This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Profile and Expression Virulence Genes of Pseudomonas
aeruginosa Isolated from Burns and Wounds
Noor F. K. Al-Shamaa1*, Mohammad A. Al-Faham2, Rasmia A. Abu- Risha3
INTRODUCTION
Burn injury is one of the significant public health problems worldwide. It is at high risk for nosocomial infections. Infection of burns is common because the skin, a physical barrier against microbes, has been compromised. Further-more, in moderate and severe burns the underlying vasculature of the skin has been damaged or destroyed and so immunity agents, such as T cells, cannot reach sites of infection, accordingly, the risk of infection increases proportionately with the size of the burn [1]. Wound infection is one of health problems that are caused by the
invasion of pathogenic organisms in different part of body and it threat life of large number of people in many countries [2]. Wound sometimes get infection by either single or multiple organisms, and are mostly due to nosocomial pathogens [3]. P. aeruginosa is one of the most common causes of burn wound infections [4]. P. aeruginosa is found as major colonizer of the burn wound because it live on moist burn wound surface and usually gains access to burn patients through cross contamination. It persists as a major nosocomial infection threat to burn patients arising
ABSTRACT
In this study 111 swabs were collected and culured, the isolated bacteria were identified by biochemical tests, API 20 E and Vitak 2. Drug susceptibility tests for the 31 isolates of P. aeruginosa were studied against 7 antibiotics and the percentages of sensitivity to antibiotic were shown as the following; Gentamicin 74%, Tobramycin 100%, Amikacin 64%, Ciprofloxacin 39%, Levofloxacin 48%, Imipenem 42% and Meropenem 45%. The DNA was isolated from 31 isolates of P. aeruginosa were extracted by DNA extraction kit, the concentration for all 31 DNA samples were between 60 - 110 ng/µl and the purity were between 1.8-2 . Polymerase Chain Reaction was used for screening the virulence genes, resistant genes (opr I, opr L) and (the macrophage apoptosis genes (exo S, exo T). The result showed that 29 (94%) isolates were positive for opr I and exo S genes and 2 (6%) were PCR-negative for opr L gene 27 (87%) isolates were PCR-positive, while 4 (13%) were PCR- negative, for exoT gene 26 (84%) were PCR- positive, while 5 (16%) were PCR - negative, For study the gene expression of the resistant genes (opr I, opr L), the technique of (RT-qPCR ) was used for the transcription of the RNA to cDNA, followed by their amplification. The result showed that the difference in gene expression of the virulence factor genes between the eight isolates, for the opr I ranged from (1.1 -561918) and the opr L ranged from (5.3 - 80684.3). The rate of gene expression of two virulence factors genes between the eight samples for opr I was 75% (6/8) and for opr L was 87.5% (7/8).
Keywords: Burn wound infection, gene expression, exo S, exo T, opr I, oprL, P. aeruginosa, RT-qPCR.
