-
PRIMA-1met Induces Apoptosis in Waldenström's
Macroglobulinemia Independent of p53, alone and in
Combination with Bortezomib
By:
Mona Sobhani
A thesis submitted in conformity with the requirements for the
degree of
Masters of Science
Department of Laboratory Medicine and Pathobiology
University of Toronto
© Copyright by Mona Sobhani 2015
-
ii
PRIMA-1met Induces Apoptosis in Waldenström's
Macroglobulinemia Independent of p53, alone and in
Combination with BortezomibMona Sobhani
Master of Science
Department of Laboratory Medicine and Pathobiology
University of Toronto
2015
Abstract:
PRIMA-1met has shown promising preclinical activity in various
cancer types. However, its
effect on Waldenström’s Macroglobulinemia (WM) as well as its
exact mechanism of action is
still elusive. In this study, we evaluated the anti- tumor
activity of PRIMA-1met alone and in
combination with dexamethasone or bortezomib in WM cell line and
primary samples.
Treatment of WM cells with PRIMA-1met resulted in induction of
apoptosis, inhibition of
migration and colony formation. Upon PRIMA-1met treatment, p73
was upregulated and Bcl-xL
was downregulated while no significant change in expression of
p53 was observed. siRNA
knockdown of p53 in WM cell line did not influence the
PRIMA-1met-induced apoptotic
response whereas silencing of p73 inhibited latter response in
WM cells. Combined treatment
with PRIMA-1met and dexamethasone or bortezomib induced
synergistic reduction in cell
survival in WM cells. Our study provides the rationale for
PRIMA-1met’s clinical evaluation in
patients with WM.
-
iii
Acknowledgements
I would like to extend my sincerest thanks and regards to all
those who supported and
encouraged me during my Master’s study.
First, I would like to express my special gratitude to my
supervisors Dr. Hong Chang whose
expert guidance, support, patience and encouragement made my
Master’s studies a productive
experience. I am grateful to have had the opportunity to train
in a diverse learning environment
with admirable individuals, particularly Manujhandra Saha, Yijun
Yang and Yan Chen, whose
proficiency and expertise in the lab have been immeasurably
helpful to me. I would also like to
express my special thanks to my committee members Dr. Donald
Branch and Dr Chen Wang for
their valuable and constructive comments.
My deep gratitude is expressed to my mother and father whose
love, inspiration and endless
encouragement made my years of studies an enjoyable and
unforgettable experience. They
deserve special and heartfelt thanks.
-
iv
Table of Contents
Abstract…………………………………………………………………………………………….i
Acknowledgments...........................................................................................................................ii
List of Tables
..................................................................................................................................v
List of Figures
................................................................................................................................vi
List of Abbreviations
...................................................................................................................
vii
Chapter 1: Introduction
...............................................................................................................1
1.1. Waldenström's
Macroglobulinemia..........................................................................................1
1.1.1Waldenström's
Macroglobulinemia.................................................................................1
1.1.2. Incidences, Demographics, and
Etiology........................................................................2
1.1.3.Diagnosis……...…………………...................................................................................3
1.1.4. Clinical Features………………………………………………………………...……...4
1.1.5. Laboratory and Pathological
Findings……………………………………..…………...7
1.1.6. Molecular
Pathology.......…………….............................................................................9
1.1.6.1. Genetics…………..…………………………………………………………....9
1.1.6.2. Epigenetics……………………...…………………………………………….13
1.1.6.3. Microenvironment…...………………………………………………………..14
1.1.7.WM Current Treatments………………….…………….……………………………...15
1.2. PRIMA-1met……………………………………………………………………………....21
1.2.1. P53 and Apoptosis……………………………………………………………………...21
1.2.2. PRIMA-1met………...………………………………………………………………...25
1.3. Rationale, Hypothesis, and Experimental
Aims…………………………………………….30
-
v
Chapter 2: PRIMA-1met Induces Apoptosis in Waldenström’s
Macroglobulinemia
Independent of p53:.……………………………………………………………………………32
2.2. Introduction
...........................................................................................................................32
2.3. Results
…................................................................................................................................34
2.4. Discussion…
..........................................................................................................................42
2.5. Materials and Method……………………………………………………………………….44
2.6. References…………………………………………………………………………………...46
Chapter 3: Discussion……………….………………………………………………………….50
Chapter 4: Conclusions and Future
Directions………………………………………………56
References
.....................................................................................................................................61
-
vi
List of Table
Table 1: p53- activating small molecule drugs utilized in
hematological malignancies………………………24
-
vii
List of Figures
Figure1: B cell maturation in WM……………………………………………………………...5
Figure2: Clinical features of WM……………………………………………………………….7
Figure3:MYD88L265 activation of NF-κB
pathway…………………………………………11
Figure4: Mechanism of p53 driven intrinsic apoptotic
pathway…………………………….22
Figure5: PRIMA-1met structure and mode of
action……………………………………...28
Figure 6: Proposed mechanism linking PRIMA-1met induced P73 and
ROS production..60
Paper Figures:
Figure1: The effect of PRIMA-1met on viability of WM cell lines
and patient samples..…36
Figure 2: The apoptotic effect of PRIMA-1met in WM cell
line.............................................37
Figure3: The effect of PRIMA-1met on apoptotic signaling in
BCWM-1 cells………………….37
Figure 4: Anti-tumor activities of PRIMA-1met in WM
cells…………………………………………..38
Figure5: Effects of PRIMA-1met in combination with current WM
therapeutics……………39
Figure 6: PRIMA-1met cytotoxicity is
P53-independent……………………………………………………40
Figure7: PRIMA-1met effect on BCWM-1 survival is
P73-dependent…….………………………..41
-
viii
List of Abbreviations
AML Acute Myeloid Leukemia
aCGH Array-based Genomic Hybridization
Apaf-1 Apoptotic protease activating factor 1
ASCT Autologous Stem Cell Transplants
AS-PCR Allele Specific Polymerase Chain Reaction
Bax Bcl-2 associated x protein
Bcl-xL B-cell lymphoma-extra Large
Bcl-2 B-cell lymphoma 2
BMNC Blood Mononuclear Cell
BMSC Bone Marrow Stromal Cells
BTK Bruton's Tyrosine Kinase
CAD Caspase-Activated DNase
CAN Chromosomal Numerical Abnormalities
CXCR4 C-X-C Receptor type 4
CR Complete Remission
GLS2 Glutaminase
G6PD Glucose-6-Phosphate Dehydrogenase
HSP70 Heat Shock Protein 70
IAP Inhibitors of Apoptosis Protein
Ig Immunoglobulin
IPSSWM
International Prognostic Staging System for Waldenstrom’s
Macroglobulinemia
IRAK Interleukin-1 Receptor-Associated Kinase
MDM2 Mouse Double Minute 2
MGUS Monoclonal Gammopathy of Undetermined Significance
MM Multiple Myeloma
MPT Mitochondrial Permeability Transition
MQ Methylene quinuclidinone
-
ix
MR Minor remission
MYD88 Myeloid Differentiation Primary response gene 88
NADPH Nicotinamide Adenine Dinucleotide Phosphate
ORR Overall Response Rate
PBMNC Peripheral Blood Mononuclear Cell
PRIMA-1 P53- dependent reactivation and induction of massive
apoptosis
PRDM1 PR Domain Zinc Finger Protein 1
Puma P53 upregulated modulator of apoptosis
REAL Revised European-American Lymphoma
ROS Reactive Oxygen Species
SDF-1 Stromal Cell-Derived Factor-1
SCID Sever Combine Immunodeficient
Smac/DIABLO Second Mitochondria-derived Activator of Caspases/
Direct
IAP- Binding protein with Low PI
TNF Tumor Necrosis Factor
TNFAIP3 Tumor Necrosis Factor Alpha-Induced Protein 3
VGPR Very Good Partial Remissions
WM Waldenström's Macroglobulinemia
WHO World Health Organization
XBP1 X-box Binding Protein 1
-
1
Chapter 1
Introduction
1.1. Waldenström's Macroglobulinemia
1.1.1. What is Waldenström's Macroglobulinemia?
Waldenström's Macroglobulinemia (WM) is a chronic B-cell
lymphoproliferative
malignancy (Gertz,2012).It was first described by Dr. Jan Gösta
Waldenström, a
Swedish internist, in two patients who presented oronasal
bleeding, anemia,
lymphadenopathy, hypergammaglobulinemia, an elevated
sedimentation rate,
hyperviscosity, normal bone survey, cytopenias, and a
predominantly lymphoid
involvement of the bone marrow (Shaheen et al. , 2012). Today,
the World Health
Organization (WHO) defines WM as a lymphoplasmacytic
lymphoma
characterized by plasmacytic infiltration of bone marrow and
immunoglobulin M
(IgM) monoclonal gammopathy (Shaheen et al., 2012). Malignant
cells in WM
are quite various cytologically ranging from small lymphocyte to
plasmacytoid
lymphocytes and plasma cells (Naderi and Yang, 2013). These
cells originate late
in B cell development after somatic hypermutation but before
final differentiation
to plasma cells (Jenz, 2013). Common symptoms of WM includes:
fatigue due to
anemia, thrombocytopenia, hyperviscosity symptoms and in more
severe cases of
the disease; organomegaly, neuropathy and symptoms associated
with Ig
deposition (Treon, 2013).
Historically, any type of lymphoma with high levels of Igs was
associated with
WM; therefore, it was popular to consider WM as a clinical
syndrome that is
associated with various lymphoma types instead of a separate
disease (Shaheen et
al., 2012). Until a few years ago, differential diagnosis of WM
was quite difficult
for hematopathologists both due to inefficient definitions of
the disease and lack
of proper diagnostic tools. In 1994, the Revised
European-American Lymphoma
(REAL) classification defined Lymphoplasmacytic Lymphoma (LPL)
as “a
-
2
diffuse proliferation of small lymphocytes, plasmacytoid
lymphocytes and plasma
cells, with or without Dutcher bodies” (Harris et al., 1994).
This definition
included most cases of WM but most hematopathologists considered
it to be too
broad and not helping with differentiating LPL from the newly
recognized
marginal zone B-cell lymphoma. WHO’s 2001 definition of WM was
even more
confusing since it categorized it as a “neoplasm of small B
cells, plasmacytoid
lymphocytes, and plasma cells, usually involving the bone
marrow, lymph nodes,
and spleen, and commonly associated with hyperviscosity symptoms
and with Ig
levels beyond 3g/dL” (Berger et al. 2001). This definition
allowed the monoclonal
protein to be IgG and IgA as well as IgM and did not address the
issue of low
levels of Ig in initial stages of WM or the fact that diagnosis
based on Ig levels
makes differentiation of WM from non malignant Monoclonal
Gammopathy of
Undetermined Significance (MGUS) impossible (Shaheen et al.,
2012). Based on
the work done by clinicians at the second international workshop
on WM, the
most recent definition of the disease published by WHO in 2008
is: “an LPL
involving the bone marrow and associated with any level of IgM
which involves
the bone marrow in an intertrabecular pattern and typically has
a mature B-cell
immunophenotype therefore lacking CD5 and CD10 on the cell
surface”(
Swerdlow et al. 2008). New technological advances in genetic
testing such as
Allele Specific Polymerase Chain Reaction (AS-PCR) in
combination with recent
findings linking Myeloid Differentiation Primary response gene
88 (MYD88)
mutations and WM, which we will be more fully discussed later on
in this
chapter, have helped with a more accurate means to diagnose WM
patients today.
1.1.2. Incidences, Demographics, and Etiology
WM is a rare incurable disease with 1500 new cases per year in
USA which is
equal to 3-5 persons per million per year ( Swerdlow et al. ,
2008). It accounts for
1% to 2% of all non-Hodgkins lymphomas ( Fonesca and Hayman,
2007). The
median age of incidence is late sixties to early seventies and
is more common
among males than females with a ratio of 1.2 up to 2 reported in
different studies
(Swerdlow et al. , 2008; Fonesca and Hayman, 2007) . Caucasians
seem to be
-
3
more prone to WM compared to their African-American counterparts
(Swerdlow
et al., 2008). Reports indicate an increase in WM incidence in
the past two
decades (Wang et al., 2012). The annual percentage-change for
this population is
1.01% per year. However, significant annual percentage-change
increases were
seen in the group aged 70 – 79 at 1.24% per year (Wang et al.,
2012). WM overall
survival was initially reported to be 5 years but the more
accurate representative
of WM population is the disease-specific survival which is 11
years (Dimopoulos
et al., 1999; Ghobrial et al., 2006).
The etiology of WM is largely unknown. Although some studies
reported
autoimmunity and hepatitis C viral infections to increase the
incidence of WM,
others have rejected these claims; therefore, no definite links
between any
environmental or habit-related factors and WM have been drawn so
far
(Kristinsson et al., 2009; Pozzato et al., 1994). Most cases of
WM are sporadic
and only 20% of the cases are familial. Patients with MGUS have
200-fold higher
chances of developing WM; hence, MGUS is considered a precursor
for WM
(Kyle et al., 2011; Treon et al., 2006)
1.1.3. Diagnosis
To establish the diagnosis of WM, both high levels of IgM and
histological
evidence for lymphoplasmacytic involvement of the bone marrow is
required
(Buske et al., 2013). Therefore, detection of IgM without the
histopathological
evidence or vice versa does not fulfill the criteria for WM.
Presence of IgM
hyperviscosity is confirmed by immunofixation and its level is
measured either by
densitometry or serum nephelometry (Ansell et al. 2010).
Lymphoplasmacytic
cells should be documented through bone marrow aspirations
and
immunophenotyped for presence of CD19, CD20, CD22 and CD79a
(Gertz,
2012). Detection of MYD88 L265P mutation is also an additional
tool to
differentiate WM from rare cases of IgM multiple myeloma, MGUS,
and splenic
marginal zone lymphoma (Treon and Hunter, 2013).
-
4
1.1.4. Clinical Features
The clinical features of WM are quite variable. Around 30% of WM
population
have what is called “smoldering WM”, meaning, they do not have
any signs or
clinical symptoms (Figure 1) (Treon, 2013). This group does have
higher than
normal IgM levels and bone marrow neoplastic involvement but
neither of these
lead to any organ damage or symptoms. The remaining 70% are
symptomatic
patients but their symptoms ranges quite variously (Figure 2).
Some only have
non-specific symptoms such as weight loss, fatigue and or
anorexia. The rest will
have symptoms resulting from one of the following four
mechanisms: 1) tissue
infiltration by lymphoma, 2) serum hyperviscosity, 3)
autoantibodies, and 4) IgM
deposition in tissues (Shaheen et al, 2012).
Symptoms resulting from tissue invasion by tumor cells are
diverse and based on
the affected tissue. The bone marrow is always involved by
lymphoplasmacytic
cells. In 50% of cases WM cells contain Dutcher bodies and
usually invade the
bone marrow in an interstitial/nodular pattern without causing
any lytic bone
lesions (Buske et al., 2013). Tumor infiltration in the bone
marrow generally
results in anemia. Other factors such as deregulated
interleukin-6 (IL-6) and
increased plasma volume are also involved in causing normocytic
and
normochromatic anemia (Ansell et al., 2010). In few cases
thrombocytopenia or
leucopenia also occur as a result of extensive bone marrow take
over by WM.
15% to 20% of WM patients develop lymphadenopathy with
paracortical and
hilar infiltrations as well as moderate involvement of marginal
sinuses (Shahin et
al., 2014). Hepatomegaly and splenomegaly occur in approximately
10% of
patients; and a very small subset of patients develop other
extranodal sites of
disease such as lungs, bowels and stomach (Treon et al., 2014b).
At the time of
relapse, organomegalies such as lymphadenopathy and
hepatosplenomegaly
become very common, in up to 50% of WM patients (Shaheen et al.,
2012)
-
5
Figure1: B cell maturation in WM. WM cells originate late in B
cell
development after somatic hypermutation but before final
differentiation to
plasma cells.
