Prominin-1/CD1331 Lung Epithelial Progenitors Protect from Bleomycin-induced Pulmonary Fibrosis

Prominin-1/CD1331 Lung Epithelial ProgenitorsProtect from Bleomycin-induced Pulmonary Fibrosis

Davide Germano1,2, Przemyslaw Blyszczuk1,2, Alan Valaperti1, Gabriela Kania1,2, Stephan Dirnhofer3,Ulf Landmesser2,4, Thomas F. Luscher2,4, Lukas Hunziker1,5, Henryk Zulewski6, and Urs Eriksson1,2,4

1Experimental Critical Care Medicine, Department of Biomedicine, University of Basel, Basel, Switzerland; 2Cardiovascular Research,

Zurich Center for Integrative Human Physiology, University Zurich-Irchel, Zurich, Switzerland; 3Department of Pathology, University Hospital,

Basel, Switzerland; 4Department of Cardiology, University Hospital, Zurich, Switzerland; 5Department of Internal Medicine and 6Division ofEndocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel, Switzerland

Rationale: The mouse model of bleomycin-induced lung injury offersan approach to study idiopathic pulmonary fibrosis, a progressiveinterstitial lung disease with poor prognosis. Progenitor cell–basedtreatment strategies might combine antiinflammatory effects andthe capacity for tissue repair.Objectives: To expand progenitor cells with reparative and regener-ative capacities and to evaluate their protective effects on pulmo-nary fibrosis in vivo.Methods: Prominin-1/CD1331 epithelial progenitor cells (PEPs) wereexpanded from adult mouse lungs after digestion and culture ofdistal airways. Lung fibrosis was induced in C57Bl/6 mice by in-stillation of bleomycin. Two hours later, animals were transplantedwith PEPs. Inflammation and fibrosis were assessed by immunohis-tochemistry, bronchoalveolar lavage fluid differentials, and real-time polymerase chain reaction.Measurements and Main Results: PEPs expanded from mouse lungswere of bone marrow origin, coexpressed stem and hematopoieticcell markers, and differentiated in vitro into alveolar type II surfactantprotein-C1 epithelial cells. In bleomycin-challenged mice, intratra-cheally injectedPEPsengrafted into the lungsanddifferentiated intotype II pneumocytes. Furthermore, PEPs suppressed proinflamma-tory and profibrotic gene expression, prevented the recruitment ofinflammatory cells, and protected bleomycin-challenged mice frompulmonary fibrosis. Mechanistically, the protective effect dependedon upregulation of inducible nitric oxide synthase in PEPs and nitricoxide–mediated suppression of alveolar macrophage proliferation.Accordingly, PEPs from iNOS2/2 but not iNOS1/1 mice failed toprotect from bleomycin-induced lung injury.Conclusions: The combined antiinflammatory and regenerative ca-pacity of bone marrow–derived pulmonary epithelial progenitorsoffers a promising approach for development of cell-based thera-peutic strategies against pulmonary fibrosis.

Keywords: cell therapy; prominin-1; lung fibrosis; stem cells; inducible

nitric oxide synthase.

Inflammation-induced lung fibrosis represents a common finalpathway of various pulmonary disorders, such as the adultrespiratory distress syndrome or interstitial lung diseases. Idio-pathic pulmonary fibrosis (IPF) is an interstitial lung diseasewith a high mortality rate and very limited therapeutic options(1, 2). The etiology and pathogenesis of IPF are not completely

understood (2). Release of profibrotic cytokines and abnormalfibroblast proliferation contributes to tissue remodeling andprogressive lung fibrosis. Intratracheal instillation of bleomycin(BLM) triggers an IPF-like disease in mice (3). BLM instillationresults in oxidative damage to the DNA of the alveolar epi-thelium, promoting the recruitment and expansion of alveolarmacrophages (AMs), neutrophils, and lymphocytes. This in-flammatory process triggers fibroblast proliferation and re-sults in excessive collagen deposition progressing to pulmonaryfibrosis (4).

Cell-based therapies might become a promising tool for themodulation of inflammatory processes and regeneration ofdamaged tissues (5). The lung exhibits a complex architecturewith some regenerative capacity. Anatomically, the lung is di-vided in three main regions: proximal airways, distal airways,and alveolar space, which is composed of alveolar type I cells(.95%) and type II cells (,5%). The current view is that any ofthese regions contains a stem cell niche able to renew the localepithelial cell population after injury (6–10). Concerning thealveolar epithelium, type II pneumocytes are regarded as a stemcell–like population because of their capacity to proliferate anddifferentiate into type I cells after local injury (11). Unfortu-nately, type II pneumocytes are not sufficient to abrogate orprevent the progression of pulmonary disorders (12), suggestingthat an exogenous source is necessary.

Bone marrow shows high plasticity and is believed tocontribute to the homeostasis and repair of nonhematopoieticorgans (13, 14). Recent data suggest that bone marrow–derivedcells are involved in lung regeneration (15–17). Furthermore, itappears that the extent of tissue injury defines the capacity ofbone marrow–derived cells to regenerate the pulmonary epi-thelium (15, 16, 18–20).

Prominin-1/CD133 is a recognized marker of hematopoieticstem cells and committed progenitors (21, 22) and is also

AT A GLANCE COMMENTARY

Scientific Knowledge on the Subject

Lung injury activates tissue resident cells with regenerativecapacity. Such cells might become of interest for designingnovel cell-based therapies.

What This Study Adds to the Field

Prominin-11 epithelial progenitors (PEPs) with antiinflam-matory and regenerative capacity can be expanded fromhealthy mouse lungs. PEPs protect mice in a nitric oxide–dependent manner from bleomycin-induced pulmonaryfibrosis.

(Received in original form September 3, 2008; accepted in final form February 12, 2009)

Supported by grants from the Gebert Ruf Foundation and the Swiss National

Foundation. U.E. holds a Swiss National Foundation Professorship.

Correspondence and requests for reprints should be addressed to Davide

Germano, Ph.D., Department of Biomedicine, University Hospital, CH-4031

Basel, Switzerland. E-mail: [email protected]

This article has an online supplement, which is available from the issue’s table of

contents at www.atsjournals.org

Am J Respir Crit Care Med Vol 179. pp 939–949, 2009

Originally Published in Press as DOI: 10.1164/rccm.200809-1390OC on February 20, 2009

Internet address: www.atsjournals.org

expressed on adult epithelial cells (23, 24). Several lines ofevidence suggest that prominin-1/CD1331 progenitor cells mightbe beneficial for treatment of several pathological disorders,including leukemia and cardiac and hepatic malignancies (25–28).

Herein we describe the expansion of high numbers of bonemarrow–derived prominin-1/CD1331 epithelial progenitor cells(PEPs) from adult mouse lungs. These PEPs combined immu-nomodulatory and regenerative capacities and protected micefrom the development of BLM-induced pulmonary fibrosis ina nitric oxide (NO)–dependent manner.

MATERIALS AND METHODS

Mice

C57Bl/6 mice and C57Bl/6-green fluorescent protein (GFP) transgenicmice (GFP under the control of b-actin promoter) were purchased fromJackson Laboratory (Bar Harbor, ME) and housed in a specific patho-gen-free environment. Inducible nitric oxide synthase (iNOS)2/2 C57Bl/6 mice were kindly provided by Dr. Adrian J. Hobbs, Wolfson Institutefor Biomedical Research, University College London, London. Allanimal experiments were conducted in accordance with institutionalguidelines and Swiss federal law and were approved by the localauthorities.

Generation of Bone Marrow Chimera

Five- to 7-week-old C57Bl/6 mice were lethally irradiated with twodoses of 6.5 Gy using a Gammatron (Co-60) system and reconstitutedwith 2 3 107 donor bone marrow cells from C57Bl/6 GFP mice.