of resistance against multiple antimicrobial drugs frequently complicates the treatment of P. aeruginosa infection. This may lead to serious infection and thus mortality rate in these patients become high [5]. Infections of P. aeruginosa are difficult to eradicate because of their elevated intrinsic resistance as well as their capacity to acquire resistance to different antibiotics [6]. opr I, opr L genes is encoded to L and I lipoproteins are two outer membrane proteins of P. aeruginosa responsible for inherent resistance of P. aeruginosa to antibiotics and antiseptics [7] exo S gene is encoded exoenzyme (s) is bifunctional enzyme, induces apoptosis of epithelial cells and macrophages [8]. exo T gene is encoded for targets host kinases involved in focal adhesion and phagocytosis [9]. P. aeruginosa possesses a variety of virulence factors that may contribute to its pathogenicity. the evaluate of oprI, oprL genes by PCR identification of clinical P. aeruginosa. In order to find any relation between special virulence factors and special manifestation of P. aeruginosa infections, so detected virulence factors among these isolates by PCR [10]. RT-PCR is used to qualitatively detect gene expression through creation of complementary DNA (cDNA) transcripts from RNA [11]. In RT-PCR, the RNA template is first converted into a complementary DNA (cDNA) using a reverse transcriptase. The cDNA is then used as a template for exponential amplification using PCR. QT-NASBA (real-time quantitative nucleic acid -based amplification) is currently the most sensitive method of RNA detection available [12]. RT-PCR with rapid thermal cycling (LightCycler™ technology), based on the amplification of the outer membrane lipoprotein gene opr L . compared the efficacy of these methods to bacterial culture by quanti-tatively measuring levels of P aeruginosa in serial dilutions, in burn wound biopsy samples [13]. The present study aims to Isolate P. aeruginosa from burn and wound infection and diagnosis by chemical tests and confirm by API 20 E and Vitak apparatus. Detection the resistant isolates of P. aeruginosa for different antibiotics. Extraction the DNA from the P. aeruginosa isolates. Detection of virulence genes (opr I, opr L, exoS, exoT) in P. aeruginosa isolates by PCR
technique. Moreover the gene expression of the resistant
gens was detected using RT-qPCR technique.
MATERIALS and METHODS
Identification and susceptibility test of P. aeruginosa
In this study 111 swab were collected from 50 patients,
aged from 9 months to 69 years, (18 patient suffered from
burn, and 32 patient suffered from wound). All samples were cultured on MacConkey agar, Blood agar, Cetrimide agar, King A and king B medium. The biochemical tests were performed for confirmed the identification the P. aeruginosa isolates by oxidase, catalase, motility, IMVIC tests [14]. The biochemical tests result of final identification of p.aeruginosa was dependent on Api 20 E, and Vitak 2 systems. Drug susceptibility tests were performed for 31 isolates of P. aeruginosa from burn and wound using commercially prepared antibiotic disks on Mueller Hinton agar plates by the disk diffusion method against seven different antibiotics (Gentamicin, Tobramycin, Amikacin, Ciprofloxacin, Levofloxacin, Imipenem and Meropenem ).
DNA Extraction
The DNA of thirty one P. aeruginosa isolates were extracted according to the instruction of the Promega kit Nano Drop 2000 C Spectrophotometer was used for measured the DNA concentration and purity. The extracted DNA was electrophoresed by gel electrophoresis system for proofing that the genomic DNA was intact and not sheared.
Preparation the primers
Primers were prepared according to the instructions of manufactured company (Alpha DNA, Canada). The primers choose (Table 1)
Table 1. Sequence of primers of virulence genes
Genes Primer sequence (5-3) product Reference
opr I F- GCT CTG GCT CTG GCT GCT
R- AGG GCA CGC TCG TTA GCC 200
bp
[15]
opr L F-ATGGAAATGCTGAAATTCGGC
R- CTTCTTCAGCTCGACGCGACG 500b
p
[15]
exo S F-ATCGCTTCAGCAGAGTCCGTC
R-CAGGCCAGATCAAGGCCGCGC 150
bp
[16]
exo T FAATCGCCGTCCAACTGCATGCG
R- TGTTCGCCGAGGTACTGCTC 150
bp
[17]
Detection of the virulence factors genes
For optimization the primer was applied into eppendorf tube, 10 μl master mix, 0.7 μl forward primer, 0.7 μl reverse primer, 7.6 μl free nuclease water and 1ul DNA, the correct PCR products could be obtained for the template DNA with the temperature gradient PCR method [18] to identify the different annealing temperature (53, 55, 60.3, 62.6, 65 ºC). Detection of virulence genes resistant genes (opr I, opr L) and the macrophage apoptosis genes (exo S, exo T) was performed by amplifying the genes by monoplex PCR, the PCR thermocycler program (Table 2).
Table 2. PCR thermocycler program for DNA amplification of P.
aeruginosa genes. X, degree of primer for every virulence gene as
fellow; (opr L, exo S): 55 ºC; (opr I , exo T ), 60 ºC.
