Promoter Analysis and Genornic Organization of the Gene ... · Abstract: Promoter Analysis and Genomic Orgamation of the Gene Encoding the B-subunit of the Rat Amiloride-Sensitive

Promoter Analysis and Genornic Organization of the Gene Encoding the P-subunit of the Rat Amiloride-

Sensitive Epithelial Sodium Channel

A thesis submitted in confomiity with the requirements for the degree of Master of Science,

Graduate Deparmient of the Institute of Medical Science University of Toronto

and The Lung Biology Research Programme,

Research Institute of the Hospital for Sick Children, Toronto, Ontdo, Canada

O Coppright by Haay Robert Bremner, 2000

National Library of Canada

Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395, rue Wellington ûttawaON K I A O W OttawaON K1AON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distritbute or sel1 reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de

reproduction sur papier ou sur format éiec tronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts kom it Ni la thèse ni des extraits substantiels may be printed or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Abstract:

Promoter Analysis and Genomic Orgamation of the Gene Encoding the B-subunit of the Rat Amiloride-Sensitive Epithelial Sodium Channel

hfaster of Science, 2000 H m - Robert Bremner, BSc. Insutute of Medical Science U,versicv of Toronto

The arntloride-sensitive epitheiial sodium charnel (EbJaC), consisting of three subunis, a, P and y,

is die rate l i M ~ g step Li nansepithelial sodium absorption. We hypothesized diat expression of the

grnr rncoding the P-subunit of rat ENaC (rENaC) is controlled by ir-acting sites in the promoter

regton which differ Lom the other 2 subuniu. 5'RhCE, primer extension and RNase protection

~ssavs indicated multiple trmscripaon s m sites over a 60 bp region. Sequencing 1.3 kb of the 5'

f l anhg DNr\ reveded the absence of a T.4T-L\ box or consensus sites for steroid rctsponse

elernents. Transient mnsfections of P-rENaC 5' aanking DNA/reporter construcrs revealed a

negativr çlemenr benveen positions 418 and -305 a f f e c ~ g basal rranscription rates, but showed no

response CO glucocorcicosteroids. Gel shifi assays confïrmed the active binding of an AP-1 site in

dus regon. Mutation of the AP-1 site did aot abrogate the repressive acavity in transirnt

mnsfections. With this and promoter studies of the odier ~ r o subunits it is suggested chat the P

and y subunirs are similady tegulared but different from the a-subunit.

Acknowledgements:

For theV support and guidance, 1 would like to thank my supervisor Dr Hugh OSBrodovich

and the memben of my supenrisory cornmittee: Drs LapChee Tsui, Keith Tanswd and Jim Hu. 1

would espeaally like to express my gratitude to my supervisor Dr. Gad Onilakowski without whom

the completion of this wok wodd have ben impossible.

For their advice, technid aainance and hiendship 1 would ke to thank Brent Steer, Bijan

Rafii, Christopher Flacid, Tanya Freywald, Maqorie Samuel, Yanxia Wen, Vidcy Hannam, Parnela

Plant and Pauhe Henry. 1 would h o like to acknowledge Dr. B. Rosier for his PrENaC DNA,

Dr. J. Whitsett for his MLE-15 cell line and Dr. V. Giguere for his RSVPga conanm and

thymidine kinase promoter.

For the love and support that 1 have needed in complethg this projen over the past three

y m , 1 am etemdy grarefd to rny parenrs Hany and Buenita Bremner and to Sergio DiZio, for this

and his enduring understanding.

Finally, for the hancial support that I received for diis work, I am grateful to the Canadian

Insitute of Health Researdi Group in Lung Development.

Table of Contents: .......................................................................... Abstract ii ... ................................................................ Acknowledgements m

............................................................... Table of Contents .. iv . . .................................................................... List of Tables: vu ... ................................................................... List of Figures mu .............................................................. List of Abbreviations ix

.................................................... Chapterl: Introduction 1 ................. 1.1 Eukaryotic Transcriptional Regulation and Gene Expression 1

....................................... 1.1.1 Basic Mechanisms 2 1.1.1.1 TheMinimalPrornoter ...................... 4

............. I . . 1.2 The Promoter P r o d Elements 5 1.1.1.3 Enhancer Elements ........................ 6

1.12 Transcription Factors ..................................... 7 ................... 1.1 2.1 Activators and Repressors 7

1.1.2.2 Cofactors ................*............... 11 .................... 1.1.3 Higher-order Transcriptional Regulation 12

................................... 1.1.4 Repressor &-Elements 15 ........................ 1.1.4. i Silencer Elements 15

1.1.4.2 Negative Regulatory Elements (NREs) ........ 15 ............................. 1.2 What is the Epithelial Na' Channel Wac)? 16

.............................................. 1.21 ~tructure 17 ......................... 1.2.1.1 Proteinstrum 17

........................... 1.2.1.2 Gene Structure 20 ................................... 12.2 PhysiologialFunction 21

........................................ 1 3 Biological Signxficance of ENaC 23 ................................................. 1.3.1 Lung 23

.......................... .................. 1.32 Kidney .. 26 1.3.3 Colon ................................................ 27

.................................................. 1.4 Regulation of ENaC 28 ...................................... 1.4.1 Regdatory Factors 28

1.4.1.1 Adrenocorticosteroids and Female Gender ................................ Hormones 28

........... 1.4.1.2 Vasopressin and the PKA Pathway 30 ............................ 1.4.1.3 OtherKinases 30

.................................. 1.4.1.4 CFIfR 31 ...................... 1.4.1.5 Nedd4andUbiquitin 31

................... 1.4.1.6 0, P a r t d ~ r e m u e ~ o J 32 ............................... 1.4.1.7 Gproteins 32

..... 1.4.1.8 Factors Affecting Inaacehhr T&cking 33 ................................ 1.42 TranscriptionalReguhon 33

........................... 1.421 mRNAStudies 34 .......................... 1.422 Promoter Studies 37

......................................................... 1.5 Hypothesis 38

Chapter 3: 3.1

.......................................... Materials and Methods 39 Isolation and Chamterizauon of Genomic DNA Encodmg PrENaC ......... 39

2.1.1 LibraryScreening ....................................... 39 2-12 Anaysis of Bacteriophage-h Clones ........................ 40 2.1.3 AIigntnent of Human and Rat ENaC subunit cDNAs ......... 41

Determination of fhENac Transcriptional Start Site ....................... 41 22.1 5' Rapid Arnp~cafion of cDNA Ends (S'RACE) ............. 41 2 . 2 PrimerExtension ....................................... 42 22.3 RNase Protection Asgy ................................. 42

Sequencing ......................................................... 43 PrENaC Promoter Sequence Anaysis .................................. 44 Characterization of BrENaC Promoter Activity ........................... ++

2.5.1 CellCdnrre ............................................ 44 2.52 Reporter C o m c t s ..................................... 46 2.5.3 Transient ? 'dec i lon ................................... 48 2.5.4 Stat i s t idhdys i s ...................................... 50

DNAMobdqShifiAssay ............................................ 50

....................................................... ResuIts 54 &rENaC Gene Svucnrre ............................................. 54

3.1.1 Position and Sequences .................................. 54 3.1.2 C o d o n with Other Rat and Human ENaC Genes ....... 57

............................................... TraxlScfiption Stm Site 61 3.2.1 S'RACE ............................................. 61 3.2.2 Primer Extension ...................................... 63 32.3 RNase Protection Assay ................................. 63

Promoter Sequence .................................................. 65 3.3.1 ai-Element Consensus Sequences .......................... 65

Characterizationof ~rENaCPromoterAaivity ........................... 68 3.4.1 Transcriptional Activity of the PrENaC 5' Flankmg DNA with

................................... Variation at the 3' end 68 3.42 Effect of Glucocorticoids on PrENaC Promoter-driven

...................... ....... . . Tranxription ... .... 69 3.4.3 Transcriptional Activiq of the PrENaC Promoter Con~vucts and

Identification of a Negdnve &-regdatory Element ............ 71 3.4.4 Effect of -305 to -417 Negatke Regdatory Element on Heterologous

............................................ Promoters 72 Mobility S E Assay .................................................. 73

3.5.1 Protein-DNA interactions on fkrENaC Prornoter Region Containing Putaxive Negative &-reguiatory Element .................... 73

35.2 Mutated AP-1 Consensus Sice in the Negative Element Region ..................................................... 78

Chapter4: Discussion .................................................... 80 4.1 Gene Svucture ...................................................... 80 4.2 Transcription Stm Site and Prornoter Sequence ........................... 81

4 1 Correkion of 5'RACE. Primer Extension and RNase Protection AssayStartSites ........................................ 81

42.2 Stan Sire Cluster and Abundance of SP-1 Sites Correspond with TATA-les Pmmoter .................................... 82

4.3 Basal Pmmoter Amvity .............................................. 82 4.4 Absence of Glucoconicoid Activity ..................................... 83 4.5 Negative Element ................................................... 85

4.5.1 Lxazion. Protéin-DNA hteraxiim and Possible si~zsdzmuit Candidates ............................................ 85

4.6 Cornparison of PrE . Regdation with Other Subunits ................... 88

............. Chapter 5 Biological Si@cance and Directions for Future Research 90

................................................................ References 93

List of Tables:

.......... Table 1.1. S w of published midies of ENaC subunit mRNA reguhon D22M 36

................... Table 3.1. Sequences of the observed inuon/exon junctions of BrENaC 56

vii

List of Figures: ................................... Figure 1.1. Main elements of VaaScriptionaI regdation 3

................................................... Figure 12: DNA-binding domains 8

...................... Figure 13. Membrane topology of each subunit (a.. and y-) ENaC 18

......................... Figure 1.4. Amiloride sensitive currents in Xè?wpus h z s oocytes 23

............................... Figure 2.1. +cETLfaC prumûïcr. SM ~ p n e r cûnsUwic~ 49

................................. FiguR 2.2. DNA fragments used in mobility s& assays 53

Figure 3.1. Partial restriction maps of 5 Mones that contain PrENaC sequences ............ 55

Figure 3.2. Alignment of human and rat ENaC subunit cDNA sequences ................ 58-60 ........................... Figure 33: @ose gel showhg bands kom S'RACE products 61

.................................. Figure 3.4. Sequence obtained h m S M C E products 62

............................. Figure 3.5. Primer extension and the RNase protection assay 61

............................. Figure 3.6. Sequence of Exon 1 and the 5' Flanking region 66-67

Figure 3.7: Txansaiption acti .;rY of PrENaC promoter c o m a s with 2 different 3' termini . . 68

................. Figure 3.8. Effect of gIucocorticoids on the PrENaC promoter c o m a s 70

................................ Figure 3.9. AcWity of the PrENaC promoter consuucts 71

Figure 3.10. Activity of the putaive negative elernent region in haeroiogous promoten ....... 72

Figure 3.1 1: Protein-DNA binding activiry in the negative element region of the promoter

................................................. with MIE-15 nuclear extract 74

Figure 3.12: Binding actMty of the 3 oligonucleotides c o v e ~ g GSA long and an atternpt to

.................... supershift with an Oct 1 anubdy Unng MLE-15 nuclear artract 74

................ Figure 3.13. Cornpetition of the GSA long probe with the other GSA probes 76

Figure 3.14: Binding activity of the negb probe and supenhifc of the negp and GSA long probes

w i t h d - a n n i d i e s ...................................................... 77

......................... Figure 3.15. Wect of AP-1 site mutation on transcription actMty 78

Figure 3.16: Ability of the m u t a d AP-1 site to compete for protein binding with the wild type site . ..................... .................................................... 79

List of Abbreviations: S'AAP - 5' abridged andior primer

5'RACE - 5' rapid amplification of &NA ends

A - adenine

A.,x - absorbante of light at 420 n m

aa - amino acid

ABC - ATP binding cassette

AK - achtlt whole kidney RNA isolate

AL - adult whole lung RNA isohte

AMP - adenosine monophosphate

AP-1 - activaring prorein 1

Apx - a p i d protein Xenopo

ASIC - acid sensing ion Channel

ATiI - alveolar type II cells

ATCC - Amerian Type Cdture Cokaion

ATl? - adenosine triphosphate

AUAP - abdged univerd andior primer

AVP - arginine vasopressin

bHLH - basic helk-loopheh

bp - basepair

bZip - basic leucine zipper

C - cytosine

CAMP - cyclic AMP

CCD - cortical collectingduct

CCT - corticai coileaing tubde

cDNA - comphentary DNA

CIEBP - CCMT/enhancer bindlig protein

CF - Cysnc fibrosis

CRD - cysteine rich domain

CREBP - CCAAT response dement bindmg

protein

CTF - CCAAT box transcription factor

Cys - cysteine

DEG - degenerin

dex - dexamethasone

DMEM - Dulbecco's modified Eagle's

medium

DNA - deoxyriboaucleic acid

DRASIC - dorsal root acicCsensing ion

channel

ENaC - epithelial sodium channel

ERE - esuogen response element

FBS - fetd bovine serum

FD - fetal distal lung cen RNA isolate

FDLE - fetal disral lung epithelium

FL - fetd whole lung RNA isolate

G - guanine

GR - glucocorcicoid receptor

GRE - glucocorticoid response element

GSA - gel (mobility) s hift assay

GTF - generai uanscripaon h o r s

HAT - hinone acetyl d e r a s e

HDAC - histone deacetylase

HEK-293 - human embryonic kidney cd line

hENaC - hurnan ENaC - -- . . . ..

CFTR - cystic &rosis transmembrane regdaor nis - hrsudme

cpm - counts per minute HMG - high mobility group

HNFla - hepatocyte nuclear factor la RDS - respiratory distress syndrome

HTH - helix-tuni-helix rENaC - rat ENaC

IMCD - inner rnedulhy collecthg duct RNA - ribonucleic atid

IP-1 - inhi'bitory protein 1 RNAP - RNA polyrnerase

IP, - inosirol 1,4,5 triphosphate RPA - RNase protection assay

kb - kilobase pairs rRNA - nisomal RNA

LEF-1 - lymphoid enhancer factor 1 SEM - secreted akaline phosphatase

W K / E R K - mirogen activated/exva-ceUular - second

ngnal activateci protein kinase sFBS - hormone stripped FBS

MAR - rnauiu attachment region sgk - senim and glucocorticoid-regdated

mENaC - mouse ENaC kinase

min - minute SP-B - surfactant prorein B

mRNA - messengerRNA T - thymine

NaC - sodium channel T, - uüodothyronine

NF4 - nuclear factor 1 TAF - TBP associated factor

NRE - negative regdatory elements TBP - TATA box binding procein

OMCD - outer medullary coikcti.ng duct TF - transcription factor

ONPG - miuophenylplactopyranoside TK - thymidine b a s e

ORF - open reading hame tRNA - d e r R N A

PCR - polyrnerase chain reacrion 'ITF-1 - thyroid u;uiscrption factor 1

PE - primer extension UPE - upstream prornoter elemenr

PGE, - prostagIandin E2 U?R - unuwlated region

PHAI - pseudohypoddosteronism type 1 YENaC - lknqm ENaC

PKA - protein kinase A W1 - Yin-Yang 1

PKC - protein kinase C

Po - open probabiïty

Po, - p d pressure of oxygen

PPy nact - poSpunne-polypyrimidine tract

Py - pyrimidine

Chapter 1: Introduction

1.1 Eukaryotic Transcriptional Regulation and Gene Expression

How do 46 chromosomes, tighdy packed wnhLi the nucleus of a microscopie cell, urïtaogie

into a complex, multicellular, sentient hurnan being? This is a fundamental question rhat is raised by

molecular biologists. Over the y- in pursuit of this question. the c e n d d o p of molecular

biology was formed; char is, that the information in DNA, the genotype, is passeci via RNA to mate

proteins which give rise to the phenotype of an organism. Although we now know this basic

mechanian of flow of information, there are many hows and whys that are d lefi to be answered.

For instance, &puon, which is the process by which DNA is converted into RNA, is a very

complex process. We know that it happens, but we want to know why it happens when it does for

different gens at different tirnes and how it is regdated and carried out. The control of

transcription is paramount, especidy in h&er multiceilukr eukaryotes, because during

developmenr the right gene mus be h a t e d ar the right time in the nght ce1 in order for

differentiation of ceh to take place, dius giWig rise to the proper maturation of the different

syaems in an organism diar are essenual for the organism's viability. Fdermore , once a cell has

differentiated it does not r e m to an undifferenuated state; the gens that have been tumed on lead

to the repression of some genes and the activation of othen in order for the ce1 to perform its

proper function wirhin the organism.

Out of approxhtely 60 000 genes, about 10 000 to 20 000 of them express proteins in one

c d p in a typical muiticdular eukaryote. ûf these proteins, the majonty are ubiquitously

expressed in all ce1 types. These indude proteins which conmine to systems such as the

cytoskdaon and c d metabolic pathways, among other dmgs. h is probably in the order of only

a few hundred provins by which the expression patterns of different ceU types a c d y Wer.

Although many types of pst-uanscriptiod regdation e x k , it is the Vanscriptiod level at which

most regulation of protein expression o c m . This is, of course, very logical and effiaent since

vanscription is the he sep of gene expression and, in most cases, it would be uwise for a cell to

wane resources on expressing RNA and proteins that won't be used Po%-uculscnptional regdation

is thus employed as "fine-nining" of proteiu expression. Therefore, transcriptional control leads to

~ 5 e cd-spe&Çi~ ~ À ~ I X S S ~ V ~ ; of &SC &&di- f k ~ p e s .x.hi~h gi:.e c d type i t ~ rs?icpc ihxtity,

dong with maintaining expression of the ubiquitously expressed proteins Li all ce1 types.

1.1.1 Basic Mechanisms

In eukaryotes, unlike prokaryotes, every gene has its own uansccipuon conml region and

one gene is well separated from another. As in prokaryotes, however, uansuiption is controlled by

W-acting proteins d e d transcription factors ('TF) which bind to & d g regulatory DNA

seqpences and tramaiplion is initiated and carried out by an RNA pdymerase (RNAP) cornplex

All information gathered on the Basic Mechanisms Section (Section 1.1.1) and its absequent

subseaions was taken from w o rext book sources (14.

TFs are proteins which usudy con& 2 major domains: 1) Ail TFs have a

recognition/DNA-binding domain, which allows the TF to either recognk certain sequences of

DNA, the &-acting elements, and bind to them or to recognize other d p t i o n facton and bind

to them. 2) Most TFs have an activaUon/repression dornain which interam with other h o r s ,

either in the RNAP complex or other cranxription factors, by protein-protein interactions to either

enhance or repress their activity. A more detailed outline of TFs is presented in Section 1.12.

In ethryotes there are 3 different RNA polymerases, RNAP I, RNAP II and RNAP IiL

Each RNAP is the holoenyme of a cornplex that contains a number of other factors, called general

UanScription facon (GTFs), which bind to DNA and initiate the Uânscription of different kinds of

RNAs. The RNAP 1 complex is responsible for the synthesis of precursor nisomal RNA (pre-

rRNA) which become the 28S, 5.8s and 18s rRNAs afcer processhg. The RNAP III complex

uansaibes the genes encodlig uansfer RNAs (Wh), 5s rRNA and many d, &le RN&. In

diis paper only the RNAP II complex will be discussed, since it is the polymerase responsible for the

transcription of all protein coding genes, thus producing messenger RNAs (mRNAs).

Every gene has three main parts which contribure to its regdarion: 1) the minimal promocer,

2) üie promoter p r o d tltinenü (induchg hth upsuziun promoter e len lem &TE) and

regdatory elements) and 3) Mhancer elements ('Figure 1.1).

Promoter proximal elements

UPES

v Minimal promoter

CpG island si es

-25 bp -7 bp - 20-2ûûbp 20 - 50 bp

Figure 1.1: Main elements of transcriptionai regulauon. Top h e shows the 3 main DNA elements conuohg Uatlscriptional regdanon: minimal promoter, promoter prorrimal elements and enhamer elements. Bottom line shows the 3 different types of minima promoter. REs, regdatory elements (may be negatke or positive); UPEs, upsueam promoter elemem; CCAAT, CCAAT box; GC, GC box; + 1, nanscription start site. promoter is the region jus upstream from the nansCnption sr;ur site.

1.1.1.1 The Mtiimal Promoter

The minimal promoter is the region jusr upsueam fmm the tramxiption start site. The

RNAP II complex binds to rhis a r a to iaitiate transcription of a gene. There have been 3 Merent

types of promoters idendid to date (Fipre 1.1).

i) Genes that are rapidly m r i b e d have all been found to contain a highly conserved

seQuence located - 25-35 base pairs @p) upsueam from the transcription m site. This

sequence is cded a TATA box. It gets its name from the fim 4 nucleotides in its consensus

sequence, which is: T A T A MT A MT. A change in jus one of the bares in diis sequence

drasticaily reduces the d p u o n level of a gene. The TATA box is also found to be

somewhat position specific in that, although mutations to the sequence between the TATA

box and the tramcripuon start have no affect on uanscription, if sequences are added or

de1eted in this area the uanscription start site will change to a position - 25 bp d o w n m

from the TATA box. The TATA box binding protein ml?) component of the RNAP II

cornplex recognizes the TATA box, binds to it and dong with other factors, recruits the

RNA polymerase holoenzyme to the gene so that the gene may be uanscribed It has been

found that 50% of die t h e , genes with TATA boxes begm RNA syntfi& with an

adenosine.

6) h e a d of a TATA box, some genes contaui an initiator sequence, which brackets the

d p t i o n start site. This SeQuence is responsible for recnJang the RNAP II cornplex to

the gene for uanscription. It was observed that moa initiator sequences have a cytohe (C)

at position -1 and an adenine (A) at position + 1 (the Vanscnption start site) and that the

sequeoces nu~ounding these determine the suen& of the promoter. The gened

consensus sequence was established by site directed mutagenesis of Mnous p e s that

contain an iniriaror sequence and was found to be: Py Py A+'N MT Py Py, where Py is a

pyrimidine (either cytosine (C) or thymine O; adenine (A) and guanine (G) are purines), N

is any nudeotide and +' is the transcription scan site.

iii) F U y , some genes, rnainly the s d e d "housekeepingn gens that are ubiquitously

tmsui'bed ar low rates, have been found to contain neither a TATA box nor an initiator

sequence in theV promoters. These genes have no definite transaiption start site, in facr,

uanscripuon rnay '+ ar any oia rnuititude of possible b t i sita thac a n covér a region of

anywhere kom 20 to 200 bp. The major characteristic of these promoters is the presence of

a GC-rich region, d e d a CpG island, which is found within the first 100-200 bp upmearn

of the d p t i o n srart region and covers - 2G50 nucleotides. The CG dinucleotide is not

represented in venebrate DNA as much as would be statistidy estimated, so GC-nch

sequences upstrearn of the transcription stm sire is a non-random event. Therefore, CpG

islanb are frequently used to iden* &ption initiation regions in newly cloned DNA

fragments. The sequence, GGGCGG, d e d a GC box, k represented any number of t b e s

within a CpG idand and is reco&d by the trmscripuon factor SP-1. These GC boxes, or

SP-1 sites, are especially important in these types of promoten for the recruitment of the

RNAP II cornplex to the gene.

1.1.12 The Promoter Proximal Elements

Promoter proxirnal elemenrs are sequences located - 100-200 bp upstream of the

transcription starc site. These elements include both 3 upstream promoter eiements (üPEs) and Li

regdatory elements.

i) UPEs are &-acting elements that are found in n d y all genes. They play an important role

in the basal Vanscripnon of genes and have ben found to severely lLnit Ul;inscription if they

are removed or muratcd Two of the most cornmon of these eIements are the GC boxes

recognszed by SP-1 (discuaed alier) and the CCAAT box which is recognized by the

CCAAT box rranscription fXtor/nudear b o r 1 (CTF/NFl) and the CChYT"T'enhancer

bindlig protein (C/EBP). One or both of these elements have been found in the promoter

proximal region of nearly every gene.

Regdatory elements, ah in the promoter proximal region, are i n t edec i with the UPEs.

These elements are not contained in every gene and are, in facc, quite varied from gene to

g n e , skct die)- are p;il"Jy rrsponsible for ceU-specifi; expression of iDe p s in x--tll& &q-

reside. They can be activators or dencen. The activity of these elements with respect to

orientation and position can vary. In some cases the TFs which bind the elemenrs are able

to recognize the sequences in reguiar or invened orientation and even at different disrances

from the vanscription start site, upsveam or dowmrearn. In other cases the activity of the

element is M y dependent on the position and orientation of the sequence. In the res of

the situations the importance of position and onenmion falk somewhere between the two

exuemes.

1.1.13 Enhancer Elements

Enhancer elements are sequences thar can be - 100 bp in length and are composed of rnany

&-acting elements. These elemenrs have mody enhanQng activity, but some silencer elements may

be present. Position and orientation with respect to the promoter is inconsequential. It is possible

for the enhancer element to exert its control on the promoter from a disrance of a few hmdred base

pairs to tens of thousands. niey may be cell specific or contained in all cek for the rresponse of

speclfic gena to specific stimuli. The elements can be found in any part of the gene, upstream of

die VanScnption stm site, dowmream, in the inuons and exons of the gene, in the 3' untransiated

region (UR) and even in the 3' region beyond rhe polyadenylation site and are thought to corne in

contact with the promoter by looping the DNA.

1.12 Transcription Factors

There are many proteins involved in the regdarion of t&ption. These factors c m

enhance or suppress transcriptional activity and can do so in several daferent mannea. They may

bind d i r d y to the DNA and act on the transcriptional activity , as do activators and most

represson; they may bind to other factors and enhance or suppress the activity of those factors or

act d i r d y on the vanscriptional activicy, as do co-reguiaton; or they rnay act on the DNA in a

marner whkh dianges the DNA strucnue to elicit their enhancing or supprealig activity.