Bleomycin-Induced Lung Fibrosis

Seven- to 9-week-old male C57Bl/6 mice were anesthetized and intra-tracheally injected with 0.05 U/mouse of bleomycin (BLM) (Blenoxane,Axxora-Alexis, San Diego, CA) dissolved in 50 ml of sterile phosphatebuffered saline (PBS). Control animals received the same volume ofPBS. Two hours after PBS/BLM instillation, the animals receivedintratracheally either 2 3 105 PEPs resuspended in 50 ml of PBS orPBS alone.

Expansion of Prominin-11 Epithelial Progenitor Cells

Lungs of 7- to 9-week-old C57Bl/6 mice were perfused with 5 to 10 ml ofice-cold PBS, excised, separated from the trachea and the main bronchi,manually dissected into small pieces, and digested for 90 minutes at 378Cin 15 ml of GKN (11 mM D-glucose, 5.5 mM KCl, 137 mM NaCl, 25 mMNa2HPO4, 5.5 NaH2PO4�H2O) containing 10% fetal calf serum (FCS), 1.8mg/ml collagenase type 4, and 0.1 mg/ml DNase I. The cell suspensionwas filtered through 70-mm nylon mesh and washed with GKN containing10% FCS. Cells were resuspended in IMDM (Iscove’s Modified Dulbec-co’s Medium, Gibco, Grand Island, NY) containing 2% FCS, 100 mMb-mercaptoethanol (Gibco), 100 U of penicillin, and 100 mg of strepto-mycin/ml (Pen/Strep, Gibco), 2mM L-glutamine, 25 mM N-2-hydroxy-ethylpiperazine -N9-ethane sulfonic acid, and plated at 5 3 106 cellsinto 6-cm diameter tissue culture dishes. Culture of lung homogenatesgave rise to two main populations consisting of a round cell populationand a fibroblast-like cell population that worked as a feeder layer. Cellswere incubated at 378C in a humidified atmosphere containing 5% CO2.The medium was changed two to three times a week. Nonadherent cellswere removed 48 to 72 hours after plating. After 3 to 4 weeks cells wereremoved, washed, stained for 30 minutes at 48C with an anti–prominin-1-PE antibody (eBiosciences, San Diego, CA) (1:200) and isolated usinganti-PE antibodies coupled to magnetic beads (Miltenyi Biotec, BergischGladbach, Germany) (purity . 95%). For alveolar epithelial celldifferentiation, PEPs were cultured on 0.2% gelatin-coated cover slipsin the presence of modified Small Airway Growth Medium (SAGM) (29)consisting of a basal medium (Small Airway Basal Medium, Cambrex,East Rutherford, NJ) supplemented with 0.5 mg/ml bovine serumalbumin, 0.5% FCS, insulin/transferrin/selenium (ITS) supplement,30 mg/ml bovine pituitary extract, 0.5 mg/ml epinephrine, 6.5 ng/mltriiodothyronine, 0.1 ng/ml retinoic acid, 0.5 mg/ml hydrocortisone, and1 ng/ml epidermal growth factor (EGF).

Fluorescence-Activated Cell Sorting

Cells were filtered through 70-mm nylon mesh, stained for 30 minuteson ice with the appropriate antibodies, and analyzed on a CyAN ADP(Dako-Cytomation, Carpinteria, CA) using FlowJo 8.7.3 software(TreeStar, Ashland, OR). The following antibodies and dilutions wereused: Primary antibodies: anti–prominin-1-PE 1:200 (eBioscience),anti–CXCR4-FITC 1:200 (BD Bioscience, San Jose, CA), goat anti–Sca-1 1:100 (R&D Systems, Abingdon, UK), biotin anti–c-kit 1:200,biotin anti-CD34 1:200, biotin anti-CD45 1:200 (eBioscience). Second-ary antibodies: Alexa Fluor 488 donkey anti-goat IgG, 1:200 (MolecularProbes, Carlsbad, CA), and streptavidin-APC 1:200 (BD Bioscience).

Immunofluorescence. Cells were cultured on gelatin-coated coverslips and fixed with 4% paraformaldehyde in PBS for 20 minutes atroom temperature. After blockade of nonspecific binding with 10%FCS, cells were stained for 1 hour at 378C with the appropriateprimary and secondary antibodies. Prior to staining with collagen I,surfactant protein-C, and b-tubulin IV antibody, cells were washedwith 0.2% saponin. Frozen sections were first stained with appropri-ate antibodies and then fixed. The following primary antibodies wereused: anti–prominin-1-PE 1:200 (eBioscience), anti–CD45 FITC1:200 (BD Bioscience), rabbit polyclonal anti–surfactant protein-C1:400 (SP-C, Chemicon, Temecula, CA), rabbit anti-collagen I 1:400(Rockland, Gilbertsville, PA), and mouse anti–b-tubulin IV 1:400(Sigma, St. Louis, MO). The secondary antibodies Green-fluorescentAlexa Fluor 488 rabbit anti-GFP, Alexa Fluor 488 chicken anti-rabbit, and Alexa Fluor 488 goat anti-mouse (Molecular Probes) wereused at a 1:200 dilution.

Histology

Animals were killed on selected days after BLM instillation. Lungswere perfused, removed, fixed in 4% formaldehyde, and stained withhematoxylin and eosin and/or Masson’s trichrome stain to visualizecollagen depositions.

Bronchoalveolar Lavage

Mice were killed by intra-peritoneal Pentothal injections (Abbott,North Chicago, IL). The trachea was exposed and bronchoalveolarlavage fluid (BALF) was obtained by three instillations of 1 ml of ice-cold PBS. BALF was centrifuged, resuspended in 100 ml of PBS,cytospun onto slides, Diff-Quik stained (according to the manufac-turer’s protocol), and analyzed under a light microscope.

Blood Collection

Blood was collected via the inferior vena cava after opening the bodycavity. A 1-ml syringe containing EDTA was used to bleed the mice.Cells were separated from erythrocytes using Lympholyte-M (CedarlaneLaboratories Ltd, Hornby, Canada) according to the manufacturer’sinstructions.

Alveolar Macrophages Isolation

BALFs from several mice were pooled and centrifuged at 300 3 g for10 minutes. The resulting pellet was resuspended in RPMI-1640medium supplemented with 10% FCS and incubated for 1 hour atroom temperature on 10-cm diameter plastic dishes. Nonadherent cellswere washed off with PBS and the adherent macrophages werecollected.

Coculture Experiments

PEPs were purified using magnetic beads, irradiated (2,000 rad) andcultured in 96-well plates in the presence of alveolar macrophages ata ratio of 1:2. Cells were stimulated for 24 hours with LPS (0.1 mg/ml)and IFN-g (50 ng/ml). [3H]Thymidine incorporation was measured asa readout for proliferation. Nitrite (NO2

2) levels reflecting NO pro-duction in culture supernatants were assessed using the Griess ReagentSystem (Promega, Madison, WI).