About 10% of patients show symptoms of hyperviscosity (Lin and
Medeiros,
2005). IgM pentamers are secreted by WM cells in to the blood
and these
macromolecules block the small vasculature leading to the
rupture in unsupported
veins and vascular infarcts (Shaheen et- al., 2012). Symptoms of
hyperviscosity
occur at serum viscosity above 3cp and its clinical presentation
includes mucosal
bleeding, loss of visual acuity due to retinal bleeding, and
cerebrovascular
accidents (Gertz, 2013). Owing to the unique physicochemical
characteristics of
paraproteins, patients with the same IgM levels can have
remarkably different
viscosities and symptoms; consequently, serum viscosity is not
an accurate
predictor of the severity of the disease (Shaheen et al.,
2012)
IgM paraprotein can also act as an autoantibody leading to
severe anemia and
neurological manifestations. IgM paraprotein can bind to a
number of neuronal
antigens such as myelin-associated proteins and cell surface
glycolipids and
glycoproteins (Janz, 2013). Approximately, 50% of patients
develop peripheral
-
6
neuropathy that is sensory and distal, while 10% develop
autoantibody related
encephalopathy (Janz, 2013). IgM paraprotein can also bind to
red blood cells
causing hemolytic anemia. Another reason for mucosal bleeding in
WM is the
excess IgM attacking the platelets and von Willebrand factor
that are involved in
coagulation process (Dimopoulos et al., 2000). IgM paraprotein
can rarely bind to
basement membranes resulting in glomerulonephritis and retinitis
leading to renal
failure and loss of vision acuity. There have been also reports
of peptic ulcer or
protein losing enteropathy in WM patients which is believed to
be due to
paraprotein binding to gastric parietal cells (Fonesca and
Hayman, 2007).
Cryoglobulins and cold agglutinin disease in WM patients are two
other
symptoms resulting from paraprotein binding to self (Stone,
2011)
Figure2: Clinical features of WM. WM patients are quite various
in their
clinical presentation. Some are asymptomatic and the rest have a
range of
different symptoms resulting from tissue infiltration by
lymphoma, serum
hyperviscosity, autoantibodies, and IgM deposition in tissues.
(Adapted from
Treon, 2013)
-
7
IgM deposition in tissue is the least common indication of WM.
Amyloidosis,
skin plaques, diarrhea and proteinuria are only some of the
consequences of IgM
deposits (Shaheen et al., 2012).
1.1.5. Laboratory and Pathological Findings
Characterizing the paraprotein is quite essential in the lab
workup of WM
patients. A serum protein electrophoresis should visualize an M
spike in
gammaglobulin region (Gertz, 2012). As mentioned before, serum
IgM level
above 5g/dl as well as viscosity beyond 3cp are required for the
diagnosis of WM
(Ansell et al., 2010). Up to 80% of patients with WM have
monoclonal
immunoglobulin light chains (Bence-Jones proteins) in their
urine (Morel and
Merlini, 2012). Laboratory evaluations should also include β2
microglobulin
measurements since its increased level has been associated with
poor prognosis
(Anagnostopoulos et al., 2006). In general, the following
features are proposed to
be adversely affecting prognosis in WM patients: age >65
years, hemoglobin
7 g/dL (Morel et al., 2009). These factors are usually
considered for risk stratification of the patients and treatment
planning.
Complete blood count in WM patients usually indicates
leukocytosis,
thrombocytopenia, and anemia (Treon, 2014b). In addition to
cytopenia, WM
patients’ blood smear usually exhibit a purplish blue background
due to the excess
paraprotein in serum taking up the Giemsa staining. Erythrocytes
also form
clusters as the result of their sticky surfaces due to their
surfaces being coated by
the paraprotein (Shaheen et al., 2012). Bone marrow smears on
the other hand can
be either normal in respect to number of cells or overly crowded
with virtually all
nucleated cells being lymphocytes (Shahin et al., 2014). As
mentioned earlier,
bone marrow invasion patterns by neoplastic cells is either
intertrabecular or
interstitial. Both cytoplasmic (Russell bodies) and nuclear
(Dutcher) inclusions
are commonly detected in these neoplastic cells. Lymphocytes can
present a range
of cytological variations in WM, ranging from small lymphocytes
to plasmacytoid
-
8
lymphocytes or even cells resembling mature plasma cells
(Remstein etal., 2003).
These plasma cell-like cells are usually few in number unless
the disease is
transforming to a more aggressive form of lymphoma. As expected,
a correlation
between IgM levels in the blood and neoplastic plasma cell
numbers in the bone
marrow was observed in WM (Ansell et al., 2010). Various
proportion of each of
these three types of B-cells has been reported by different
pathologists and can
potentially be an indication of differences in disease
aggressiveness; however, the
prognostic value of these differences has not yet been proven
(Shaheen et al.,
2012)
In the lymph nodes, the pattern of involvement is quite variable
but they never
show any evidence for marginal zone involvement. Cytologically,
the neoplastic
cells in the lymph nodes show the same cytologic spectrum that
is observed in the
bone marrow and Dutcher bodies can be numerous (Sewerdlow et
al., 2008). The
patterns of invasion in extramedullary regions include around
the portal tracts in
the liver and surrounding the white pulp nodules in the spleen.
Extranodal regions
such as skin, gastrointestinal tract and lungs can also be
involved and it is usually
an indication of disease progression or relapse (Lin et al.,
2003)
1.1.6. Molecular Pathology
Despite recent efforts to clarify the molecular mechanism of WM
pathogenesis,
the molecular basis of WM initiation and progression is not
quite understood.
Attempts to illuminate the molecular pathology of WM can be
categorized in 3
groups: genetics, epigenetic, and microenvironment.
1.1.6.1. Genetics
Historically, WM cells’ slow proliferating nature was one of the
main challenges
for the scientific study of the genetic basis of the disease.
This obstacle was
overcome through the technological advances of sequencing in the
past century
(Binachi et al., 2013). Recent whole-genome sequencing
techniques such as
Array-based Genomic Hybridization (aCGH) and massively parallel
DNA
-
9
sequencing are two of the techniques used for high resolution
analysis of WM
patients’ genome without the need for tumor cell division. In a
recent array-based
comparative genomic hybridization study, 83% of newly diagnosed
WM patients
showed altered genome with a median of 4 Chromosomal
Numerical
Abnormalities (CNA) per case (Poulain et al., 2013a). Low
prevalence of biallelic
deletions and high-level amplifications has allowed experts in
the field to
categorize WM as a simple cancer that genetically is more
closely related to
Chronic Lymphocytic Leukemia (CLL) than to Multiple Myeloma (MM)
(Poulain
et al., 2013a; Chng et al., 2006). CNAs were found to be more
frequent in
symptomatic WM patients in comparison to smoldering patients.
Gain of 4q and
deletion of 13q are two abnormalities that were also more
frequent in
symptomatic cases (Poulain et al., 2013a). Furthermore, a
genome-wide linkage
analysis between WM and IgM MGUS patients identified a high
linkage on 4q33-
q34, denoting both linkage and common susceptibility factors in
both diseases
(Kyle et al., 2011). Based on the latest findings, two of the
most frequently
mutated genes identified in WM are MYD88 and C-X-C Receptor
type
4 (CXCR4) (Binachi et al., 2013).
Treon and colleagues initially reported MYD88 mutation in high
frequency in 30
WM patients which was later confirmed by many groups around the
globe (Treon
et al., 2012; Poulain et al., 2013a; Xu et al., 2013). In this
study, next generation
sequencing detected a MYD88 mutation that was a single
nucleotide change,
T→C, leading to a leucine to proline switch at amino acid 265.
The frequency of
the MYD88 L265P mutation among familial and sporadic cases was
100% and
86% respectively. Only 4 patients had acquired homozygous
mutations and the
rest were heterozygous with the mutation expressing in both
CD19+ and CD138+
cells (Treon et al., 2012). Knockdown and inhibition studies of
MYD88 L265P
associates it with cell survival promotion by spontaneous
assembly of Interleukin-
1 Receptor-Associated Kinase (IRAK) 1 and 4, leading to
IRAK1
phosphorylation by IRAK4 and activation of NF-κB (Figure3) (Yang
et al., 2013).