1.111 Activators and Repressors

AU activaton and moa repreaon are DNA-bindmg proteins; in fact, it is king realized rhat

many TFs have the ab* to act as both activaton and represson (34 . These proreins are

desaibed as being bimodular, containing a DNA-binding and/or dimerization dornain and a

transactivating or repressing domain. To date, it is the DNA-binding domains of these TFs that

have been most closely mtdied and the known factors can be divided into 4 families corresponding

to the 4 different types of DNA-binding motifs. The helix-nun-heh 0 homeodomain motif,

the zinc h g e r motif, the basic leucine zipper (bZIP) motif and the basic heh-loophelix @HLH)

motif (Figure 1.4 (4).

i) n e helk- t~m-helk homeodomain mot* The homeodomali is a 60 amino

acid (aa) motif encoded by a 180 bp DNA sequence, termed the homeobox. The temary

suuccure created by the homeodomain is reported to most closely resemble the helixnrrn-

helix DN,4-binduig motif of prokaryotic TFs. The structure is desaiid as 3 a helices led

by an N H 2 ~ arm, thar intema with DNA in such a way that the third a h e h inserts

into the major groove of the DNA and the NHrtermind a m comects wHh nucleotides in

the minor groove (4).

Homeodomain proteins were fim discovered in Dnqddz as targets of homeotic

mutations whkh distdxd the basic body plan of developmenr during embryogenesis.

Mammalian homologues were identifid and the M y of genes to which these belong k

termed the HOX family. These genes are highly consemed from Drosophila to human,

e s p e d y in the homeobox itself. They have been found to be responsible for the rempro-

s p t d expression of guiès during rlrvélopmrnt to ensue the corrrcz ~Iereniiarion and

location of the different ceii types (4).

Zinc

Basic amho tsudne

* 1 DNA Mnding and Qmerlzatiari

Figue 12: DNA-binding domains. The ~llticnves of four DNA-binding motifs are shown on the lek the helix-rurn-hek &lTH) homeoéomain, M c b e r , basic leucine zipper, and basic heh-loophelix (HLH) domain. The interactions of theses dornains with DNA, as detennined by crystallographic analyses, ,are shown on the ngbt C, cysteine; L, leucine; Zn, zinc. (Reprinted and adapted with permission of the Massachusetts Medical Society and Dr. Papavdou (5). Copyright 1995 Massachusetts Medical Society. AU rights re~erved.)

ii) The zinc finger motif;. In this motif, 4 aa form a tetrahedral c o o r h t i o n complex with

Zn* forming what appears to be a "hger" with DNA-bhding properties. The 4 aa

involved in ceordinaMg Zn* are mon frequently either 4 cysteine residues or 2 cysteine

and 2 histidine residues. In the Cys@3, type of zinc finger the terciary structure is reponed

as being 2 antiparallel P sheets followed by an a helix The majority of zinc finger TFs

contain at least 2 of the h g e r mot& in order to bind to the DNA. The interaction o i zinc

fingen with the DNA is via rrsidues wirhin the a h e h inserting into the major groove of

the DNA. Eadi zinc h g e r independently contans a 3 bp sequence, whidi is often rich in

guanine bases, which interam with arginlie residues in the finger. Well known, important,

zinc fhger factors belong to the nuclear receptor supelfamily and the GATA family. In

both of these cases the proteins contain cwo zinc fingen that have a Cys, configurarion (4).

iii) The basic Ietlcine zipper (bZIP) motif;. This motif is a heptad repeat where every

seventh Knino acid is moa frequently leucine and on occasion another hydrophobic amino

acid sudi as isoleucine, valLie or methionine. This is an amphipathic a helical configuration

where the hydrophobic resïdues are all aligned on the same face of the helix. This formation

leads to the dimerization of bZIP monomen by a paralle1 coiled-coil interaction berween the

a helices, termed a leucine zipper. Dimerization of bZlP monomers brings together basic

amino acids in eadi monomer that lie immediately NH2-terminal to the zipper. Bringing

together the 2 basic amino acid regions creates a hinctional DNA-binding domain that

cannot be formed d e s s dimerization of bZIP proteins takes place (4).

Excellent examples of bZIP factors are the AP-1 site binding fmoa, which have

been shown to act as both activators and repfesson (6-8). AP-1 stands for aaivating protein

1 and as the name states was originally found to be an eniiancer. Two families of proteins

bind to the AP-1 site: t h e h proteins and the Fos proteins. The& M y is made up of the

9

proteins @m,/rmB and JunD. These proteins are able to fom homodimers of themselves or

heterodimers with each other. The Fos family is made up of the proteins dta, FosB, Ra-I

and Rd. These proteins cannot form homodimers or heterodimers with eadi orher to

bind to the AP-1 site, they need to fonn heterodimers with Jm famiy proteins in order to

act on the DNA (9). These proteins recognize the paindromic sequence 5'-TGA(C/G)TCA-

3'. The basic doriahi in ~11ese Lcon are h ail a n & p d c l coof,guiarion and & m f m

each domain binds ro the half-site sequence 5'-TGA-3' which is present on each su-and of

the DNA (4). Nthough these factors can act as &ptional repressors themselves, a

repressor of AP-1 binding is the factor IP-1. This kaor has the leucine zipper domain, but

not the basic domain. This means chat IP-1 can foxm dimers with other AP-1 binding

factors, but the dimers will subseyentiy be unable to bind to DNA (4).

iv) The basic helix-loophelir (bHLH) motif This This very similar to the bZIP motif except

that the HLH motif is two a helices separated by a nonhelical loop. As with the bZIP

proteins, the a helices of one monomer inreract wirh the a helices of another, bringing

together the mol4 aa basic regions forming the funaional DNA binding domain.

Therefore, like the bZIP proteins, bHLH proteins m m fonn dimers in order to be

hinctional. In addition to Wes of factors which dimerize by only the HLH domain, two

aciditiond famiiies exist where an additional domain is necesary for dimerbation. One is

the bHLH-ZIP family which includes an a-helical leucine zipper jus COOH-terminal ro the

HLH domain. The other is the bHLH-PAS family which indudes a PAS dimerization

domain just COOH-tennioal to the HLH domain. The PAS domain was im&@ identifid

in the proteins FER, -ARNT and SM and is approrrimatdy 300 aa long (4).

Nearly all bHLH proteins recognize the consensus sequence 5'CANNTG3', te&

the E-box. Like the AP-1 site, this is a palindrome where each of the baac domains

10

recognize one haE-site. El2 and E47 are a couple of examples of bHLH factors. Si& to

the repressor of AP-1 acrivity , IP-1, there e x k repRaon of DNA bindmg within the HLH

M y as well. ID is a protein containlig only the HLH domain and no basic domain. It is

able to dimecLe with El2 and E47 but it subsequendy rendea the dimer unabie to bind to

DNA (4).

Another set of factors have ken identifieci as TFs, but they do not bind to DNA. Innead

these factors act by inteiaCLing with other TFs through protein-protein interactions.

i) Coactivaton: Coactivators bind to DNA-bound TFs in order to r d t other facron

needed to initiate tmscription, enhance the activity of another TF, bridge the aCUvity of

different TFs or change die chromarin configuration (see section 1.1.39. Typical examples

of coactivaton are the TBP-arsotiated facton VAFs). These h o r s bind to the basal

uansaiption factoa like TBP that are bound to the DNA and recmit other factors necessary

for uaascription, or interact with promoter proximal or dista elernents to elicit their activity

on the uamcription cornplex. (4).

Corepresson: Corepressoa may eh& a masking effect by binding to the DNA-binding

domain of an activator or a quenching effect by binding to the activation domain of the

actNator. In both of these mses the activator is rendered inactive. They also may bind to

another TF and conse~uently target it for degradation or even degrade that TF itself.

Finally, they may evoke their negative acWity by activatïng other means of gene den-

such as the deacqlation of histones by the histone deacetylases WACs), descriid in

more detail in section 1. î.3i (1-3).

iii) 0th- cofucton: Many 0 t h cofaccon exist, but they cannot be labeUed as coactivaton or

corepresson, since they are able to eliat both responses. %me of diese h o r s aid in the

dimerization of other hors . For example, the formation of homodimers of the

homeodomain &ptional activator hepatocyte nucleac factor la (HlW-la) is fdtated

by the cofaaor DCoH. Other faccon acc on TFs by posnranshtional modifications, nidi as

oxidation~reduction and phosphorylaUoddephosphory1ation. Two examples that involve

the phosphorylation nate of TFs cm be found arnong the AP-1 factors* One is that it is

necessary to dephosphorylate c-/M in order for it to bUid to the AP-1 site. The second is

that IP-1, which a n inhibit AP-1 activity as mentioned in sectioni.i.î.Iiii, needs to be

dephosphoryla~ed before it cm exert its inhibition (4).

Chromutin: Chromath is the cornplex of coiled DNA, hisrones and other proteins that

confen a sufficiently high degree of compaaion on diromosomal DNA ro d o w it to be

contained within the nucleus. The fonn that duomatin tales is very important to the

regdation of gene transcription. There are two forms of chromath, haerochromatin and

euchronmin. Heterochromatin is the tightly packed, highly coiled fonn of chromatin and

any gens within an a m of heterochmatin are rendered inactive. Euchromatin is the more

relaxed f o m of chromarin where transcription of gens can take place (1,2,4).

The moa primary unit of chromath is the nudeosorne. Nudeosornes connst of a

suetch of about 200 bp of DNA th Y wrapped twice around an ocramer of histone

proteins. The position of the nudeosornes themselves on the DNA may block muscription

somewhat even in the more relaxed euchromath. Therefore, the chromaUn needs to be

remodelled at diese positions in order for trmscription to proceed. There is, in fact, a family

of An-utilizing factors, the SWVSNF M y , ,that d y s e chromaM rem- and these

h o r s have ken found to aaoQate with the RNAP cornpiexes. These factors somehow

detach the DNA from the histone octamer and r d the DNA molede a number of

nucleotides away h m the initial binding site, in &a causing a wave-like action of DNA

detadung and reactadiing to occur around the nucleosome. How exactiy the rernodelling

facton are recruited is poorly u n h o o d Conversely, if a gene that is king d e l y

uanscri'bed ne& to be repressed there are dencing elements which bind TFs that recruit

rhe rem&lling fimn ta rérnokl th2 chamah inro iï confûrmacion that denczs Ehe guie

(12,4).

Aceqdation of the nucleosomes is also a method of r e g u h g manscription. The

histone tail of a nucleosome has a high positive charge, this charge k thus anracted to the

negatively charged phosphate backbone of DNA and creates a Dght association. Aceqdation

of the histone tail decreases irs positive charge which consequently causes a relaxation of its

hold on the DNA, allowing it to be accessed by transcription facton Conversely, gens can

be repressed by deacetylating the histones. In fact, exverne deacetylation of the

nudeosomes will cause heterochromatin to be formed, which as stated earlier, dows little, if

any transcription to occur. Factors which cause borh the acetylarion and deacetylation of the

nudeosomes have been idenufid Histone acetyluansferases (HATs) acetylate, while

HDACs deacetylate histone. HATs have been identifid associating with the RNAP

complexes, as weil as with other transcription fmoa, while HDAC activity has been

dernonnrated in both tramcriptional represroa and corepresson. Therefore, the HATs and

HDACs, dong with the chromatin remodelling factors play an imporrant d e in the

regdation of gene vanscription (1 ,2,4,10).

ii) Architecturul Truttsmption Fucton: These TFs are another f o m of DNA-bhding TF.

Unlike activators and repressors, however, they do not aw their action on other factors

invohred in UanScnption, rather, they act on the DNA irself. The DNA bindhg domain is

tenned a high mobiliry group (FIMG) domain. It is an 80 aa motif which binds to the rninor

grove of the DNA double h e k These h o r s aker the tertiary structure of the DNA.

Bending the DNA allows for many other events to happen. The bend may render ce&

elements inaccm'ble or it rnay bring together factoa that have bound to the DNA so that

they may interan. with each other. An e,xampIe of an architectural TF is the iymphoid

e ~ a n c e r factor i m-i). Tnis faccor bindï in the enhancer of the TseU nceptor a gene.

When it is bound it causes a sharp bend in the DNA which brings together factors which

bind to the enhancer on either side of the LEF-1 site and allows hem to subsequently

functiody interact (4,ll).

iii) MahUE-binding Factors: These factors bind to mauixattachment regions (MARS) of DNA

and anchor the DNA to the nuclear ma& This occurs during the interphase of a cell when

the chromosomes are orgamzd h o lwped domains. The MARs are usually AT-rich

sequences and the MAR-binduig proteins bhd to the minor groove of the DNA in these

regions in order to anchor them. This activity can have a profound negative effea on the

vanxnpti~n rate of a gene (3).

iv) CpG Methylation: Methylation of CpG sequences has been shown to silence the

transcription of genes. The rnethyl-binding protein M e 0 2 is reponed to bind to the

methylated sequences. Studies have shown t h MeCP2 binds the corepressor mSLi3A,

which complexes with HDACi and HDAC2, and these fanon mediate the deacqlation of

histone. Therefore, CpG methylation is observed to repress the uanscription of genes by

caUS;ng the deacetylation of the hinones in the nudeosorne, uitimately resulthg in the

formarion of heterodvomatin (12).

1.1.4 Repressor cis-Elements

S p d c repression of gene &ry in eu chroma^ k incompledy understood, but rnany

factors and rnethods of repression have already been discovered It is now undemood that 2 main

types of repressor elements exkt (see review by Ogboume ad (3)): 1) The chsical, position-

independent silencer element and 2) the non-classical, position-dependent negative regdatory

element m). Both of these types of repressor elements can be found in any part of the gene.

1.1.4.1 Silencer Elements

Silencer elemenvj are position-independent elements that direct active repression

mechanians. These are parailel to theù acllvator ci-elemenr coumerparts in that in mon cases the

TFs for these sites will recognize their elements in any orientation and will exert their activity on

dieir target from anywhere in the gene by acting wirh other factors to loop out the DNA in becween

the element and the target. The represson that bind to these elements usuaily act directly on the

RNAP complex by inhiiiring the cornplex's assembly, the action of one of its components or the

binding of the complex to the DNA. This group of uanscriptiond repressors are to date the largest

group reported An example of a silencer element is the dorsai switch protein (DSPI) element.

DSPi binds to this element in a position-independent manner and inhiiits transcription by bliding

to TBP. TBP d y binds to the TATA box and recnllts RNAP II, but when the uari9cWa8on

domain of DSPi binds to TBP the interanion between TBP and RNAP II is inhiiited (3).

1.1.42 Negative Regdatory Elements (NREs)

NREs are position-dependent elements that direct passive repression mechanisms. There

are a number of different mettrods by which these mechanisms are carrieci out. Masking is one way

in which NREs may funaion. This ïs a siniation where the NRE overlaps d, for ei<ampIe, an

acevator ske or the transcription start site and the activators or RNAP complex are unable to bind

to the DNA and elicit transcription. Quenching is a second mechanism. In this case the NRE is

15

adjacent to an activator bindiag site and the presence of the repressor bound to the NRE smically

hindea the activity of the acaVator's activation dom- A &rd medianimi is physical hindrance.

In these cases, when the represMr bincls the MIE it may bend the DNA in sudi a way that it

inhbits actix~ors from conracMg the RNAP cornplex, or it may simply stand in the way of

elongation of the uanscript. The dement to which the nudear factor Yin-Yang 1 (WI) b inb is an

example of dn ?YIRIZ. In the cfar pornotu; binding of YYi io iü & m a t bènils the DNA in mzh a

way thz the interaction of the d\MP-response element with its oj-element is inhiiited (3).

1.2 What is the Epithelial Na+ Channel (ENaC)?

In rhis study the eukaryouc gene of interest is the b b u n i r of the rat, adoride-sensitive,

epithelial NaC channel (ENaC). The epirhelia Na* channel Û a Na' permeant ion Channel thar is

found in the apical membrane of absorptive epithelia and is expreaed in the rissues of many

organisms from amphhians to birds to mammals (13-18). In fax, ENaC beiongs to a large super-

farnily of ion channels called rhe amiloride-sensirive Na' channel and Qgenerin (NaC/DEG) family.

In addition to the 3 subunits (a, P and y) of ENaC, this famiiy includes the non-epirhelid 6-ENaC

found in the human brain, pancreas, ovary and tes& (19); the rnammalian brain and sensory neuron

specific acid sensing ion channels ASIC PNaC2) (X,21) and DRASIC (found specifidy in dorsal

root gangk) (24, the related BNC 1 W E G , BNaC 1) from the human brain(ZlJ3,24) and the

related s m d intestine channels rodent BLTNaC (25) and human INaC (26); mechanosensory

channels in nematodes, cded degenerins (27-29) and in DrosopSi(a called Pickpocket (PPK) (30); the

hgand gated FaNaC, found in the neurons of the mail H& m p e ~ (31,32); gonadspecific dGNaCl

(&O d e d Ripped P o k ) in h s @ z (30 33) and t&-specific TNaCî found in humans (34).

ALI the subunits of the h e I s included in NaC/DEG super-My have 2 m e m b r a n e

domains wirh a large ~macdukr loop and short i n d u l a r amino and car&xyI termini Mon are

amiloridesemkke and all are cation pe~neant but anion inipermeaflt cha~els.

16

1.2.1 structure

111.1 Protein Stnicture

The cIynalline structure of ENaC has yet to be eluadated but many methods have been

used to gain a better understandmg of the protein structure of the chamel. ENaC was cloned from

the distal colon of At deprived rats and was found to contain 3 homologous subUILits: u, P and y

(2935-37). These 3 subunits were thought ro ail play a part in the construction of the channel

because only when 4 3 subunifs were expressed in Ahpis oocytes was there a resuiing Channel

with comparable properties to that of the native channel(35) (discussed furrher in section 12.4.

The 3 subunits have been proven to associate with each other (38) and ail of the nibunits have been

found to d e sirnilar conmbutions to the formation of the pore of the Channel (39). When the

amino acid seqyences of the 3 nibunits were aligned cogether and compared, they proved to be

homologous. At the nucleotide level, the a-subunit shared 35% identiv with the b b u n i t and

340h with v b u n i t and the b b u n i t shared 37% identity with the y-subunic (35).

The membrane topology of the subunits was fùst assesseci by e,Yafnining the primary

m c n u e of the subunits: 1) It was observed diat the NH-ermini of the nibunits did not conrain

sequences diar would predia a signal peptide or leader sequence. 2) Two hydrophobic domains

consining of an a-helix menue and an area of ksheet folding were predicted by hydropathy plot

analysis. The a-helices were termed Mi and M î and the bheet areas were termed Hl and H2,

thus giving Ne to the rwo hydrophobic domains, MINI and Hî-EN. 3) Two cysteine-rich regions

were noted in the hydrophilic region berneen the hydrophobic domains. With these observations it

was then predicted thar the ENaC subunits would CO& of two membrane spanning domains, MI-

HI and ED-EN, a large extracellular loop containing 2 cysteine-rich boxes, and the NH,- and

COOH-termini would be short huacellular sequences (35,N). Studies on the ambunit revealed

what is thought to be the secondary structu~ of all of the subunits MI and M2 were, in face, shown

to be membrane spanning seQuences, but HI and Et2 were found to be localized exmceUularIy (40).

A nuniber of independent studies demomted, either by glycosylauon activiq of the asparagine

raidues of the nibunit or by immmoprecipitation of proreolytic fragments of the subunit, that the

large hydrophilic region, containing the cysteine-rich box, between MI and M2 was in fact an

extUcu:d& lcop and th die NH,- and COOH-redi were hrraccllular (4C-42). A xtat

refinement to this topology arises from evidence showing that the H2 region loops back into the

membrane to form parc of the channel pore dong with M2 and part of the preM1 sequence

(39,40,43) Figure 1.3).

Figure 13: Membme topology of eadi subunit (a-, B and y) ENaC. MI and MZ indicate heIicaI uansmembme domains; CRDI and CRD2 indicate cysteine-rich domains; glycosylarion rites are indicated (Reprinted with pennission of Cambridge University Press and Dr. Benos (49.)

The subunit noichiommy of ENaC is controved and two different models have ben

proposed One mode1 niggescs that the channe1 composition is ~@,y~, with the 2 a-subunicj king

separated by a psubunir on one side and a ynibunit on the other. This mode1 was created based on

the biophysicai properties of ENaC channels in Xiqms oocytes, containing mutations on the

various subunits, diat had affected sensitivity to specific blockers (45,46). It is supported by studies,

performed with human embryonic kidney cells @EK-293), indicating FaNaC, a member of the

NaC/DEG family, was found to consist of 1 subunits (47). The second mode1 suggests that the

channel has a a3$,y, composition. This configuration was nipporced by elecvophysiological

evidence fiom channels, expressed in Xenopa oocytes, wah mutations altering th& inhibition by

methanethiodonates and by sucrose gradient sedimentation of subunits expressed and assembled

mubu or in COS7 ceils (48,49). Berdiev ad, however, proposeci diat the two theories were not

necesady m u d y exdusive. They found rhat the a-subunits did in facc foxm teuamen, when

expressed aione after h.Uao translation and insertion into proteoliposomes or planar îipid bilayers, . However, they proposed that this might be simply a core condudon element of ENaC; innead of 2

of the ambunits k ing replaced by P and ysubunits, the P and ysubunits were added to the a-

tetramer. They proposed that the ratio of the ENaC heteroteuamer might be correct, but the

number of subunits was underestimated They ~ggesred that each subunit may fonn di- or d e n

with itself More joining the other subunh to form the mature ENaC (50). In X k p s oocytes,

Eskaadar ad hvthered the argument by showing that a Mgle Channel contains 8 or 9 subunits by

f r e e z e - b e dectron microscopy and by electrophysiologid means displaying that at Ieast 2 of

the subunits m m be wbunits (51). The rel;shiIity of all of thûe studies is somewhat questionable,

since they are performed in heterologous expression synems, yet, alI of this in mind, t seems

possiile in these systems thar ENaC could have a subunit stoichiometry of or there could be

charnels consisting of a variety of subunit compositions that evist in nature, as suggested before by

McNicholas and Canessa (52).

1 1 1 1 Gene Structure

Since the initial cloning of the ENaC subunits from rat dinal colon (29,3137), the Channel

has been doned from a number of different O-, including human (53,54), mouse (55),

chicken (1 a), cow (56) and XeMpcr[aam (57). The genes of the mouse and human subunits have

been mapped to specific chromosomes. The human ambunit gene has k e n localized to

chromosome 12p13 (58) and the b and ynibunit genes are closely liaked in a 400 kb fragment on

chromosome 16~12-pl3 (59). The gene encodtig mouse a-ENaC has mapped to a conserved

iinkage group, which corresponds to homologous genes from human chromosome 12, on disral

chromosome 6 (58) and the and ysubunit genes were found to be closely linked on dista

chromosome 7 (60).

The genomic stnicture of the human a- , and ysub"rs and the rat a- and ysubuniu

have been decerrnined. The human ambunit was found to contain 13 exons that spanned 17 kb

according ro one publication (61) and 30 kb in another (U), both coded a tranxript of - 3 250 bp

and an open reading hame (ORJ?) for a protein of 669 aa (54,61,62). The rat a-nibunit was found

10 contain 12 exons that spanned 23 kb which coded a mature uanscript of 3 161 bp and an ORF

for a protein of 698 aa (29,63). The rat subunir has been found to have 2 possible vanscription stan

sites, one at + 1 and one at +454, mg rise ro 2 pombilities for Exon 1: Exon LA and 1B. These

alternative starts are both contained in the 5' UTR of the gene and therefore do not affect the

protein mm. The translation start codon is downsueam from the aarc of Exon 1B and the stop

codon is contained in Exon XII (63). Accorchg to 2 snidies of the human a-subunic, there are no

variants in Exon 1 and the translation narr codon is in Exon II and the stop codon is in Exon Xm

(6 l,62). However, in a & by Voilley ad, Northem aualysis of OC-hENaC from the lung revealed

two distinct fonns ofmmcripts, one 3.4 kb in length and the odier 3.8 kb in length (64). This led

Thomas etd (65) to believe that there were spiice variants among the a-hENaC mRNA and they

subsequendy reponed 2 major and 2 minor a -WaC transcripts, hererogeneous at the 5' end (a-

hENaC i + a-hENaC4). a-hENaC1 is as expected from the d e s by Chow a d (62) and Ludwig

et aL (61) and a-hENaCZ adds 59 residues to the NHZ-terminus of the protein. Both variants were

found to function equivaiendy when arpreaed in Xenopa oocytes (65).

The human ysubunit was reported to be made up of 12 exons spanning 23 kb which coded

a uamcript of - 2950 bp and an ORF for a protein of 649 amino acids. The rat ysubunit was f o n d

to be made up of 13 exons spauning 37kb which coded a uanxript of 3009 bp and an ORF for a

protein of 650 amino acids. The start codon was in Exon II for both subunits and the stop codon

was in Exons W and XIII for human and rat rrspectively. No spiice variants or dtemate

mmcription start sires were found (35,53,66,67).

The human &nibunit was found to be made up of 13 exons which coded a uanscript of

- 2100 bp and an OEW for a protein of 64û amino acids. The srart codon was located in Exon II

and the stop codon was in Exon Xm, No splice variam or alternate mmcription narc sites were

found (53,68).

1.2.2 Physiological Function

The physiology of ENaC was fim explored in kog skin and toad urinary bladder where the

major definhg c h a r a c t e c of the chanad was discovered; its high s e l b t y for Na'. ENaC was

found to be 1W to 1 ûûû Mies more penneable to Na' than to K+ and impermeable to anions. In

fia, the only other ions tha* the chamel would transport were Li+ and H+ (69,70). Using the patch-

damp technique and rat comcal co~ecthg tubde (CC?) c&, a sixq$ech~d conduMnce of 4-5

21

picosiemens @S) was observed (71). The gaMg kinetics of the Channel were shown ro be slow,

giving mean open and closed Urnes in the range of O.iSsec in three different tirnies induding rat

CCT, A6 cells and toad urinary bkdder c e h v2-74). The dianne1 was also observed to have a

saturation point suggestïng that a Na* ion would bind to speafic sites withli the pore of the channel

and that at hi& concenuarions of Na', concentrations over the saturation threshold, the transport

tksugh the &=el vodd 5e hnired by the of dissocktion of the ion h m its bhding site

(75976)

Another important characteristic of this charme1 is amdoride's ability to block ks function

with y's reported between 100 nM and 1 (77-79). Amiloride was believed to bind ro the

exuacellular surface of the channel, since it was able to block the channel only when applied to the

extracellular surface (80). Once the ENaC nibunits were cloneci and expressed in XeMpa oocytes

the result was a &anne1 wirh the same characteristics as the native Channel when ail 3 nibunits were

expressed (35). When the a-subunit was expressed by itself it showed all of the charactexistics of

the narive channel, except diat it produced a greatly reduced current (29). N e i h the nor the

nibunits produced a m e n t alone but when one or the other was coexpressed with the asubunit

there was a 3-5 fold increase of amiloride sensitive m e n t (35) (Figure 1.4). The ap and

channels also showed differing ion seleccivity and d o r i d e response which led Canessa etd to

believe that all of the nibunits contritbuted to die ion pore and the amiloride-bindmg site. They aiso

showed, by using p/y chimeras, that R was the H2 region thar was active in doridebinding (52).

