Top Banner
Primer Design Dave Palmer [email protected]
21

Primer Design Dave Palmer [email protected]. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Dec 31, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Primer Design

Dave [email protected]

Page 2: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Why Are Primers Important?

Primers are what gives PCR its SPECIFICITY!!!Good primer design: PCR works great.Bad primer design: PCR works terrible.

Page 3: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Very-Brief PCR Reminder

PCR is a method to amplify large quantities of a DNA covering a specific sequence.

Page 4: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Factors That Affect Priming

Melting / Annealing Temperature Of primers to target

Secondary Structure Within target

Complementarity Primers to target Primers to each other

Page 5: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Factor 1:Melting / Annealing Temperature

PRIMER LENGTH Longer primers stick better = melt

at a higher temperature.

GC CONTENT More G-C content = more triple

bonds = primers stick better = melt at higher temperature.

PCR Annealing Temp = Melt T - 5°C

Tm = [4(G + C) + 2(A + T)] °C Tm = 58.3°C + 0.41°C (%G-C) - 500/length

http://www.alkami.com/primers/refprmr.htm

aagtcagtcagtactagtgatgtaaagtcagtcag

Page 6: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Factor 2:Secondary Structure

Primers will have difficulty annealing:

if they anneal to regions of secondary structure within the target that have a higher melting point than the primer.

http://www.alkami.com/primers/refprmr.htm

Page 7: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Factor 3:Complementarity

PRIMER-PRIMER (BAD) Excessive similarity between primers,

especially at the 3’ ends, leads to the formation of “primer dimers”

PRIMER-TARGET (GOOD) Ideally should be 100% similar for

maximal specificity. Primers don’t HAVE to be perfectly similar

to target to work.

http://www.alkami.com/primers/refprmr.htm

atcggactatcga

gctatacttatggcca

atcggactatcga

tagcctgatagctatacttatggcca

Page 8: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

What is a Primer-Dimer

An unwanted extension productResults from primers annealing to themselves, or each other, at 3’ endsExtended primers are no longer available to prime target for PCR

atcggactatcga

gctatacttatggcca

atcggactatcgatatgaataccgga

tagcctgatagctatacttatggcca

Page 9: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Two Strategies for Primer Design

?

Optimize the primer design to work in a specific set of PCR conditions.

If you’ve got flexibility around the amplified site.

Allows more “standardized” PCR conditions.

Pick a primer pair and optimize PCR conditions for it.

If an exact sequence site needs to be primed or amplified.

If you’re working with someone else’s primers.

Page 10: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Strategy 1 for Primer Design: Fixed Primers, Vary ConditionsWith a given primer pair, the Tm can be calculated.Run multiple PCR reactions, each using a different annealing temperature (= Tm - 5).“Bracket” Ta: – 10C, -5C, 0C, +5C, +10CTemp too low: Smearing due to non-specific primingTemp too high: No amplification due to no primingChoose conditions which give the best results.

http://www.iscpubs.com/pubs/abl/articles/b9812/b9812pre.pdf

Page 11: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Strategy 2 for Primer Design:Optimizing Primers for Set Conditions

PCR conditions (esp. annealing temp) are kept constant.Select primers for a theoretical Tm.Best to select multiple primers, then experiment to see which combination works best.95C – 65C – 72C

F1: atcgatcgatcgatcagtcatcg

F2: gtactgagctagctgcagctc

R1: atgactgagctgctagcttg

R2: atgcatgctcgtgactgtg

F2 F2R1 F1/R1 F2/R1 R2 F1/R2 F2/R2

Page 12: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Designing Primers

Primer Design on the Web Example: “Primer3”

Example gene: GFP5 Green Fluorescent Protein GFP5, Genebank 18482861 ggatccaagg agatataaca atgagtaaag gagaagaact tttcactgga gttgtcccaa 61 ttcttgttga attagatggt

gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 181 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca tatgaagcgg cacgacttct tcaagagcgc catgcctgag ggatacgtgc 301 aggagaggac catcttcttc aaggacgacg ggaactacaa gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc aacaggatcg agcttaaggg aatcgatttc aaggaggacg 421 gaaacatcct cggccacaag ttggaataca actacaactc ccacaacgta tacatcatgg 481 ccgacaagca aaagaacggc atcaaagcca acttcaagac ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat cattatcaac aaaatactcc aattggcgat ggccctgtcc 601 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 721

atgaactata caaataagag ctc

http://frodo.wi.mit.edu/

Page 13: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Designing Primers

Primer Design on the Web Using Primer3

Enter sequence

Pick Primers

Page 14: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Designing PrimersPrimer3 Advanced Controls

Primer Size

Primer Tm

Complementarity

Page 15: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Primer3 Output

Details:-Start-Length-Tm-GC-Sequence

Designing Primers

Where they bind:

Page 16: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Designing Primers

Primer 3 Output, continued

Page 17: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Primer EvaluationLet’s assume we selected the first primer pair (for + rev)Website for online primer evaluation:

TCATTGTTTGCCTCCCTGCTAGAAACCCCAACCCGTGAAA

Enter Sequence

Page 18: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Primer EvaluationWebsite displays potential problems with primer self-annealingMore advanced software can examine interactions between primers

TCATTGTTTGCCTCCCTGCTAGAAACCCCAACCCGTGAAA

GraphicalOutput

Page 19: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Primer EvaluationJust for fun, let’s assume we selected a really BAD primer...

GGGCCCCTCACCAACCCGTGCCCGGG

Page 20: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

Live Example Primer Design

Primer Design Workflow:

1. Pick a gene.ie. BRCA1

2. Pull up sequence for the gene.a. http://www.ncbi.nlm.nih.gov/b. search Nucleotide Database for brca1c. scroll through accessions for desired one

3. Copy sequence to text editor.

4. Pull up a primer design website.a. http://frodo.wi.mit.edu/b. copy sequencec. select options and choose Pick Primers

4b. Verify primers find target (optional)a. http://www.ncbi.nlm.nih.gov/BLAST/b. select nucleotide blastc. enter primer sequence, choose blast

4c. Analyse and double-check the primersa.

http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspxb. enter sequence, view

5. Order oligos.a. http://www.operon.com

Page 21: Primer Design Dave Palmer dpalmer@zdap.com. Why Are Primers Important? Primers are what gives PCR its SPECIFICITY!!! Good primer design: PCR works great.

End of Primer Design