Gene expression
Preparation of control broth
Selected single colony of P. aeruginosa from certrimide agar and cultured on Luria Bertani (LB) broth and incubated at 37 ºC for 24 h.
Preparation antibiotic broth
Single colony of P. aeruginosa was selected from cetrimide agar and cultured on L.B broth. The powder antibiotic was dissolved in1 ml normal saline. 0.1 ml of the dilution
antibiotic was added to the cultured colony in the LB broth, for transformation the concentration of the antibiotic to microgram, as fellow: 1gm = 1000 mg = 10^6 ug , at final concentration of antibiotic (Table 3) and incubated at 37 ºC for 24 h [19].
Table 3. The antibiotic powder and solutions were used in the
experimental study.
No. of the
isolate
The antibiotic Concentration ug/ ml
1 Ciprofloxacin 2000
2 Tobramycin 5000
3 Pipracillin 10000
4 Amikacin 5000
6 Ceftizidine 10000
7 Meropenem 5000
RNA extraction
RNA of 8 P. aeruginosa isolates were extracted according the instruction of the Promega kit.
Gene expression analysis
According to previous study [20] each virulence gene(opr I, opr L) was tested for its ability to expressed using RT-qPCR technique. The expression values were calibrated with rpoD gene which consisted of housekeeping gene. In this work, one step RT-qPCR had been used, RNA was transcript directly to cDNA before PCR beginning, material that had been used and their volumes and the Amplification steps of the gene expression were described in the Tables 4
Table 4. Materials and volumes of RT-qPCR technique.
No. Material The volume
1 Master mix 12.5ul
2 RT mix 0.5 ul
3 RNA 5ul
4 forward primer 2.5ul
5 reverse primer 2.5ul
6 H2O 2ul
and 5 Folding values were determined using ΔΔCt model, which known also as Livak equilibrium [21].
Table 5. Amplification steps of the gene expression of RT-qPCR
technique.
°C Min Cycles
cDNA making 37°C 15 min 1
Initial denaturation 95°C 5 min 1
Denaturation 95°C 30 sec 40
Annealing opr L : 55 ºC
opr I : 60 ºC
30 sec
Extension 72°C 30 sec
Melting curve 1
RESULT and DISCUSSION
In this study, from 111 specimens 31 isolates of P. aeruginosa (25 from burns and 6 from wounds) 33 isolates of E. coli, 10 isolates of Klebsiella spp (Table 6).
Table 6. Percentage of the isolated bacteria.
Type of bacteria No.
P.aeruginosa 31(25burn 6 wound)
E.coli 33
Klebsiella spp, 10
In previews study in Iraq, Alwan et al. [22] revealed that P. aeruginosa was most common isolate from burns and wounds another study of Ranjan et al. [23] founded that the most common isolated organism from postoperative wounds was P. aeruginosa. P. aeruginosa colonies, on blood agar produce a clear zone due to produce β-hemo-lysis [24], on MacCkonky agar medium the bacterial colon-ies appeared pale because it does not ferment lactose [25]. The identification of P. aeruginosa was confirmed on Cetrimide agar, King A and King B medium. In these media the bacteria produce pyocyanin and flourescen pigments. so it selective for P. aeruginosa. The positive isolates produce pyocyanin pigment (blue or green) on Cetrimide agar and king A and produce flourescen pigment (yellow) on King B [26]. The isolates of P. aeruginosa showed different percentage of resistance to each antibiotics of the aminoglycoside group: Gentamicin 74% (23/31), Tobramycin 100% (31/31), Amikacin 64% (20/31). The Quinolone group: Ciprofloxacin 39% (12/31), Levofloxacin 48% (15/31). The Carbapenem group: Imipenem 42% (13/31) and Meropenem 45% (14/31). According to the percentage of Gentamicin (74%) our results closed to results of Ra'oof [27], here the isolates were isolated from (burn, wound, otitis media, urinary tract infection), which rate was 