Schild ad M e r confùmed this role of the H2 domain using siteirected mutagenesis and

showed that it also contri'buted to the formarion of the ion pore dong with the M2 domain (39).

Figure 1.4: Amiloride sensitive currents in XBlopcsLaevrs oocytes injecteci with HzO, cRNA (O.Qing) of a, P and yrENAC done, or combinations of a$, ay, py, apy or poky(A) +RNA from the eRtiched fraction of rat distai colon (Reprinted with p"""on from I\knrne (35) copyright (1994) M a a d a n Magazines Ltd and Dr. Rossier.)

1 3 Biologid Sipificame of ENaC

ENaC is expressed in dt absorbing epithelia Licluding the dista nephron of the kidney,

lung alveolar and airway epithelia, dista colon epitheiia, skin, salivary and sweat gland ducts and

rasce buds (81). In all of diese organs and tissues the charnel has a sigdcant role in salt and fluid

homeostasis. The bulk of study has focussecl on ENaC's contn%ution to sat and fluid homeostasis

in the kidney, colon and 1- as cletaileci below.

13.1 Lung

During f d life the lungs are filled with fluid as a result of the active secretion of CI- into the

lumen of the lungs (82,83). The presence of fluid during this stage of He is essential for the proper

development of the fetal lung (84,85). At the time of binh this musc diange, the fluid mus be

deared so d m the newbom can take its fint b r d and gas exchange in the alveoli can occur. It is

m d y thought d m a rJpitch to active Na' tramporc acroa the &eolar e p i t h e h phys a aiacal

role in the clearance of the f e d fluid kom the h g (8692).

ENaC's expression inneases dunng late gestation in order to prepare the fenis for the

upcorning birdi. In agreement with this late gestational gene activation is a mdy by Tchepichev a

al (93), Northem analysis showed no detectable ENaC mRNAs in lung und day 19 of rat gestation

(term is 22 days), at which t h e only the a-nibunit is expressed at detectable levels. The i3- and y-

subunits are undetectable und day 21. An hsitu nu*, perfoxmed by Tabot ad (%), in mice

agreed with diese d t s . In conuast, Smith ad (99, found earlier expression of human ambunit

mRNAs by haiu anal+. This early expression of mRNA was confirmecl by a study of human

ENaC protein expression by Gaillard ad (96). They found the & and p b u n i t proteins 10 be

expressed &et only 17 weeks of gestation (term is 40 week) and expression was up to adult levels

and ar ad& disuriution afier only 30 weeks. A nurnber of different hypocheses can ben derived

from these observations. One hyporhesis would be that human ENaC expression is different from

that of rodems and that perinatal lung liquid dearance in humans involves more complex or

different pathways than that of rodents. A second could be that, although the proteins are

expresseci at an early time point in humans, the b e l s may not be tmsported to the cell

membrane und they are needed This may ah be the case for rodents, but the levels of mRNA

expression in the previously mentioned studies may have been too low to be detected dunng earlier

stages of developrnent. Thirdly, the proteins may, in hct, be inserted into the apical membrane of

the ce&, but they ky inactive und some stimulus tums them on at the appropriate time.

There is evidence, nonetheles, that relates the f d lung's switch h m flid secretion to

fluid absorption u, Na+ transport. Exposure of matme f d lmgs to $ and pz agoins

caused the switch from flui&secretion to flui6absorption (97,98) and in a Nniiar W o n p r i v

cultures of late gestation FDLE c& exhriited inaeased Na+ absorption in response to P ago&

(99,100). Membrane-permeam analogues of CAMP were a h &le to mediate the switch that the

and p, agonisa were able to produce, but none could create diis phenornenon in immanire lungs,

regardes of ENaC Nbunt expression (97,101). With this correlation b e e n Na' transport and

the ion and fluid uansport conversion it seemed reasonable to conclude that respiratory distress

syndrome (MIS), seen in premarure infants, may in parc be due to insuffiaent Na+ vansport (102).

A mdy by Barker ad (103) reported that premanire infant humans with RDS had a lower than

n o d amiloride sensitive potential differenr arross their n a d epithelium, suggesting that a iower

Na+ transport rate was contriiuting to the Lnproper lung fluid clearance. Additiody, evidence

exists thar direcdy links inadquate ENaC acivity with failure of feral lung fluid clearance. It was

shown that in)ilimon of Na+ charnels by the amiloride d o g u e s , benzamil or p h e n d , or bock-

outs of the or ysubunit genes of m o w ENaC (mENaC) showed slow clearance of fetal lung

fluid after b i d (89,9O, 104,105). A knock-out of the a-mENaC gene resulted in the newbom mice

being unable to dear th& lung liquid and dymg shortly after birth (88).

During adult life the role of ENaC continues as the rate limting sep in Na+ absorption and

plays a key role in lung homeostasis (106108). In ha it is thought that diis regdation of Na+

absorption dong with the Cl- secretion in the airways is kept in a fine baiance in order for the lungs

to keep the fluid 1 i . g their epithelia at the proper thickness and vixosity. In order to maintain rhis

activity ENaC is expressecl in the nirface epithelia of the nose, uachea, brondii and bronchioles, the

glandular epithelial ce& and alveolar type II cek (AlTl) (93,107,109-112). The balance between

fluid secretion and reabsorption is disrupted in patients with PseudohypoaIdosteronism I

(PHAI) and Cystic Fbrosis (Ce. In a study of PH. patients with the disease were found to have

loswf-funmon mutations in the ENaC subunit genes wnh a severe rend phenotype. These los-

of-funkon mutations would ause lower than normal absorption of Na+ and thus lung fluid

deaance would be lessened. The patients did indeed present with excess fluid in the airways of

25

their lungs (113). On the other hand, ENaC har been found to be down-reguiated by the Cystic

Fibrosis Transmembrane Regulator (CFTR) and dius in the absence of funaional CFTR, as is the

case in CF, ENaC is hypeactive. The hyperacavity of ENaC causes excess salt and watcr ro be

reabsorbed from the lung lumen contributhg to the thick, dry mucous characterisic of CF (1 14-

11 8) (ENaC/CFTR interactions are dûcuned in more derail Li Section 1 A. 1.4).

1.3.2 gi*

The biophysicd properties of ENaC were determineci by parch clamp of kidney cells: rat

cortical col.Ie&g dua (CCD) cells and Xmpalaaic A6 kidney cells Q1,72,96). The expression of

ENaC in the kidney is mainly restficted to the dina nephron. Besides the CCD, the Channel was

found in the distal convoluted tubule, the comecting tubule and the outer medullary colkting ducr

(OMCD) (1 1% 119,120). AIthough inner meduilary collecting duct (IMCD) did nor show expression

of ENaC mRNAs by i.2 sdzd hybridization (119), the IMCD ceIls did show expression of the

channei's m R N k from IMCD cells in primary culture. This suggests that ENaC conmiutes to Na'

tansport by IMCD cek transport as it does to the other regions of the d i d nephron (121). In the

kidney, ENaC plays its mon important role as a cont.ri%utor to the elmolyte balance of the body

and thus takes part in blood pressure control. The principle cells of the distal nephron tubules

express ENaC on cheir apical membrane, facing the heumen of the tubuies (lî2,lU). The more Nai

is reabsorbed, the higher the salt concenuation in the blood becornes and therefore more water is

absorbed to maintain the h o m e o s ~ c concentration of sait in the bloodsueam, therefore, blood

pressure rises. With les Na' absorption the converse happens.

ENaC's role in blood premire regulanon t evident in the fact thac mutations of the subunits

can cause d e r hypertension or hypotension. Losof-funaion mutations cause

pseudohypoaldostero~ type 1 PHAI), which is a form of hypotension that presents dong with

hyperkalemk, salt-wasting, rnerabolic acidosis and e l d aldosterone levels in the planna that

does not respond to corcicosteroids (124). One such mutation is a glycine to serine point mutation

at position 37 (G37S) of the human fhubunit (125). Gain-of-funaion mutations cause Liddle's

Syndrome. This is a f o m of hypertension that p r e ~ e ~ t s wbh hypokalemia, nrppressed plasxna renui

activity and de<lreased aldosterone lm&. Amilonde is effective in treavnent of the hypertension

and hypokaemia (126). The mutations in Liddle's syndrome are truncations of the COOH-tenninus

oi the or p b u n i t s of the chamel, which lead to increased retention of mature channels on the

e x v a c e l l h membrane (127,128). Human and ysubunits likely influence systolic blood pressure

as differeat poiymorphisms in chromosome lbp12 correlate with the patient's systok pressure

(129). In rnouse knock-out snidies where the & or yntbunir gene was dimipted, the homozygous

deficient animals died within a few days from their rend disease having presented with severe

hyperkalemia and sdt-w&g. It is thought that their death was due to the severe hyperkaiemia

(89,104). Knock-out studies on the a-subunit could not be evaluared for effect on rhe kidney since

the animas died so quickly of severe RDS (88).

133 Colon

As it was stated earlier, it was from the distai colon of the rat that ENaC subunits were fim

isolated and cloned (29,3137). The channel is expressed only in the surface cells of the distai colon,

not in the crypts, and has not been detected in any other part of die intestlie (112,119). An

adoride sensirive current is ody detectable in the presence of higher than normal levek of

mineralocomcoids in the blood saeam. In fact, under basal condi8ons Na' tramport is via a

coupled transport of NaCl through Na+/H+ and CVHCO; antipo ners (V,UO,l3 1). Under these

condiuons ody the ambunit mRNA is expressed at a detectable level wMe the and ysubunits

are only induceci with exposure to rnineralocomcoid (1 4 132).

1.4 Regulation of ENaC.

The repuiation of ENaC activky is quite complet and e x e d ar multiple levels, from gene

d p t i o n through tdficking to activation state of the mature channel. A Iarge number of signal

transduction pathways play roles in different phases of the nibunit genes' expression. Some work

stricdy at transcn'ption and some affect ENaC only post-wlauody, while others may play a part

ar alI leveh of expression. Regdation of ENaC has been observed to be nibunit and Ussue specific

during both fetal development and aduk life. This is shown quite weil in studies of levels of ENaC

subunit m R N h dong a n o d amilt rat respiratory tract, in the perinaral period of lung

development and in the kidney and colon under stimulation by aidosterone (93,132-134).

1.4.1 Regdatory Factors

Many factors conuibuting to ENaC regulation have been studied and several of h e m are

presented in the following sections (1.4.1.1 - 1.4.1.8).

1.4.1.1 Adrenocorticosteroids and Fernale Gender Hormones

Aldosterone, whose effect was fim discovered in the toad bladder, is the Most snidied of

ENaC regdators. Two processes of activacion by aldosterone are observed; 1) a fast phase, tenned

the "early effect", which was thought to CO& of either the activation of preevining charnels from

a pool near the apical membrane that inaeased Na+ nanspon within 3 houn or an increase in the

open probabdiry (PJ of the channel and 2) a slower phase, t e n d the ''late effect", which consised

of activation of transcription to manufacnue akao chamels which appeared after 3 houn (131

137). This 2 phase response has since ben observed in 0 t h tissues, includmg rat distal colon

where a ment midy has shown that the eady effett is not due to the activation of preemsting

chatlllels or ao increase in Po, but d e r a rapid upregulation of the transcription of the and y

subunits (138). An increase of Na' transport is seen in kidney and colon ce& in response to low salt

diet or exposure to aldostemne, but not in the lung (131,139,140). Na' transport is enhanceci in

fetal lmg by the glucocorticoid, dexamethasone (64,141). In one hziu, mouse mdy, however, no

change in NaC vansport was observed in the lungs after exposure to aldosterone or dexamethasone

(1 42).

Mechanimis of action of ddonerone Licreasing the Po of ENaC have been investigated in

Po of the channel(143). There have been a few factors that have ben found to work in concert

with conicosteroids to regulate ENaC. Argirune-vasopreain has been shown to synerginically

stimulate Na+ transport when working together with aldosterone at physiological levels (144). The

thyroid hormone, nüodorhyronine VJ, has been shown to potentiate the stimulatory effect of

dexamethasone in rat lung primary culture ceils (141) and immature rat fetal lung (145), it is

synerginic with hydrocortisone in the sheep f e d lung (146) and T3 showed a permissive effect on

aldosterone in the colon (147). In one mdy the actions of T3 were found to be on the Na+/K+

ATPase and aot ENaC in a colon cd h e (148), however, potenthion of the a-rENaC

dexamethasone response by T, was observed in mamient d e c t i o n s proving the thyroid

hormone's comection to ENaC (63). The Ras pathway has been found to end in repression of the

ambunit of ENaC in salivary epithelia ce&, when workmg together with the glucocolticoid

receptor (GR) and the glucocorticoid response element (GE) (149). Moa excitingly the s e m and

glucocomcoi6regulated kinase (sgk), which is part of the serintthreonine kinase family, has ben

idenaf;ed as an ddosteroneinduced reguiator of ENaC activity. This is because it was found to be

an aldosteronestimuIated gene that caused a 7-fold stimulation of ENaC activity when ENaC and

sgk were coarpressed in oocytes (150).

The fernale gender hormones progesterone and l 7 w o l are other hormones with

ENaC Rguiato ry abilities. When they were combined and a-ered together to immature

29

f d e rat aiveokr primary culture cek, adult AT11 cells, an increase in Na' absorption &er 5 days

of incubation was observed(I51).

1.4.12 Vasopressin and the PKA Pathway

ENaC is upreguiated by exposure of cells to arginine-vasopressin (AVP) h o u & AVP

stimulared CAMP in kidney CCD ceils (152). This relation of AVP and ENaC to CAMP is fbnher

nrengrhened by the kt Jiar iorskoiin, a known CAMP activator, is &O abie to enhance ENaC cell

d a c e expression (153). This dMP stimulation is thought to bring about PKA d v i t y (81). In a

study by Djelidi etd (154) it was observed that AVP increases the level of and wbunit &As,

but not a, in a rat CCD c d line, suggesting that the increase in ENaC activity due ro AVP may be

mediated ac the tratl~criptiod level. The exact medianimi of action fiom AVP to PKA to ENaC is

still unclear, dthough, it is known that min filaments are r+ed for PKA to stimulate ENaC

(155). However, AVP is not able to affect ENaC in FDLE cek, possibly due to a lack of the V,

receptor (99).

1.4.13 Other Kinases

PKC rnay be involvesi in lung Liquid clearance. Rather chan due ro an increase in kinase

activity in the inflamrnatov ceUs or an inmase in enzyme quantity, there was an increase in PKC

&ty due ro a decrease of PKC inhiiitory activity in the lung after 40% of W e d fluid was

already reabsorbed from the lung lumen. This suggests that a PKC second messenger system, which

nomaiiy inhibits PKC, phys a role in lung liquid clearance (156). Since ENaC is so tightly linked

with lung fluid clearance there is a pssiiility that the PKC second messenger system rnay conmibute

to the regulation of the channel. PKC is further impiicated in the down-regulanon of U-ENaC

also found to act through PKC. In this case, however, the action of the honnone is two fol& 1)

h u g h inositol1,4,knphosphate @PJ which activates PKC, acute PGE, exposure cimeases the

open probabilicy (PJ of ENaC and 2) Nstained generation of CAMP by chronic PGE. exponue,

causes and increase in the density of ENaCs on the ceil membrane (158).

1.4.1.4 CFTR

The Cystic Fibrosis m e m b r a n e conductance regulator (CFTR) is part of the ATP

bliding cassate (ABC) transporter family. Ir û a Cl- channel that is able to regulate other

transmernbrane proteins (159) and is non-hctiond in patients with CF. CFTR has been found to

dom-regdate ENaC activity in the presence of CAMP (117,160). It was shown earlier thar ENaC is

upregulated by CAMP, but evidence has been put forth that reveals that CFTR has the ability to

invert ENaC's response to CAMP to down-regdation from upreguiation (16 1). More direct

evidence of CFTRs inhibition of ENaC is the facr that the CF mutant M508 CFTR is unable to

inhibit Na' conductance (1 16). The exact mechanimi by which CFTR mediates N conuol is d

unknown, but it has been established that the COOH-terminus of the ENaC nibunits, involved in

Liddle's Syndrome or Nedd4.dependent ubiqyitination, are not involved in the CFTR regulation

(162) and the fim nucleotide-binding domain of CFTR is essential for the reguiation of ENaC (163).

It has ken proposed that ENaC hyperactivity, in the absence of h a i o n a l CFTR, conmbutes to

the lung phenotype of CF.

1.4.15 Nedd4 and Ubiquitin

Nd4 is a ubicpitin Iigase which binds to membrane proteins so that they may be

ubiquiihmed and subsequently intemalized and recycleci (164). Rat Nedd4 contains 3 WW

&mains, which are known to form protein-protein intefactions with PY motifs in other proteins

(165). Each of the ENaC subtfnits contains a PY motif in ia COOH-terminus and the WW2 and

WW3 of Ne& bind to rhem and the channel is ubiqyitinated at lysme residues in the NH,-

31

terminus and thus targeted for lysosomal degradation (166168). It has been shown recendy that

bindlig of N d 4 to ENaC is mediated by the inrracellular Na' concentration; once it gers roo high

the diannels are degradeci (169). Since Liddle's Syndrome mutations involve the deletion or

mutarion of the PY mot& in the COOH-termini of P or y-ENaC, Nedd4 is unable to bind to diese

channels (1W172). With this in mhd and the Na+ concennationdependent action of Nedd4, it

seems keiy that this absence oi degradation oi ENaC is what causes rhat hyperactivity oi the

channels to cause the symptoms of Liddle's Syndrome (169).

1.4.1.6 O, Partial Pressure (Po3

ENaC has b e n shown to be upreguiated by an increase in Po,. When moving from fetal

(3*/0) to a postnatal (21%) Or environment rat FDLE prLnary culture cek exhiited an inaeax in

Na+ transport, which might be expected from late gestational fetal alveolar c e h (173). This &O

occun in the adult lung as primary cultured adult ATII cells, incubated at hyperoxic levels of 85% or

100% O,, &bit an increase in Na' uansport (107,174). Accordingly, adult rat ATII ce& ab

showed a Qwn-regulauon of Na+ vansporr when cultures were moved to hypoxic conditions

(175). The medianism of action is not known, but it has been recendy dûcovered that the

respome may be mediated by reactive oxygen species and reS;.es iron and heme proteins

1.4.1.7 G-proteins

Gprotein d v i t y was fim obsenred associated with ENaC when the unibunit of the GL3

protein activatecl a patdied Channel (1). Moreover, G q 3 protein-spdc antibodies showed the

presence of the protein in a Western blot of an ENaC cornplex isolated from A6 cek (178).

Further evidence of Gprotein mediated regulation of ENaC is the observation that Gprotein

spe&c activators and inhibitors actmate and suppres ENaC activky respeCtiVely, and the5 actions

m abolished by amiloride in FDLE C& (179,180).

1.4.1.8 Factors Affecting IntraceIl& Trafficking

The 2 cysteine-rich domains (CRDI and 0 2 ) in the exvaceliular loop proved to be

important for efficient transport of aaembled channels to the piasma membrane. This was because

mutations in these areas caused a decrease in cell Nlface expression of channel molecules that

caused a denease Li the whole ce1 Channel aaivity, not because channek on the d a c e were

dysiunnionai, but because fewer diamek were on rhe surface. Plus, normai assembly and rate of

degradanon was observed Both of these d e out the CRDs being integral in subunit aaembly or

intriasic channe1 activity (181).

A proLinerich region in the COOH-terminus of a-rENaC proved to be an SH3 bliding

domain that binds a-specVin, thus localiung the subunit to the d a c e of the ceil (182). h A6 cells

.UENaC was &O found ro aaociate with a-spectrin as well as apical protein X m p (Apx), which

the Channel was found not to be able to f d y funaion without (183).

Finally, syntazcins LA and 3, which are proteins involved in rnany membrane vafficking

precesses, wwe obsemed to associare with ENaC. Syn& 1A was kihibitory, while syntaxli 3 was

srimulatory. These in~emtions suggest a protein-protein interaction pathway for ENaC in which

the syntaxins play a role (184,185).

1.4.2 Transcriptional Regulation

Many regdaring factors have been rnentioned for ENaC, but not ail wiU affect the channe1 at

the vanscriptionai level, in fia, mon of those previoudy mentioned are post-tr;~1~lational

regulaton. ui this section the adrenocomcosteroids, Pa, f e d e gender hormones and various

d p t i o n factors will be explod

A number of nudies have been performed that &ed effecrs on ENaC subunit mRNA

levels to ascertain how the channel is ti.anscriptionally reguiated Those that wili be discussed

include the adrenocorticoaeroids, Pa and female gender hormones dong with levels of rat ENaC

subunits during development and they w d illustrate a cornplex picnire of ENaC reguhon. The

subunir, rissue, onroiogicai and or@ specificiry of regdation wiü become apparent (Table LI).

i) Ontogeny in the pen*nutal lung: In an zizzim study of the rat, the ENaC subunR mRNAs

were differend~ expresseci during the perinatal period The a-subunit was expressed starting

on &y 19 of gestation and increased und birth, while the P and ysubunits were not

arprased u n d day 21 afier which they were eupresseci at low leveis unal birch, when there

was an abrupt increase. The and y-nibunit mRNh continueci to increase in abundance

for the fk rwo week after bkh , while the ambunit decreased somewhat after birth, but

then increased again afier the frst few weeks of life (93).

ii) Adrenocorticosteroids: Low salt diet, and thus elevated endogenous aldosterone levels, had

only a srnaIl effect on expression of ENaC in the kidney htim. The r d t was a s@t

elevation in the level of the ambunit mRNA in cells kom the distal collecthg duct, rnainly

from the inner medulla, and no effect on the P and 'psubunits (1 12,186,18ï). Chronic

. . -on of aldosterone or dexameethamne to n o d or adrenalctomized animais

produced the sarne d t s and the levels of subunit proteins in the kidney colecting chas

were in parallel with this (112,133,186-188). In die lung a low salt diet did not change the

leveis of any of the subunits (1 12,181) and no change was seen when n o d animais were

aeated wich aldosterone or dexarnethasone (112). In a case where pregnam raa were

administered h e t h a s o n e , to obseme the e f f k t s on fenws, there was an increase in only

a-wbUILit mRNAs in the f d lungs and it was only effective during the c d & stage of

fetal lung development (93). In adrendectomized animais admin;str=ition of aidosterone had

no effect, bur b e t h a s o n e iacreased all the nibunits in one case (112) and only the a-

subunit in another case ( 1 4 . From these lung snidies it would seem that basai

glucocorticoid levels in the blood meam caused ~~ expression of the &arme1 subunits,

since admirkation of deanethasone to n o d animas showed no change, while

adrendectomized animals did In the distal colon the ambunit was constitutively expressed

at the a m e lwel, regardes of the hormone ueatment. On the other han& the and y-

nibunit mRNh were undetectable in the resting colon, but they were increased by low salt

d i a (1 12, W), dexamethasone and aldosterone admirkation to normal animais (1 12,188)

and dexamethasone and aldoserone adminisvation to adrenalectomized animals (133,187).

hztPao mdies of c d m d cell lines were somewhat different hom the ktku smdies.

Human fd lung cell culrures showed an increase in all ENaC nibunit rnRNAs after

ueatment widi dexamethasone (189). Rat f d lung ceil cultures showed the same resuits

with both chmethasone and aidonerone (141). This could be because they were both late

stage fd ce& and that once they were culturd they may have manired to a posmatai level

or they may have been SEmulated by the corticosteroids to switch to postnatal levels of

expression, greatly increasing their P and ?subunit levels. ki rwo mdies, rabbit b e y

CCD cd &es were used. One study showed an increase of all the subunit rdWAs, but

or.dy a- and fhubuM protein levels increased wîth ueaunent of aidosterone (190) and

another midy, which was ody examining the wbunit, reported an increase of the p b u n i t

mRNA by aldosterone (19 1). These midies may have been different h m the hzim studies

ch u, the facc rhat they were hzibo or because the rabbit kidney is differently regulated.

Two mdies addressed the potentiation of adrenocorcicosteroid action with the

thyroid hormone, T,. One study, in culnired rat fetal lung cek demonstmed the

pomtiation with an increase in the subunit &As (141), while another showed no affect

by T, in human fetai iung dm (189). A third midy looked at the ENaC subunit mRNA

level in thyroidectomized sheep and found that the levels of al1 three subunits were

substanially decrcdscd 092). Thac f i h s inilicatd rhat T, aDo phys an hpwt rolé in

ENaC acoression besides jus the potenthrion of the comcosterone effect.

dt deprivation (aldosterone)

inner medulla

Lung Colon

TabIe 1.1: Summary of published studies of ENaC subunit mRNA reguktion OlzRo. Effects on the levels of subunit &As in response to the different ueatments are d e p i d ADX, adrenalectomized animals used; TX, thyroidectomized animais used; T3, uiiodothyronine; Po2, partial presure of oxygen; 8 , female. Data compiled h m references indicated in brackets above.

iii) Prettatrél to postmtal Pm: al w the P, is only - 3Oh; at birth the infant is immediatety

exposed to 21% Oz. In rat FDLE ce&, moving a dnire of c e h from 3% O2 to 21% Oz

caused not ody an increase in Na+ transport, but also an increase in ENaC subunit m R N h

from all three subunits (173).

iv) Female gender bonnones: The female gender hormones progesterone and 17fistradiol

when administered together to immature female rats showed an upreguiation oi ENaC a-

and wbuni t ~RNAs, suggesting a gender-specific regdation of ENaC (151).