Reverse Transcription and Real-Time Polymerase

Chain Reaction

RNA was isolated using Trizol (Invitrogen, Carlsbad, CA) from totallung tissue according to the manufacturer’s recommendations. First

940 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 179 2009

strand cDNA synthesis was performed as follows: RNA (2 mg) wasincubated with oligo(dT)18 for 5 minutes at 708C and chilled on ice.Reaction buffer (53) 10 mM 4dNTP mix, RNase inhibitors, andRevertAID M-MuLV Reverse Transcriptase (Fermentas, St. Leon-Rot, Germany) were added and the reaction mixture was incubated for60 minutes at 428C. For real-time polymerase chain reaction (RT-PCR)the following primers were used: AQP5 Fw 59-GGC CAC ATC AATCCA GCC ATT A-39, Rw 59-GGC TGG GTT CAT GGA ACAGCC-39; b-tubulin Fw 59-GGA ACA TAG CCG TAA ACT GC-39,Rw 59-TCT ACT GTG CCT GAA CTT ACC-39; CC10 Fw 59-CGCCAT CAC AAT CAC TGT GGT CA-39, Rw 59-GAG GGT ATCCAC CAG TCT CTT CA-39; E-cadherin Fw 59-ACG TAT CAG GGTCAA GTG CC-39, Rw 59-CCT GAC CCA CAC CAA AGT CT-39;Islet-1 Fw 59-GTT TGT ACG GGA TCA AAT GC-39, Rw 59-ATGCTG CGT TTC TTG TCC TT-39; Keratin 5 Fw 59-ACC CTT GTTCCA CGG AAT GCA A-39, Rw 59-AAA GCA CAG TTA AGACCA GAA AC-39; Nanog Fw 59-AGG GTC TGC TAC TGA GATGCT CTG CA-39, Rw 59-CAA CCA CTG GTT TTT CTG CCA CCG-39; Oct4 Fw 59-GTG GAT TCT CGA ACC TGG CT-39, Rw 59-GTCTCC AGA CTC CAC CTC AC-39; SP-C Fw 59-TAT GAC TAC CAGCGG CTC CT-39, Rw 59-GTT TCT ACC GAC CCT GTG GA-39. Theprimers used for quantitative RT-PCR are listed in Table 1. RT-PCRwas performed using a 7,500 Fast RT-PCR System (Applied Biosystems,Foster City, CA) in the presence of SYBR-green (Applied Biosystems);glyceraldehyde-3-phosphate dehydrogenase was used as internal con-trol. Amplification conditions were as follows: 508C (2 min); 958C (10min); 958C (15 s), 608C (1 min), 40 repetitions. Specificity of eachreaction was ascertained by performing the Melt procedure (60–958C;18C/15 s) after completion of the amplification protocol, according tothe manufacturer’s instructions. Relative gene expression was ana-lyzed using the 22DDCt method.

Statistics

Normally distributed data, such as proliferation responses and cytokinelevels, were compared using the Student t test. Statistical analysis wasconducted using Prism 4 software (GraphPad Software). P , 0.05 wasconsidered to be statistically significant.

RESULTS

Expansion of Prominin-11 Epithelial Progenitor Cells

Several lines of evidence suggest that activation of tissueresident progenitor cells represents an injury-triggered process(9, 10). Thus, we hypothesized that dissection of pulmonarytissue creates a specific ‘‘injured’’ microenvironment that canpromote the expansion of progenitor cells with a lung-specific

differentiation capacity. In fact, the culture of lung homoge-nates gave rise to a population of small, round, semi-attachedcells, growing on a feeder layer (Figures 1A and 1B). FACSanalysis revealed that the vast majority of these round cellsexpressed prominin-1, stem cell antigen (Sca-1) (Figure 1E), c-kit (CD117) (Figure 1F), chemokine receptor type 4 (CXCR4)(Figure 1G), as well as the hematopoietic antigen CD45 (Figure1H), but not CD34 (Figure 1I). PEPs were then purified by cellsorting and further analyzed. RT-PCR revealed that PEPs werenegative for bronchial (Clara Cell 10-kd protein, CC10),alveolar type I (aquaporin-5, AQP5), alveolar type II (surfac-tant protein-C, SP-C), and epithelial (E-cadherin and keratin 5,K5) genes, but expressed genes characteristic for stem andprogenitor cells (Islet-1, Nanog, but not Oct4) (Figure 1D). Ofnote, sorted prominin-11/GFP1 cells do not grow on feederlayers from other organs or on embryonic fibroblasts (i.e., 3T3cells) (see Figure E1 in the online supplement).

All prominin-11 cells coexpressed hematopoietic markers.To confirm the bone marrow origin of these cells, mice werelethally irradiated and reconstituted with bone marrow cellsfrom GFP1 transgenic mice. Three weeks after bone marrowtransplantation, we dissected lung tissues and expandedprominin-11 lung-derived progenitors as described. As illus-trated in Figure 1C, nearly all prominin-11 cells were GFPpositive (Figure 1C), indicating clearly that PEPs are of bonemarrow origin.

Prominin-11 Epithelial Progenitor Cells Differentiate into

Alveolar Type II Epithelial Cells

We next addressed the potential of prominin-11 progenitors todifferentiate into an epithelial phenotype. To induce alveolarepithelial differentiation, sorted PEPs were cultured for 2 weeksin modified SAGM (29). Immunofluorescence microscopyshowed that PEPs acquired the expression of surfactant pro-tein-C (SP-C) (Figure 2B), which is specific for pulmonary typeII cells, but lose the expression of prominin-1 (Figure E2). RT-PCR confirmed the expression of SP-C, but not of CC10 andAQP5, which are characteristic for bronchial and alveolar type Iepithelial cells, respectively (Figure 2D). GFP1 PEPs expandedfrom lungs of chimeric mice exhibited a similar capacity todifferentiate into type II epithelial cells in vitro (Figure 2C).

To address the differentiation capacity of PEPs in vivo,sorted prominin-11/GFP1 cells were intratracheally delivered

TABLE 1. PRIMERS USED IN REAL-TIME POLYMERASE CHAIN REACTION

Gene Product Forward Primer Reverse Primer

GAPDH CCTGCACCACCAACTGCTTA TCATGAGCCCTTCCACCATG

iNOS CAGCTGGGCTGTACAAACCTT TGAATGTGATGTTTGCTTCGG

IL-4 ACAGGAGAAGGGACGCCAT GAAGCCCTACAGACGAGCTCA

IL-6 TGTATGAACAACGATGATGCACTT GGTACTCCAGAAGACCAGAGGAAAT

IL-13 CGCAAGGCCCCCACTAC AAAGTGGGCTACTTCGATTTTGG

IFN-g TGGAGGAACTGGCAAAAGGAT GCCTGATTGTCTTTCAAGACTTCAA

TNF-a CCCAGACCCTCACACTCAGATC CCTCCACTTGGTTTGCT

CCL2 CATCACTGAAGCCAGCTCTCTCT GCAGGCCCAGAAGCATGA

MIP-1a TTTTGAAACCAGCAGCCTTTG TCTTTGGAGTCAGCGCAGATC

MCP-5 AGAATCACAAGCAGCCAGTGTC GTCAGCACAGATCTCCTTATCCAGT

TGF-b1 CAACGCCATCTATGAGAAAACC AAGCCCTGTATTCCGTCTCC

Fibronectin TACCAAGGTCAATCCACACCCC CAGATGGCAAAAGAAAGCAGAGG

Col-I GATGACGTGCAATGCAATGAA CCCTCGACTCCTACATCTTCTGA

SDF-1a CGTGAGGCCAGGGAAGAG TGATGAGCATGGTGGGTTGA

CCL21/SLC GGCAAAGAGGGAGCTAGAAAACA TGGACGGAGGCCAGCAT

MMP-9 CCTGGAACTCACACGACATCTTC TGGAAACTCACACGCCAGAA

KC/CXCL1 TGCACCCAAACCGAAGTCAT GGAGCTTCAGGGTCAAGGC

Definition of abbreviations: CCL 5 CC chemokine ligand; GAPDH 5 glyceraldehyde 3 phosphate dehydrogenase; iNOS 5

inducible nitric oxide synthase; KC/CXCL 5 keratinocyte-derived chemokine/chemokine (C-X-C motif) Ligand; MCP 5 macro-

phage chemoattractant protein; MIP 5 macrophage inflammatory protein; MMP 5 matrix metalloproteinase; SDF 5 stromal

cell-derived factor; TGF 5 transforming growth factor; TNF 5 tumor necrosis factor.