Bruton's Tyrosine Kinase (BTK) is another downstream target of
MYD88 L265P
-
10
which was shown to activate the NF-κB independent of IRAK
pathway.
Simultaneous inhibition of BTK and IRAK led to a stronger
inhibition of NF-κB
Figure3:MYD88 mutation in WM. More than 90% of WM cases bear
MYD88
L265P mutation which results in IRAK1 phosphorylation by IRAK4
and
activation of NF-κB..Given the frequent mutation in various
members of NF-κB
pathway, NF-κB is considered to be a key player in WM
pathology.
and synergistic killing in WM cells (Yang et al., 2013).
Although MYD88 L265P
mutation has been correlated with higher levels of IgM and bone
marrow
involvement in WM patient, no significant difference in response
rates to
treatment and overall survival was noted (Treon et al., 2014a).
AS-PCR studies
have demonstrated MYD88 L265P in 50-80% IgM MGUS cases which
suggests
an early oncogenic role in WM pathogenesis for this mutation and
that other
genomic events are required for WM disease progression (Landgren
and Staudt,
2012)
-
11
Sanger sequencing identified CXCR4 mutations in 32% of WM
patients and
associated it with drug resistance caused by ERK1/2 and AKT
overactivation.
98% of CXCR mutant patients also exhibited the MYD88L265P
mutation (Hunter
et al., 2014). In a very recent epidemiological study by Treon
et al., in 175 WM
patients, MYD88 and CXCR4 status were linked to patient’s
clinical presentation
and response to treatment. Patients with MYD88 L265P/ CXCR4
mutant
displayed higher marrow burden, elevated levels of serum IgM,
and were more
likely to have symptomatic disease requiring therapy at initial
diagnosis (Treon et
al., 2014a)
Similar to many other hematological malignancies, deletion of
various regions of
6q was reported in WM, in more than 42% of cases (Schop et al.,
2002). PR
Domain Zinc Finger Protein 1 (PRDM1) and Tumor Necrosis Factor
Alpha-
Induced Protein 3 (TNFAIP3) are two of the candidate genes of
these regions.
PRDM1 has been implicated in repression of cell proliferation
and down-
regulation of Paired box Protein 5 (PAX5) and ER stress protein
X-box Binding
Protein 1 (XBP1) (Bianchi et al., 2013). TNFAIP3 is a suppressor
of NF-κB
pathway. 38% of WM cases have monoallelic while 5% have
biallelic inactivation
of TNFAIP3 (Mitsiades, 203). Given all the mutations mentioned
so far that target
the NF-κB pathway proteins, NF-κB pathway is believed to be one
of the major
players in WM pathology.
1.1.6.2.Epigenetics
miRNAs are small, non-coding, 18-24 nucleotide RNAs, described
for the first
time in the nematode Caenorhabditis elegans (Lee et al., 1993) .
They play major
roles in regulating mRNA targets involved in development, cell
differentiation,
apoptosis, and cell proliferation (He and Hannon, 2004). WM has
a specific
miRNA signature that is different from that of their normal
counterpart. In a
recent study miRNA-363*, -206, -494, -155, -184, -542-3p
demonstrated
increased expression while miRNA-9* was decreased in WM patients
(Hodge et
al., 2011)
-
12
miRNA-155 has been shown both in-vitro and in-vivo to play a
pivotal role in the
pathology of WM (Roccaro et al., 2009) . Knock down study of
miRNA-155 in
WM illustrated its role as a regulator of cell cycle. miRNA-155
knocked-down
cells had decreased percentage of S phase cells as the result of
cyclin inhibition
and p53 overexpression. miRNA-155 silenced cells also exhibited
significant
inhibition of migration and adhesion to fibronectin compared to
control in WM,
denoting the crucial role of miRNA-155 in migration and
expansion of the
malignant cells in the bone marrow (Roccaro et al., 2009).
miRNAs also interfere with the epigenetic machinery by
regulating the expression
of DNA methylation enzymes or histone modification complexes
(Sato et al.,
2011). Primary WM cells are already characterized by increased
expression of
Histone Deacetylase (HDAC)-2, -4, -5, -6, -8, -9, and
significant decrease in
expression of Histone Acetyl Transferase-1 (HAT-1) (Roccaro et-
al., 2010). WM
cells transfected with pre-miRNA-9*- and anti-miRNA-206
displayed an
upregulated acetyl histone-H3 and H4 as a result of HDAC
regulation that led to
reduction in cell proliferation and increase in cell toxicity in
WM (Roccaro et al.,
2010).
1.1.6.3.Microenvironment
Bone marrow is the main tissue involved by WM. Bone marrow’s
structure is
quite complex in that it contains cells from various lineages
(e.g. stromal, mast,
and epithelial cells) and blood vessels that support and
maintain the hematopoietic
lineage (Nagasawa, 2006). This microenvironment plays a pivotal
role in B-cell
homing and expansion (Ghobrial and Witzig, 2004 ). Various
components of
bone marrow microenvironment have been implicated in WM tumor
growth,
survival and drug resistance by several studies (Ngo et al.,
2008; Poulain et al.,
2009; Tournilhac et al., 2006).
-
13
WM cells co-cultured with stromal cells leads to resistance to
therapeutic agents
such as bortezomib and other proteasome inhibitors (Ngo et al.,
2008). Tournhilac
et al. demonstrated that WM co-cultured with mast cells leads to
cell proliferation
and expansion (Tournilhac et al., 2006). Furthermore, WM
patients have a 30-
40% increase in bone marrow vascular density and primary WM
endothelial cells
present a higher expression of ephrin-B2, an important regulator
of cell motility,
suggesting an important role for endothelial cells in WM
pathology (Terpos et al.,
2009).
On the other hand, WM cells themselves have been shown to
express high levels
of chemokines and adhesion receptors such as CXCR4. CXCR4 is
essential for
the migration of WM cells and its knockdown leads to inhibition
of migration,
transendothelial migration and adhesion of WM cells (Ngo et al.,
2008). Stromal
Cell-Derived Factor-1 (SDF-1) is a CXCR4 ligand primarily
produced by stromal
cells. The major biological effects of SDF-1 are related to the
ability of this
chemokine to induce motility, adhesion, and secretion of
angiopoietic factors
(Kucia et al., 2004). Similar to increased expression of CXCR4,
SDF-1 levels in
the bone marrow of WM patients was significantly higher compared
with that of
normal controls (Ngo et al., 2008). CXCR4/SDF-1 interaction
promotes activation
of some very important signaling pathways such as focal adhesion
kinases,
MAPK, ERK-1, PI3K, AKT, PKC, and NF-κB pathways (Kucia et al.,
2004).
Proteomic studies have already demonstrated an increased Akt
expression in WM
as well as elevated expression of ERK pathway proteins; taken
together,
CXCR4/SDF-1 interaction seems to play a significant role in WM
biology
(Mitsiades et al., 2003).
1.1.7.WM Current Treatments
The diversity in clinical presentations and lack of effective
therapies for WM
patients has made planning the right treatment approach a
challenging task for the
clinicians. Based on risk factors that we already discussed in
section 1.1.5,
-
14
International Prognostic Staging System for Waldenström's
Macroglobulinemia
(IPSSWM) categorizes WM patients in 3 groups with significantly
different 5-
year survival rates: low risk (87%), mid risk (68%) and high
risk (36%) (Morel et
al., 2009). These categorizations as well as the consideration
of chronic nature of
the disease are helpful tools for deciding on the correct method
of treatment.