1.4.2.2 Promoter Studies

Promoter mdies of ENaC have so Far only b e n reported for the a- and ymbunits of both

the rat and human (62,63,66,67,193,1%).

9 pubunit: Snidies of borh the human and rat subunits reponed the absence of a TATA box

in their promoters. In one mdy of the hurnan ynibunit, 2 GC boxes or SP-1 consensus

sites are identified within 70 bp of the uansniption scarc site. The GC box near -26 is

shown to bind protein by gel shift in 4 disena interactions and 3 of them are super-shifted

with SP-3 antibodies, while the fourth is niper-shifted with an SP-1 anniody. Deletion of

the two GC boxes or SP-1 sites brings vanscription leveis d o m to background levels, so

their importance is clear. A CpG island is also identified at the muscription srart site, which

dong with the SP-1 sites are characteristic of a TATA-les promoter (194). This study &O

repom a polypurinepolypymudine aact (PPy ma), rhat may fonn uiplex DNA, and a

n w e element about 1.3 to 1.5 kb upstream of the start sire. Only GRE consensus haif

sites are uncovered in the ynibunit 5' fhking sequence and Intron 1. Transient

d & o m show no response to ~ucocorticoids in any YEN& constructs (67). Other

consensus sequences rhat are found are PEA3, AP-I and SP-1.

ii) cnubxnit: ThRe a-subunit studies, one rat and two human, reporced the absence of a

TATA box and the presence of GC boxes near the transcription scarr site. They ako ali

showed an active glucocorcicoid response element (GRE) (6263,193) and the rat promoter

study demonstratecl the potentiating activity of T, on the dexamethasone response (63).

These findings agree with changes in expression of the a-nibunit mRNA in the kidney and

lung in response to treatmenr with dexamethasone and the potentiation of that expression

by T, (1 lZ,l33,l41,lS&l88). m e r consensus sequences were P M , Ar-1 and SI?-1.

Since the psubunit promoter a&ivity has yet to be mdied and due to the diffemtid

regdation of ail the nibunits, for example, by corticoneroids and esuogen, the hypothesis became:

"Developmend and rissue specific expression of the gene encoding the b b u n i t of the rat

amiioride-sensitive epithelial sodium channel (ENaC) is conuolled by &-acting d p t i o n factor

binding sites in the promoter region of PrENaC that differ from those of the other two subunits."

Chapter 2: Materials and Methods

2 1 Isolation and Charactekation of Genomic DNA Encoding B-rENaC

21.1 Library Screening

Libruràes: Two rat genomic DNA liiraries were screened for genomic sequences encoding B

rENaC. The £kt library screened was kom iiver cells of a 12 week old, d e , W k rat, O btained as

a commercial library in a Lambda DASX II vector (Suaragene; La J o b CA). The second Lirary

was also a commerd library from Stratagene, from kidney ceils of a 16 month old, male, Sprague-

Dawley nx in a Lambda II vector. The second library was used only w hen we were unable to

isolate DNA encoding the fim exon of PrENaC from the Lambda DASH' II iibrary.

Probes for screening: Initial screening was done with a random primed probe from PrENaC

cDNA encompassing nudeotides 18-2462 of GENBd sequence accession nurnber X77932 (gift

of B. Rosier). The cDNA in the pSPORTl vemr, was excised by dqption with the restriction

enzymes Eco RI and Na 1. Random primhg was performed using the Random Primers DNA

Labehg System (Lde Technologies, Giko BRL: Burlington, ON) and 50pCi of 8 OûûpCi/mrnol,

10pCi/pL [a-'fp]dCTP (ICN; Costa Mesa, a) for every 50 ng of tempiate DNA. To isolate

genomic clones contaliing the k exon of PrENaC, an exon-spe&c probe was generated by PCR

using a PrENaC 5'RACE product p 3 ) as ternpkte in the presence of [a-32P]dCTP, using the

Expandm Long Template PCR Syscem (Roche Laval, PQ), following the man-? s

instructions. The primen were h m + 17 to +33, p5TD3 5'&CTGGCTCTACAGGTGG3'

(I', -56°C) and h m + 89 ro + 107, P3Fi 5'-TTI'AGAAA~GCTCCAAT-3' Fm-Q°C) and were

obtained from Life Technologies, GibcoBRL. Cyding conditions were as follows: 2min@94OC;

45sec@94OC, 45se@7OC, l~nin@72~C x 31 cydes; 7min@72OC; 4°C. Followkg punfaion by

39

gel filtration, one tenth of this d o n was then used as the template in a second reaction

containhg radidabeiled nucleotide. The conditions were identical except 5OkCi [a-'ZP]dCTP

replaced the unIabelIed dCTP. f i e r the reaction the probe was p d e d using a G50

ProbeQuant'IM Micro-Column and stored at -20°C. Probe activity was assessed using liquid

scintillation counting.

Screening: Primary, secondary and tertiary screening of the liiraries was &ed out as speciiied by

Suaugene. Phage p k e s were d e r r e d onto HybondwN+; positively diarged nylon

membranes (Amersham Pharmacia Biotech, Baie d'Urfé, PQ). ExpressHyb (Clontech; Pdo Alto,

CA) was used as prehybridization and hybridkion buffer. 0.5 - 1.0 X IO6 cpm of probe were

added per millilitre of hybridization buffer. Results were visualized using X-OMAT film (Kodak;

Rochester, NY). Positive phage plaques were grown to hrgh titre stocks and purifid following

standard protocols (1 95). Phage stocks were stored at 4°C for short no rage and at -80°C for long-

term storage.

212 Andysis of Bacteriophage-h Clones

Aclone RE site mupping: The h-clone DNA was restriction mapped by using parual restriction

enzyme @E) digestion followed by Southem blotting with en6IabeUed T3 and ï7 promoter probes

which recognized the 5' and 3' en& of the genomic inserts from the h-clones (1%).

Subcloning of laclones: h-clone DNA was digested with various RE'S to completion and

Southern blotted. The blots were probed with the PrENaC dlNA randorn primeci probe

inmduced above in section 21.1. Fragments which hybridized with the probe were subsequently

subcloned followîng the staadard protocol(I95), d o r x n e d into DHSa cells, purified and

se~wnced.

213 Aligiment of Human and Rat ENaC subunit cDNAs

The programme PILEUP from the soofcwaare GCG (Wisconsin Sequence Analysk Package)

was used to aigri the human and rat a-, p and yENaC cDNAs.

2.2 Determination of B-rENaC Transcriptionai Start Site.

221 5' Rapid Amplifcation of cDNA Ends (5'RACE)

A S'RACE Kit (Life Technologies, GibcoBRL) was used for this procedure as well as the

GLASSMAX'IM Spin Cartridges (Lfe Technologies, GikoBRL). The protocol as suggested by the

man-r was foUowed, For cDNA syutbesis, four different RNA preparallons were used: mt,

p"iary culture, fetal d i d lung epithelial (FDLE) t o d RNA (FD), rat f d whole lung total RNA

0, rat &t whole lung total RNA (AL) and rat adult whole kidney totai RNA (AI<). The RNA

was isolated using TRIzolm Reagent (Life Technologies, Gibco BRL) and following the

manufactureirer's protocol. The primer used for cDNA synthesis was PGSP 1, 5'-

TGGAAGGGGCTGGAATTG3', which was 366 bp downsueam from the 5' cDNA end as

reported by Rossier et al. The PCR of dC-tailed cDNA was p e r f o d ushg the 5'RACE Abridged

Anchor Primer (5'AA.P) and the primer ~SP2,5'CTCCCAGCZ:CAGGTAGGTCT-3'. kGSP2

was 287 bp downsveam from the O@ 5' cDNA end The nested PCR was performed u h g the

Abridged Universal Amplification Primer (AUAP) and the primer FGSP3,S9-

CCGAA?TÇACCACATGGCCTTCITCI?:G3'. wSP3 was 210 bp downstrearn from the

onguial 5' cDNA end PCR produm were punfied using the QIA@ck PCR Purifi~on Kit

(Qiagen: Mississa* ON) and nibjected to gel electrophoresis in 1% agarose gels. Produas were

digesteci with Eco RI and Sp I and ligated into EcD RVS' 1 linearized pBluesaipt' II KS(-) vecror

(Snatagaie), widi T4 DNA ligase @ d e Technologies, GbcoBRL), following standard pmtocoL

Lgatiom were d o r m e d into DH5a ceh and spread on Xgal treated LB +amp agar plates.

41

2.21 Primer Extension

Primer extension was carrieci out using standard protocols (195). The primer was located in

exon 1 (nt. + 82 to + 107) PPU'EI, 5'-mAGAAAGCI:GCTCCAATGTGTGCAGT-3'. 10U of T4

Polynucleotide Ktiase &de Technologies, GibcoBRL) and SOpCi [y3ZPwTP (3COO CVrnmoI)

@ni) were used to encClabel 50 ng of prirner. The radiolabeled oligonudeotidenudeotide was

hybndaedto - 15pg total RNA from the four different RNA prepamions, FD, FL, AL and AK

200U/pL SuperSaipt" II reverse transcriptase (ide Technologies, Gibco BRL) was used in rhe

primer extension r d o n . The samples were loaded on an 890 acrylarnide/8M urea gel and

electrophoresed dong with a sequencing W r . Resulrs were visualized using XOMAT fh.

2.2.3 RNase Protection Assay

DNA Template: Due to the small size of Exon 1, the DNA template for the RNA probe was

c o m c t e d from both genomic and cDNA sequemes. The genomic fragment was arnplified using

PCR primes PEI, 5'~GCTCCAATGTGCAGTGATGGCA~AA-3' (nr +97 to +69) and

BRPAGS' ,5'-CCCAAm AGTCCCCTGTCGTCGrITm-3' (nt -233 to -215). The cDNA

fi;igment was arnplified using PCR prirners PSEX, 5'-ACCACCTTAGCTGCCATC-3' (nt. +63 to

+ 80) and PRPAcDNA3', 5'-CCCCTCGAGATGCGTITmCGTGT-3' (nt. +239 to

+Zû). The fd le& RPA probe was generated from the overiappiag cDNA and genomic PCR

products uskg the primers PRPAG5' and PRPAcDNA3' and Vent DNA Potymeme (Arnersham

Pharmacia Biotech). The 490 bp product was digesteci with Hmd III and Ah 1, ligated into a

W X h I l i n 4 pBl~escript' II KS(-) and d o r m e d into DH5a cells. The sequence was

con&rmed by automat;ed sequencing. %me arperiments were carrieci out using a modified probe in

which i&, bp h m the upnream end were removed by digesnng the original DNA ternpkre PCR

p&ct with Mrp L The resulthg 279bp fragment was blunted by fdlmg in with T4 DNA

polymerase, digesced with Xho I, ligated into a Eco RV/Xho I linearized pBluescript8 II KS (-) and

tztansformed into DHSa cells.

RNae Protection Assuy : The DNA remphte for RNase protection was m ' b e d , h.r;ibo,

following standard protocol(19S) and using 8 000 yCi/mmol IOpCi/pL [a-2P]CTP FCN) and the

enzyme T3 RNA polymerase (Arnbion; Austin, TX). Afrer aanscliption the DNA template was

desvoyed using RQ1 DNase (Ambion) and Uicubated at 3PC for 15mi.n. The probe was gel

purified foIlowing the protocol given by the RPA I I P kit (Ambion). The RPA I I P kit (Ambion)

was used for the N a s e protection assay and was carried out as per the manuface~rer's insuu&ons.

The final p&ct was auaiyzed using 8% PAGE with RNA markers from the RNA Century Marker

Plus Template Set (Ambion) (uanscrii as above with the ï7 RNA polymerase) and a "SdATP

labelled DNA lbp lacMer derived h m a Sanger dideov sequenchig reaction. The results were

VinialiZedusingXOMATfh

2.3 Sequencing

Manual seqlcencing: AU manual sequencing was carried out using the "SequencingR" Kit

(Amenham Phannacia Biotech) short mixes, 3 ûûû~Ci/mmol, 10pWp.L [aJSS+ATi?, appropriate

primea and DNA ternplates and following the manufactureis protocoL R&om were nin on an

8% acryIamide/urea seqencing gel at 80W. Gels were dned and exposed to BioMax film (Kodak;

Rochester, NY) ovemght at m m temperature.

Automated sequencing: Auto~llated sequencing was canied out with the ThermoSe~uenase

fluorescent kbelled primer cyde sequemhg kit widi 7-deaza-dGTP (Amersham Pharmacia

Biocech), the M13Revene and M13Fwd(-38) primers (LICOR; Lincoln, NE), appropriate DNA

template and following the m a n u b e r ' s praocol. Reaaions were nin on the LICOR dNA

Sequencer mode1 NOOL (LJ-COR) and data was collected using the software N O R

BaseImagRm Data Collection Vernon 4 &&COR).

2.4 p-rENaC Promoter Sequence Analysis

The promoter sequence was entered into 2 cornputer programmes in order to locate

consensus site sequences. One was the programme FINDPAïTERNS from the software GCG

(Wisconsin Sequence Analysis Package) a g k s ~ die TFSlTES database. The second programme was

the MatInspecror V22 search engine found on the web at http://transfac.~bf.de/c+

bin/rnatbch/matsea~h2.~~ w hich locates consensus sequences with 75% core similarity and 85%

& nmilanty with sequences in the promoter DNA.

2.5 Characterization of B-rENaC Promoter A m

25.1 CeIlculture

MDCK Ce8 Line (ATCC CCL-34): A canine, kidney cell line from ATCC. C h m e r i d as an

epithelial-like cell h e , it was observed to form et junctions bemeen adjacent cells and aiso to

endogenously express the ENaC subunit mRNAs. The ceII he was grown in Dulbecco's modified

Eagle's medium (DMEM) supplememed with peniciilin (10O&rnL) and mptomyQn (025wmL)

(P/S) (Life Terhnologies, Giko BRL; Grand Island, NT), 90%; f d bovine senun (FBS) (Gansera;

Rexdale, ON), 10%. The media was c b g e d when appropriate and the ce& were passagecl every P

5 days using 025% ayPnn-EDTA &Se Technologies, Giko BRL) and subsequendy seeded in

fmh Fdcon T-75 c d culnue flasks @kaon Didwn; Franklin Lakes, NJ) ar a ratio of 120.

M-1 Cell Line (ATCC CRL-2038): A murine, kidney, cortical coilecting duct cell h e from ATCC.

Characterized as an epithelial ceil line, it was o b m e d to form &t junctions between adjacent cells

and &O to endogenowly express the ENaC subunit mRNAs. The cell Line was gram in a 1:I

mixture of Ham's FI2 medium (Lfe Technologies, G1ko BRL) and DMEM nipplemented with

5 p M dexamethasone and P/S, 95%; FBS, 5%. The cells were pasgged every 4 5 days using 025%

trypsin-EDTA and subsequendy seeded in kesh Eàkon T-75 ceU d t u r e tlasks at a ratio oi 1~0.

MLE-15 Cell Line: A murine, lung ceIl line isolated from transgenic mice expressing the SV40 large

T antigen under conuol of the SP-C promoter (from Dr. Jeff Whirsett; CinÇinnatti, OH). It is

characterized as a d i d lung epithelial ceil line and ir was observed to endogenously express the

ENaC subunit I.i1RNAs. The ceii line was grown in RPMI 16K) medium (Lfe Technologies, G i k o

BRL) supplemented with lOmM HEPES, 5 p M L-glutamine, LiniLLi, 10pg/mL d e m i n , sodium

selenate, hydrocortisone, Lhg/mL -01 and P/S, 98%; FBS 2%. The media was changed

every two days and the cells were passaged every 4-5 days with O.OS0/0 trypsin-EDTA and

subsequentiy seeded in fresh Falcon T-75 cell d m e flasks at a ratio of 1:s.

Cam-2 Ce21 Line (ATCC HTB-37): A human, colon, adenocarcGiorna ceil Line frorn ATCC. It is

characterized as an epithelial-Iike c d line. It was grown in a-MEM medium w/o ~nuc leos ides

and deoxyninuleosides (Life Technologies, Giko BRL) supplemented with P/S, 80%; FBS 20%.

The media was changed as appropriate and the cells were passaged every 4 5 days wirh 0.25%

trypsin-EDTA and subsequently seeded in k s h Fdcon T-75 cell culture flasks at a ratio of 15.

2.52 Reporter Constructs

Ali consuucts (Figure 2.1) were inserted into the multiple clonlig site of the pSEAP2-Basic

Vector (Clontech) . The inserts for constructs F305a and b1214a were cut out using the

corvenient RE sites Sph I (nt.-305) and Sd 1 (nt.-1214) respeccively at the 5' end and subsequently

blmted. At the 3' end both were digened with BstE II (nt. +B) and bluntecl These fragments were

Ligated into the multiple cloning site of the pSEAP2-Basic Vector at the blunted Hmd III site at the

5' end and at the Nru 1 site at the 3' end Coma pl214 was created by cutting the P1214a

construct with Spb I and En> RI and inserthg a Sph VEco RT digeaed PCR product fiom the prirnea

P P W , 5'-WTAGUCGGGGCTGTGA-3 ' (nt. -357 to -339) and P3 ' rE 1E, 5'-

CaGAA?TC'I?TAGAAAGCTmCCAAT-3' (nt + 106 to + 88). Standard PCR pmcedures,

Taq DNA polymerase &de Technologies, Gibco BRL) and the Xh I fragment of h-clone B27.l.l

conraining Exon I as a template were used for diis PCR. P-927 was made by digesting BI214 with

I and reLgating the resulting Wkb fragment. P O 4 was generated by digesthg pl214 with L$I

II and rehgatingthe r d t i n g 53kb fragment Construct b535 was produced by digesring pl214

with Xho I and p a d y with Ifpa l, isolating the r d t i n g 5& fragment, blunt- endhg it and

rehgaing. P I 7 was connniaed by digesting pl214 with Eco47 III and Xho 1 and religating the

d t i n g 5.1 kb fragment. C o m a b305 was creared by digesting pl214 with Sph I and &n 1,

blunting the ends and reiqpmg the resulting 5kb fragment*

In glucocorticoid r q n s e experiments the a1051 construct (as in ref (63)) was transfected

as a pontive conmL

The comruct pTRSEAM was b d t by amacting the thymidine kinase promoter from the

pTKLUC plasmid (a gift fiom S. Hollenberg and V. Giguere) by digestmg t with Bon HI and l#$ II

and ligating it into the L$I II site of the pSEAP2-Basic vector multiple doning site. PnegTK was

consvucted by digesting the Ml7 construct with Spb I, b l u n ~ g the end and subsequently digesting

w;th I$n I and Lgaan% the d t i n g - 145bp kagment into a Xn I@lunted)/I$a 1 digeaed

TKSEAP2 c o m a . To prepare the Bnegu548 conmct, p l 7 was digested with Sph 1 and blunt-

ended, then dgested with lCllu I and the d t i n g - UObp fragment was ligated into a fnnd III

(blunted)/Mh 1 digested a548 construct (as in ref. (63)).

A final consvuct was made that contained a mutated AP-I site. In order to inmduce the

mutation, fint, p l 7 was used as a template in a PCR widi two primen that inmduced the

mutations to the template and two primen Li the pSEAR-Basic vector. The mutated primen were,

p rENAP-1 mut 1,s '-TGAAGTGCAGCCGTGTATGTGAT-3' (nt. -339 to -3 14) and p rENAP

lmut2,S' CGGCTGCAC?TCACCTCACAGcC-3' (nt -324 to -345). These overhpping prirners

were placed in 2 separate reactions that also contalied the primers from the pSEAP2-basic veaor

and the enzyme Ph Qife Technologies, Gibco BRL). The S E M primer pSEAP4095(25), 5'-

Ti'AGGGTTCCGATTI'AGTGCTlTAC-3' (nt 4095 to 41 19 in the vector) was used in the

reaction with BrENAP-imuQ and the primer 30d'pSEAP2,5'-

ATGCCCAGGGAGAGCTGTAGCCTCA-3' (n~ 132 to 108 in the vector) was used in the reaaion

wirh BrENAP-îrnutî. The two fragments h m these PCR reactions were then put into a final PCR

as the template and the o d y primers used were pSEAP4095(25) and 30rSpSEAP2. The product

from rhis final PCR was doned into pBS II a(-) and the proper mutation was confinned by

secpencing. The insert was digesteci out of pBS II using the resviction enzymes A@8 and EcD RI

and inserted in a -2-Basic vector. This consvuct was cded mAP-1 B4V.

Figure 2.1: PrENaC promoter, SEAD reporter ionsuucts. The of restriction sites in Exon 1 and the 5' flanklig region . used . to mate the c o m c t s IS shown at the tom The m r t e r

with each terminating at the position of the restriction enzymeusedtocreareit +lis the transcription srarr site. pSEAP2 Lidicates the stm of the SEAP reporw gene.

Transient Transfection

Al1 ceii lines were seeded on C o w Gweii plates (Co* hcorporated;

NY) and grown to 6(180°h confluency before transfection. S E N constnicrs were CO-uansfeaed

with an R S V W (gift of V. Giguere) expression connnin ro d o w normalization for d e c t i o n

efficiency. In order to reach the desired degree of confluency over night, we& were seeded wirh

MDCK, M-1, MLE-15 and Cac& cells ar concentrations of 2.0 X IO5, 4.0 X IO5, 7.5 X IO5 and 4.0

X 105 ceWwell mpectbely. LipofectAMINEm Ragent (me Technologies) was used for DNA

delivery to the ceh and the protocol for d e c t i o n was followed as specified by the manufacturer

wirh the foiiowing parameten: Each d e c t i o n was performed in tripliate and amoums of

reagents were adj jed accordingly. OpPMEM 1 Reduced S e m Medium &de Technologies) was

used as the transfection medium. MDCK, M-I and Cac& cell lines were all uansfected using 4pL

~ i p f e c t ~ ~ ~ ~ ~ ~ per well and for MLE-15 cells, 8pL L i p f W M per w& was iwd 1

of each of the S E N promoter c o m c t plasmid and the RSVPga plasmid were d e c t e d into

MDCK and Cam-2 cells, while 0 . 5 ~ of each plasmid were d e c t e d h t o M-i and MLE-15 cek.

The d e c t i o n mixtures were dowed to sit at room temperature for 2Omin, to d o w complexes to

form, previous to overlaying the complexes onro the ceh. MDCK, MLE-15 and Cam2 ceh were

incubated with the complexes for M hours before the medium was changed to normal culture

medium and M-l ceils were incubated with the complexes overnight pnor to a medium change. For

glucocorticoid response experiments, media following d e c t i o n contained hormone reduced fetal

bovine serum (sFBS) (196) and any hormones thar were d y cded for in a ce1 line's normal

culture medium were omkted. 5p.M dexamethasone was added to the stripped medium was added

to half of the weh to test for the glucocorticoid responsiveness of the promoter connnicts. The

medium was changed again on die second &y of transfection and the cells were incubated for

24hours at Y ° C ; 5% CO,. Following rhis incubation the cells were harvested. Fim, a 200 p.L

aliquot of medium was removed and centnfuged at 20 000 X g for 2 min. Subsequently the

remainder of the medium was aspked from each weil and cek were washed with 025M TGHCl. *

The celis were lysed by addition of 500 pL of OSM Tris-HCVIOh Triton to eadi well followed by a

Nigle round of freezehhaw. Lysates were cenuifuged at 20 000 X g for 2 min. Hanrested media

and lysates were stored at -80°C und they were assayed.

SEAP assay: Harvested media was assayed for secreted all<aline phosphate (SEAP) actîvify. The

assay was carrieci out ushg the Phospha-Light'IM Cherniluminescent Reporter Gaie Assay SFm

WOPIX, Bedford, Massachusetts) following the rnanufaccurers insauctions. The

chemi l~esceace was measured in the EG&G Berthold Microplate Luminometer LB 96V Fisher

Scientifiç Napean, ON) and data was colIected with the software EG&G Berthold WinGlow

Version 121 Fisher ScientSc).

pgal asay: The ce1 lysates were used for this assay. 50pL of each MDCK sample, I W j L of each

of MLE-15 or Caco-2 samples or 200pL of each M-1 =pie were used. An e4;valent amount of

H,O was used as a negative control. 1 mL of the Pgal asay buffer was added to each sample and

conuoL The buffer was as follows: 1ûûm.M sodium phosphate, pH 7.5, î O m M KCl and 1mM

MgSO,; pmercaptoethanol(~mM) was added jw before use. The submte, mitrophenyl-

galactopyranoside (ONPG) was dissolved in Bgal buffer at a concenuation of 2mg/mL and 2OOp.L

was added to each reaction. The samples were then incubated in a water bath at 3PC und they

m e d a medium yellow colour (A, 0.2 - 0.8) and dien the remions were scopped by the addition

of 500 @ 0.5M NaQ3,. The absorbante of the samples at 420 n m (A&) was measured with the

Hitachi U-2000 Spectrophotometer. All d e c t i o n data was normalized by dividing the SEAP

activity (dative light units) by the aaiviry (A42Q) for each well.

2.5.4 Statistical Analysis

Reporter gene activiues in uansiendy uansfected ceUs are presented as means 2 standard

enor, and statisucal signtficances were calcuiated using an analysis of variance and unpaired mdent

-t tests (hstat sofcware by Graphpad, Inc.; San Diago, CA). All uanddons were performed at

least *ce, using mplicate wells.

