elongation:• RNA polymerase then “reads”

the bases of DNA and builds a single strand of complementary RNA called messenger RNA (mRNA)

3. Termination:• When the enzyme reaches the

terminator sequence, the RNA polymerase detaches from the RNA molecule and the gene

Page 9: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Transcription

The code on DNA tells how mRNA is put together.

Example: DNAACCGTAACG

mRNAUGGCAUUGC

• Each set of 3 bases is called a triplet or codon (in mRNA)

UGG CAU UGC

Page 10: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

• Noncoding segments called introns are spliced out

• Coding segments called exons are bonded together

• A 5’cap and a 3’ poly-A tail are added to the ends

Eukaryotic RNA is processed before leaving the nucleus

Figure 10.10

DNA

RNAtranscriptwith capand tail

mRNA

Exon Intron IntronExon Exon

TranscriptionAddition of cap and tail

Introns removed

Exons spliced together

Coding sequence

NUCLEUS

CYTOPLASM

Tail

Cap

Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

Page 11: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.
Page 12: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Protein Synthesis

• Transcription• Translation

Process in which RNA is used to make a protein

Page 13: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

• In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide

• The process is aided by tRNAs

Transfer RNA molecules serve as interpreters during translation

Figure 10.11A

Hydrogen bond

Amino acid attachment site

RNA polynucleotide chain

Anticodon

Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

Page 14: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Ribosomes build polypeptides

Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

Page 15: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

• The mRNA moves a codon at a time relative to the ribosome– A tRNA pairs with each codon, adding an amino acid

to the growing polypeptide

Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation

Page 16: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Translation1. Initiation:– mRNA molecule binds to the small ribosomal subunit – Initiator tRNA binds to the start codon (AUG—

Methionine) in the P-site of the ribosome– The large ribosomal subunit binds to the small one so

that the initiator tRNA is in the P-site to create a functional ribosome

Page 17: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Translation2. Elongation:– Codon recognition: anticodon

of incoming tRNA molecule, carrying its amino acid, pairs with the mRNA codon in the A-site of the ribosome

– Peptide formation: polypeptide separates from the tRNA in the P site and attaches by a peptide bond to the amino acid carried by the tRNA in the A site

– Translocation: the tRNA in the P-site now leaves the ribosome, and the ribosome moves along the mRNA so that the tRNA in the A-site, carrying the growing polypeptide, is now in the P-site. Another tRNA is brought into the A-site

Page 18: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Translation

3. Termination:– Elongation continues until a

stop codon is reached—UAA, UAG, or UGA

– The completed polypeptide is released, the ribosome splits into its subunits

Page 19: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.
Page 20: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

• An exercise in translating the genetic code

RNA

DNA

Polypeptide

Startcodon

Stopcodon

Page 21: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Mutations

• Mutagenesis—creation of mutations• Can result from Spontaneous Mutations

• Errors in DNA replication or recombination• Mutagens—physical or chemical agents

– High-energy radiation (X-rays, UV light)

Page 22: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Types of Mutations• Mutations within a gene

– Can be divided into two general categories.• Base substitution• Base deletion (or insertion)

– Can result in changes in the amino acids in proteins.

Normal hemoglobin DNA

mRNA

Normal hemoglobin

Glu

Mutant hemoglobin DNA

mRNA

Sickle-cell hemoglobin

Val

Normal hemoglobin DNA

mRNA

Normal hemoglobin

Glu

Mutant hemoglobin DNA

mRNA

Sickle-cell hemoglobin

Val

Sickle-CellDisease

Page 23: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Substitution Mutations

• Missense mutation: altered codon still codes for an amino acid, although maybe not the right one

• Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely– Leads to nonfunctional

proteins

Page 24: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

Insertions and Deletions

• Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made

Page 25: Protein Synthesis. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as.

• Although mutations are often harmful,– They are the source of the rich diversity of

genes in the living world.– They contribute to the process of evolution by

natural selection.

Are all Mutations Bad?