Patients with smoldering WM are managed with a watch-and-wait
approach and
do not require any therapies (Morel et al., 2009). In
Garcia-Sanz et al. study, more
than 50% of smoldering cases did not require therapy for almost
3 years and 1 in
10 patients did not require therapy for 10 years (García-Sanz et
al., 2001). Only
WM patients who show symptoms are administered treatments and in
WM these
symptoms include : constitutional symptoms including fever,
night sweats or
weight loss, lymphadenopathy or splenomegaly, hemoglobin
-
15
rituximab (FCR) regimen. The Overall Response Rate (ORR)
associated with this
combination therapy was 79%, including 11.6% Complete Remission
(CR) and
20.9% Very Good Partial Remissions (VGPR). Despite the
favourable results,
myelosuppression in 45% of cases led to discontinuation of the
treatment in most
patients (Tedeschi et al., 2012). Nucleoside-analogue treated WM
cases have an
increased incidence of transformation to non-Hodgkin’s lymphomas
and the
development of myelodysplasia which limits their use (Ansell et
al., 2010). In
another combination therapy, combination s of dexamethasone,
rituximab, and
cyclophosphamide (DRC) resulted in an ORR of 83% in previously
untreated
WM patients, of which 7% were CR and only 9% of patients
experienced grade 3
or 4 neutropenia (Dimopoulos et al., 2007). In a recent trial,
34 WM patients were
treated with rituximab, cyclophosphamide, doxorubicin
hydrochloride,
vincristine sulfate, and prednisone (R-CHOP ) and 30 patients
with CHOP with
no rituximab. Patients receiving R-CHOP exhibit a longer time of
progression
compare to CHOP treated group and had a significantly higher ORR
with no
major differences in general toxicity (Buske et al., 2009).
There is a consensus
that an alternative rituximab and chemotherapy combination
regimen should be
used if the relapse occurs within the first year, which means
that if in the first
round rituximab was used in combination with a purine analogue,
after the relapse
it should be used in combination with an alkylating agent or
vise versa (Ansell et
al., 2010). Treon et al. reported an ORR of 83.3% in 30 relapsed
WM patients
treated with bendamustine in combination with rituximab (BR).
The only down
side of this combination was that it showed an increased
myelosuppression in
patients who had previously been treated with nucleoside analogs
as was expected
(Treon et al., 2011).
Bortezomib which is a first generation proteosome inhibitor is a
novel WM
treatment that exerts its effect through inhibition of NF-κB
pathway (Treon,
2013). As it was eluded to , NF-κB pathway plays an important
role in WM
pathology, therefore, bortezomib single or combination
treatments has been quite
effective in managing WM patients (Treon, 2013). In a clinical
trial bortezomib,
-
16
dexamethasone, and rituximab (BDR) combination was administered
to 23
previously untreated symptomatic WM patients, ORR was measured
to be 96%
with 3 patients in CR, 2 near CR, 3 VGPR, 11 PR, and 3 MR. In
this study, 30%
of patients exhibited grade 3 peripheral neuropathy (Treon et
al., 2009b). A
separate study by Ghobrial et al. reported an ORR of 88% in a
bortezomib and
rituximab (BR) combination on symptomatic WM. This study did not
show any
grade 3 or 4 neuropathies and its most significant side effect
was neutropenia
(Ghobrial et al., 2010a). In comparison to R-CHOP, BR treatment
resulted in
fewer relapses, was better tolerated, and was associated with a
longer progression
free survival, despite identical response rates. In another
study, single agent
bortezomib in relapsed or refractory WM patients resulted in
78%-85% Minor
remission (MR) or greater in patients with relapsed or
refractory WM (Chen et al.,
2009). The only down fall of bortezomib is its neurotoxicity
which makes it
especially unsuitable for patients with pre-existing
neuropathies making it an
unsuitable frontline treatment for low to mid risk WM patients (
Ansell et al.,
2010). Bortezomib is not myelotoxic, and long-term follow-up in
Waldenström
patients did not show any risk of the disease developing to
higher grade
malignancies as happens in nucleoside-based treatments (Treon,
2013).
Autologous Stem Cell Transplants (ASCT) is another option for WM
treatment
that is only used on younger patients with aggressive cases who
had not been
previously treated with nucleoside-based treatments. In a
retrospective analysis of
158 WM patients who underwent ASCT, the overall survival was
68.5% and
nearly 50% of the patients remained progression free after 5
years. Non-relapse
mortality rate for this group was as low as3.8%, making ASCT a
viable option for
WM treatment (Kyriakou et al., 2010a). Unlike ASCT, Allograft
Stem Cell
Transplantation (alloSCT) was discovered to be quite risky and
30% of these WM
patients experience non-relapse mortality; therefore, its use
has been limited to
clinical trial settings (Kyriakou et al., 2010b).
-
17
In light of recent molecular findings about WM pathogenesis,
many novel
therapeutics are either being tested in clinical trials or are
on their way to a
clinical trial. Next generation monoclonal antibodies and
proteosome inhibitors,
immunomodulators, mTOR inhibitors, Bruton tyrosine kinase
inhibitors, and
HDAC inhibitors are some examples of these novel therapies
(Leblebjian et al.,
2013).
Ofatumumab (OFA) is a monoclonal antibody against both the large
and small
extracellular loops of CD20. In OFA trials as a single-agent in
37 relapsed WM
patients, an ORR of 59% with a lower incidence of IgM ‘flare’ as
compared to
rituximab was achieved and developing infections was its only
side effect (Gupta
and Jewell, 2012).
Carfilzomib is a second generation proteosome inhibitor which is
proven to be
non-neurotoxic. In a recent phase II trial, a combination of
carfilzomib, rituximab
and dexamethasone was administered to 20 mostly untreated WM
patients. The
ORRs and major response rates were 75% and 50% respectively,
with 1 VGPR, 9
PR, and 5 MR. All drug related toxicities were reversible and,
except in one
patient with a grade 2 peripheral neuropathy, there were no
neuropathological side
effects (Treon et al., 2014b).
Thalidomide and lenalidomide, two immunemodulators, have also
been studied
on WM in hopes to potentiate rituximab-mediated cytotoxicity.
Despite 50-75%
ORRs, combining rituximab with both thalidomide and lenalidomide
were
accompanied by severe toxicities (Treon et al., 2008; Treon et
al., 2009a). In the
case of lenalidomide, the trial was stopped after almost all the
patients developed
significant anemia (Treon et al., 2009a). It is believed that
optimization of the
dose and protocol used are required for its future use in WM;
therefore, phase I
trials of lenalidomide are underway (Leblebjian et al.,
2013).
.
-
18
Considering the elevated levels of several proteins from the
Akt/mTOR pathway
and their role in tumor survival in various hematological
malignancies,
everolimus, an mTOR inhibitor has also been studied in 50
patients with relapsed
or refractory WM (Mitsiades et al., 2003). Everolimus ORR in WM
was 70%
with PR of 40% and MR of 30%. The most important adverse effects
observed
were cytopenias and pulmonary infections (Ghobrial et al.,
2010b). In another
study, the combination of everolimus, bortezomib and rituximab
was investigated
in relapsed/refractory patients and showed an ORR of 74% with
5%CR, 30%PR,
and 39% MR. The major side effects included 24% anemia, 15%
thrombocytopenia and 15% neutropenia (Ghobrial et al.,
2011).
Finally, given the very recent discovery of MYD88 and BTK’s role
in WM
pathology, ibrutinib, a BTK inhibitor, has become the subject of
several clinical
trials. Ibrutinib was initially found efficacious in managing
hematological
malignancies in a trial investigating its effect on a variety of
B-cell malignancies
including WM (Advani et al., 2013). In a more recent phase II
trial on 63 relapsed
WM patients with average 2 previous treatments, ibrutinib was
able to induce
81% ORR with PR or better of 57.1% and a fast response time. No
neurological
toxicity was observed and two of the more frequent side effects
of the treatment
were thrombocytopenia (14.3%) and neutropenia (19.1%) (Treon et
al., 2013).
Despite the significant advances in regards to WM therapeutics,
studies have not
demonstrated any improvement in the patients’ outcome over the
last 25 years
(Kristinsson et al., 2013). WM remains an incurable disease with
currently
available therapy, and the quest for finding a more effective
therapeutic approach
continues.
1.2. PRIMA-1met
1.2.1. p53 and Apoptosis
p53 is a transcription factor which takes part in various
cellular processes such as
cell-cycle arrest, senescence, apoptosis and metabolism. As a
stress sensor, p53
-
19
plays a pivotal role in transmitting stress-induced signals in
order to restrict the
cell proliferation in the wake of DNA damage, oncogenesis, and
hypoxia. In fact,
in order to divest the cell of its anti-tumoregenic effects, in
approximately 50% of
human cancers, p53 gene is mutated and in the majority of the
rest it is
deactivated through alternative mechanisms such as
overactivating p53 inhibitors
or silencing its co-activators ( Bieging et al., 2014).