2.6 DNA Mobility Shift Assay

Turget D M and kbelling: The initial target DNA was h e e n nt -417 and -305 in the PrENaC

promoter region. This region was amplified from the pl214 constnrct using standard PCR

procedures, Taq DNA poiymerase and the primers SFGSAPC5,S'-

ATITAGCTCAGTGGTAGAG3' (nt. 434 to 416) and 3IRGSAP4-5, 5'-

ATAAGACACGCATGC?TCA-3t (nt. -291 to -309). This hagrnent was d e d GSAfutl @gue

50

2.2). GSAfull was then cut at position -379 ushg the Ah 1 site d t k g in two fragments: 1)

GSAshort, 56 bp from nt. -434 to -379 and 2) GSAlong, 88 bp from nt. -378 to -291. Six

oligonudeotidenudeoUdes were then made in order to mate 3 double-smmded DNA fragments

that overlap each other and cover the region of the GSAlong fragment. The 3 DNA fragments

were: 1) G S M I , 30 bp from nt -378 to -349, made from the oligonudeoudes PGSA4-5L#lF, 5'-

A G L ] T C C G A A A A A A A w T A G A A G 3 t and PGSACSL#lR, 5'-

G T T C T A m m C G G A G C T - 3 ' , 2) G W 2 , 3 3 bp h m nt. -357 to -326, made

hom the oligonucleotides PGSAPSL#ZF, 5'-

MTAGAACGGGGCTGTGAGGTGATGTGTCAC-3' and BGSACSL#X, 5'-

GTGACACATCACCTCACAGCCCCGTfCTA~-3' and 3) GSAW3,W bp from n t -335 to -

305, made hom the oligonucleotides PGSA4-5LiY3 F, 5 '-

GATGTGTCACCGTGTATGTGATGCGCI'GAAûCAT-3' and BGSA45L#3R, 5'-

AT~CAGCGCATCACATACACGGTGACACATC-38. A d o u b b d e d DNA fkgment

was created rhat covered 18 bp kom nt. -339 to -322, which was the overlapping region of GSAW2

and GSAW3, this was called GSAnegp. It was made with the olgonucleotides Fnegp, 5'-

AGGTGATGTGTCACCGTG3' and Rnegp, 5'CACGGTGACACATCACCT-3'. A fina double-

suandeci DNA h;lgnient was cmted which covered the same 18 bp region, but rnutated the AP-1

consensus site contalied within. The oligonucIeotidenudmtides mutAP1,S-

AGGTGAAGTGCAGCCGTG3' and mt.uAPî, S'CACGGCTGCACTTCACCT-3' were used to

consuuct this fragment* Oiigonucleotides were anneaieci by mBang comphentary pairs in îOmM

Tris-HCI pH 7.5 and incubaring the mEmua at 9S°C for 5 min followed by slow coolkg to m m

temperature. All probes were en&Iabelld

Antibodies: Three anabodies were used in the gel &.fi assays. 1) Oct-î (C21) X TransCniz; a

rabbit polydonal antiibody raised against the carboxy terminus of human OCX-1; it is exclusively

reactive with Oct-1 of mouse, rat and hurnan; prepared for super-shift assays, 2) C-/un/AP-1 @) X

T d w a rabbit polyclod a n a i raised againn the h@dy consend DNA binding domain of

mouse c - - p39, residuû 247-263; it is reanive with ~ ~ , J u n B and JmD p39 proteins of &&en,

mouse, rat and human; prepared for super-shift assays and 3) pc-/un (KM-1) X TransCniz; a mowe

monoclonal XgG, an$mdy raised agalist raidues 56-69 of h u m L = - J ; it is ucdusively redctive a-ith

c;Fm p39 phosphorylated on Ser-63 of mouse, rat and hurnan; prepared for super-& aaays. AU

antridies were at concentration 2WpL and were h m Santa Cruz Biotechnology; Austin, TX

Nuclear Extract preparation: Nudear exvacts were prepared from MDCK, MLE-15, M-1 and

Caco2 cek, following standard protocols for dtured cell monolayen (195). Extracts obtained

were divided into 60 pg aliquots and aored at -80°C

Mobiliry Shifi DNA-Binding Assay: The assays were perfomed following standard protocol for

mobility shift DNA-bindhg (gel SM) assays (195). The binding r&on mixtures were as follows:

lOmM Tris-HCl pH 7.5, ImM DTT, 1mM EDTA, 10% glycerol2 pg poly dIdC as buk carrier

DNA, 20 pg B A , O.OSO/ii NP-40 and 8 pg nuclear excract and 20 000 cpm probe. If a reaction

containecl a cornpetitive unlabelleci DNA probe, it was added at an arnount at least 200 X more than

that of the labelled probe. In super-shift experiments, 4 pg of the antib~dy was added Reactions

were bmught to 20 pL with ddK70. In competirion or super-shift reactions, the unlabelled probe

or the anu'body were added to the d o n before the labelled probe and the mixture was pre-

incubated at room temperature for 30 min. The iabelled probe was added and the réactions were

incubated for a Mer 30 min at rwm temperature. The samples were then run on a 5%

acrykmide non-denaniring gel in 1.OX TBE. FolIowiq electrophoresîs for 4 h ar 80 V, the gel was

dried and arposed to XOMAT film overnight at -80°C

Xba I Kpn 1 Hpa 1 SphI I 1 I I

**.*.***'I I +IO6 *.!****. .mm 'O

Sa1 I Bgl II Eco47 III m., BstE LI A h 1 0.

*m.. *...a.**-

I ' 0

aie...* .. ....-aa08 GSA full ..

-4 18 .'* .a* : a

9 "es -30 j

- 8 8 /a i 8 8 8 8

a 9 * 8

a ..' œ a œ œ GSA short a 8

-418 : 1 -377 f œ f 8 8

8 &.* >

GSA long

GSA L#l

GSA L#2

GSA L#3

ds-oligos GSA negp

mutated Apl site

Figure 2.2: DNA fragments used in rnobility shift aaays. The restriction rnap of B rENaC Exon 1 and the 5' flanking region is shown at the top. Dotted hes to the GSAfull probe show the position from which it came in the 5' tlanking region. T h e doned box and h e d lines leading to the GSAnegP probe indicate the position h m which the ne@ probe came in the overlap of GSAW2 and #3. The solid Ikie box shows the AP-1 consuisus site. Shaded nudeotides within the GSAmutAP probe indicate the bases diat were murated to abolish die AP-1 site. ds- oligonucleoticles, double-ssanded oligonudeotidenucleoudes.

Chapter 3: Results

3.1 B-rENaC Gene Structure

3.1.1 Position and Sequences

In order to mdy the gene mm and promoter activity of PrENaC, genomic DNA

containhg the gene was needed. Therefore the A-phage libraries were screened and 5 klones were

isolated that contained FrENaC exon sequences (Figure 3.1). Clones B1.12, P2.22, P4.1.1 and

P9.I.I where isolated from the Lambda D A S r II, Wistar rat genomic Brary, w Me clone PD. 1.1

was isolatecl from the Lambda FIX' II, Sprague-Dawley rat genornic library. Once the 4 hclones

from the Lambda DASH' II library were subcloned and hagments that contained PrENaC exon

sequences were sequenced it was found that p1.1.2 contahed Exon II, p.i.1 contained Exons II-

N, p9.1.1 contained Exons V-VI11 and p2.2.2 comained Exons XI-Xm: but none contained Exons

I, IX or X Since finding Exon I was important in order ro mrdy the promoter region of die gene,

an Exon 1 specific probe was used to rescreen the hirary. Aher numerous attempts it was

concluded that the Lambda D A W II liirary did not include any clones that contained Exon 1

sequence. Therefore a new library, the Lambda FR@ II, Sprague-Dawley rat genomic library was

xreened and hclone p27.1.1 was found to conrali Exon L No liclone was isolated that contained

Exons Dç and X Figrire 3.1 shows the position of exon seyences and parcid RE site mapping for

the 5 h-clones.

The subdones that contained exon sepences were ~e~uenced in order to reveal the

sequences and positions of the RNA splice sites for each intron/exon juncrion. It was observed that

every inmn sequence began with the nudeotides GT and ended with the nucleotides AG @%le

indicates exon position

Exon Exon Exon II 111 IV

319bp 268 bp IO0 of

Ic clone 9.1.1 of PrENaC I

Exon Exon Exon Exon v VI VII Vlll

104bp 164bp108bp 46of

h clone 27.1. 8

Exon Exon Exon XI XII Xlll

58 of 76 bp 635 of 62 bp A m bp

1 of &rENaC

Figure 3.1: Partiai restriction maps of 5 klones that contain PrENaC sequaces. Clones 1.12,22.2,4.1.1 and 9.1.1 were isola& from the Lambda DASH' II Wistar rat genomic library and clone 27.1.1 was isolateci from the Lambda FIX' II Sprague- Dawley rat genomic library. Exons I duough VIü and XI to XIII were found in these dones. No clones containing Exons IX and X were isolated.

T7 Exon

Exon Intron Position 3'Acceptor 5' Donor Size

@PI

Table 3.1: Sequences of the observed intron/exon junctions of &rENaC. Exoo 1 is deemed to be 1O9bp in length accordhg to the primer extension aaay (section 32.2). Placement of unobserved junctions were detemineci by comparison of rENaC cDNA with d e r subunit cDNAs. Italicized numben indiate predicted exon sizes and boudaries determineci by rhis comparison (section 3.12).

3.1). The 5' donor seqpences for Exons IV and W and the Yacceptor sequence for Exon XI were

not determined due to the fàct that the exon sequences containeci RE sites that were used for

subcloning and the seqwnces at the correspondlig ends were cut off. These fragments proved very

difficult to subclone and were consequently not sequenced None of the sequences for b o n s IX or

X were determineci since a k-done containing them was not found. The 3' end of Exon II was

somewhat different h m the published cDNA sequence ar the 3' end oi the exon whch made ir.

diffidt to deapher where the exon ended and the invon began. Thedore, the Sdonor sequence

for Intron 2 codd not be determiaed

3.12 Conservation with Other Rat and Human ENaC Genes

The cDNA sequence of FrENaC was aliped with die OC- and prENaC cDNA sequences

and the cDNA q e n c e s of the 3 human ENaC subunits in order to compare the positionhg of the

huons (Figure 3.2). Since the genornic orPan;auon of these 5 subunits was already determined, the

inuon/exon junction positions were available. The positions of the now known inmn/exon

junaions of PrENaC codd then be compared with those of the other subunits. The positions of

the fim 7 and the lasr 2 Litrons were identical to those of the PhENaC gene. a-hENaC showed

equident position of introns to PrENaC except the position of Inuon 1 was furcher upstream.

The gene structure of yhJZNaC was ab conserved with these hree subunits except Innon 1 was

further upsveam than in the b b u n i t , but not as far as die a-subunit. a-rENaC also showed

identicai invon placement except that Inuon 1 was mûsing, giving rise to only 11 inaons and 12

exons. The intron placement in yrENaC was identical to that of &rENaC arc- innon 1, whidi,

similar to ybENaC, was further upsneam than in the b b u n i t and not as far as in the a-subunit,

but was slighdy downstream from the firn innon of yhENaC.

alpha- hENaC : C ~ C T G C G G C G C C C C A G C ~ ~ G C C ~ G G X G C C C K ~ A T C G ~ ~ G I T C C A C : 25 5 alpha-zEFJaC : G G ~ W C C ~ C ~ G C C ~ ~ T I ' C C X : 290 beta-hENaC : T A ~ ~ ~ T C G C C K ; C A G A A G C O C C Z : C G C C : 184 &ta-rENaC : C A ~ ~ C K i C n c A ~ C A M ; C : 174 gamma-hENK : C G G A G G A A C A - w G A A P : 207 gamma-KEN~C : E G G G N G A ~ ~ T C K X : C G O ~ ~ C G ~ \ G G C C C C ~ : 164

alpha-hENaC : alpha-rmaC : beta-hENaC : beta-rENaC : g m - ; i Z ; ; o c " . gamma- r ENaC : A T G C A c ~ T G A 0 K : G A A G A A A

alpha-hENaC : : 1654 alpha-rENaC : : 1695 beca--aC : : 1595 beta-rENaC : : 1579 ~ ~ - h E S a C : : 1636 gamma-rmc : TK;C~;~\~\'~~ITT~T~C~TGGG~~CC;UACC~;\CC~\AA : 1596

Figure 32: Alignment of human and rat ENaC subunit cDNA sequemes. kitrodexon junctions are marked by shading the pair of nudeotides tbat flank the introns with biack. Grey shading shows predicted innodexon junction placement

3 2 Transcription Sîarî Site

The fim sup towards determinauon of the U'ansCription scarr site was SRACE, this was

performed on the total RNA gmples fmm rat FDLE cells (FD), fd rat whole lung w), adult rat

whole lung (AL) and d t rat whole kidney (Al(). When the produas were run on an agarose gel,

one band was observed in each case and dl bands mip ted the same distance on the gel. The lanes

conraining the S'RACE reat5on.s without SuperScnptT" II as reverse transcriptase negative convols

showed no bands as expeaed (Figure 3.3) indicating the products did not arise from genomic DNA.

Three independent nibclones from each of the 4 products were purified and sequenced in

order to determine the exact length of the mnscripts and define any new sequence. Nine of the

sequences p 2 , FD3, FU, FU, ALI, AU, Ml, AK2 and AK3) ended wichui a 50 bp region

upsueam from nt 18 of the known PrENaC cDNA sequence from GENBank sequence AC#

X77932. One sample, A U , terminated 55 bp dowanream h m die nan of Exon II and the two

other gmples (FDI and Ki) didn't sequence well. The longest of the 5'RACE sequences added 51

bp co the 5' end of the known cDNA SeQuence (Figure 3.4).

Figure 3.4: Sequence obtained from S'RACE products. Asterisks show the 5' termini of the indepenàent nxbclones that were sequenced; 2 from FDLE cells (FDZ, FD3), 2 from whole fetal lung FU), 3 h m whole adult lung (ALI-3) and 3 kom whole addt kidney (AKI-3). The vertical line between nucleotides 62 and 63 indiaes the 5' boundary of the pubiished PrENaC cDNA sequence. Arrows indicate the primen WSP 1, pGSP2 and w 3 th were used for the S'RACE protocoL The box indicates the methionine codon, ATG, which is the translation srart site. The nudeoudes are numbered in accordance with the d p t i o n start site revealed with primer exremion (smion 32.2).

3.22 Primer Mension

In order to pinpoint a uanscription sw site, primer extension was executed on the 4 RNA

sources (FD, FL, AL and AK). The products were run on an acrykmide sequencing gel dongside a

-en+ ladder that used the same primer for sequencing as the primer extension, PPU'EI, on a

genomic subclone containhg Exon L The result was a dear band from each RNA source that was

11 bp upsrream from the longest 5'RACE product makuig Exon 1 109 bp in length Figure 3.5A).

3.23 RNase Protection Assay

The RNase protection aaay @PA) was performed as a third form of VanScnption start site

detemination and its products, one kom each RNA source (FD, FL, AL and AQ, were mn on an

acxyIamide sequencing gel. The 2 outside h e s contained RNA marken, lanes 2-5 conraineci a 1 bp

DNA sequencing ladder, h e s 6-9 contained the RPA samples and lanes 10 and 11 contained the

yeast RNA conmk. The RNA marken were used as a groa assessment of protected fragment

length, since lengths of o d y 100,200,300,400 and 500 nt were available, while the 1 bp DNA

sequencing ladder was used for fine assessment counUng from the position of an RNA marker.

AIthough DNA and RNA run at slightly different rates, when counthg less than 50 bases the

differences are minor, only about 2 or 3 nucleotides. All4 procfucts in lanes 6 9 showed the same

resulrs: 1) a protected hgment of a lengrh comparable to that expected for the results of the primer

memion assay at about 238 bp and its position was hence called + 1,2) two cluners of protected

hagments amund positions +2O and +4O and 3) varyiug degrees of full-length, undigesteci

ribprobe. The yeast convoi that was exposed to RNases, in lane IO, was dear excepl a faim band

where the bill-length riboprobe would nin, while the yeast conml without RNase, lane 11, showed

a very mng, full-le.@ ribprobe, both were as atpected (Figure 35B).

A A F F A C G T K L L D

longest , 5 ' R A C E

B. F F A A Y Y

A C G T D L L K + *

1 5 0 0

400

R N A markcr

. h

site

Figure 3.5: Primer extension and the RNase protection assay. A Primer extension (PE) products nui on an 80h polyacrylarnide sequencing gel. Lanes 18 show the pfodtrcts from whole addt kidney AI(), whole d t lung (AL), whole feral lung (FL) and FDLE cells (FD) respectively. The m n g band observed in d4 lanes is rnarked as the transcription start site (+ 1). Lanes 1-4 are ACGT, respeclively, of the sequencing ladder produced ushg the same primer, fIPEYE1, as used for the primer &on. The position of the longest S'RACE product is indicated on the sequencing ladder. B. The RNase protection assay @PA) products nui on an 8% polyacrylarnide seqyencing geL Lanes land 12 show the RNA markers. Lanes 2-5 are ACGT, repecWely, fiom the secpenchg ladder, used only to count nudeotides h m the RNA marker positions. Lana 6.9 show the products h m FD, FL, AL and AK, respecWely. The products are marked in accordance with the PE results. The moa 5' promicc corresponding with PE and two o h dusters at +20 and +40. Laue IO shows the negative control, protection of yeast RNA with exposure to RNases (Y+), which is dear as expeaed. Lane 11 shows the positive comol, protection of yeast RNA without RN- (Y-), which shows the fidl lm& probe. Full length probe was as0 observed in ines 7 and 9, most Itkely due to incomplete digeseonwah RNases.

3.3 Promoter Sequence

33.1 cis-Element Consensus Sequences

The sequence of the region 5' to and including Exon 1 was &ed, using the analysis

pro- referred to in the methods, in order to locare any consensus sites or other sequences of

interest that may be present. In fàct there were some interesthg finding. No TATA box or

initiator Sequence were found, which is confistent with the observed multiple start sites. Although it

might be expected that glucocorticoid response element (GRE) consensus sites would be present

due to the rnRNA induction snidies performed on the colon, none were found Many other ai-

element consensus sites were observed. Some of the moa interesring or important of these are

marked on the sequence in Figure 3.6. The a m contained 4 AP-1 sites, 4 PEA3 elernents, 3

estrogen receptor haf sites @RE), 2 Oa 1 elements, an NF-KB element and numerous SPI sites at

many locations as weil as a CpG island near the d p t i o n srarr site.

Figure 3.6: Secpence of Exon 1 and the 5' Flanking region. TF consensus binding sites are boxed and named above the sequence. The VrdflSCription start sire is rnarked by a vertid line and horizontal arrow. The CpG island is r6xked as a horizond line above the SeQuence. The inmdexon junclion û marked as a vertical line wÏth a double ended horizontal arrow.

3.4 Chaacterization of /3-rENaC Promoter Activity

3.4.1 Transcriptional Activity of the f M N a C 5' Flanking DNA with

Variation at the 3' end

To tes &ptional acllvity, the longes &tENaC promoter consuua, which terminates 5'

at -1215, and the shortest, which terminates 5' at -305, were transientiy transiCected into die 4

epithelial cell lines. Each construct has 2 different 3' ends (see Figure 2.1 for comcts) . p1215a

and k305a both teminate 3' at the & E II site at +28, while pl215 and P305 both terminate 3' at

+ 106, covering nearly al of Exon L It was observed that pl215 produced approximately Sfold

more + chan k1215a and that p305 produced S f o l d more activity than P305a This

phenornenon was observed consistendy in each of the 4 epithelial cell hes, M-1, MDCK, MLE-15

and Caco-2 (Figure 3.1). The negative conuol, the ernpty pSEAP2-Banc veccor, showed minimal

activity. From this point on all consvucrs were created with the 3' terminus at + 106.

w 1 MDCK Figure 3.7: Transcription actiWy of FrENaC promoter consuum with 2 different 3' tennini. The SEAP activity, normalid to the P-gal activity, was plotted from transient transfimïons of each of the 4 epithelia ce1 lines, M-1, MDCK, MLE-15 and &O-2. The construas terrninated 5' at - 1215 and -305 and 3' at either +28 (B1215a and k305a) or + 106 (pl215 and 8305). The empy pSEAP2-Basic vector (PSEAPZ) was also uandected as a n w e conml Asterisk (*) indicates ngnificant Merence @ < 0.02) h e e n one constnia and its longer version.

3.42 Effect of Glucocorticoids on p-rENaC Promoterdriven

Transcription

Glucocorcicoid responsiveness was tested in the 6 major PrENaC promoter conmas ,

305, P418,8536, p 0 5 , P928 and pl215 (see Figure 2.1 for constmcrs) in each of the 4 epithelial

ce11 lines, M-1, MDCK, MLE-15 and Cace2. Medium wkh anpped semm and no hormones was

used to incubate the ceh after uaasfection. To test for glucocorticoid response, dexarnethasone

(dex) was added co this medium. None of the constnicts in any of the 4 cell lines showed any

sigdcant change in VanScnption activity in response to da (Figure 3.8). M-1 and MLE-15 ceh

were known to be capable of direct induction of the a-rENaC promoter by glucocorticoids (Dr* G.

Onilakowski, penonal commULZication), but MDCK and Caca-2 cd lines were not so they were also

d e c t e d with al051 as a positive conuol. a1051 is an a-rENaC promoter SEAP construct th*

is known to contain an active GRE (63). The positive control demonsvated good dex-induccion in

both cell lines. The negative conuol, the empty pSEAP2-Basic vector, showed mliimal activity and

was not da-induced

Ci- - 5 "" 0

0 - dex + dex

0 I- dex + dex

MDCK

Figure 3.8: Effect of glucocorticoids on the PrENaC promoter constnxcts. SEAP activity, nomi;rlized to Pgal activity, was plotted from transient d e c t i o n s in eadi of the 4 epithelial celI lines, M-1, MDCK, MLE-15 and Cam-2. Open bars show vanscription activity in the absence of steroids dex). The solid grey bars show tanscription acti.;rY in the presence of 5p.M dexamethasone (+ dex). All pst- d e a i o n media were prepared 6th hormone scripped semm (see Methods). The 6 comcts, P-305, p 1 8 , 8 5 3 6 , p 0 5 , k928 and pl215 were transfected kto each cell line dong with the empty fiEAP2-Basic veaor as a negative control and a1051 in MDCK and Caccd ceils as a positive conml of dex-induction.

3.4.3 Transcriptional Activity of the B-rENaC Promoter Constmcts and

Identification of a Negative cis-regdatory Element

The activity of the various PrENaC promoter conmcts (see Figure 2.1 for consuucts) was

aLo observed in each of the 4 cell lines under normal conditions in order to detect potential

upsveam regulatoy elements in the 5' flanking DNA (Figure 3.9). In each ce11 line the B305

c o m c t showed the West activity. This aaivity was reduced by mO/O when exrended 112 bp

upsveam of the k305 c o m a , observed Li the activity of c o m a p 1 8 . The activity declines

gtaduaiy, yet iangnificantly, h m P I 8 ro f h O 5 and plateaus to pl215 in M-1, MDCK and Caco-

2 cells. TranSfKtions in MLE-15 ce& showed the same pattern as the other cell lines with repeated

testkg. The patterns indicated the presence of a negative regdatory element berween -305 and -418

in the PrENaC promoter. The empty pSEAP2-Basic vector showed negligiile activity.

lm* M- 1

lm-

*

Figure 3.9: Activiry of the rENaC promoter con~~ucts~ SEAP activity, normalized to P gai +, was plotted from transient transfections in each of the 4 epithelial ce1 lines, M-1, MDCK, -15 and Cam-2. The 6 con~lnrcts, 8305,8418, P536, w05,8928 and pl215 were d e a e d into each cell Iine dong wich the empty pSEAP2-Basic vector as a nwtive conmL hterisk (*) indicates significant difference @ < 0.02) between 8305 and P 418.

3.4.4 Effect of -305 to -417 Negative Regdatory Element on

Heterologous Promoters

The 114 bp fragment that contains the putative negitive element between -305 and -418 was

testeci in rwo heterologous promoters in MLE-15 cells, in order to determine if its negative elernent

was d e r r a b l e . This fagrnent was inserted Li front of a minimll a-rENaC promorer, a548, and

in front of a thymidine kinase promoter, TK (Figure 3.10). The a548 construct aras not as active as

the P305 comtruct, but the n-tive element did suppress its activity apprommately 2.596, as shown

by comparing the a548 and pneg-8 activities. The TK promoter activity was enhanced by

a p p r o h t e l y 50% by the negauve element region, as observed by comparing the activities of TK

and PnegTK.

Figure 3.10: Activiv of the putative n e e v e element region in heterologous promoten. SEAP activity, nomdized to Bgal activify, was plotted h m transient transfections in MLE-15 c h . The two heterologous promoten were the a-rENaC promoter (a) minimal promoter constnict a548 and the thymidine kinase prornoter inserted into the pSEAP2-Basic vector m. The corresponding consvum containing the 112bp PrENaC upstream element were Bnega548 and PnegTK, r@ely. The PrENaC promoter constructs flankulg the n m v e element, 8305 and 8418, were tested alongside as a positive conml (B). The empty -2- Basic vector was transfected as a negacive conmL Asterisk (*) indicates significatlt diffetence @ < 0.02) be tweenco~wi thandwi thou t the n w e dement

3.5 Mobility Shift Assay

35.1 Protein-DNA interactions on p-rENaC Promoter Region

Containing Putative Negative cis-regdatory Element

The GSAfull probe (see Figure 2.2 for GSA probes), which coven the entire 114 bp

negative element region, was first tend for protein binding acrivity with MLE-15 nuclear exnact.

As apparent in Figure 3.11, the G S M probe showed some diffuse binding activiiry, which was not

sigdicantly reduced by cornpetition with cold probe &mes 8-10). This ni%gests that the observed

binding aceivity was non-specific. Subsequently, the GSAhill probe was cut at the Ah 1 site

d t i n g in the GSAshort and long probes. These 2 probes were assayed (Figure 3.11; lanes 1-6)

and it was observed that the long probe, in lane 2, and the short probe, in lane 5, both showed

protein binding acti*, however, only the binding activiçy for the long probe appeared to be

specific. When the binding activities were compered wirh cold probe the long probe showed

sigdcant specific bindmg, lane 3, while the short probe did not, lane 6. Therefore, the region

covered by the GSA long probe was chosen for furdier mdy. The GSA WI, #2 and #3 probes

were subsequently tested to M e r delineate the region conraining protein binding activity. Figure

3.12 illustrates the results of incubating GSA long and each of the 3 ohgonucleotidenucleotide

probes wRh M'LE-15 cell nudear exuact. The GSA long binding anMty was competed out by the

iullaheiied GSA long probe and, aithough GSA long contains a consensus Oct 1 binding element

(GATGCG), anti-Oct 1 antibodies showed no effect on the observed GSA long binduig activity of

MLE-15 nudear eiman &ines 24). The GSAWi binding activicy was competed out by the

&ed GSAWI probe and, although it contained an AT-rich sequene, its binding aceWy was

not nipershifted by anti-Octî antibodies @anes 8-10). The GSAU2 bindhg acllwy was competed

out by the unlabelled GSAL#2 probe &mes 13,14), but no supershift artempt was made on the

probe

treatment iane #

major binding ac ti vi ty b

Figue 3.11: Protein-DNA binduig activity in the negative element region of the &rENaC promoter with MLE-15 nudear exuact. Lanes 1-3 contain the labellecl GSA long probe flond, lanes 4- 6 contain the labeiled GSA short probe (short) and lanes û-10 contain the GSA full probe 0. As a negative control h e s I, 4 and 8 conraineci binciing reaction samples that had only the kbelled probe added and no nuclear extract or cornpetition (-). Lanes 2,s and 9 coniained binding reaction samples of the labelled probe exposed to nudear exuacr (+). To look for specific bindmg &ty unlabelleci probes were used as cornpetition (C) with their correspondhg labeiled probe in at lean 200 fold excess.