Germano, Blyszczuk, Valaperti, et al.: CD1331 Cells Prevent Lung Fibrosis 941

into C57Bl/6 mice after BLM instillation. At Day 1 afterdelivery, GFP1 cells were detected in the alveolar walls onlyand were negative for SP-C (Figures 2E22G). In contrast, 7days after delivery most GFP1 cells expressed SP-C (Figures2H–2J). GFP1/SP-C1 cells corresponded to 1.71 6 0.43% outof the total amount of SP-C1 cells. Importantly, GFP1 cells didnot engraft into the alveolar epithelium of unchallenged animals(data not shown).

Taken together, these findings clearly demonstrate that PEPshave the capacity to differentiate into type II pneumocytesin vitro and in vivo.

Identification of Two Distinct Prominin-11 Cell Populations in

the Adult Mouse Lung

We next addressed the presence of prominin-11 cells within thehealthy mouse lung. Distal airways were isolated from adult

Figure 2. Prominin-11 epi-

thelial progenitors (PEPs) dif-

ferentiate into alveolar type IIepithelial cells in vitro and

in vivo. (A) Phase contrast

micrograph of prominin-11

cells incubated for 2 weeksin Small Airway Growth Me-

dium, and (B) stained for sur-

factant protein-C (SP-C, red).

(C) In vitro differentiation ofprominin-11/green fluores-

cent protein (GFP)1 cells ex-

panded from chimeric lungs.(D) Real-timepolymerasechain

reaction confirmed expres-

sion of surfactant protein-C

(SP-C) type II cell-specificgene, but no other lung

epithelial genes. (E–J) Intra-

tracheal injection of GFP1

PEPs. (E–G) GFP1 cells weredetected only in alveolar walls

after 1 day, and (H–J) differ-

entiated into SP-C–positivetype II alveolar epithelial cells

after 7 days. SP-C (red),

GFP (green), 49,6-diamidino-

2-phenylindole (DAPI, blue).Bars 5 30 mm.

Figure 1. Characterization of prominin-11 epithelial progenitors (PEPs). (A) Passage 0 cultures exhibit a rounded, semi-adherent cell populationgrowing on feeder layer cells. (B) Immunohistochemistry showed that all round cells were positive for prominin-1 (red). 49,6-diamidino-2-

phenylindole (DAPI, blue) was used to visualize cell nuclei. (C) Culture of cells expanded from green fluorescent protein (GFP) chimeric lung

demonstrated that nearly all prominin-11 cells were GFP positive. Bars 5 30 mm. (D) Real-time polymerase chain reaction showed no expression of

lung epithelial markers (CC10, surfactant protien-C, AQP5, keratin-5, E-cadherin); in contrast, expression of genes characteristic for stem andprogenitor cells (Islet-1, Nanog) was detected. cDNA from mouse embryonic stem cells was used as positive control in the right panel. (E–I)

Fluorescence Activated Cell Sorting analysis of cell cultures. (E) Prominin-11 cells coexpressed with Sca-1, (F) c-kit, (G) CXCR4, and (H) CD45, (I) but

not CD34.


mice and digested as described. FACS analysis revealed that thepercentage of prominin-11 cells correspond to 10.41 6 0.98%(Figure 3B); prominin-11 cells were then stained for CD45antibody. Analysis of samples showed that among the prominin-11 subset, 6.82 6 0.31% were coexpressing CD45 (Figure 3C).Collectively, the percentage of prominin-11/CD451 cells in theadult mouse lungs corresponds to 0.71 6 0.08%. In addition,staining of frozen sections confirmed the presence of twodifferent cell phenotypes in the adult lung. In fact, rare, singleround prominin-11 cells were detected in the alveolar epithe-

lium (Figure 3D, asterisk), differently located from prominin-11

cells sited along the bronchial epithelium (Figure 3D, arrows)(see Figure E3 for negative control).

Next, we performed further stains on frozen sections tocharacterize the two prominin-1–expressing populations. Asshown, round prominin-11 cells were detectable only in thealveolar epithelium, but they were all negative for type II–specific marker SP-C (Figures 3E–3G) and for type I markerAQP5 (data not shown). In addition they were all coexpressingCD45 (Figures 3H–3J). The second subset of prominin-11 cells

Figure 3. Characterization of prominin-11 cells in mouse lungs. (A–D) Fluorescence Activated Cell Sorting analysis of adult mouse lungs. (B)Prominin-11 cells were gated and (C) stained for CD45. The percentage of prominin-11/CD451 cells within lungs corresponded to 0.71 6 0.08

(n 5 3). (FL1 5 unstained; Iso 5 isotype control). (D) Immunohistochemistry on frozen sections confirmed the presence of two prominin-11 distinct

cell phenotypes located in the bronchial epithelium (white arrows) and alveolar epithelium (asterisk). (E–G) Prominin-11 cells located in the alveolar

epithelium were negative for surfactant protein-C (SP-C), (H–J) but were all coexpressing CD45. (K) Prominin-1 was also expressed on the apicalsurface of bronchial epithelial cells (H–I) coexpressing b-tubulin IV. Prominin-1 (red), SP-C (green, F, G), CD45 (green, I, J), b-tubulin IV (green, L, M),

49,6-diamidino-2-phenylindole (DAPI, blue). Bars 5 20 mm.


was found in the bronchial epithelium and the expression wasrestricted on the apical surface (Figure 3K). As shown inFigures 3L–3M, these cells were all coexpressing b-tubulin IV,which stains for cilia and is specifically expressed on bronchialepithelial cells.

To confirm that epithelial progenitor cells specifically ex-panded from the hematopoietic prominin-11 population, wesorted ex vivo prominin-11/GFP1 cells from chimeric mice andcultured them on a lung tissue–derived feeder layer. Up to 10GFP1 cells were cultured with 5 3 105 feeder layer cells(Figures 4A–4C). Single prominin-11/GFP1 cells expandedand gave rise to colonies (Figure 4D). Transfer of prominin-11/GFP1 cells into SAGM resulted in their differentiation intotype II alveolar epithelial-like cells expressing SP-C (Figures4E–4G). Prominin-11/GFP1 cells sorted from blood did notexpand and did not give rise to colonies (Figure E4).

Prominin-11 Epithelial Progenitor Cells Protect from

Bleomycin-induced Pulmonary Fibrosis

At Day 7 after intrapulmonary delivery of GFP1 PEPs intoBLM-challenged mice (Figures 2E–2K), alterations in thealveolar epithelial architecture, typically affected after BLMtreatment, were not evident. Given this observation, we set outto specifically address the reparative and protective capacity ofPEPs in the BLM model. Figures 5A, 5D, and 5G illustrate thearchitecture of the alveolar epithelium in unchallenged, PBS-injected mice (control). In BLM-challenged mice intratra-cheally injected with PBS the alveolar epithelium was massivelydamaged with extensive collagen deposition and progressivefibrosis (Figures 5B, 5E, 5H). In contrast, intratracheal deliveryof PEPs to BLM-challenged mice resulted in the preservation ofan almost completely normal architecture of the alveolarepithelium for up to at least 21 days (Figures 5C, 5F, 5I).Administration of PEPs into BLM-challenged mice also pro-tected from progressive loss of body weight (Figure 5J).