In normal conditions, p53 has a very short half life due to the
activity of its E3
ligase Mouse Double Minute 2 (MDM2), leading to p53 proteosomal
degradation.
p53 is activated by both external and internal stimuli that
promote its nuclear
accumulation. p53 activation involves stabilization of the
protein and
enhancement of its DNA binding (Yee and Vousden 2005) . The sum
of the
pathways induced by p53 activation will determine whether the
cell will undergo
growth arrest or apoptosis. The latter is shown to be crucial
for p53 suppression of
tumors (Haupts et al., 2003).
Apoptosis is a recognized mechanism of programmed cell death. It
is both a
homeostatic mechanism to maintain cell populations and a defense
mechanism in
reaction to cell damage (Elmor, 2007). Apoptosis is a complex
cascade of events
that primarily involves activation of a group of proteases
called caspases. The
mechanism of apoptosis is very complex and is composed of two
main pathways:
extrinsic or death receptor pathway and intrinsic or
mitochondrial pathway
(Figure 4). These two pathways in the end converge and cleave
caspases 3,7, and
6 resulting in DNA fragmentation, degradation of cytoskeleton,
formation of
apoptotic bodies, and expression of cell surface ligands for
phagocytic cell
(Haupts et al., 2003). Caspase 3 is the main executioner caspase
which is
activated by all initiator caspases. It activates the
endonuclease Caspase-Activated
DNase (CAD) which degrades chromosomal DNA. Caspase 3 also
reorganizes
and disintegrates the cell into apoptotic bodies (Elmore,
2007).
-
20
The extrinsic pathway of apoptosis involves activation of death
receptors that are
members of the Tumor Necrosis Factor (TNF) receptor superfamily.
Upon TNF
activation a death-inducing signaling complex is formed leading
to autolytic
activation of initiator caspase, caspase 8. Caspase 8 then goes
on to catalyze the
activation of caspase 3 (Elmore, 2007). p53 can activate the
extrinsic apoptotic
pathway through the induction of genes encoding receptors
involved. For
example, p53 may enhance levels of Fas, a member of TNFR family,
at the cell
surface by promoting its translocation to the membrane. This may
allow p53 to
rapidly sensitize cells to Fas. The type of receptor
overexpressed by p53 seems to
be cell type specific (Zilfou and Lowe, 2009).
Mechanism of intrinsic pathway of apoptosis is much more
complex. The intrinsic
pathway of apoptosis is based on permeabilization of the
mitochondria
membrane. Opening of the Mitochondrial Permeability Transition
(MPT) pores
leads to loss of mitochondrial potential and release of
pro-apoptotic proteins:
cytochrome c and Second Mitochondria-derived Activator of
Caspases/ Direct
IAP-Binding protein with Low PI (Smac/DIABLO). Released
cytochrome c
complexes with Apoptotic protease activating factor 1 (Apaf-1)
and procaspase 9,
forming an “apoptosome” which activates caspase 9. Smac/DIABLO
complex
promote apoptosis by inhibiting Inhibitors of Apoptosis Proteins
(IAP) (Galluzzi
et al., 2011).
Mitochondrial membrane permeability is regulated through B-cell
lymphoma 2
(Bcl-2) family of proteins. There are 25 genes identified in the
Bcl-2 family that
are either pro-apoptotic or anti-apoptotic (Czabotar et al.,
2014). Bcl-2 and B-cell
lymphoma-extra large (Bcl-xL) are two examples of anti-apoptotic
members of
this family. Downregulation of both Bcl-2 and Bcl-xL in various
cancer types has
led to induction of apoptosis or enhancement of chemosensitivity
(Yamanaka et
al., 2006; McDonnell and Korsmeyer, 1991). Pro-apoptotic members
of Bcl-2
family on the other hand, carry out their function either by
neutralizing the anti-
-
21
apoptotic members or activating the pro-apoptotic effector Bcl-2
associated x
protein (Bax).
Figure4: Mechanism of apoptotic program cell death. Apoptosis is
a complex
cascade of events that primarily involves activation of a group
of proteases called
caspases. It is composed of two main pathways: extrinsic or
death receptor
pathway and intrinsic or mitochondrial pathway. (Adapted from
Elmore, 2007)
Bax exerts its effect through opening the mitochondrial membrane
channels as
well as forming oligomeric pores (Czabotar et al., 2014). P53
upregulated
modulator of apoptosis (Puma) and Noxa are members of the Bcl-2
family that
-
22
are pro-apoptotsis. Puma was shown to change Bax conformation
and promote its
translocation to the mitochondria (Yu et al., 2001).
Studies on Noxa indicate its interaction and disruption of
anti-apoptotic Bcl-2
family members, resulting in the activation of caspase 9 (Oda et
al., 2000). p53
has a pivotal role in regulating Bcl-2 family of proteins.
Induction of apoptosis by
p53 involves both transcription-dependent and
transcription-independent
functions of p53. p53 upregulates pro-apoptotic genes containing
p53-responsive
elements such as Puma, Noxa and Bax while down regulating the
anti-apoptotic
members Bcl-xL, Bcl-2 and Mcl-1 (Haupt et al., 2003). p53 also
directly binds
and activates Bax and inactivates Bcl-xL without the need to
regulate their genes(
Geng et al., 2010; Bharatham et al., 2011).
Table 1: p53 activating small molecule drugs
utilized in hematological malignancies. (Adapted from Saha et
al., 2013b)
-
23
Given the tumors suppressive effects of p53, developing means to
activate p53
has been subjected to intensive studying. Some of the potential
approaches for
cancer therapeutics targeting p53pathway includes: p53 gene
therapy, drugs
activating targets of p53, and small molecules activating p53 or
disrupting p53
inhibitors (Table1) (Wang and Sun, 2010).
1.2.2. PRIMA-1met
P53- dependent reactivation and induction of massive apoptosis
(PRIMA-1) is a
small molecule initially identified in a cell-based assay for
screening of chemical
libraries searching the National Cancer Institute database. In
this assay, PRIMA-1
was able to induce cell death in osteosarcoma cell line Saos-2
expressing p53
mutant His 273 under a tetracycline driven promoter (Bykov et
al., 2002). A
methylated form of PRIMA-1, dubbed PRIMA-1met, was later
discovered and
reported to be biologically more active than the original
compound (Bykov et al.,
2005). Both compounds’ ability to induce cell death has been
confirmed in
several solid tumors and hematological malignancies in-vitro,
in-vivo, and ex-
vivo on primary samples (Aryee et al., 2013; Bao et al., 2011;
Ali et al., 2011;
Nahi et al., 2008) .
In a break through study, Lambert and colleagues identified the
kinetic and
chemical properties of PRIMA-1 and PRIMA-1met (Lamber et al.,
2009). It was
reported that half of the starting material of both PRIMA-1 and
PRIMA-1MET
was decomposed in 32.6 hr in-vitro. They also identified the
decomposition rate
of PRIMA-1 in-vitro and in animal models to be 4h and 1h
respectively. PRIMA-
1 was then uncovered to be rapidly excreted into the urine in
their mouse model.
Methylene quinuclidinone (MQ) is one of the compounds derived
from PRIMA-1
and PRIMA-1met during decomposition. MQ has a double bond which
is highly
reactive and prone to nucleophilic additions (Lamber et al.,
2009). Thiol groups
are favorable targets for MQ in this reaction. Further
investigations confirmed that
production of MQ is essential for PRIMA-1 biological effects.
The importance of
-
24
thiol modification in the apoptotic effects of PRIMA-1 was also
proven using
inhibitors of thiol modification. Mutant p53 (mut p53) has many
exposed thiol-
containing cysteine residues on its surface making it a suitable
target for PRIMA-
1. Formation of disulfide bonds as the result of these exposed
thiol groups can
potentially lock mut p53 in an unfolded conformation. Disruption
of these
unwanted disulfide bonds by MQ can result in mut p53 proper
folding and
efficient binding to DNA (Lamber et al., 2009). Wild-type p53
(wt p53) was also
shown to be able to form bonds with MQ depending on the degree
of its unfolded
status (Lamber et al., 2009).