Figure 3.U: Binding MMty of the 3 oligonucleotides covering GSA long and an attempt to nipershifi with an Oct 1 a n u i using MIE-15 nuclear exuact. Binding reactiom for GSA long (ion%) are in lanes 1-4, for GSA W1 (1) in lanes 7-10, for GSA L#2 (2) in lanes 12- 14 and for GSA L#3 (3) in hues 16-19. Lanes 1,7,12 and 16 are the negative connok (-), conraining labeiled probe in the absence of nudear extraa. Lanes 2. 8,13 and 17 contain bindiag reactions for eadi of the probes with the MLE-15 nudea. emract (+). To check for speaficiq, la& 3,9,14 and 18 contain buiding ramions that are competed with unlabelled probe (C). Lanes 4, IO and 19 show attempts to supershifi the binding acWHy wich an Oct 1 antibody (Oc).

GSAL#2 probe since it contained neither an O a 1 consensus site or an AT-rich region. The

GSAW3 probe was shown to be competed out with unlabelled GSAL#3 and, although it conrained

the Oct 1 consemus site, it was not supenhifced by anti-ûct 1 anribodies &mes 17-19). The GSA

long probe was further asayed with nudear exnacts from 3 c d iines, MDCK, MLE-15 and Caco-2

and cold cornpetition was atrempted with itself and with the GSAWI, #2 and #3 cold probes

(Figure 3.13). This assay was pifJmxd to nmoa- doan rh3 binjing actitit)l ta one af the 3 &-

ohgonudeotides. The GSAlong probe binding aaivity with each nuclear exûact was tody

competed out with cold GSAlong probe 17). This biading activity was not inhibited by

competi~ion with die cold GSAWî probe (lanes 8-10). However, cold GSAW2 probe (lanes 1 1-

13) and cold GSAW3 probe (lanes 1416) each exhiiited p a d inhiiition of the binding activity.

It was speculated that this parual inhiiition may indicate that the binding activity of GSAlong is

taking place at the point where GSA W2 and #3 overlap. An 18 bp double svanded

oligonudeotidenucieotide, d e d ne& was synthesized corresponding to the GSA L#2 and #3

overlap, and it was shown to completely compete out the major binding acthiiry of the GSAlong

probe in lanes 17-19 of Figure 3.13.

The ne$ probe was subsequently radiolabeled and testeci for binding activity. h addition,

since an AP-1 conseanis site was noted within this probe, nipenhifts werr anempted wirh 2

different anti-Pm anabdies, one which is a unived anti-- antibody, binding to the DNA binding

domain of allh specïes and the other which binb specifidy to cjh (Figure 3.14A). The bindhg

activity of the negp probe with the 3 different nudear amacts was completely competed out with

cold pneg probe (lana 5-7). The bindlig activity was ngnificantly reduced with exposure to the

w e r s a l a m i . &mes 11-13) and it was supershifiecl by the specrfic anti-c-jh aatbody

change in bindlig ( h e s 14-16).

Since the supershifis indicated that the observed DNA-protein interactions on the ne$

probe involved qkn, they were a h attempted with the GSA long probe, to test the bindlig in the

larger context in which the element was situated (Figure 3.14B). The major binding activity of the

GSA long probe, wirh 3 Werent nudear exuacts, is ngnificantly reduced by the univedJuz DNA

bindmg domain antibody &ines 810) and a nipenhifr is observed with the C-jh-specihc antibody

(lanes 5-7).

cold corn pe t i t i on -- long I 7 e r

n u c l e a r e x t r a c t -- D L C D L C D L C D L C D L C D L C L n n e a I '2 3 . 4 5 6 7 8 9 IO I I 12f9 1113 iSAf9

Figure 3.13: Cornpetition of the GSA long probe wkh the other GSA probes. The labeled GSA long probe is used in every binding reaction. Lane 1 is the negaWe conmol, labelleci GSA long in a bindlig d o n d no nudear aruact or cornpetition. The bindkig activify is shown in lanes 2-4 wich the nudear exaaa~ from 3 diffefent cd lines, MMJC (D), MIE-15 (L) and Cam2 (C). GSA long is competed wirh rinlabeI1ed GSA long in lanes 5-7, with iinlabeilled GSA W1 in lanes 8-10, with udalded GSA L#2 in lanes 11-13, wîth &ed GSA W3 in lmes 1416 and with irnlaheilled negp in Ianes 17-19.

c o m p j ~ b - - n c-Jun Jun NFicB AAAAA nuc-ext- - D L C D L C D L C D L C D L C

B. Ab

nuc. ext. Lane #

major bindhg) iictivity

Figure 3.14: Binding activity of the negp probe and supeahift of the ne$ and GSA long probes with a n t i t i - antiidies. A negp is the k l l e d probe for wery binding reaction and nuclear exttfdcts from the 3 cell luies, MDCK p), MLE-15 (L) and Caco-2 (C), were used Lane 1 is the negative control showing the background binding accMty when negP labellecl probe is incubated in the binding reaction in the absence of nudear ewact. The binding acti.;tV of ne$ is shown in Ianes 2-4. The bindlig activity is competed with unlabelleci negp in lanes 5-7. Supenhift is attempted with a specific anti-c-jbz anti'body in knes %IO, with a universai anti-+z angbocty that binb to the DNA binding domain of d&z &es in h e s 11-13 and with an NF-icB anti'body in lanes 14-16 as a negative conuol. B. GSA long is the hbelled probe for every-bindmg -on and rÏuc1ea.r artracts from the 3 &Il lines, MDCK (D), MLE-15 &) and Caco-2 (C), were used. Laue 1 is a n@e conml showing background binduig arWity when the GSA long probe is alone in the binding d o n . The binding &ty of the GSA long probe is depicteci in lanes 2- 4. Attempts to supershifr diû activiy were made using a c jh specific antr'bohg in lanes 5-7 and a universalJin an- rhat binds to the DNA bindhg domain of all pm spec;es in Ianes 8-10.

3.53 Mutated AP-1 Consensus Site in the Negative Element Region

In order to detemine if the AP-1 si te located in the region containing the negaWe element

was codkrring the negative activity, the site was mutated and tested for any change in activiry in the

FrENaC promoter construct 8418 in MLE-15 cek (Figure 3.15). The level of activky berneen

418 and the mutated c o m c t mAP-IV18 was found ro be similar. The negative aaivity berneen

was still observed and the negative conml, the empty PSEAP2-basic vector,

The ds~ligonucleotide GSAmutAP was used to test for protein binding to the mutated AP-

1 site by rnobility shift assay (Figure 3.16). The GSAnegp probe was W e d DNA-protein

binding acWiry was competed out by unlabeued GSAnegP Qanes 2-7), but could not be competed

out by an equai amount of the dabelled GSAmutAP fragment @anes 8-10), confinning that the

point mutations had desvoyed the AP-1 bindtig site.

Figure 3.15: Effea of AP-1 site mutation on &ption a&*. SEAP acuMty, nomialized to 13-gal actkity, was plomd fiom transient transfections in MLE-15 cells. The AP-1 site in the negative region of the consvuct pl8 was mutated to give the consmux lllPLP-1 p.118. This consvuct was d e c t e d dongide 8305 and MIS, which were d e c t e d as a positive control of the negative activity. The empty pSEAP2-Basic vector was d e c t e d as a negative controL Asterisk (*) indicates signifiant difference (p ~0.02) h e e n k305 and the 8 4 1 8 c o m c t s .

cold corn petition -- ne P rnutAP A L - nuclear extract - - D L C D L C D L C

Figure 3.16: AbIlity of the mutated AP-1 site to compete for protein bliding with the wild type site. The Iabelied GSAnegP probe is used in every bliding reaccion. Lane 1 is the negative conml, labelled GS&& in a binding Raction with no nudear extract & cornpetition. nie binding acUvify is shoA in lanes 2 4 with the nuclear exvacrs from 3 different ce1 lines, MDCK (El), MLE-15 (L) and Cace2 (C). GSAnegP is competed with unlabellecl GSAnegp in lanes 5-7 and with unlabelled GSAmutAP in lanes &IO.

Chapter 4: Discussion

Based on the cornparison of the cDNA sequences of rat and human ENaC subunits, one

cm m e that the coding region sequence and innodexon junction placement of ENaC are very

h;ehly conserved between the subunits and across v i e s . It was observed that the cDNA

sequences of PhENaC and FrENaC share a similarity of 81.4%. During the coune of diis project

Papen were published desmiing the gencnic organkation of the human a, B and y and the rat a

and ysubunits. The placement of Litrons 2 through 12 were identical for all of the previously

studied subunits and the Liuodexon junctions that were found in diis study ail corrnponded with

this placement. The inmdexon junctions of PrENaC also ail comesponded well with the

consemeci pattern of splice sites. This patrem is: MC A G gt dg ... c h G, where the upper

case letten indicate exon sequences and the lower case Ienen denote inuon sequence. T h e moa

important nucleutides are those that are underlined; they have been found to be conserved Iûû9/0 of

the time (1). The BrENaC innordexon junaions that have b e n sequenced ail maiatain the gt...ag

junction sequences with minor variations in sequence £lanking the splice sire as s h o w in Table 3.1.

The fact that all of the previoudy d e d subunits have 13 exons except a-rENaC, which is missing

inuon 1, niggens that it is probable that PrENaC also contains 13 exons. Therefore, since ENaC

genomic s t ~ c n u e is now w d characterized and PrENaC shows no apparent differences, we chose

not to pursue complete characterization of innon/exon m m e and proceeded to focus on

charart- funCaon of putative promoter sequences for PrENaC.

4.2 Transcription Start Site and Promoter Sequence

42.1 Correlation of SRACE, Primer Extension and RNase Protection

Assay Start Sites

The 5'MCE results at first seemed mnewhat incondusive. Although only one major

product was detected by gel electrophorâis, sequencing of independent subdones did not revd a

unique, favoureci nart site. In order to more accurately define a start site we performed both primer

srtension and RNare protection assays using RNA from a variq of sources. Primer extension

assay gave a very dear result that indicated a single start site 11 bp upstmm of the longest 5'RACE

produa (&one FD3). Although the assay gave a dear major band, it shodd be noted that this

site Lies widiin a GC-rich region (see lanes 2 and 3, Figure 3.5A). Primer extension (PE), like

5'RACE, relies on a reverse uansaiptase sep which can be severely inhiiited by GC-rich regions.

PE is a good aaay to determine the number of nucleotides an mRNA extends upstream from a

primer, but it m o t detect introns. The SMCE is an excellent assay, since it can not only measure

the length of an mRNA upstream from a primer, but it ah produces products that can be

sequenced, meanhg that introns can be idenaed by cornparhg the sequence with that of genomic

DNA However, as in PE the reverse transcriptase used in these assays can be inhibited by certain

secondary suucnires, espeaally GC-rich regions. The RPA is able to overcome the secondary

structure problems thar face the other 2 assays making it induable, but it m o t distinguish

between swt sites and intron/exon junctions. Thedore, it is important to perform aU3 of these

assays, in order to accurateIy define the transcription starc site of a gene. The N a s e protection

assay (RPA) was perfomed to c o h the results from PE and S'RACE. RPA confirmecl the PE

start site and ah showed two other dusters of sw mes around position +20 and +40, in

accordance wich the S'RACE d u . These 3 assays led to the conclusion that PrENaC has a

cluster of many possible start sites within a 60 bp region; for simpiicity, the nart site that was

furthest S', which was the PE stan site, was defined as + 1.

4.2.2 Start Site Cluster and Abundance of SP-1 Sites Correspond with

TATA-les Promoter

Analysk of the Seqllence of the region 5' to the first exon phyed a large part in

understandlig the dmer of s~art sires in the PrENaC gene. The sequence contains no TATA box,

but contains a GC-rich ara upsveam from + 1 that is a CpG island containing multiple SP-1 sites

(characteristic of a TATA-les promoter without an Liitiator sequence, as discussed in the

inuoduction, section 1.1.1) (14. Such genes rypically initiate transcription at multiple sites over a

region of 20 - 200 bp. The importance of the SP-1 sites withli the CpG island at the transcription

srarr sire of yhENaC were invesrigated by Thomas et al (199, as discussed earlier in section 1.4.2.2.

yhENaC, which like PrENaC also contains a TATA-les promoter, exhiiited severely

compromised VanScriptionaI activity foUowing disruption of one of the SP-1 sites. It is probable

that the SP-1 sites in the CpG island of the PrENaC promoter probably are of e q d importance.

These data bring one to the conclusion that the PrENaC promoter is a classic TATA-lesiinitiaxor-

less promoter gMng rise to the characteristic cluster of possible sans sites rhar werri observed with

S'RACE and RPA

4 3 B d Promoter Activity

As obsenred in Figure 3 3 , 8 3 0 5 and BU15 had ngnificantly higher transcnption activity

dian k 3 0 5 a and b1215a It would seem that the 79 bp sequeme between the &t EIi restriction

sire at +28 and the 3' terminus of 8305 and b1215, at position + 106, conrains some important

elements for uansaiption. U n e possible candidate for &cing vanscription may be the presence

of an AP-1 consensus site around +31. However, from Figure 3.4 it is apparent that the majoriry of

the 5' termini of the 5'RAC.E products initiatecl were downsueam of +28, and in F&e 35B the

RPA demonsvated the presence of a large cluster of aarc sires around +40. P r d l y , shce P

rENaC has a TATA-les and iniriaror sequace-les promoter, it mus rely on al1 the uanscription

starc sites available in order ro be expressed at a maximal level Therefore, one c m conclude that the

simples explanation for the higher transcription acWiry of 8305 and pl215 over b305a and P-

1215a is the fact that the longer consuucts contain a greater nurnber of the possible uanxription

srart sites available to PrENaC.

4.4 Absence of Glucocorticoid Activity

. . Examuiing the i 215 bp of sequence upstream from the transcription start site of PrENaC,

using the analysis programs as stated in the Methods, we were l o o k for glucoco~coxd receptor

response consensus elements (GREs), since the mRNA levels of PrENaC have bee. shown to

increase in the distal colon in response m dexamethasone or aldosterone exposure

(1 12,133,l87,l88). GREs respond to both dexamethasone and ddosterone, siuce both the

glucocorcicoid receptor and the mineralocorticoid receptor recognk the GRE &acting sequence,

but no GRE consensus sites were found. Accorduigly, when transient transfections of the B

rENaC promoter consmicts were treated with b e t h a s o n e , no change in acEviry was observecl

in any of the cell lines, men the human colon cd line, Cam-2 @gure 3.8). There are several

possible explanatiom for the absence of a glucocomcoid response in these experiments. The

sirnplest a11swer would be that a GRE is either further upnream than what has been isolated in this

83

study or it is present in an intmn or 3' to the gene in the 3'UTR or beyond A second reason may be

that the f3-rENaC gene, indeed, does not contain a GRE and there is some secondary medianism

following corticoaeroid exposure that tr&m the upregukuon of transcription instead of a direct

corricosteroid response. Although the a1051 construct was directly upreguiated by dat in Cam2

ce&, this does not indicare that a mechanism secondary to dexexponire is present and functional.

Tberefore, the Cam2 c d line may not be a good represenmtive ceil line for dm-induction of B-

rENaC tJCUlSCription. A third possibllity is that an increase in PrENaC mRNA d d k y is involved

rather than an increase in transcription initiation. With all of this in minci, howwer, it is possible

that PrENaC is not VaaScnptionaily affected by corriconeroids. The a-nibunir has been shown to

be die only subunit responsive ro dexamethasone or aldosterone in the Lung and kidney at the

transcription levei, but shows no response in the colon (93,112,133,186-188) and this response to

corticosteroib in the a-subunit has been tied to a proven active GRE in both the human and rar

subunit promoters (62,63,193). Since the adunit, therefore, is reguiated by direct induction by

corticosteroids, this mechanimi mus be blocked kmb in the colon. These elements, dong with the

fact that the ysubunit shows a similar response to corticoaeroids as the pnibunit (1 12,133,187,188)

and that no GRE or glucoconicoid response has been observed in the p b u n i f promoter (66,194),

suggest that there might be an altemate mecha& at work in the colon in response to

corticosteroids and that PrENaC is not mmcript iody dLectly induaile by cort.icosteroids. Also,

these observations sqgest that the p and v b u n i t induction in colon may be due to a mechanhm

common to both subunits.

4.5 Negative Element

45.1 Location, Protein-DNA Interactions and Possible tmns-elernent

Candidates

Evidence of the presence of a negative element was fus observed in transient uansfections

and was narrowed down to a 114 bp region from -418 to -305. Inserting this region into

heterologous promoters proved to be intereskg; it was s u c c d in nippressing an a-rENaC

subunit minimal promoter, but it enhanceci the d v i t y of a thymidine kinase (ïK) promoter.

Therefore, it was postulateci that the 'negative dement" m u t be contact specific and one factor that

may have contniuted to this could be the fan dut a-rENaC, l ike PrENaC, has a TATA-les

promoter, while the TK promoter ponesses a TATA box There also may be other factors that the

a- and PrENaC minimal promoters share that are not in the TK promoter and vice vem.

By gel shfi anay (GSA), the specific major binding activiry in the region was further

narrowed down to a 74 bp region from -378 to -305. This major binding acllvity was amimed to be

produceci by the binding of a suppressor to the DNA. Upon mUny of the sequence Li the area a

conventionai Oa-1 site was found dong with an AT-& region which could be a ma&

attachment region (MAR). In a study by Kim ad (197) k was found that Oct-1 can confer

den+ activity on the human thryotmpin B gene. They found that it could bind to an AT-rich

region of degeneraxe Oct-I binding sites and from this position it could associate widi the nuclear

matrix and bring about irs dencing a&+. An AT-rich region was contained in the GSA UII

probe and a convenuonal Oct-1 consensus site was contained in the GSA W3 probe. Howwer,

attempting to supershifi the binding accMty on these 2 probes with anti-Oct-î m t i i was

unsuccesshil Therefore, E was conduded that the major bindlig activiry was not from active Oct-1

binding.

Performing the GSA s h o w in Figure 3.13 proved very informative. Noacing that the

GSAW2 and #3 &ed probes both p d y reduced the major bindlig hvi ty , suggested that

the overlap between the 2 probes may contain the b i n d q acWity and dius the ne$ probe was

created. L w , this probe was very efticient in competing out the major binding activity,

otherwise, point mutations of the oligonudeotide that showed the mon cornpetition wodd have

'been done to uy to pinpoint the active binchg site. %%at proved very i . n t d g about the 1% bp

neg$ fragment was that an AP-1 consensus site was discovered within it.

One of the f k t promoters that an AP-1 site was inserted into was a TK promoter, in which

it enhanced transcnption (198). This fan may explain the upreguktion of the TK promoter

conferred by the 114 bp pneg fragment as in Figure 3.10. Although AP-1 was originally defined as a

transcriptional aaivator, it has also been found to f i b i t UctIlSCnption. For example, an AP-I site

has been found to be inhibitory in a distal lung specific gene, surfactant protein B (SP-B), where it

was pan of a composite binding site. AP-1, CAMP response element binding protein (CREBP),

thyroid transcription facror-1 (TT-1) and nuclear factor 1 (?IF 1) all interact at this site. Mutation

andysis showed that the AP-i sire was responsible for the inhiiitory anion when bound by or

jhû. Howwer, whenjunD bound to the site the r d t was a c d y upregulation of the gene (6).

This dual action funher supports the opposite actions of the negative element when inserted into

heterologous promoters discuaed earlier. AP-1 sites have ken found to be inhbitory from other

sntdies as w d ; they have been shown to act in concert with both Oct-l(7) and glucocorEcoid

hormone (8) to mediate inhibitory responses.

With these findings in mind, ir seemed reasonable thar the AP-1 site could be mediaung the

negarive response, possibly in concert with the Oct-i consensus me present just dowmtream h m

the Al?-1 site. To test for the involvement of AP-î in the DNA-protein interaclions observed by

GSA, anti-AP-1 antibodies were added to binding reactions prior to the addition of radioIabeled

86

probe. Since, as descnibed above, any of c - - , & d l o r j d could bind as home or heterodimers

with t h e d v e s or eadi other or as hetemdimers with any member of the Fos famiy of proteins (9,

it seemed feaslcble to attempt the supershifi with more than one anti'body directed againsch. Two

amibodies were selead One, which a;ts a unived anti-&n antibody, bound to the DNA binding

domain of dja species, which would d o w it to detect any AP-1 binduig activity. The second

iuitibody wiü spécifii to c-hi. Thé univerd iuiti-$a antibody r d u c d the bindiq activity, as m&t

be expected since it is directed against an epitope in the DNA binding domain presumably blocking

interanion with DNA The anti-c-- a n t i i caused a decrease in mobility of the protein-DNA

complexes, a classic "nipershift." Both of these results indicated that the major binding acÉivity seen

Li the GSAs was AP-1 activity.

In order to tes whether the AP-I bindlig activity was responsiile for the negative reguiation

of rransaiption in our d e t r e d reporter consuucts, the AP-1 site was mutated in the p l 8

construct. T d e c U o n with the mutated consuua showed no si&cant ciifference in the reporter

gene expression when compareci to the wild type p l 8 consuuct, suggesing that the AP-1 site was

not involved in the negarive regdation of U;uiscnpuon. Furthemore, GSAmutAP, which containeci

the mutated AP-1 sire, could not compete with the wild site for DNA-protein btiding &ty.

Therefore, it can be concluded that the AP-1 site alone is not the dencing agent. It is possiile that

a rechindant system may be in place where knocking out the AP-1 acavity would not significandy

affect the suppression. Perhaps the AP-1 and Oct-1 sites are working together and for further study

both could be mutated in orQr to test this theory. Although no apparent 0-1 binding was taking

place in this midy, it is +le that the binding condirions were not opMial for E to occur.

By emmining Figure 3.U further, it can be noted diax the GSAL#I probe gave a weak and

diffiw, yet specific gel shifc band, which could possibfy be another candidate for the ne@e

dement. Also, in Figure 3.12 and 3.13 one can observe other b i n a actmities that are somewhat

l e s Litense than the major AP-1 binding activity, but which are @c and are not ail competed

out by the negP probe; these too are possible candidates for the negative element. On the other

hand, it is possible that the mie "transcriptional silencer" does not bind DNA under the conditions

used for the GSAs, and thus we Med to detect it in these l i r h assays.

Whatever the case may be, what we now know is that the inwnon of the negative element

containing region into heterologous promoten and its dects suggest the silencer is most Likely

promoter dependent, since the two rENaC promoten have a different medianism of &puon,

lacking a TATA box, from the TATA containing TK promoter. This does not mean that the

presence or absence of a TATA box k the sole factor meditating prornoter specificity, there are any

nurnber of factors that may be speafic to ENaC tmsaiption that are not present in TK

transcription and vice versa. The element is mon likely not position dependent since it was

appmximately 350 bp upsueam of the transcription srart site in the wild type P consuuct, about 600

bp upsneam in the a consuuct and 200 bp upnream of the TK vanxription start. In addition, Li

the study of y W a C the negative element that was observecl was anywhere from 1 250 to 1 500 bp

upstream of the sw site (1941, suggesting that the position of the element was not essential in order

to mediate in activify.

4.6 Cornparison of p-rENaC Regulation with Other Subunits

The promoters of each of the a-, and ~ b m i t s &are a few similarities. They all lack a

TATA box but contain multiple SP-1 elemenu near the &ption start &es. Al1 contain some

PEA3 consensus sites (62,63,66,194). Further regulation by the 5' fknking SeQuences, however,

illustrates a number of ciifferences. FFirsF, although the 3 nibunits are all TATA-less, the and y-

subunits have obvious CpG islands near their start sites containing multiple SP-1 consensus sites

and resul~g in multiple possible transcription start sites in a given are- (66,194). The crsubunit

does contain some SP-1 sites near its vaascripuon start site but does nor seem to have an obvious

CpG island (62,63). In faR the rar subunit has been shown to have at least nvo distinct scart sites

that are not merdy pan of a cluster of possible start sites as seen in this study of &rENaC. These

start sites are 450 bp apart and they have been shown to be expressed in differing amounts in

different tissues and during development (63). Similady, the human ambunit's 2 narc sites have

shown tissuespeclfic expression (64,65). A second sviking difference would be the absence, as yet,

of a GRE in the 5' flanking DNA of the P and v b u n i t genes (66,1941, while the ambunit gene

has been found to have a well defineci, anive GRE site (62,63) as well as a thyroid hormone

receptor response element whidi is shown to synergise widi the GRE element (63). There is &O a

third difference bemeen the subunits. In this study a negative &tory element was dûcovered

between positions -305 and 418 in the bENaC prornorer and in another mdy, by Auerbadi ad,

the human y s u b d t aiso showed a negative reguIatory element between positions -1 248 and -1 525

in its promoter (194). A negative element such as this has not been obsenred in the smdies

performed with the a-subunit. Overail, our m e n t understanding of the ENaC subunit promoters

suggescs that the and ynibunixs are similady regdated, but both are cpke different from the a-

subunit. In fan, as med in the introcfuction, Voilley etaL (59) found that the human P and

subunits were found withli the same 400 kb fragment of chromosome 16. This fincihg mggests

that these 2 subuaits could physically &are transaiptional elements and that they probably arose

from a relatively recent gene duplication, snengthening the view that they are more similar to each

other than to the a&& Thus our original hypothesk, that ail of the subunia are differentially

regulated by elements in their promoters, is onh/ parcially trw. For example, the identification of a

Chapter 5: Biological Sigacance and Directions for

Future Research

The eluadation of the 5' flanking sequence of the PrENaC gene and the preliminary study

of its promoter in this thesis have opened the way for further midy of vanscfiptional regulation of

BrENaC. With this mdy pestions have arisen and therefore hrther avenues of experimentation

have been created

Fin, what could be the identity of the "negative elernent" that was dixovered? What is its

biologid signtficance? This negative element may be a way to keep the PrENaC mRNA expressed

at a minimal level under basal conditions. One sequence in the negative repuiatory region which

deserves investigation is the AT-rich region nretching from -371 to -349. This element could be a

bIAR (3) mediating the uanscriptional represion that was observe& however, die degree to which

matriv attachment occurs with transfected plasmi& may be minimal. However it is canied out, the

negative element in PrENaC must keep the gene ~~uiscri i ing a - a 'house keepingn level and if

there is a need to upreguiate the transcription of the subunit, rernoval of the suppressor would cause

VaflSCfiption ro increase at leas to a level around that of the k305 collsvua. Funher midy should

atternpt to pin-point the position of the negative elemenr and what, if anyth;ig, binds to it.