75%, while another study by Yolbas et al [28], the isolates were isolated from burn wounds which rate was 45 %, the percentage of Tobramycin (100%), the study of Ekrami and Kalantar, [29] found that the same result, while another study by Ranjan et al, [23], the bacteria were isolated from Post-operative wound Infection, the rate was (69.5%), the percentage of Amikacin (64%) was closed with Naqvi et al (30), as rate was (70.5 %), while the study of Yolbaş et al, [28] the rate was 18 %. The percentage of sensitivity to ciprofloxacin (39%) was closed to results of Arabestani et al, [31] who isolated the bacteria from clinical samples and the rate was 38%, While another studies in Iraq by Al-Habib et al, [32] who isolated the bacteria from burn infection the rate was 80%. The percentage of Levofloxacin 48% previews study by Akingbade et al, [2] the isolates were isolated from wound infections the rate was 40 %, and Arabestani et al, [31] found the rate was 61.2 %. The percentage of Imepenem 42% in another studies revealed different percentages, Wang et al, [33] showed the rate was 30.4 %, Arabestani et al, [31], the rate was 9.6 %. Percentage of resistance of Meropenem was 45%, Salimi et al, [34] showed the rate was 37.2%, and Yolbaş et al, [28] the rate was 58%. The result revealed that the concentration for all DNA samples of the thirty one P. aeruginosa isolates were between 60 - 110 ng/ul and the purity was between 1.8 - 2. PCR was used for screening the resistant genes (opr I, opr L) and the macrophage apoptosis genes (exo S, exo T) of the thirty one P. aeruginosa isolates, and the result showed that 29 (94%) isolates were positive for opr I and 2 (6%) were PCR-negative, (Fig 1). From the 25 burn isolates, the positively rate was 25 (100%) and from 6 wound isolates
Shamaa et al. (2016).
World J Exp Biosci. Vol. 4, No. 2: 163-170.
166
the rate was 4 (66%), the percentage of opr I in burn was similar with study in Iraq by Khattab et al, [35] who isolated
the isolates from different origins revealed the burn isolates was 100 % harbored this gene.
Fig 1. Gel electrophoresis of amplified PCR products of opr I gene (200 bp) in monoplex PCR at (100 v for 90 min) in (1% agarose), TBE (1x),
stained with ethidium bromide. M, DNA ladder, all the lanes were positive for the opr I gene except the lanes (4,7) were
negative.
For the opr L gene 27 (87%) isolates were PCR- positive, while 4 (13%) were PCR-negative (Fig 2). From 25 burn isolates 23 (92%) were positive isolates and from 6 wound isolates 4 (66%) were positive isolates, whereas study by
Khattab et al, [35], exhibited that 100 % isolates from burn was harbored this gene. The study of Salman et al, [36] was 80% isolated from wound contain this gene.
Fig 2. Gel electrophoresis of amplified PCR product of opr L gene (500bp) in monoplex PCR at ( 100 v for 90 min ) in (1% agarose ) , TBE
(1x) , stained with ethidium bromide . M: DNA ladder, all the lanes were positive for the opr L gene except the lanes from (4-7) were negative
Khattab et al, [35] found that simultaneous use of oprI and oprL genes provides more confident detection of P. aeruginosa by PCR. The exo S gene dissemination in thirty
one isolates of P. aeruginosa showed that 29 (94 %) isolates were PCR- positive, and 2 (6%) isolates were PCR-negative (Fig 3)..
Fig 3. Gel electrophoresis of amplified PCR product of exo S gene (150bp) in monoplex PCR at (100 v for 90 min) in (1% agarose), TBE (1x),
stained with ethidium bromide. M, DNA ladder, all the lanes were positive for the exo S gene except the lanes (4,7) were negative.
Shamaa et al. (2016).
World J Exp Biosci. Vol. 4, No. 2: 163-170.