PRIMA-1met has shown great cytotoxicity towards various solid
tumors and
hematological malignancies (Zandi et al., 2011; Zache et al.,
2008; Ali et al.,
2011). Results from PRIMA-1met recent phase I/II clinical trial
in prostate cancer
and several hematological malignancies have also been promising
(Lehmann et
al., 2012). Most of PRIMA-1met’s adverse effects were reversible
and mild ones
such as fatigue, dizziness, headache, and confusion. No bone
marrow toxicity was
detected (Lehmann et al., 2012).
The exact molecular mechanism of PRIMA-1met effects is still
elusive and seems
to be quite dependent on cellular context. As was mentioned
before, PRIMA-1met
was initially discovered as a mut-p53 reactiving small molecule.
Some studies on
breast, colon, and small cell lung cancer cell lines portrayed a
mut p53-dependent
mechanism through knock down studies (Lambert et al., 2010;
Zandi et al., 2011;
Lambert et al., 2009). Zandi et al. reported PRIMA-1met effects
through
activating mut p53 and upregulating its downstream
transcriptionally regulated
targets such as p21, MDM2, and Bax in small cell lung cancer
(Zandi et al.,
2011). Others have reported nucleolar translocation of p53 and
its stabilization by
Heat Shock Protein 70 (HSP70) (Rokaeus et al., 2007). PRIMA-1met
also
activates mutant p53 through phosphorylation at its serine 15
and upregulates the
expression of p53 and its proapototic targets, Bax and puma in
colorectal cell
lines (Lambert et al., 2010).
-
25
Despite previous reports of mut p53-dependent effect of
PRIMA-1met, Ali and
colleagues described the cytotoxic effect for PRIMA-1met in
Acute Myeloid
Leukemia (AML) primary samples to be independent of p53 status
(Ali et al.,
2011). The same phenomenon was observed in melanoma cell lines
when
PRIMA-1met did not show any significant difference in apoptosis
between mut
p53 and wt p53 cell lines both in-vitro and in-vivo (Bao et al.,
2011). Recently,
Saha et al. has taken this story one step further and
demonstrated that PRIMA-
1met exerted its effect in a p53-independent manner in MM ( Saha
et al., 2013a).
In this study, PRIMA-1met was denoted to activate p73 which led
to induction of
apoptosis in a Noxa- dependent fashion (Saha et al., 2013a). A
study conducted
by Tessoulin et al. confirms Saha et al.’s findings in regards
to p53-independent
PRIMA-1met –induced apoptosis that is deiven by activation of
Noxa (Tessoulin
et al., 2014).
Based on current knowledge of PRIMA-1met chemistry,
theoretically, changes in
the activity of any protein containing a thiol group by
PRIMA-1met is possible as
long as the structural and sterical context of the thiol group
allows such reaction.
Therefore, activating other targets beside p53 that lead to cell
death is quite
possible. As highlighted in the previous paragraph, one such
possible target was
recently proposed to be p73 (Saha et al., 2013a). Thioredoxin
Reductase 1 is
another target which was discovered to be inhibited and
converted to an NADPH
oxidase enzyme independent of cell lines’ p53 status leading to
an increase in
Reactive Oxygen Species (ROS) production in the cells and
consequently their
apoptosis (Peng et al., 2013). Furthermore, Tessoulin and
colleagues also
confirmed that disrupting the GSH/ROS balance through impairing
glutathione
synthesis in MM plays an important role in PRIMA-1met -induced
apoptosis
(Tessoulin et al., 2014). Taken all together, these findings
provide an explanation
for the previously observed effects of PRIMA-1met on tumor cells
lacking p53.
-
26
Figure5: PRIMA-1met structure and mode of action: Methylene
quinuclidinone (MQ) is one of the compounds derived from
PRIMA-1met during
decomposition. PRIMA-1met was initially discovered in an
screening for
compound activating mutp53. Wild-type p53 (wt p53) was also
shown to be able
to form bond with MQ depending on the degree of its unfolded
status.
-
27
1.3. Rationale, Hypothesis, and Experimental Aims
Molecular tools that take advantage of apoptotic effects of p53
to eradicate cancer
cells have been greatly researched in hematological malignancies
both in the lab
and clinics. PRIMA-1met is one such compound that has shown
great killing
abilities against various solid and hematological cancers.
Despite the vast number
of studies, given the conflicting reports, we are still in the
dark in regards to the
PRIMA-1met mechanism of action (Figure 5). It is therefore
paramount that
separate functional and mechanistic studies are conducted for
each cancer type
using specific and targeted tools.
On the one hand, current treatments are lacking in managing WM
patients and
their side effects are greatly affecting patients’ quality of
life. On the other hand,
PRIMA-1met has shown promising results in both pre-clinical and
phase I/II
clinical studies in a number of haematological malignancies such
as CLL and MM
that are closely related to WM in both clinical presentations
and genetic makeup.
Therefore, we hypothesized that PRIMA-1met has anti-tumor
activity against
WM cell lines and primary samples. This study is an attempt to
provide the pre-
clinical framework for evaluation of PRIMA-1met either alone or
in combination
with current therapies as a novel therapeutic approach for
treatment of WM
patients.
The aims of this study are:
1) To investigate the anti-tumorigenic effects of PRIMA-1met on
WM:
Explore whether PRIMA-1met induces cell death in WM cell line
and primary
samples. Examine the mode of PRIMA-1met- induced cell death.
Evaluate the
effect of PRIMA-1met on WM cell migration and colony
formation.
2) To elucidate the signaling pathway affected by PRIMA-1met:
Assess the
expression of apoptotic markers such as PARP and caspase
cleavage, p53, and
MDM2 through western blot analysis of lysates from cells treated
with PRIMA-
1met.
-
28
3) To examine the combinatory effect of PRIMA-1met and current
WM
therapies: Using the correct concentration range found in Aim 1,
determine what
type of drug interactions will PRIMA-1met show in combination
with sub-
therapeutic doses of bortezomib or dexamethasone in WM cell
line.
-
29
Chapter2:
PRIMA-1MET Induces Apoptosis in Waldenström's
Macroglobulinemia
Independent of p53
Introduction:
Waldenström’s Macroglobulinemia (WM) is a low grade
lymphoplasmacytic
lymphoma characterized by infiltration of bone marrow with
malignant B cells
and IgM monoclonal gammopathy (Ansell et al., 2010). Reports
show an increase
in WM’s incidence over the past 20 years (Gertz, 2012). In US,
almost 1500 new
cases of WM are reported annually (Shaheen et al., 2012). WM
patients are quite
heterogeneous with respect to clinical presentation, varying
from an
asymptomatic to highly aggressive disease, and their responses
to treatment.
Given current therapies, WM remains incurable, and most patients
eventually
relapse (Gertz, 2013).
P53 is a well-known tumour suppressor protein responding to
cellular stresses
through regulating cell cycle, DNA damage repair mechanism and
inducing
senescence and apoptosis (Vousden and Prives, 2009; Green and
Kroemer, 2009).
At steady state, p53 level is kept substantially low through a
tight feedback
regulation by negative regulators such as MDM2 (Choek et al.,
2011). Over the
past decade, more than 150 trials exploiting p53 have been
conducted taking
advantage of its pro-apoptotic effects on tumor cells (Choek et
al., 2011). PRIMA-
1met is a small molecule initially identified as a mutant p53
activator in cellular
screen of a small molecular library (Bykov et al., 2002).