Second, is it possible that the AP-1 site found in this region has any hinction? It is possible

thar this site codd in fan be an enhancer, whose action is b l d e d by the represmr binding to the

n w e dement. The suppressor may work not only to suppress the &ption mechanism, but

a b to mask the AP-1 acti*. This could explain the absence of a &ange in d p u o n a l actMty

with the milraton of the AP-1 site. When PrENaC needs to be upregulated, ir is possible that this

suppression is reliwed and the result is activation of transcription with enhancement by the AP-1

activity. It is also possible that, as in the midy on the SP-B gene, the different &z species have

different activitia on the AP-1 site (6). This could be a cd s p d c regulation of the gene, where

one Juz species is expressed in one type of ceil and mediates one response and another Jm species is

expressed in another cell type and mediatû a different response. To make it more complimed, the

different Fos species rnay interact with the Jm species in different combinations to c m e diEerent

r s p n s s . In û r k r EU :a &i2x h j p & e s s k wodd bé f a d e ta ;issdy ülê -mwriptional ~c?iiit).

of the wild type and mutated consuum with cotransfection of the different Jin @es and perhaps

even the different Fos species in combination wirh the Jta species.

With more r d a large number of represson are king identifieci, but few of their

binding sequences have been defineci More and more TFs which were originally thought to be

enhancers are ais0 in some cases showing repressor hvi ty , making it apparent that many TFs have

the potenual to act as reprenon or enhancers and it is king realized that the factor whidi mediates

how a TF wiU act is the Ca-element to which it bhds (3). Thedore, it is irnponant to idenufy

negauve N-regulatory elements, be they silencen or NREs, in order to elucidate the mechanism of

action of many TFs.

Thid, is there a GRE anywhere in the PrENaC gene and if not, by what mechaniSm is the

gene upreguiated by steroids in colon epithelium? Isolating more of the 5' flanking seqyence of the

gene from genomic clones, seqwncing the large first intmn and 3' flanking sequence and searchg

for consensus GRE sixes would be the preliminary sep in the search for a GRE. Any consensus

sites would need to be tested for a m in d e c t i o n s . If no GREs are found, a f u d e r course of

midy would be to derermine by what mechanism P r E M is upregulated by aeroib in colon

epithelNm. These types of experiments would have to be conduned using a colon epithelial cell Line

in which PENaC is endogenously arpressed and increased by steroids.

F i d y ; does the PrENaC regulatory region contain any further ekrnents of interest?

92

Further amnination of the identifid consensus sites and their aaivify dong with testhg sequence 5'

to position -1215 and in h n 1 for transcriptional activhy would be worch while. Understanding

how PrENaC is d p t i o n a l l y regulated can lead to hziu> tests on its regulauon in rats and

possibly lead to an understanding of the human gene bec- of prENaC9s high conservation

between the rwo species. The importance of this work is cl-, because once the regdatory

mechanimis of ENaC are elucidated, they could reveal potential, novel, therapeutic targets for

people who d e r from sudi ahents as edema, hypertension and even CF.

References:

1. Lodish,H., Baltimore,D., Berk,A., Zipursky,S.L., Matsudaka,P., and DarnellJ. 1995.

Molecular CeU Biology. W. H. Freeman and Co., New York.

2. Latchman,D.S. 1998. Eukaryotic Transcription Factors. Academic Press, Cambridge.

Ogboume,S. 1998. Transcriptional control and the role of silencen in transcriptional

regulation in eukaryotes. l3iochem.J. 33 1: 1- 14.

Semenza,G.L. 1999. Transcription Factors and Human Disease.

Press, New York.

Papavassiliou,A.G. 1995. Tanscription facton. Neu, Engl. JNed

Oxford University

332:45-47.

I3addadJJ.E. and Land,S.C. 2000. Orevoked regulation of HIF-la and NF-kB in

perinatal lung epithelium requires glutathione biosynthesis. Am.J.Pbysioi. 278:L492-

7. Takimoto,M., Quinn J.P., Farina,A.R., Staudt,L.M., and Levens,D. 1989. fos/jun and

oaamer-binding protein interact with a common site in a negative element of the

human c-myc gene. J Biol C h . 264:8992-8999.

8. Jonat,C., Rahmsdorf,H.J., Park,L-K., Cato,A.C.B., Gebel,S., Ponta,H., and

HerrlichP. 1990. Antitumour promotion and antiinflammation: down-modulation of

AP- 1 (Fos/Jun) activity by glucocorticoid hormone. Cd 62:1189-1204.

9. Angel>. and Karin,M. 1991. The role of Jun, Fox and the AP-1 complex in cell-

proliferation and transformation. BiochimBiopbysActa 1072: 129-157.

10. Gmaein,M. 1997. Histone acetylation in chroma& structure and transcription.

Nature 389:349-352.

11. Wemer,M.H. and Burley,S.K 1997. Architecturai uanscnption factors: Proteins that

rernodel DNA. W88:733-736.

Razin,A. 1998. CpG methylation, chromatin m a u r e and gene silencing - a three-

way conneaion. M O ] . 17:4905-4908.

Paher,L.G., LiJ.H.Y., Lindemann,B., and Edelman,I.S. 1982. Aldosterone control of

the density of sodium channels in the toad urinary bladder. jMmbr.Biol. 64:91-102.

Bindslev,N., Cuthben,A.W., Edwardson,J.M., and Skadhauge,E. 1982. Kinetics of

amilonde action in the hen coprodaeum in vitro. Pf2ugm Arch. 392:340-346.

Clauss,W., DurrJE., Guth,D., and Skadhauge,E. 1987. Effeas of adrenai neroids on

Na transport in the lower intestine (Coprodeum) of the hen. JMmbr.Biol.96:141-152.

Knowles,M., Munay,G., ShdalJ., Askin,F., Ranga,V., Gatzy J., and Boucher,R.

1984. Bioelectnc properties and ion flow across excised human bronchi. JAp#.PhysioI.

56:868-877.

Will,P.C., Cortright,R.N., Delisle,R.C., DouglasJ.G., and Hopfer,U. 1985.

Regdation of amiloride-sensitive electrogenic sodium transport in the rat colon by

neroid hormones. Am.J.Pbysioi. 248:G124-G132.

Golbtein,O., Asher,C., and Gany,H. 1997. Cloning and induction by low NaCl

intake of avian intestine Na' channel subunits. Am.bPhynol. 272:C270.C277.

Wddmann,R., Champigny,G., Bassilana,F., Voilley,N., and Lazdunski,M. 1995.

Molecular cloning and funaional expression of a novel amilonde-sensitive Na+

channel. j. Biol. CSmr. î70:274 11-274 14.

Waidmann,R., Champipy,G., Bassilana,F., Heurteaw,C., and Lazdunski,M. 1997. A

protongdted cation channel involved in acid-sensing. Nature 386:173-177.

Garcia-AnoverosJ., DerfleqB., Neville-GoldenJ., Hyman,B.T., and Corey ,D .P. 1997.

BNaCl and BNaC2 consitute at new family of human neuronal sodium channels

related to degenerins and epithelial sodium channels. A.ocNat..AcadSci (lSA 94:1459-

1464,

22. Waldmann,R., Bassilana,F., de WeilleJ., Champigny,G., Hemeaux,C., and

Lazdunski,M. 1997. Molecular cloning of a non-inactivating proton-gated Na + channel specific for sensory neurons. JBiol. C h . 272:20975-20978.

23. Price,M.P., Snyder,P.M., and Welsh,M.J. 1996. Cloning and expression of a novel

human brain Na+ channel. JBioL C h 271:7879-7882.

24. Waldmann,R., Charnpigny,G., Voilley,N., Lauritzen,L, and Lazdunski,M. 1996. The

mammalian degenerin MDEG, an amiloride-sensitive cation channel activated by

mutations causing neurodegeneration in Caenorhabditis elegans. JBiol. Chm.

271: 10433-10436.

25. Sakai,H., Lingueglia,E., Champigny,G., Manei,M.G., and Lazdunski,M. 1999.

Cloning and funaional expression of a novel degenerin-like Na' channel gene in

mammals. /.Physiol.(Lond) 5 19:323-333.

26. Schaefer,L., Sakai,H., Mastei,M.G., Lazdunski,M., and Lingueglia,E. 2000. Molecular

cloning, h a i o n a l expression and chromosornai localization of an amiloride-sensitive

Na' channe1 from human smali intestine, FEBS Lett. 471:205-210.

27. Dnscoll,M. and Cha.Ee,M. 1991. The mec-4 gene is a member of a family of

Caenorhabditis eiegans genes that can mutate to induce neuronal degeneration. Natrrre

349:588-593.

28. ChaXe,M. and Wolinsky,E. 1990. The identification and suppression of inhented

neurodegeneration in Caenorhabditis elegans. Nature L o d 345410-416.

29. Canessa,C.M., Horisberger Je-D., and Rossier,B.C. 1993. Epitheliial sodium channel

related to proteins involved in neurodegeneration. Nature 36 l:46%47O.

3C. Adams,C.M., Andenon,M.G., Motto,D.G., Pnce,M.P., Johnson,W.A., and

Welsh,M.J. 1998. Ripped pocket and pickpocket, novel Drosophila DEG/ENaC

subunits expressed in early development and in mechanosensory neurons. /: Cell Biol.

140:143-152.

3 1. Green,hA., Faiconer,S.V.P., and Cottreii,G.A. 1294. The neuropeptide Phe-Met-

Arg-Phe-NHZ (FMRFamide) directly gates two ion channels in an identified Helk

neurone. pflzigm A rch. 428:232-240.

32. Lingueglia,E., Champigny,G., Lazdunski,M., and Barbry,P. 1995. Cloning of a

neuronal m a m i d e receptor, a peptide-gated sodium channel. Nature 378:73O-732.

33. Darboux,I., LUigueglia,E., Champigny,G., Coscoy,S., BarbryP., and Lazdunski,M.

1998. dGNaC1, a gonad-specific amiloride-sensitive Na+ channel. JBiol. Cbm.

U3:9 424-9429.

Ishibashi,K and Marumo,F. 1998. Molecular cloning of a DEG/ENaC sodium

channel cDNA from human tesis. Biochem.Biophys..Res. Comm. 245:589-593.

Canessa,C.M., Schild,L., Buell,G., Thorens,B., Gautschi,I., HorisbergerJ.D., and

Rossier,B.C. 1994. Amiloridesensitive epithelial Na+ channel is made of three

homologous subunits. Nature 367%)-467.

Jentsch,T.J. 1994. Trinity of cation channels. Nature 367:412-413.

LinguegliaJ., Voilley,N., Wddmann,R., Lazdunski,M., and Barbry,P. 1993.

Expression cloning of an epithelial amilonde-sensitive Naf channel: A new channel

type with homologies to Camorhabditis eleguns degenerins. EEBS 3 18%-99.

Adams,C.M., SnyderJ?.M., and Welsh,M.J. 1997. Interactions between subunits of the

human epithelial sodium channel. J B i d Chem 27227295-27300.

Schild,L., Schneeberger,E., Gautschi,L, and Finov,D. 1997. Identification of amino

acid residues in the a, p, and gamma subunits of the epithelial sodium channel

(ENaC) involved in amiloride block and ion permeation. 4 Gm. Physioi. 109: 15-26.

Canessa,C.M., Menilat,A.-M., and Rossier,B.C. 1994. Membrane topology of the

epitheliai sodium channel in intact cells. AmJPhysiol. 267C1682-C1690.

Renard& Lingue&&, Voiiley,N., Lazdunsid,M., and Barbryp. 1994. Biochernical

anaiysis of the membrane topology of the amiloride- sensitive Na* channel.

J B i o L C h . 269:12981-12986.

Snyder,P.M., McDonald,F.J., Stokes J.B., and Welsh,M.J. 1994. Membrane topology

of the amiloride sensitive epithelial sodium channel. JBiol. C ' m . 269:24379-24383.

Coscoy,S., De WeilleJR., Lingueglia,E., and Lazdunski,M. 1999. The pre-

tansmembrane 1 domain of acid-sensing ion channels participares in the ion pore.

/.Biol.Cbm. 274:10129-10132.

Benos,D.J. and Stanton,B.A. 1999. Funaional domains within the

degeneridepithelid sodium channel (.Deg/ENaC) superfarnily of ion channels.

J PhysioL(Lond) 52063 1-644.

Firsov,D., Gaurschi,L, Merillat,A.-M., Rossier,B.C., and Schild,L. 1998. The

heterotetrameric architecture of the epithelial sodium channel (ENaC). H B O J

17:344-352,

Kosari,F., sheng,S., LiJ., Mak,D.O.D., FoskeaJJC, and Kleyman,T.R. 1998. Subunit

aoichiometry of the epithelial sodium charinel. JBiol. ChPm. U3: 13469-13474.

Cosco y,S., Lingueglia,E., Lazdunski,M., and Barbry ,P. 199 8. The P he-Met-Arg-Phe-

amide-activated sodium channel is a tetramer. J BioL Chem. U3:83 17-8322.

Snyder,P.M-, Chen&., Prince,L.S., RogenJ.C., and We1shJL.J. 1998.

Electrophysiologicd and biochemical evidence that DEG/ENaC cation channels are

composed of nine subunits. JBioL CSem. 273:681-684.

49. Cheng,C., Prince,L.S., Snyder,P.M., and Welsh,M.J. 1998. Assernbly of the epithelial

Na' channel evaluated using nicrose gradient sedimemation analysis. J Biol. C h .

273:22693-22700.

50. Berdiev,B.K., Karison,KH., Jovov,B., Ripoil,P.J., Moms,R., Lofhg-Cueni,D.,

HalpinJ?., Stanton,B.A., Kleyman,T.R., and Isrnailov,I.I. 1998. Subunit aoichio metry

of a core conduaion element in a cloned epithelial amiloridesensitive Na' channel.

BiophysJ. 75:U92-23 O 1.

5 1. Eskandar,S., Snyder,P.M., ECreman,M., Zampighi,G.A., Welsh,M.J., and Wright,E.M.

1999. Number of subunits comprising the epithelial sodium channel.JBio1. Chem.

274:2728 1-27286.

52. McNicholas,C.M. and Canessa,C.M. 1997. Divenity of channels generated by

different combinations of epithelial sodium channel subunits. JGetrPhysiol. 109:681-

692.

53. McDonald,F.J., Price,M.P., Snyder,P.M., and Welsh,M.J. 1995. Cloning and

expression of the beta- and gamma-subunits of the human epithelial sodium channel.

AmJPhysiol. 268:C1157-C1163.

54. McDonald,F.J., Snyder,P.M., McCray,P.B., Jr., and WeIsh,M.J. 1994. Cloning,

expression and Ussue distribution of a human amiloride-sensitive Na+ channel.

AmJPhysoL 266:L728-L734.

55. Ahn,Y.J., Brooker,D.R., Kosari,F., Harte,B.J., LiJQ., Mackler,S.A., and

Kleyman,T.R. 1999. Cloning and hinaional expression of the mouse epithelial

sodium channel. AmJ PhysoL 277Z121-F129.

Fuller,C.M., Awayda,M.S., Arrate,MS., Bradford,A.L., Moms,R.G., Canessa,C.M.,

Rossier,B.C., and Benos,D.J. 1995. Cloning of a bovine rend epithelial Na+ channel

nibunit. Am.]. Physiol. 269:C641-C654.

Puoti,A., May,A., Canessa,C.M., HorisbergerJ-D., Schild,L., and Rossier,B. 1995.

The highly seleaive low-conductance epithelid Na channel of Xenopus laevts A6

kidney cells. Am.J.Physio1. 269:C 188-cl W.

Meisler,M.H., Barrow,L.L., Canessa,C.M., and Rossier,B.C. 1994. SCNN1, an

epithelial cell sodium channel gene in the conserved linkage group on mouse

chromosome 6 and human chromosome 12. Gerrornics 24:185-186.

Voilley,N., Bassilana,F., Mignon,C., Mencher,S., Manei,M.-G., Carle,G.F.,

Lazdunski,M., and Barbry,P. 1995. Cloning, chromosomal localization, and physical

linkage of the P and gamma subunits (SCNNlB and SCNNlB) of the human

epithelial amiloride-sensitive sodium channel. Genomics 28:560-565.

Brooker,D.R., Kozak,C.A., and Kleyman,T.R. 1995. Epithelial sodium channel genes

ScnnZb and Scnn Ig are closely linked on diaal mouse chromosome 7. Genomics

29:784-786.

Ludwig,M., Bokenius,U., Wickert,L., Marynen,P., and Bidlingmaier,F. 1998.

S t r u c t d organisation of the gene encoding the a-subunit of the human amiloride-

sensitive epithelial sodium channel. Hum. Genet. 102:576-581.

Chow,Y.H., Wang,Y., PlumbJ., OtBrodovich,H., and HuJ. 1999. Hormonal

regdation and genomic organization of the human amiloridesensitive epithelid

sodium channel a subunit gene. Pediatr.Res. 46:20&214.

Onrlakowski,G., Rafii,B., Bremner,H.R., and O ' Brodovich,H. 1999. Stmcture and

hormone responsiveness of the gene encoding the a-subunit of the rat amiloride-

sensitive epithelial sodium channel. Am. JJespir. CèIl Md BioL 20: 1028-1040.

Voilley,N., Lingueglia,E., Champigny,G., Mattei,M.-G., Wddmann,R.,

Lazdunski,M., and BarbryJ? 1994. The lung amiloride-sensitive Na+ channel:

biophysical properties, pharmacology, ontogenesis, and molecular cloning.

Proc.NatZ.AcadSciUS4 91:247-251.

Thomas,CS., Auerbach,S., StokesJB., and Vok,KA. 1998.5' Heterogeneiry in

epithelial sodium channel a-subunit mRNA leads to distinct NHrtemiinal variant

proteins. Am.J.Phynol. 274:C 13 12-C 1323.

Thomas,C.P., Doggett,N.A., Fisher,R, and St0kesJ.B. 1996. Genomic organization

and the 5' flanking region of the gamma subunit of the human amiloridesensitive

epithelial sodium channel. J Biol. Cbm. 27 1:26062-26066.

Thomas,C.P., Auerbach,S.D., Zhang,C., and St0kesJ.B. 1999. The n m m r e of the rat

amiloride-sensitive epithelial sodium channel gamma subunit gene and functional

andysis of its promoter. Gene Z8:I 11-122.

Saxena,A., Hanukoglu,L, Stautnieks,S.S., Thompson,R.J., Gardiner,R.M., and

Hanukogiu,A. 1998. Gene suucnue of the human amiloride-sensitive epithelial

sodium channel beta subunit. Biocbm. Biophys. RB. Cornmt 252:208-213.

Palmer,L.G. 1982. Ion selecrivity of the apical membrane Na+ channei in the toad

urinary bladder. J.Mmbr. Biol. 67:9 1-98.

Benos,D.J., Mandel,L.J., and Simon,S.A. 1980. Cation selectivity and cornpetition at

the sodium entry site in frog skia J Gm.Phyiol. 76:U3-247.

Palmer,L.G. and Frindt,G. 1988. Conductance and gating of epithelial Na+ channels

from rat cortical collecting tubule. Effects of 1Um;nal Na+ and Li + . /. Gm Physiol.

92121-138.

Pdmer,L.G. and Frindt,G. 1986. Amiloride-sensitive Na+ channek from the apical

membrane of the rat cortical collecting tubule. Ploc.Nut.AcadScL USA 83:2767-2770.

Hamilton,KL. and Eaton,D.C. 1986. Regdation of single sodium channels in rend

tissue: a role in sodium homeostasis. Fehation Proc. 452713-2717.

Frings,S.M., Purves,R.D., and Macknight,A.D. 1990. Ion channels in urioary bladder.

R d PhysioLBiochem. 13:112-128.

Palmer,L.G. 1982. Na+ vansport and flux ratio through apical Na+ channels in toad

bladder. Nature Lond 297:690.

Benos,D.J., Hyde,B.A., and Latorre,R. 1983. Sodium flux ratio through the amiloride-

sensitive pathway of frog skin. j. Gm.Phys01. 81:667-685.

Benos,D.J. 1982. Amiloride: a molecular probe of sodium transport in tissues and

celis. Am.. Physid. 242333 1-(2145.

Kleyrnan,T.R. and Cragoe,E.J., Jr. 1988. Amiloride and its andogs as tools in the

study of ion tansport. J.Membr.Biol. 105:l-21.

Palmer,L.G. and Kleyman,T.R. 1994. Potassium-sparing diuretics: amiloride. In

Handbook of Experimentd Pharmacology, Diuretics. E.Mutschler and Greger,R.,

editors. Springer-Verlag, Heidelberg, Germany . 3 63-394.

Palmer,L.G. and Frindt,G. 1986. Epithelial sodium channels: characterization by

using the patch-clamp t ethnique. Fedeation h o c . 45:2708-27 12.

Garty,H. and Palrner,L.G. 1997. Epithelial sodium channels: Function, structure, and

regulation. PhysioLRev. 77:359-396.

Olver,RE. and Strang,L.B. 1974. Ion flues across the pdmonary epithelium and the

secretion of lung liquid in the foetal lamb. J o u d ofPh.,siology, London 241:327-357.

Adamson,T.M., BoydJLD., Platt,H.S., and Suang,L.B. 1969. Composition of aheolar

liquid in the Fetal lamb. JooumaZ of Fbysiology, London 204:159-168.

Orzalesi,M., Motoyarna,M., Jaco bson,H.N., and Kikkawa Y. 1965. The development

of lung liquid in fetd goats. Pediatria 35373-381.

Alcom,D., Adamson,T.M., Lambert,T.F., M&neyJ.E., Ritchie,B.C., and

Robinson,P.M. 1977. Morphological effects of chronic tracheal ligation and drainage

in the fetd hmb h g . Journai ofAnaromy 123:649-660.

Bland,R.D. and Nielson,D.W. 1992. Developrnental changes in lung epithelial ion

tansport and liquid movement. Annu. Rw. Physiol. 54373-394.

Olver,R.E., Ramsden,C.A., Strang,L.B., and Walten,D.V. 1986. The role of

amiloride-blockable sodium transport in adrenaline-induced lung liquid reabsorption

in the fetal lamb. journal of Physioiogy, London 376:321-340.

H u d e r , E . , BarkerJ?, Gat y J., Beexmann,F., Verdumo,C., Schmidt,A.,

Boucher,R., and Rossier,B.C. 1996. Early death due to defecrive neonatal lung liquid

clearance in ocENaCdeficient mice. Nature Genet. 12:325-328.

Barker,P.M., Nguyen,M.S., GatzyJ.T., Grubb,B., Norman,H., Humrnler,E.,

Rossier,B., Boucher,R.C., and Koller,B. 1998. Role of gammaENaC subunit in lung

liquid clearance and elearolyte balance in newborn mice. /. CIin.lnvest. 102: 1634-1640.

O'Brodovich,H., Hannam,V., and Rafii,B. 1991. Sodium channel but neither Na+-

H+ nor Na-glucose symport inhibiton slow neonatd lung water clearance. Amenkan

]on& of Respiratory Ce22 & MoZecdÙr Biology 5377-384.

O'Brodovich,H. 1991. Epithehl ion transport in the fetal and perinatal lung.

Am.JPhysd 261:C55EC564.

O'Brodovich,H., Hannam,V., Seear,M., and MdenJB. 1990. Amiloride impairs lung

water clearance in newbom @ea pigs. JAippPbysiol. 68:1758-1762.

Tchepichev,S., UedaJ., Canessa,C., Rossier,B.C., and O'Brodovich,H. 1995. Lung

epithelid Na channel subunits are differentially regulated during development and by

steroids. Am./. Physoi. 269:C805-C8 12.

Talbot,C.L., Bosworth,D.G., Brdey,E.L., Fenaermacher,D.A., Boucher,R.C.,

Gabnel,S.E., and Barker,P.M. 1999. Quantitation and localization of ENaC subunit

expression in fetal, newbom, and adult mouse Iung. Am.JRespir.Cell MoLBiol. 20:398-

406.

Smith,D.E., Otulakowski,G., Yeger,H., Pon,M., Cutz,E., and OIBrodovich,H.M.

2000. Epithelial Na' channel (ENaC) expression in the developing normal and

abnormal human perinatal lung. AmJRespir. C A Càre Med 161: 1322-133 1.

Eaton,D.C. and Hamilton,K.L. 1988. The amiloride-blockable sodium channel of

epithelial tissue. In Ion Channels. T.Narahashi, editor. Plenum, New York. 251-282.

Brown,M.J., Olver,R.E., Ramsden,C.A., Strang,L.B., and Walten,D.V. 1983. Effects

of adrenaline and of spontaneous labour on the secretion and absorption of lung

liquid in the fetal lamb. Journal ofPhynoogy, London 344:137-152.

Chapman,D.L., Carlton,D.P., Curnmings J.J., Poulain F.R., and Bland,R.D. 199 1.