167
While, the study by Winstanley et al, [37] isolates from ulcerative keratitis samples showed that 38% were positive for this gene. The prevalence of exoS gene in 25 burn isolates, exhibited the positive rate was 25 (100% ) while in 6 wound was the rate 4 (66%). Another studies revealed different percentage from the percentage of exo S in burn, Khattab et al, [35] showed the isolates from burn was 70% contain this gene. Study by Gawish et al, [38] isolated from nosocomial and environmental samples found the burn isolates was 33.3 % harbored this gene. The percentage of exo S in wound different from other studies, study of Wolska and Szweda [39] showed that the isolates from wound was 77.8 % and the study of Holban et al, [40] showed the isolates from wound was 20%. Exoenzyme S is important for the pathogenic activity of P. aeruginosa [41]. The isolates harbor exoS are referred to as invasive strain, therefore the phenotype of P. aeruginosa is invasive [42].
exoT diminishes macrophage motility and phagocytosis, at least in part through disruption of the actin cytoskeleton of eukaryotic cells, and blocks wound healing [43]. The determined of exo T gene in thirty one isolates of P. aeruginosa revealed that PCR-positive for 26 (84 %) isolates and 5 (16%) isolates were PCR- negative (Fig 4). The positive percentage was different from the study of Georgescu et al, [44] revealed that all the isolated from chronic leg ulcers samples were 100% positive for this gene. The frequencies of exo T gene in 25 burn isolates was 23 (92%) positivity rate, while the isolates 6 wounds was 3 (50%) positivity rate. A study of Gawish et al, [38] revealed that all the isolates from burn were 100% harbored this gene. The percentage of (exo T) in isolates from wound not similar with the study of Holban et al, [40], showed that the isolates from wound was (95%) harbored this gene and the study of Gawish et al, [38] showed that the isolated from wound was 100% contain this gene.
Fig 4. Gel electrophoresis of amplified PCR product of exo T gene (150bp) in monoplex PCR at ( 100 v for 90 min ) in (1% agarose ) , TBE
(1x) , stained with ethidium bromide . M: DNA ladder (100bp) , all the lanes were positive for the exo T gene except the lanes (4,7, 26,30,31)
were negative.
Results of present study showed that the burns infection harbored high positively rate of the virulence genes than the isolates from wounds infection as fellow; 86% burn isolate,14% wound isolate for opr I gene and exo S genes, 85% burn isolate, 15% wound isolate for opr L gene and 88% burn isolate,12% wound isolate for exo T gene. The low prevalence of this virulence factor genes in the isolates from wound infections may show the role of this genes in the wound infections is less important than the burn infections. Nikbin et al, [10] reported in his study that the determination of different virulence genes of P. aeruginosa isolates are associated with different levels of intrinsic virulence and pathogenicity and the differences in the distributions of virulence factor genes in the populations strengthen the probability that some P. aeruginosa strains are better adapted to the specific conditions found in specific infectious sites. There were differences in the virulence genes profiles of strains isolated from different clinical origins, correlating between virulence patterns and infection clinical outcome could be useful for therapeutic procedures in hospitalized patients with positive P. aeruginosa cultures [40]. Significant correlations between some virulence genes and source of infections indicate implementation of infection control measures will help in controlling the dissemination
of virulence genes among P. aeruginosa isolates as reported by the study in Iraq of Khattab et al, [35].
For study the gene expression of the resistant genes (opr I, opr L), the RNA of the eight of P. aeruginosa isolated from burn infection were extracted by RNA extraction kit. The RT-qPCR technique was used for the transcription of the RNA of each sample to cDNA, followed by their amplification and relative quantification expression ratios of the (oprI, oprL) genes were measured in comparison to the housekeeping gene (rpoD). The folding value (gene expression) for each of these virulence genes were determined as dependent on the mathematical models are very widely applied the (ΔΔCt model) (Livak equilibrium)
Since relative quantification is the goal for most for real-time PCR experiments, several data analysis procedures have been developed. Mathematical models are very widely applied: the ΔΔCt model, Livak and Schmittgen (21). The threshold cycle values (Ct) were automatically determined for each reaction. These values were defined
Shamaa et al. (2016).