Importantly, whereas BALF samples taken at Days 3 and 7from BLM-treated control mice injected with PBS only hadincreased numbers of total cells, samples taken from BLM-challenged mice injected with PEPs did not (Figure 5K andTable 2). RT-PCR analysis of Day 7 lung samples from PEP-treated mice showed no upregulation of IL-4, IL-6, IL-13, andTNF-a, nor of the chemokines KC, CCL2, MIP-1a, and MCP-5mediating inflammatory cell recruitment (30, 31) (Figure 5L).Profibrotic genes, such as TGF-b1, and genes of cytokines

mediating fibrocytes recruitment, such as SDF-1a or CCL21(32, 33), were also not upregulated in PEP-treated animals atDay 21 (Figure 5M). Accordingly, FACS analysis on bloodsamples revealed that the number of circulating fibrocytes(CD451/Col I1/CXCR41) did not increase in mice that hadreceived PEPs (Figure E5).

Similarly, mice that received bleomycin intraperitoneallyfollowed by intratracheal injections of PEPs, showed markedlyless fibrosis and displayed significant reduction of the collagencontent in the lung. Control mice treated with PBS on the otherhand developed significantly more lesions and showed highercollagen deposition and more thickened epithelium (FigureE6).

Taken together, these results indicate that intratrachealadministration of PEPs specifically prevents the recruitmentof inflammatory cells, abnormal extracellular matrix remodel-ing, and pulmonary fibrosis in BLM-challenged mice.

Prominin-11 Epithelial Progenitor Cells Suppress Alveolar

Macrophage Proliferation

To specifically address the mechanism whereby PEPs mediatesuppression of BLM-induced fibrosis, we focused on the earlystages of disease development in this injury model. We com-pared the expression of various pro- and antiinflammatorygenes in Day 1 lungs of control PBS-treated mice, and BLM-challenged mice treated or not with PEPs (Figure 6A). Lungs ofPEPs-treated mice did not show an upregulation of IL-4 and IL-13. Importantly, lungs of PEPs-treated mice also did not displayupregulation of KC/CXCL1 and CCL2, chemokines mainlyproduced by macrophages, which are considered as key playersfor the onset of pulmonary fibrosis in the BLM-induced injurymodel (31). However, BLM-challenged mice injected withPEPs showed significant upregulation of iNOS (Figure 6A).Current evidence suggests a regulatory effect of NO in manycell types (34–37) and a protective role in various lung diseasemodels (38–40). To clarify whether PEPs or AMs were majorNO producers, and to specifically assess effects of PEPs on theproliferation of AMs, we performed coculture experiments. Asillustrated in Figure 6B, the proliferation of AMs was dramat-ically reduced when cultured in the presence of PEPs. PEPs-induced suppression of AM proliferation required cell-to-cellcontact between AMs and PEPs (Figure 6D). Compared withindividual cultures of AMs or PEPs, NO release was markedlyincreased in the supernatant of AM and PEPs cocultures

Figure 4. (A–C) Prominin-11/GFP1 cells sorted from

chimeric mice were plated

with 5 3 105 feeder layer

cells (D) and expanded.(E–G) After expansion,

green fluorescent protein

(GFP)1 cells were incu-

bated for 2 weeks in thepresence of Small Airway

Growth Medium and dif-

ferentiated into surfactantprotein-C (SP-C)–positive

cells. SP-C (red), GFP

(green), 49,6-diamidino-2-

phenylindole (DAPI, blue).Bars 5 30 mm.


(Figure 6C). To evaluate the role of NO in growth arrest, wefirst assessed proliferation responses in the presence of thenonspecific NO synthase inhibitor L-NAME. As shown inFigure 6E, addition of L-NAME neutralized the effect of PEPsand restored AM proliferation capacity. We next expandedPEPs from iNOS-deficient mice and cocultured them with AMs.iNOS2/2 PEPs did not suppress the proliferation of AMsin vitro (Figure 6B). NO levels increased only in cocultures ofAMs with iNOS1/1, but not iNOS2/2 PEPs (Figure 6C),confirming that NO was produced specifically by PEPs. It isnoteworthy that NO production did not differ between irradi-ated and nonirradiated PEPs (data not shown). Taken together,our findings suggest that PEPs directly inhibit the proliferationof AMs, which are critical for disease development in the BLM-induced lung injury model (31). In addition, our in vitro dataargue for a critical role of NO in regulation of AM proliferation.

Nitric Oxide Mediates the Protective Effects of Prominin-11

Epithelial Progenitor Cells

To address the role of iNOS and NO in the PEPs-mediatedsuppression of BLM-induced lung injury in vivo, we injected BLM-challenged mice with either iNOS1/1 or iNOS2/2 prominin-11

cells. BALF was collected at Day 7. The number of total cells inBALF from mice injected with iNOS1/1 PEPs was comparableto the BALF of mice challenged with PBS only (Figure 7A).However, BALF from BLM-challenged mice injected withiNOS2/2 PEPs contained a markedly increased number of totalcells. Hematoxylin and eosin and Masson’s Trichrome staining oflung sections from iNOS2/2 PEPs-treated animals revealed thepresence of inflammatory foci and collagen deposition (Figures 7E,7I, 7M), comparable to that in lungs from BLM-challenged mice(Figures 7C, 7G, 7K). Importantly, mice that received other NO-producing cells, such as bone marrow–derived macrophages orbone marrow–derived dendritic cells, were not protected frompulmonary fibrosis (Figure E7).

In conclusion, bone marrow–derived PEPs expanded frommouse lungs possess regenerative capacity and striking antiin-flammatory properties, and protect BLM-treated mice frompulmonary fibrosis in an NO-dependent manner.

DISCUSSION

This study has identified a population of prominin-1/CD1331

bone marrow–derived epithelial progenitors with antiinflamma-

Figure 5. Effect of prominin-11 epithelial progenitors (PEPs) injection on bleomycin (BLM)-induced lung fibrosis in mice. Hematoxylin and eosin(H&E)–stained histopathological sections from lungs of C57Bl/6 mice 21 days after either (A, D) saline exposure, (B, E) BLM exposure, or (C, F) BLM

exposure and PEPs. (G, H, I) Masson’s Trichrome staining of lung sections from the same experimental groups. Original magnification: 325 (H&E)

and 3200 (H&E and Trichrome). Data are representative of at least five mice per condition. ( J) Body weight measurement from the same groups. (K)The number of total cells in bronchoalveolar lavage fluid of the three groups at Day 3 and Day 7. (L) Quantitative real-time polymerase chain

reaction on lungs collected at the peak of inflammation (Day 7) and (M) at the fibrotic stage (Day 21) after BLM instillation; the panels summarize

the quantitative results after normalization to the glyceraldehyde-3-phosphate dehydrogenase signal. Bars represent mean 6 SD (n 5 3).


tory properties and regenerative capacity from adult mouselungs.

In support of the hypothesis that lung injury exceedinga certain threshold is necessary to activate stem/progenitor cellexpansion, we found that dissection of pulmonary tissue re-sulted in the expansion of a small, round, undifferentiated pop-ulation of prominin-11 cells growing on a feeder layer. Recentstudies have shown the presence of stem cell populations withinlungs (9, 41). Our sorted prominin-11/CD451 cells were nega-tive for SP-C and CC10. Accordingly, they represent a distinctsubset from bronchioalveolar stem cells (9). Furthermore, ourPEPs were of hematopoietic origin and clearly expressed a phe-notype different from the bronchioalveolar stem cells and lungside population mesenchymal stem cells described by Summerand colleagues (41).