Intrapulmonary terbudine and aminophylline decrease 1ung liquid in fetd lambs.

Pediatr,Res. 29:357-36 1.

OtBrodovich,H.M., Rafii,B., and Perlon,P. 1992. Arginine vasopressin and atnd

natriuretic peptide do not alter ion transport by d tu r ed fetal distal lung epithelium.

Pediatr.Res. 3 1 :3 18-3 22.

O'Brodovich,H., Rafii,B., and PostJd. 1990. Bioelecuic properties of f e d dveolar

epithelid monolayers. Am.J.Pbysiol. 258:UOl-L206.

Waltea,D.V., Rarnsden,C.A., and Olver,R.E. 2000. Dibutyryl CAMP induces a

gestationdependent absorption of fetal lung liquid JAppl.Physio1. 68:2054-2059.

O'Brodovich,H.M. 1996. Immature epithelid Na+ channel expression is one of the

parhogenic mechanisms Ieading to human neonatal respiratory dimess syndrome.

A.oceedings of the Association of Am&n Physiciam lO8:345-3 55.

Barker,P.M., Gowen,C.W., Lawson,E.E., and Knowles,M.R. 1997. Decreased sodium

ion absorprion across nasal epidieiium oi very premarurt infanrs w ir h respiratory

distress syndrome. JPediatr. 130:373-377.

McDondd,F.J., Yang,B., Hmka,R.F., Drumrnond,H.A., Tarr,D.E., McCray,P.B., Jr.,

StokesJB., Welsh,M.J., and Williamson,R.A. 1999. Disruption of the P subunit of the

epitheliai Na+ channel in rnice: Hyperkalemia and neonatal death associated with a

pseudohypoaldosteronism phenotype. Proc.Natl.AcadSci. USA 96: 1727-173 1.

Padervand,S., Barker,P.M., Wang,Q., Ema,S.A., Beermann,F., Grubb,B.R.,

Burnier,M., Schmidt,A., Bhdels,R.J.M., Gar yJT. et al. 1999. Salt restriction induces

pseudohypoaidosreronism type 1 in mice expressing low levels of the Pwbunit of the

amiloride-sensitive epithelial sodium channel. Ploc.NatAcadSci. USA 96: 1732-1737.

Matthay,MA., Folkesson,H.G., and Verkman,A.S. 1996. Salt and water transport

across alveolar and distd airway epithelia in the adult lung. Arn.J.Physiol. 270:L487-

LSO3.

Yue,G., Russell,WJ., Benos,D.J., Jackson,R.M., Ohan,M.A., and Matdon,S. 1995.

Increased expression and activity of sodium channels in alveolar type II cells of

hyperoxic rats. Roc. NudAcadSci. USA 92:8418-8422.

Yue,G. and Matalon,S. 1997. Mechanisms and sequelae of increased dveolar fluid

clearance in hyperoxic rats. AmJPhysiol. 272:L407-L412.

OtBrodovich,H., Canessa,C., UedaJ., Wi,B., Rossier,B.C., and EdelsonJ. 1993.

Expression of the epitheliai Na+ channel in the developing rat lung. Am.]. PhysioI.

265:C491-C496.

1 10. Buch,L.H., Talbot,C.R., Knowles,M.R., Canessa,C.M., Rossier,B.C., and

Boucher,R.C. 1995. Relative expression of the human epithelial Na+ channel

subunits in normal and cystic fibrosis ainvays. AmJPbysz'ol. 269:C5ll-C5 18.

111. Marsushita&, McCray,P.B., Jr., Sigrnunci,R.D., Weish,M.j., and BokesJ.3. 1496.

Localization of epithelial sodium channel nibunit &As in adult rat lung by in situ

hybridization. Arn.JPbysiol. 271:L332-L339.

112. Renard,S., Voilley,N., Bassdana,F., Lazdunski,M., and Barbry,P. 1995. Localization

and regdation by steroids of the a, and gamma subunits of the amilotide-sensitive

Na' channel in colon, lung and kidney. W~gers Archives 430:299-307.

113. Kerem,E., Bistriczer,T., Hanukoglu,A., Hofmann,T., Zhou,Z.Q., Bennett, W.,

MacLaughlin,E., Barker,P., Nash,M., Quittel1,L. et al. 1999. Pulmonary epithelial

sodium-channel dysfunction and excess ainvay liquid in pseudohypoaldoneronism.

NEnglJMed 341:15&162.

114. Boucher,R.C., Chiner,T., Willurnsen,N.J., Knowles,M.R., and Stuas,M.J. 199 1. Ion

transport in normal and CF airway epithelia. Adv.E;epNedBiol. 290:105-115.

115. Boucher,R., Cotton,C.U., Gauy,J.T., Knowles,M.R., and YankaskasJR. 1988.

Evidence for reduced Cl and increased Na+ permeability in cyaic fibrosis human

primary cell culturess./'ousnol of Physiology, London 40577403.

116. Md,M., Hipper,A., Greger,R., and Kunzelmann,K. 1996. Wild type but not

DeltaF508 CFTR inhibits Na' conductance when coexpressed in Xenopw ooqnes.

E B S k t t . 381:47-52.

117. Stutts,M.J., Canessa,C.M., OlsenJC., Hamrick,M., CohnJA., Rossier,B.C., and

Boucher,R.C. 1995. CFTR as a cAMPdependent regulator of sodium channels.

Sciace 269:847-850.

118. Welsh,M.J. 1990. Abnormd regdarion of ion channels in cystic fibrosis. FASEBJ.

4:2718-2725.

119. Duc,C., FannaqN., Canessa,C.M., BonvderJ.-P., and R0ssieqB.C. 1994. Ceil-specific

expression of epitheiiai sodium ciiannei a, 13, and gamma subunits in aidoaerone-

responsive epithelia from the rat: Localization by in situ hybridization and

immunocytocheminry.J.CeIIBio1. 127:1907-1921.

120. Ciampolillo,F., McCoy,D.E., Green,R.B., Karlson,K.H., Dagenais,A., Molday,R.S.,

and StantonJ3.A. 1996. Cell-specific expression of amiloride-sensitive, Na'-

conducting ion channels in the kidney. AmJ PhysioI. 27l:C1303-C 13 15.

121. Volk,&A., Sigmund,R.D., Snyder,P.M., McDonddJ., Welsh,M.J., and Stokes J.B.

1995. RENaC is the predominant Na' channel in the apical membrane of the rat rend

inner medullary collecting duct. /. CLin.huest. 96:2748-2757.

122. OINeil,R.G. and Hayhurst,R.A. 1985. Functiond differentiation of ce11 types of

conicd coue&g duct. Am./. Physioz. 248H449-F453.

123. PachaJ., Frindt,G., SackLi,H., and Palmer,L.G. 1991. Apical maxi K channeis in

intercdated ceils of CCT. Am.].Physiol. 261F696-F705.

124. Chang,S.S., Grunder,S., Hanukoglu,A., Roder& Mathew,P.M., Hanukoglu,I.,

Schild,L., Lu,Y., Shimkets,R.A., Nelson-Williams,C. et al. 1996. Mutations in subunits

of the epithelial sodium channel cause s a l t wasting with hyperkalaemic acidosis,

pseudohypoaidoneronism type 1. Nature Genet. 12248-253.

125. Gninder,S., Firsov,D ., C hang,S.S., Jaeger,?Y.F., Gautschi,L, Schild,L., Lifcon,R.P., and

RossierJ3.C. 1997. A mutation causing pseudohypoaldosteronism type 1 identifies a

conserved glycine that is involved in the gating of the epithelial sodium channel.

EMBOJ. 16:899-907.

Botero-Velez,M., CmisJJ., and Wmock,D.G. 1994. Liddle's syndrome revisited: a

disorder of sodium reabsorption in the d i d tubule. Neu, EngLJNed 330:178-181.

HanssonJH., Nelson-Williams,C., Suzuki,H., Schild,L., S himkets,R., Lu,Y ., Canessa,C., IwasaiqT., Rossier,B., and Lifron,RP. 1995. Hypertension caused by a

tnincated epithelial sodium channel gamma subunit: genetic heterogeneity of Liddle

syndrome. Nature Genet. 11:76-82.

Shimkets,R.A., Wamock,D.G., Bosius,C.M., Nelson-WUiams,C., Hansson J.H.,

Schambelan,M., GillJ.R.J., Ulick,S., Milora,R.V., FindlingJW. et al. 1994. Liddle's

syndrome: Heritable human hypertension caused by mutations in the beca subunit of

the epithelid Na channel. Cell79:404-414.

Wong,Z.Y .H., Stebbing,M., EhJ.A., Lamancia,A., and Harrap,S.B. 1999. GeneUc

linkage of B and gamma subunits of epithelial sodium channel to syaolic blood

pressure. Lancet 353:121-1225.

Chamey,A. and Feldman G. 1984. Systemic acid-base disorders and intestinal

elenrolyte transporr. AmJ Phynol. 247:Gl-G12.

Bast1,C.P. and Hays1eaJ.P. 1992. The cellular action of aldosterone in target epithelia.

Kidney International 42:250-264.

Lingueglia,E., Renard,S., Wddma~,R. , Voil.Iey,N., Champigny,G., Plass,H.,

Lazdunski,M., and BarbryJ? 1994. Different homologous subunits of the amilonde-

sensitive Na' channel are differently regulated by aldosterone. JBiol. Chem 269:13736-

13739.

Escoubetb., Coureau,C., BonvdetJS., and Farman,N. 1997. Noncoordinate

regulation of epithelial Na channel and Na pump subunit &As in kidney and

colon by aldosterone. Am.j.Physioi. 272:Cl482-C149 1.

Farman,N., TaIbot,C.R., Boucher,R., Fay,M., Canessa,C., Rossier,B., and

Bonva1etJ.P. 1997. Noncoordinated expression of alpha-, beta-, and gamma-subunit

mRNAs of epithelid Na' channel dong rat respiratory tract. Am.JPhyno1. 272:C131-

C141.

Garty,H., Peterson-Yantomo,K, Asher,C., and Civan,M.M. 1994. Effeas of conicoid

agonists and antagonists on the apicd Na+ permeability of road urliary bladder.

Am.J.Physo!. 266:F108-F116.

Asher,C., Eren,R., Kahn,L., Yeger,O., and Garty,H. 1992. Expression of the

amiloride-blockable Na' channel by RNA from control versw aldosterone-aimulated

tissue. JBioi. chm. 267: 1606 1-16065.

Asher,C. and Garty,H. 1988. Aldoaerone increases the apicd Na+ permeability of

toad bladder by two differenr mechanisrus. Proc. NutAcad Sri. USA 85~7413-7417.

Epple,H.J., Amasheh,S., Mankertz J., Goltz,M., SchulzkeJD., and Fromm,M. 2000.

Early aldonerone effect in distal colon by transcriptionai regulation of ENaC

subunits. AmJ Physoi. 278:Gil8-G724.

Frindt,G., SackiqH., and Palmer,L.G. 1990. Whole cell nirrents in rat conicai

coilecring tubule: low Na+ diet increases amilonde-sensitive conductance.

Am.J Physioz. 258F562-F567.

Fromm,M., SchulzkeJ.D., and Hege1,U. 1993. Control of electrogenic Na+

absorption in rat Iate d i s d colon by nanomolar aldosterone added in vitro.

AmJ Physd. 264:E68-E73.

Champigny,G., VoilIeyJV., Lingueglia,E., FriendV., Barbryp., and Lazdunski,M.

1994. Regdation of expression of the lung amiloride-sensitive Na+ channel by neroid

hormones. EMBOJ 1332177-2181.

Grubb,B.R. and Boucher,R.C. 1998. Effect of in vivo corticoneroids on Na' transport

across airway epithelia Am.J.Pbysiol. 275C303-C308.

Rokaw,M.D., WangJ.M., Edinger,R.S., Weisz,O.A., Hui,D., Middleton,P.,

Shiyonsky,V., Ber&ev,B.K, Isrnaiiov,I., Eaton,D.C. et ai. 1998. Carboxyimetiiyiation

of the subunit of xENaC regulates channel aaivity. JBiol. Cbm. 273:28746-28751.

Hawk,C.T., Li,L., and SchaferJA. 1996. AVP and aldosterone at physiologicd

concentrations have synergiaic effects on Na' transport in rat CCD. Kidney

Internationaf 50:S35-S41.

Barker,P.M., Markiewicz,M., Parker,A., Walters,D.V., and Scrang,L.B. 1990.

Synergistic action of triiodothyronine and hydrocortisone on epinephrine-induced

reabsorption of fetal luag liquid. Pediatr.Res. 27:588-59 1.

Barker,P.M., Walten,D.V., Markiewicz,M., and Strang,L.B. 1991. Development of the

lung liquid reabsorptive mechanism in fetal sheep: synergisrn of triiodothyronine and

hydrocortisone. JPhysioL(Lond) 433:435-449.

Pkha J., Pohlov&I., and Zemanov&Z. 1996. Hypothyroidism affects the expression of

electrogenic amiloride- sensitive sodium transport in rat colon. Gatromterolog~

111: 1551-1557.

Mrnka,L. and PichaJ. 2000. Permissive effect of thyroid hormones on induction of

rat colonic Na' transport by aldosterone is not localised at the level of Na' channel

transcription. Mol. CèlL Endohnol. lS9:179-185.

Lin,H.H., Xentner,M.D., Ho,H.-L.L., Kim,K-J., and Ann,D.K 1999. The gene

expression of the amiloride-sensitive epirhelid sodium channel a-subunit is regulated

by antagonistic effects between glucocorticoid hormone and ras pathways in salivary

epithelial cells. JBioZ. Cbm. 274:21544-21554.

Chen,S.Y., Bhargava,A., Mastrobedno,L., Meijer,O.C., WangJ., Buse,P.,

Firestone,G.L., Verrey,F., and Pearce,D. 1999. Epithelial sodium channel regulated by

aldosterone-induced protein sgk. Proc.Natl.AcadSk USA 96:25 1425 19.

Sweezey,N., Tchepichev,S., Gagnon,S., Fertuck,K., and O'Brodovich,H. 1998.

Femaie gender hormones regulate mRNA levels and hinaion of the rat lung epirhelial

Na channel. Am.].Physiol. 274C379-C386.

Breyer,M.D. and Fredin,D. 1996. Effect of vasopressin on intracellular Na'

concentration in corcicd coilecting duct. Kidney International 50:S57-S6 1.

Kleyman,T.R., Ema,S.A., and Coupaye-Gerard,B. 1994. Arginine vasopressin and

forskolin regulate apical ce11 surface expression of epithelial Na+ channels in A6 cells.

AmJ Physiol. 266:F506-FS 1 1.

Djelidi,S., Fay,M., Cluteaud,F., Escoubet,B., Eugene,E., Capurro,C., B0nvaletJ.P ., Farman,N., and Blot-Chabaud,M. 1997. Transcriptional regdation of sodium

transport by vasopressin in rend cells. /. Bioi. Chm. 272:329 19-32924.

Prat,A.G., Bex-torello,A.M., AusielloD.A., and Cantiel10,H.F. 1993. Activation of

epithelid Na + channels by protein kinase A requires aain filaments. Am.J Physiol.

265:CZ4-C233.

Sapijaszko,M., MacKenzieJ., Walsh,M.P., and Berthiaume,Y. 1993. Protein kinase C

activiry during the process of lung liquid clearance. Am.JPhyn'oI. 265:L57-L66.

Zenmer,M.D., Lin,HH, Wen J., Kim,KJ., and Ann,D.K 1998. The amiloride-

sensitive epithelid sodium channel a-subunit is vanscriptiondy dom-regulated in

nt parotid cells by the extracellular signal-regulated protein kinase pathway.

Kokko,K.E., Matsumoto,P.S., Ling,B.N., and Eaton,D.C. 1994. Effects of

prostaglandin E2 on amilonde-blockable Na' channels in a diaal nephron cell line

(A6). AmJPhysiol. 267:C1414-C1425.

Al-Awqati,Q. 1995. Regdation of ion channels by ABC transporten that secrete

A n . $amce 269:805-806.

Letz,B. and KorbmacheqC. 1997. CAMP nimulates CFTR-Like Cl- channels and

inhibits d o r i d e - sensitive Na' channels in mouse CCD cells. Am.J.Physiol.

272:C657-C666.

Stutts,M.J., Rossier,B.C., and Boucher,R.C. 1997. Cynic fibrosis transmembrane

conductance regulator inverts protein kinase A-mediated regulation of epithelial

sodium channel single channel be t i c s . /.Biol. Chm. 272:14037-14040.

Hopf,A., Schreiber,R., Mall,M., Greger,R., and Kwelmann,K. 1999. Cynic fibrosis

transmembrane conductance regulator inhibits epithelial Na+ channels carrying

Liddle's syndrome mutations. JBiol. Cbm. 274: 13894-13 899.

Schreiber,R., Hopf,A., Mall,M., Greger,R., and Kunzelrnann,K. 1999. The f i -

nucleotide binding domain of the cystic-fibrosis transmembrane conduaance

regulator is important for inhibition of the epithelial Na' channel.

Proc,NatkA~&Sti. USA 9653 10-53 15.

Hanrey,KF. and Kumar,S. 1999. Nedd4-like proteins: an emerging family of

ubiquitin-prorein ligases implicated in diverse cellular functions. Trends Cell Biol.

9:165-205.

Staub,O. and Rotinp. 1996. WW Domains. Stnrcture 4495-499.

Staub,O., Gautschi J., Ishikawa,T., Breitschopf,k, CiechanoverA., Schild,L., and

RotinD. 1997. Regdation of aability and hinction of the epithelial Na+ channel

@NaC) by ubiquitination. EMBOJ. 16:6325-6336.

167. Harvey,KF., Dinudorn,A., Komwatana,P., Jolliffe,C.N., Day,M.L., Parasivam,G.,

Cook,D.I., and Kumar,S. 1999. Al1 three WJU domains of murine Nedd4 are involved

in the regulation of epithelial sodium channels by intracellular Na'. Biol. Cbem.

274: 12525-12530.

168. F-,TJey Coddington-Lawson,S.J., Snyder,P.M., and McD0nddF.J. 2000. Human

Nedd4 interam with the human epithelial Na+ channel: WW3 but not WW1 binds

ro Na+-channel subunits. Biochem./. M:SO3-509.

169. Dinudom,A., Harvey,K.F., KornwatanaJ?, YoungJA., Kumar,S.. and Coo k,D.I.

1998. Nedd4 mediates control of an epithelial Na+ channel in sdivary dua cells by

cytosolic Na+. Proc~NadAcadSci USA 957169-7173.

170. Staub,O., Dho,S., HenryP.C., CorreaJ., Ishikawa,T., McGladeJ., and RotLi,D. 1996.

WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelid Na+

channel deleted in Liddle's syndrome. EMBOJ 152371-2380.

171. Goulet,C.C.,Volk,KA.,Adams,C.M.,Prince,L.S.,SrokesJ.B.,andSnyder,P.M. 1998.

Inhibition of the epirhelial Na' channel by interaction of Neddr) with a PY motif

deleted in Liddle's syndrome. JBiol. h. 273:3OO 12-300 17.

172. Abriel,H., LoffmgJ., RebhunJ-F., PrarrJH., Schild,L., Horisberger&-D., Rotin,D.,

and Staub,O. 1999. Defeaive regulation of the epitheliai Na+ charme1 by Nedd4 in

Liddle's syndrome. J Clidnvest. IOM67-673.

173. Pitkanen,O., TansweU,A.K, Downey,G., and O'Brodovich,H. 1996. Increased Po,

dten the bioelecuic propertîes of f e d distal lung epitheiium. Am.J.PhysioL

270:L106GLl066.

174. HaskellJF., Yue,G., BenosDJ., and Matalon,S. 1994. Upregulation of sodium

conduaive pathways in alveolar type II cells in sublethal hyperoxia. Am.J.Physiol.

266:L30-L37.

175. Planès,C., Escoubet,B., Blot-ChabaudM., Fnedlander,G., Farman,N., and Clerici,C.

1997. Hypoxia downregulates expression and activity of epitheiial sodium channels in

rat dveolar epithelial cells. AmJ Respir. Ced Mol. Biol. l7:508-5 18.

176. Rafi,B., Coutinho,C., Otulakowski,G., and O'Brodovich,H. 2000. Oxygen induction

of epithelial NaC transport requires heme proteins. AmLPhysiol. 278:L399-L406.

177. Cantiello,H.F., Patenaude,C.R., and Ausiello,D.A. 1989. G protein subunit, alpha i-3,

activistes a pemissis toxin-sensitive Na+ channel from the epithelial ce11 line, A6.

J BioL Cbem. 264:20867-20870.

178. Ausiel10,D.A.~ StowJ.L., Cantiel10,H.F.~ de AlmeidaJB., and Benos,D.J. 1992.

Purified epithelial Na+ channel complex comains the pemissis toxin-sensitive G,.,

protein. JBiol. &. 267:47594765.

179. MacGregor,G.G., Olver,R.E., and Kemp,P.J. 1994. hiloride-sensitive Na + channels

in fetd type II pneumocytes are regulated by G proteins. Am.J.PhysioL 267:Ll-L8.

180. Fyfe,G.K., Kemp,P.J., and Olver,R.E. 1997. Conduaive Na' transport in fetal lung

alveolar apical membrane vesicles is regulated by fatty acids and G proteins.

BiochimBiophysActa Mol. Cell Res. 13 55:33-42.

18 1. Firsov,D., Robert-Nicoud,M., Gruender,S., Schild,L., and Rossier,B.C. 1999.

Mutationd andysis of cysteine-rich domains of the epithelial sodium channel (ENaC):

Identification of cysteines essential for channel expression at the cell surface.

/. BioL Chem 2742743-2749.

182. ScheU,S. and Mendoza,C. 1997. Enzpmological considerations for a theoretical

description of the quantitative cornpetitive polymease chah reaction (QC-KR).

j. l%eor.Biol. 184:433-440.

ZuckermanJB., Chen,X., JacobsJD., Hu,B., Kleyman,T.R., and Smith,P.R. 1999.

Association of the epithelial sodium channel with Apx and a-spectrin in A6 rend

epithelial cells. 4 Biol. Chem. 274:23286-2329 5.

Qi J., Peten,K.W., Liu,C., WangJM., Edinger,R.S., Johnson J.P., Watkhs,S.C., and

FNzeU,R.A. 1999. Regdation of the amilonde-sensitive epithelial sodium channel by

syntaxin 1A. JBiol. Chm. 274~3034530348.

Saxena,S., Quiçk,M.W., Tousson,A., Oh,Y., and Wamock,D.G. 1999. Interaction of

syntaxins w ith the ami10 ride-sensitive e pidielid sodium c hannel. JBioZ. Chem.

274:2O8 12-208 17.

Masilamani,S., Kim,G.H., Mitchell,C., Wade,J.B., and Knepper,M.A. 1999.

Aldonerone-mediated regulation of ENaC a , P, and gamma nibunit proreins in rat

kidney. J. Clin.lnvest 104:R19-R23.

St0kesJ.B. and Sigmund,R.D. 1998. Regulation of rENaC mRNA by dietary NaCl

and neroids: organ, tissue, and steroid heterogeneity. Am.JPhyno1. 274:C1699-C1707.

Asher,C., Wald,H., Rossier,B.C., and Garty,H. 1996. Aldoaerone-induced increase in

the abundance of Na' channel mbunits. AmJPhysio~. 27l:C605-C6 11.

Venkatesh,V.C. and Kauberg,H.D. 1997. Glucocorticoid regulation of epithelial

sodium channel genes in human fetd lung. Am./. Physiol. t73:U2%LU3.

Dijkink,L., Hartog,A., Deen,P.M.T., Van Os,C.H., and Bindels,RJ.M. 1999. Tirne-

dependent regulation by aldosterone of the amiloride- sensitive Na' channel in rabbit

kidney. Wugers Arch. 438:3 54-360.

Denault,D.L., Fejes-T&th,G., and Nky-Fejes-T6th,A. 1996. Aldosterone regdation

sodium channel gamma-subunit mRNA in cortical collecting duct cells. ArnJPhysiol.

271:C423-C428.

192. Barker,P.M., Brown,MJ., Ramsden,C.A., Strang,L.B., and WaIten,D.V. 1988. The

effect of thyroideaomy in the fetal sheep on lung liquid reabsorption induced by

adrenaline or cyclic AMP. J Pbysiol. Lond 407:373-383.

193. Sayegh,R., Auerbach,SD., Lis . , Loh,R.W., Huaed,R.F., Stokes J.B., and

Thomas,C.P. 1999. Glucocorticoid induction of epithelial sodium channel expression in

lung and rend epithelia occurs via crans-activation of a hormone response element in

the 5'-flanking region of the human epithelial sodium channel a subunit gene.

/. BioL Chm. 274: 1243 1-12437.

194. Auerbach,S.D., Lofms,R.W., Itani,O.A., and Thoma5,C.P. 2000. Human amiloride-

sensitive epithelial Na+ channel gamma subunit promoter: funaional analysis and

identification of a polypurine-polypyrimidine tact with the potentid for triplex DNA

formation. ~ i o c h m J 347: 105-1 14.

195. Ausubel,F.M., Brent,R., Kingstoa,R.E., Moore,D.D., SeidmanJG., Smith,J.A., and

Struh1,K. 1995. Currem Protocols in Molecular Biology. John Wiley & Sons, Inc., New

York.

196. Samuels,H.H., Stanley,F., and CasanovaJ. 1979. Depletion of L-3,4,3'-triiodothyronine

and L-thyroxine in euthyroid calf semm for use in ce11 culture snidies of the action of

thyroid hormone. endo IOS:8O-85.

197. Kim,MX., Lesoon-Wood,LA., Weinrraub,B.D., and ChungJH. 1996. A soluble

transcription factor, Oct-1, is also found in the insoluble nuclear mavix and possesses

silencing activity in its alanine-rich do main. Mol GU. Biol. 16:43 664377.

19 8. Angelp., Imagawa,M., Chiu,R., Stein,B., Imbra,R.J., Rahmsdorf,H. J.. Jonat,C.,

HerrlichJ?., and K a . , M . 1987. Phorbol ester-induced genes contain a cornmon cis

element recognized by a TPA-rnoddated uans-acting factor. Cell49:729-739.