World J Exp Biosci. Vol. 4, No. 2: 163-170.
168
as the cycle number at which the fluorescence generated by the released reporter dye molecule exceeds a fixed threshold value above the baseline [45]. The following antibiotics were used in the gene expression (Table 7). The folding rate (the gene expression) of the resistant genes (opr I) were variant between the (eight) different isolates (Table 8, and Fig 5)
Table 7. Types of the antibiotic used in the gene expression.
No. of the isolate The antibiotic
1 Ciprofloxacin
2 Tobramycin
3 Pipracillin
4 Amikacin
5 Pipracillin
6 Ceftizidine
7 Meropenem
8 Meropenem
Fig 5. The amplified curve and Ct of the resistant gene (opr I).
The folding rate (the gene expression) of the resistant gene (opr L) were variant between the 8 different isolates (Table 9 and Fig 6).
Fig 6. The amplified curve and Ct of the resistant gene (opr L).
From 8 isolates, the high value of gene expression (opr L gene) was for the isolate 1 and this value was (80684.3), so it gene expression of the resistant to the ciprofloxacin antibiotic was very high of this isolate. The result of gene expression of the opr L gene for the isolates (1,6) was (80684.3), (16384.0) lower than the result of study Khodabakhshi et al, [46] who showed that the gene expression for opr L gene of P. aeruginosa isolated from cystic fibrosis patients was (112868). All the isolates exhibited resistant rate for all the used antibiotic and the value of the resistant genes (opr I, opr L genes) difference between these genes for the same antibiotic one of the resistant gene exhibit expression and the another resistant gene not exhibit expression. The rate of gene expression of the two virulence factors genes between the eight samples for oprI was 75% (6/8) and for opr L was 87.5% (7/8) and for compared between the expression rate of the resistant genes for the same isolates the result showed that 5/8, 62.5% expressed opr I and opr L genes (2/8) 25 % expressed only opr L gene and (1/8) 12.5% expressed only opr I gene (Table 10). The cause of high gene expression in this study and correlated with the type of samples of P. aeruginosa isolated from burn infection site, the reason of higher gene expression resistance rates may be associated with the type of clinical samples that as only burn samples have usually higher gene expression antibiotic resistance rates than other clinical samples [47]. The virulence genes expression differs according to site and severity of infection [10]. Increase in expression of virulence factors may be linked to reduced susceptibility to antimicrobial agents [48]. The low expression case of the resistant gene may be presence of another type of the resistant gene responsible for the resistant of the antibiotic. Vaisvila et al, [49] showed that the large size and the versatility of the genome of P. aeruginosa and its distribution in aquatic habitats, which could constitute a reservoir for bacteria carrying other resistance genes. Another mechanism that affecting the resistant, because the present study could not explain the resistant mechanisms exactly as mention El Amin et al, [50], the identification of resistance mechanisms based on gene expression analysis might be complicated when several mechanisms affecting the same class of antibiotics are at work. From current study it can conclude that The burns infection revealed high percentage of P. aeruginosa than wounds infection, the most active compound against P. aeruginosa was ciprofloxacin and the detected of four virulence factors genes (opr I, opr L, exo S, exo T) of P. aeruginosa showed high positively rate of virulence genes in isolates from burns infection than that of wounds infection. The folding rate (the gene expression) of the resistant genes (opr I, opr L) were variant between the eight different isolates and were graduate from high rate to no detect in gene expression and for compared between the expression rate of the resistant genes for the same isolates the result showed that (5/8) 62.5% expressed opr I and opr L genes (2/8) 25% expressed only opr L gene and (1/8) 12.5% expressed only opr I gene.
Shamaa et al. (2016).
World J Exp Biosci. Vol. 4, No. 2: 163-170.
169
Table 8. The folding rate of the resistant gene (opr I) for 8 isolates.