We have demonstrated that the healthy mouse lungs dis-played two distinct prominin-11 cell phenotypes. We identifiedfor the first time the presence of a population of prominin-11/CD451 cells within the adult mouse lung. On the other hand,the majority of prominin-11 cells belonged to the bronchialepithelial ciliated population. Prominin-1/CD133 expression hasbeen already found on different adult epithelial cells (22). Ourfindings are consistent with recent work of Shmelkov and

collaborators (24) demonstrating the presence of prominin-11

cells along the bronchial epithelium. Notably, prominin-11/GFP1 cells sorted from chimeric lungs expanded only in thepresence of a feeder layer from GFP-negative cultures, but notin presence of other feeder layers including embryonic fibro-blasts. This observation suggests that expansion of bone mar-row–derived PEPs is specifically triggered by lung-derived cells.On the other hand, it was not possible to expand in vitroprominin-11 cells isolated from mouse blood under the sameconditions. These records clearly exclude that PEPs expandedfrom lungs could represent a residual of blood cells.

PEPs differentiated in vitro into type II epithelial cells.Based on their expression of type II alveolar specific gene SP-C, but not bronchial epithelial CC10, PEPs may representa specific early committed alveolar progenitor population. Insupport of this notion, intratracheal injection of PEPs in BLM-challenged mice resulted in straight differentiation toward a typeII epithelial phenotype. These data underscore the strikingregenerative potential of PEPs in vivo. It is significant thatPEPs engrafted into the alveolar walls of the lungs of BLM-challenged animals only. These findings support the view thattissue injury is necessary to create a specific microenvironmentthat promotes engraftment and subsequent differentiation of

TABLE 2. ANALYSIS OF BRONCHOALVEOLAR LAVAGE CELL DIFFERENTIALS

Parameter

PBS Day 3

(n 5 3)

BLM Day 3

(n 5 3)

BLM 1 PEPs Day 3

(n 5 3)

PBS Day 7

(n 5 3)

BLM Day 7

(n 5 3)

BLM 1 PEPs Day 7

(n 5 3)

Total (3106) 0.251 6 0.036 0.630 6 0.144 0.261 6 0.067 0.270 6 0.040 1.145 6 0.163 0.343 6 0.005

Neutrophils 0.002 6 0.002 0.278 6 0.083 0.006 6 0.003 0.003 6 0.002 0.450 6 0.147 0.011 6 0.008

Lymphocytes 0.004 6 0.003 0.076 6 0.028 0.007 6 0.002 0.005 6 0.001 0.177 6 0.036 0.027 6 0.007

Macrophages 0.245 6 0.034 0.276 6 0.035 0.248 6 0.050 0.262 6 0.039 0.518 6 0.009 0.305 6 0.042

Definition of abbreviations: BLM 5 bleomycin; PBS 5 phosphate buffered saline; PEP 5 prominin-11 epithelial progenitor.

Data represent mean 6 SD.

Figure 6. (A) Real-time polymerase chain reaction performed on lungs of mice challenged with phosphate-buffered saline (PBS), bleomycin (BLM)

alone, or BLM 1 prominin-11 epithelial progenitors (PEPs). (B) Proliferation of alveolar macrophages (AMs) is suppressed in the presence ofinducible nitric oxide synthase (iNOS)1/1 PEPs but not in the presence of iNOS2/2 PEPs. (C) Nitrite levels reflecting NO production in culture

supernatants increase when AMs are cultured in the presence of iNOS1/1 PEPs but not in the presence of iNOS2/2 PEPs. (D) The suppressive effects

of PEPs require close contact to AMs. (E) Inclusion of the NOS inhibitor L-NAME, but not its inactive enantiomer D-NAME, restores proliferation

of AMs in the presence of PEPs. [3H]-Thymidine incorporation was measured as the readout for proliferation. Bars represent mean 6 SD (n 5 3).*P , 0.01.


PEPs. Our data are consistent with other studies that havedemonstrated the occurrence of tissue-specific differentiation ofengrafted bone marrow cells only in challenged animals(17, 19).

Accumulating evidence supports a beneficial role of admin-istered stem or precursor cells in several injury models (5, 28,42–45). Here we have demonstrated that intratracheal injectionof PEPs in the BLM-injury model resulted in complete pro-tection from pulmonary fibrosis. Other studies have shown thatinjection of bone marrow–derived stem cells can ameliorateBLM-induced lung fibrosis (18, 19). In line with these studies, wefound that beneficial effects occur only when PEPs are injectedduring the early phases after BLM instillation. Intrapulmonarydelivery of mesenchymal stem cells has been shown to attenuatethe effects of pulmonary injury in different animal models whenadministered at early stages (46, 47), indicating that stem cells ofhematopoietic and mesenchymal origin share similar immuno-logical properties. It remains to be established whether bonemarrow–derived stem cells might exert a similar protectivepotential in reverting BLM-induced effects at the late stagesof fibrosis. In the presence of profibrotic cytokines and massivedamage to the whole alveolar epithelium, a higher number ofcells might be required to exert an adequate response.

Our study also demonstrates that PEPs exerted an antiin-flammatory effect in vivo and suppressed AM proliferationin vitro. Baran and colleagues (31) have shown that the presenceof macrophages is crucial for development of BLM-inducedfibrosis. The fundamental role of AM in the context of lunginjury has been similarly noted in other studies (48, 49). Wefound that injection of PEPs suppressed the production ofcytokines secreted by macrophages, such as KC/CXCL1, whichmight explain the lack of neutrophils recruitment to the lungs ofPEPs-treated BLM-challenged mice. In addition, no upregula-tion of SDF-1a was found in lungs of the PEPs-treated mice.Lack of SDF-1a upregulation, as well as CCL21, might impairrecruitment of circulating fibrocytes (33) and bone marrow–derived fibroblasts to injured lung (32).

The suppressive effect of PEPs-treatment on AM prolifera-tion was mediated by NO production. In vitro, AM growthsuppression was restored in presence of NO inhibitor L-NAME.In accordance with this finding, PEPs expanded from iNOS2/2

mice could not suppress AM proliferation in vitro and failed toprotect from BLM-induced injury in vivo. Interestingly, ourdata show that whereas normally cultured PEPs could notsecrete NO, they did so when stimulated with LPS and IFN-g.This would suggest that a specific environment (e.g., inflamma-tory) is necessary for PEPs to exert their NO-based immuno-modulatory effect. Of note, the administration of NO-producingcells, such as bone marrow–derived macrophages and bonemarrow–derived dendritic cells, did not exert any protectiveeffect, therefore emphasizing the specific role of prominin-11

cells. We can only speculate whether NO-producing cells otherthan the prominin-11 cells secrete proinflammatory factors thatin turn compensate the potential beneficial effects of NO release.Likewise, a recent study has shown that bone marrow–derivedprominin-1/CD1331 cardiac progenitors protect from autoim-mune myocarditis in mice through an NO-mediated mechanism(28). Moreover, our data are consistent with the reportedbenefits of NO inhalation in other lung injury models (40),confirming that low concentrations of NO exert a protectiveeffect, despite the evidence that iNOS2/2 mice are protectedfrom BLM-induced fibrosis (50). Collectively, these findingsstrongly support that NO-dependent mechanisms play a criticalrole in PEPs protection from BLM-induced pulmonary fibrosis.Although BLM may damage structural cells of the lungsdirectly, its principal mode of action in leading to IPF-likepathology seems to be via endogenous mediators of inflamma-tion, fibrinolysis, and proliferation. Thus, the development ofpulmonary fibrosis represents a well-orchestrated process in-volving different cells at many active sites/interfaces. Asidefrom AM, other cells, such as T cells, neutrophils, and naturalkiller cells, for example, may also contribute to the pathogenesisof IPF. Therefore, nitric oxide may not only affect AM but mayalso influence the pathogenic process in other ways.