Isolates Calibrator OprI ∆∆Ct Fold
oprI rpoD ∆Ct oprI rpoD ∆Ct
1 37.6 19.4 18.2 21.7 22.6 -0.9 -19.1 561918.0
2 36.2 16.8 19.4 13.7 12.2 1.5 -17.9 244589.0
3 16.8 12.5 4.3 23.3 20.6 2.7 -1.6 3.0
4 17.4 14.6 2.8 25 16.2 8.8 6 0.0
5 17.4 14.6 2.8 18 15.3 2.7 -0.1 1.1
6 17.4 14.6 2.8 19.7 12.4 7.3 4.5 0.0
7 21.9 14 7.9 23 21.4 1.6 -6.3 78.8
8 23.8 21.5 2.3 26 28.6 -2.6 -4.9 29.9
Table 9. The folding rate of the resistant gene (opr L) for (8) isolates.
Isolates Calibrator oprL ∆∆Ct Fold
oprL rpoD ∆Ct OprL rpoD ∆Ct
1 37.6 19.4 18.2 24.5 22.6 1.9 -16.3 80684.3
2 38 16.8 21.2 29.5 12.2 17.3 -3.9 14.9
3 20.6 12.5 8.1 24.5 20.6 3.9 -4.2 18.4
4 33.7 14.6 19.1 22.8 16.2 6.6 -12.5 5792.6
5 33.7 14.6 19.1 32 15.3 16.7 -2.4 5.3
6 33.7 14.6 19.1 17.5 12.4 5.1 -14 16384.0
7 19.6 14 5.6 22.9 21.4 1.5 -4.1 17.1
8 22.3 21.5 0.8 33.6 28.6 5 4.2 0.1
Table 10. The difference of the gene expression value
between the opr I , opr L genes for every antibiotic.
No. of
isolate
The antibiotic Gene expression
folding of opr I
Gene
expression of
opr L
1 Ciprofloxacin 561918.0 80684.3
2 Tobramycin 244589.0 14.9
3 Pipracillin 3.0 18.4
4 Amikacin Undetectable 5792.6
5 Pipracillin 1.1 5.3
6 Ceftizidine Undetectable 16384.0
7 Meropenem 78.8 17.1
8 Meropenem 29.9 Undetectable
Conflict of interest The authors declare that they have no conflict of interests.
REFERENCES
1. Church DS, Elsayed O, Reid B ,Winston RL. (2006) Burn wound
infections. Clin Microbiol Rev 19: 403-434.
2. Akingbade OA, Balohun SA, Ojo DA, Afolabi RO, Motayo BO,
Okerentugba PO, Okonko IO. (2012) Plasmid profile analysis of
multidrug resistant Pseudomonas aeruginosa isolated from wound
infections in South West Nigeria. World Applied Sci J 20:766-775.
3. Mulu AF, Moges BT, Kassu A. (2006) Patterns and multiple drug
resistance of bacterial pathogens at university of Gondar teaching
hospital Northwest Ethiopia. Ethiopian Med J 44: 125-131.
4. Bojary NMR, Hajia M. (2012) Multidrug resistant Pseudomonas
aeruginosa strains in Tehran Reference Burn Hospital. Tehran Iran. Afr J
Microbiol Res 6: 1393-1396.
5. Estahbanati HK, Kashani PP, Ghanaatpisheh F. (2002) Frequency of P.
aeruginosa serotypes in burn wound infections and their resistance
antibiotics. Burns 28: 340-348.
6. Breidenstein EBM, De la Fuente-Nuñez C, Hancock REW. (2011) P.
aeruginosa all roads lead to resistance. Trends Microbiol 19:419-426.
7. De Vos D, Lim A, Pirnay JP, Struelens M, Vandenveld C, Duinslaeger
L. et al. (1997) Direct detection and identification of Pseudomonas
aeruginosa in clinical samples such as skin biopsy specimens and
expectorations by multiplex PCR based on two outer membrane genes,