Figure 7. (A) Intratracheal injection of inducible nitric oxide synthase (iNOS)2/2 PEPs does not protect from bleomycin (BLM)–induced pulmonaryfibrosis. The total cell number in bronchoalveolar lavage fluid (BALF) is comparable in mice injected with BLM alone and BLM 1 iNOS2/2 PEPs. The

total number of cells is similar in BALF from mice exposed to saline buffer or BLM 1 iNOS1/1 PEPs. *P , 0.01. Bars represent mean 6 SD (n 5 3).

Lungs were harvested, sectioned, and stained with (B–I) hematoxylin and eosin (H&E) or ( J–M) Masson’s trichrome. Photomicrographs arerepresentative of at least five mice per condition. Original magnification: 325 (H&E) and 3200 (H&E and Trichrome).


PEPs represent a population of prominin-11 bone marrow–derived cells. Prominin-11cells are also found in blood and bonemarrow of healthy animals, but do not share analogous regener-ative and immunomodulatory properties with PEPs (unpublisheddata). We believe that either the specific microenvironmentcreated by disintegration of whole pulmonary tissue or inflam-matory processes are critical for the activation and expansion ofimmunomodulatory and regenerative PEPs. Appropriate adapta-tion and optimization of culture conditions for blood- or bonemarrow–derived cells might enable isolation and expansion ofvast numbers of immunomodulatory/regenerative cells from theperipheral circulation as well. This would be a further step towardan innovative treatment strategy against inflammatory pulmonarydiseases.

In conclusion, we have been successful in the expansion ofa bone marrow–derived epithelial progenitor population from adultmurine lungs with immunosuppressive and regenerative capacities.Our study represents an important step toward the development ofnovel cell-based therapies not only for IPF but also for otherpulmonary disorders, such as acute respiratory distress syndrome,asthma, chronic obstructive pulmonary disease, or sepsis.

Conflict of Interest Statement: None of the authors has a financial relationshipwith a commercial entity that has an interest in the subject of this manuscript.

Acknowledgment: The authors thank Dr. Adrian J. Hobbs for providing C57Bl/6iNOS2/2 mice, Prof. Alex N. Eberle for providing 3T3-L1 cells, Heidi Bodmer andMarta Bachmann for technical assistance, Prof. Therese J. Resink for criticalreading, and Verena Jaggin and Emmanuel Traunecker for cell-sorting.

References

1. Verma S, Slutsky AS. Idiopathic pulmonary fibrosis—new insights.N Engl J Med 2007;356:1370–1372.

2. Perez A, Rogers RM, Dauber JH. The prognosis of idiopathic pulmo-nary fibrosis. Am J Respir Cell Mol Biol 2003;29:S19–S26.

3. Bowden DH. Unraveling pulmonary fibrosis: the bleomycin model. LabInvest 1984;50:487–488.

4. Hay J, Shahzeidi S, Laurent G. Mechanisms of bleomycin-induced lungdamage. Arch Toxicol 1991;65:81–94.

5. Mimeault M, Batra SK. Recent progress on tissue-resident adult stemcell biology and their therapeutic implications. Stem Cell Rev 2008;4:27–49.

6. Otto WR. Lung epithelial stem cells. J Pathol 2002;197:527–535.7. Borthwick DW, Shahbazian M, Krantz QT, Dorin JR, Randell SH.

Evidence for stem-cell niches in the tracheal epithelium. Am J RespirCell Mol Biol 2001;24:662–670.

8. Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbora unique airway stem cell population that localizes to the bronchoal-veolar duct junction. Am J Pathol 2002;161:173–182.

9. Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S,Crowley D, Bronson RT, Jacks T. Identification of bronchioalveolarstem cells in normal lung and lung cancer. Cell 2005;121:823–835.

10. Park KS, Wells JM, Zorn AM, Wert SE, Laubach VE, Fernandez LG,Whitsett JA. Transdifferentiation of ciliated cells during repair of therespiratory epithelium. Am J Respir Cell Mol Biol 2006;34:151–157.

11. Mason RJ, Williams MC. Type II alveolar cell. Defender of the alveolus.Am Rev Respir Dis 1977;115:81–91.

12. Bishop AE. Pulmonary epithelial stem cells. Cell Prolif 2004;37:89–96.13. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-

Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, et al.Pluripotency of mesenchymal stem cells derived from adult marrow.Nature 2002;418:41–49.

14. Okamoto R, Yajima T, Yamazaki M, Kanai T, Mukai M, Okamoto S,Ikeda Y, Hibi T, Inazawa J, Watanabe M. Damaged epitheliaregenerated by bone marrow-derived cells in the human gastrointes-tinal tract. Nat Med 2002;8:1011–1017.

15. Herzog EL, Van Arnam J, Hu B, Krause DS. Threshold of lung injuryrequired for the appearance of marrow-derived lung epithelia. StemCells 2006;24:1986–1992.

16. Theise ND, Henegariu O, Grove J, Jagirdar J, Kao PN, Crawford JM,Badve S, Saxena R, Krause DS. Radiation pneumonitis in mice:a severe injury model for pneumocyte engraftment from bonemarrow. Exp Hematol 2002;30:1333–1338.

17. Macpherson H, Keir P, Webb S, Samuel K, Boyle S, Bickmore W,

Forrester L, Dorin J. Bone marrow-derived SP cells can contributeto the respiratory tract of mice in vivo. J Cell Sci 2005;118:2441–2450.

18. Rojas M, Xu J, Woods CR, Mora AL, Spears W, Roman J, Brigham KL.

Bone marrow-derived mesenchymal stem cells in repair of the injuredlung. Am J Respir Cell Mol Biol 2005;33:145–152.

19. Ortiz LA, Gambelli F, McBride C, Gaupp D, Baddoo M, Kaminski N,

Phinney DG. Mesenchymal stem cell engraftment in lung is enhancedin response to bleomycin exposure and ameliorates its fibrotic effects.Proc Natl Acad Sci USA 2003;100:8407–8411.

20. Yamada M, Kubo H, Kobayashi S, Ishizawa K, Numasaki M, Ueda S,

Suzuki T, Sasaki H. Bone marrow-derived progenitor cells areimportant for lung repair after lipopolysaccharide-induced lung in-jury. J Immunol 2004;172:1266–1272.

21. Kania G, Corbeil D, Fuchs J, Tarasov KV, Blyszczuk P, Huttner WB,

Boheler KR, Wobus AM. Somatic stem cell marker prominin-1/CD133 is expressed in embryonic stem cell-derived progenitors. StemCells 2005;23:791–804.

22. Bauer N, Fonseca AV, Florek M, Freund D, Jaszai J, Bornhauser M,

Fargeas CA, Corbeil D. New insights into the cell biology ofhematopoietic progenitors by studying prominin-1 (CD133). CellsTissues Organs 2008;188:127–138.

23. Corbeil D, Roper K, Hellwig A, Tavian M, Miraglia S, Watt SM,

Simmons PJ, Peault B, Buck DW, Huttner WB. The human AC133hematopoietic stem cell antigen is also expressed in epithelial cellsand targeted to plasma membrane protrusions. J Biol Chem 2000;275:5512–5520.

24. Shmelkov SV, Butler JM, Hooper AT, Hormigo A, Kushner J, Milde T,

St Clair R, Baljevic M, White I, Jin DK, et al. CD133 expression is notrestricted to stem cells, and both CD1331 and CD133- metastaticcolon cancer cells initiate tumors. J Clin Invest 2008;118:2111–2120.

25. Barfield RC, Hale GA, Burnette K, Behm FG, Knapp K, Eldridge P,

Handgretinger R. Autologous transplantation of CD133 selectedhematopoietic progenitor cells for treatment of relapsed acutelymphoblastic leukemia. Pediatr Blood Cancer 2007;48:349–353.

26. Bartunek J, Vanderheyden M, Vandekerckhove B, Mansour S, De

Bruyne B, De Bondt P, Van Haute I, Lootens N, Heyndrickx G,Wijns W. Intracoronary injection of CD133-positive enriched bonemarrow progenitor cells promotes cardiac recovery after recentmyocardial infarction: feasibility and safety. Circulation 2005;112:I178–I183.

27. Furst G, Schulte am Esch J, Poll LW, Hosch SB, Fritz LB, Klein M,

Godehardt E, Krieg A, Wecker B, Stoldt V, et al. Portal veinembolization and autologous CDd1331 bone marrow stem cells forliver regeneration: Initial experience. Radiology 2007;243:171–179.

28. Kania G, Blyszczuk P, Valaperti A, Dieterle T, Leimenstoll B,

Dirnhofer S, Zulewski H, Eriksson U. Prominin-11/CD1331 bonemarrow-derived heart-resident cells suppress experimental autoim-mune myocarditis. Cardiovasc Res 2008;80:236–245.

29. Rippon HJ, Ali NN, Polak JM, Bishop AE. Initial observations on the

effect of medium composition on the differentiation of murineembryonic stem cells to alveolar type II cells. Cloning Stem Cells2004;6:49–56.

30. Lee CG, Homer RJ, Zhu Z, Lanone S, Wang X, Koteliansky V, Shipley

JM, Gotwals P, Noble P, Chen Q, et al. Interleukin-13 induces tissuefibrosis by selectively stimulating and activating transforming growthfactor beta(1). J Exp Med 2001;194:809–821.

31. Baran CP, Opalek JM, McMaken S, Newland CA, O’Brien JM Jr,

Hunter MG, Bringardner BD, Monick MM, Brigstock DR, Strom-berg PC, et al. Important roles for macrophage colony-stimulatingfactor, CC chemokine ligand 2, and mononuclear phagocytes in thepathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med 2007;176:78–89.

32. Hashimoto N, Jin H, Liu T, Chensue SW, Phan SH. Bone marrow-

derived progenitor cells in pulmonary fibrosis. J Clin Invest 2004;113:243–252.

33. Phillips RJ, Burdick MD, Hong K, Lutz MA, Murray LA, Xue YY,

Belperio JA, Keane MP, Strieter RM. Circulating fibrocytes traffic tothe lungs in response to CXCL12 and mediate fibrosis. J Clin Invest2004;114:438–446.

34. De Caterina R, Libby P, Peng HB, Thannickal VJ, Rajavashisth TB,

Gimbrone MA Jr, Shin WS, Liao JK. Nitric oxide decreases cytokine-induced endothelial activation. Nitric oxide selectively reduces endo-thelial expression of adhesion molecules and proinflammatory cytokines.J Clin Invest 1995;96:60–68.


35. Kim YM, Talanian RV, Billiar TR. Nitric oxide inhibits apoptosis bypreventing increases in caspase-3-like activity via two distinct mech-anisms. J Biol Chem 1997;272:31138–31148.

36. Sato K, Ozaki K, Oh I, Meguro A, Hatanaka K, Nagai T, Muroi K,Ozawa K. Nitric oxide plays a critical role in suppression of T-cellproliferation by mesenchymal stem cells. Blood 2007;109:228–234.

37. Valaperti A, Marty RR, Kania G, Germano D, Mauermann N,Dirnhofer S, Leimenstoll B, Blyszczuk P, Dong C, Mueller C, et al.CD11b1 monocytes abrogate Th17 CD41 T cell-mediated experi-mental autoimmune myocarditis. J Immunol 2008;180:2686–2695.

38. McElroy MC, Wiener-Kronish JP, Miyazaki H, Sawa T, Modelska K,Dobbs LG, Pittet JF. Nitric oxide attenuates lung endothelial injurycaused by sublethal hyperoxia in rats. Am J Physiol 1997;272:L631–L638.

39. Kobayashi H, Hataishi R, Mitsufuji H, Tanaka M, Jacobson M, TomitaT, Zapol WM, Jones RC. Antiinflammatory properties of induciblenitric oxide synthase in acute hyperoxic lung injury. Am J Respir CellMol Biol 2001;24:390–397.

40. Gazoni LM, Tribble CG, Zhao MQ, Unger EB, Farrar RA, Ellman PI,Fernandez LG, Laubach VE, Kron IL. Pulmonary macrophageinhibition and inhaled nitric oxide attenuate lung ischemia-reperfu-sion injury. Ann Thorac Surg 2007;84:247–253.

41. Summer R, Fitzsimmons K, Dwyer D, Murphy J, Fine A. Isolation of anadult mouse lung mesenchymal progenitor cell population. Am JRespir Cell Mol Biol 2007;37:152–159.

42. Pluchino S, Zanotti L, Rossi B, Brambilla E, Ottoboni L, Salani G,Martinello M, Cattalini A, Bergami A, Furlan R, et al. Neurosphere-derived multipotent precursors promote neuroprotection by animmunomodulatory mechanism. Nature 2005;436:266–271.

43. Khalil PN, Weiler V, Nelson PJ, Khalil MN, Moosmann S, MutschlerWE, Siebeck M, Huss R. Nonmyeloablative stem cell therapy

enhances microcirculation and tissue regeneration in murine inflam-matory bowel disease. Gastroenterology 2007;132:944–954.

44. Lee ST, Chu K, Jung KH, Kim SJ, Kim DH, Kang KM, Hong NH, KimJH, Ban JJ, Park HK, et al. Anti-inflammatory mechanism of in-travascular neural stem cell transplantation in haemorrhagic stroke.Brain 2008;131:616–629.

45. Cerletti M, Jurga S, Witczak CA, Hirshman MF, Shadrach JL, GoodyearLJ, Wagers AJ. Highly efficient, functional engraftment of skeletalmuscle stem cells in dystrophic muscles. Cell 2008;134:37–47.

46. Baber SR, Deng W, Master RG, Bunnell BA, Taylor BK, Murthy SN,Hyman AL, Kadowitz PJ. Intratracheal mesenchymal stem celladministration attenuates monocrotaline-induced pulmonary hyper-tension and endothelial dysfunction. Am J Physiol Heart Circ Physiol2007;292:H1120–H1128.

47. Gupta N, Su X, Popov B, Lee JW, Serikov V, Matthay MA. Intra-pulmonary delivery of bone marrow-derived mesenchymal stem cellsimproves survival and attenuates endotoxin-induced acute lung injuryin mice. J Immunol 2007;179:1855–1863.

48. Naidu BV, Krishnadasan B, Farivar AS, Woolley SM, Thomas R, VanRooijen N, Verrier ED, Mulligan MS. Early activation of the alveolarmacrophage is critical to the development of lung ischemia-reperfu-sion injury. J Thorac Cardiovasc Surg 2003;126:200–207.

49. Zhao M, Fernandez LG, Doctor A, Sharma AK, Zarbock A, TribbleCG, Kron IL, Laubach VE. Alveolar macrophage activation is a keyinitiation signal for acute lung ischemia-reperfusion injury. Am JPhysiol Lung Cell Mol Physiol 2006;291:L1018–L1026.

50. Genovese T, Cuzzocrea S, Di Paola R, Failla M, Mazzon E, Sortino MA,Frasca G, Gili E, Crimi N, Caputi AP, et al. Inhibition or knock out ofinducible nitric oxide synthase result in resistance to bleomycin-induced lung injury. Respir Res 2005;6:58.


Prominin-1/CD1331 Lung Epithelial Progenitors Protect from Bleomycin-induced Pulmonary Fibrosis

Documents