PRIMA-1met has shown
promising results in in-vitro and xenograft models of several
solid tumours such
as breast, hepatic and colon cancer as well as haematological
malignancies closely
related to WM such as CLL (Zandi et al., 2011; Bao et al., 2011;
Liang et al.,
2009; Nahi et al., 2008). A recent phase I/II clinical trial of
PRIMA-1met in
prostate cancer and AML also demonstrated promising results in
terms of toxicity
-
30
and general tolerance, making it a good candidate for further
exploration in other
neoplasias (Lehman et al., 2012). Although initially thought to
act through
inducing apoptosis by restoring the wild type conformation to
mutant p53(
Lamber et al., 2009), recent evidence points towards its ability
to induce apoptosis
irrespective of p53 status or even in a p53-independent manner;
therefore, the
exact pathway affected by PRIMA-1met is highly controversial and
seems to be
cell type specific (Nahi et al., 2004; Supiot et al., 2008; Ali
et al., 2011; Saha et
al., 2013).
To date, the effects of PRIMA-1met in WM have not been explored
at either
preclinical or clinical levels. The purpose of the current study
is to examine the
anti-tumour effects of PRIMA-1met in WM cells and explore the
underlying
mechanism.
Materials and Methods
Patient samples and cell lines
Bone marrow samples were collected from WM patients during
routine diagnostic
procedures. This study received written approval from the
University Health
Network Research Ethics Board, Toronto, in accordance with the
Declaration of
Helsinki. WM cell line, BCWM-1 (Ditzel Santoz et al., 2007), was
kindly
provided by Dr. Treon’s lab. This cell line was maintained for
no more than 3
months in standard culture medium RPMI 1640 medium containing
10% fetal
bovine serum, 2 mM L-glutamine, 50U/ml penicillin, and 50 µg/mL
streptomycin
at 37°C in a 5% CO incubator. Freshly isolated primary WM cells
were separated
by Ficoll Hypaque density gradient (Sigma Aldrich, St. Louis,
MO, US). To
separate the cells with Ficoll Hypaque, the blood samples were
diluted in PBS and
EDTA buffer with 2 in 1 ratio of blood to buffer. 35 ml of this
diluted cell
suspension was then carefully layered on 15ml of Ficoll Hypaque
and centrifuged
-
31
at 400×g for 30 minutes at 20˚C. Lymphocyte located at the
interface layer were
carefully pipetted out and transferred to a new tube for
washing. Then, 3 volume
of buffer used in the first step was added and mixed with the
cells by gently
pipetting. The mixture was centrifuged at 100×g for 10 min at
20˚C and the
supernatant was removed. The lymphocyte pellet was again
re-suspended in 6ml
buffer and centrifuged at 100×g for 10 min at 20˚C.The pelleted
primary WM
cells were re-suspended in above mentioned culture medium and
incubated at
37°C in a 5% CO incubator and used the next day for
experimentation.
Drug treatment
PRIMA-1metwas purchased from Cayman Chemical and dissolved in
dimethyl
sulfoxide (DMSO) to make a 10 mM stock solution and stored at
-200 C. In each
experiment, the final DMSO concentration was kept constant and
did not exceed
0.05% (v/v). In some experiments, cells were simultaneously
exposed to PRIMA-
1met and dexamethasone (Cayman Chemical, Ann Arbor, MI,US) or
bortezomib
(Orthobiotech, Horsham, PA,US) . After drug treatment, cells
were harvested and
subjected to further analysis as described below.
Cell viability, apoptosis, colony formation and migration
assays
Cell viability was assessed by MTT
((3-[4,5-dimethilthiazol-2yl]-2,5-diphenyl
tetrazolium bromide)) (mention the company and address).
Briefly, cells were
cultured in 96-well micro-titer plates with different
concentrations of the drugs for
48 h. To assess the effect of PRIMA-1met on cell viability and
proliferation of
primary samples, 20 × 104 cells/ml and for BCWM-1 cell line, 30
× 104 cells/ml
were cultured in 96-well plates and then treated with the drug
for 48 h. After
incubation, MTT (0.5 mg/ml) was added and the cells were further
incubated for
an additional 4 h. This was followed by the addition of
acidified isopropanol to
the wells and overnight incubation at 37°C to solubilize the dye
crystals.
Following incubation, the optical density of the wells was read
with a microplate
-
32
reader set at a test wavelength of 570 nm and a reference
wavelength of 630 nm.
In combination treatments both drugs were added to the wells
simultaneously and
the treated cells were incubated for 72h. To examine apoptotic
cell death, WM
cells were treated with various concentrations of PRIMA-1met for
48h and then
harvested, washed twice with PBS to get rid of PRIMA-1met and
stained with
Annexin V-FITC (Abcam, MA,US) and propidium iodide
(Sigma-Aldrich, St.
Louis, MO) using the companies protocols for flowcytometric
analysis. Becton
Dickinson Canto II FCF 8 color analyzer was used for
flowcytometry. Data were
analyzed using FlowJo software. The extent of apoptosis was
quantified as
percentage of Annexin-V positive cells. For colony formation
assays, WM cells
(5×104 cells/mL) were plated into 6well plates in 1 mL RPMI
medium (20% FBS)
containing 1% methylcellulose and maintained with DMSO control
or the
indicated concentration of PRIMA-1met. Ten days after plating,
the total number
of colonies was calculated and enumerated by morphologic
assessment, as
previously described ( Trudet et al., 2007). Migration assays
were conducted with
24-well Transwell insert chambers (8 µm insert; Costar,
Corning
Inc.,Corning,NY,USA) according to the manufacturer’s
instruction. In brief, WM
cells (5×104 cells/mL) in FBS media were added to the upper
chamber in the
presence or absence of PRIMA-1met at the indicated
concentrations and allowed
to migrate for 8 hours at 37ºC to the lower chamber containing
media with 10%
FBS. The migration of control DMSO-treated cells on the
Transwell was
normalized to 100%. All the readouts from viability, apoptosis,
colony and
migration assays were from measurements of at least three
experiments.
Immunoblotting
Western blot analysis was performed to evaluate several protein
targets in whole
cell lysates obtained from the cells treated with PRIMA-1met in
the absence or
presence of siRNAs. Whole cell lysates were prepared by lysing
the cell pellets
for 10 min on ice in a buffer composed of 150 mM NaCl, 50 mM
Tris-HCl (pH
-
33
8.0), 5 mM EDTA, 1% (v/v) Nonidet P-40, 1 mM
phenylmethylsulfonyl fluoride
(PMSF), 20 µg/ml aprotinin and 25 µg/ml leupeptin. Protein
concentrations were
measured by using a Nano Drop 1000 spectrophotometer
(ThermoFisher
Scientific Inc., San Diego, CA, USA). Equal amounts of protein
were resolved
using 12% SDS-polyacrylamide gel electrophoresis and transferred
to a
polyvinylidene diflouride (PVDF) membrane (Perkin Elmer Inc.,
Waltham, MA,
USA). After blocking for 1 h at room temperature with PBS
containing 3%
bovine serum albumin (BSA), the membrane was incubated with
specific
antibodies for at least 1 h at room temperature or overnight at
40C. After washing
the membrane 3×10 minutes, the membrane was incubated with a
horseradish
peroxidase (HRP)-labeled secondary antibody for 1 h at room
temperature. The
blots were washed again for 3×10 minutes and were developed
using a
chemiluminescent detection system (ECL, Perkin Elmer). Primary
antibodies
were from the following manufacturers: Santa Cruz Biotechnology
(Santa Cruz,
CA,USA): MDM2, P73 (H-79) and β-actin; Biolegend (San Diego,
CA,USA):
p53 (DO-7); Roche (Manheim, Germany) : PARP. Goat anti-mouse and
anti-
rabbit secondary antibodies conjugated to horseradish peroxidase
were purchased
from Cell Signaling Technology (Beverly, MA, USA).
Knockdown of selective target genes
BCWM-1 cells were transfected with target specific siRNAs for
p53 (Invitrogen,
Carslbad, CA, USA) or p73 (Invitrogen) or control scrambled
siRNA
(Invitrogen) using the Cell Line Solution Kit V (Amaxa, GmbH,
Cologne,
Germany) according to the manufacturer's instruction with the
Amaxa
Nucleofector II device (Amaxa) Program T-030. Following
transfection, cells
were treated with PRIMA-1met using the same steps explained in
cell viability
assay and analyzed for its effect on cell viability by MTT
assay. These
experiments were done in triplicates. For qPCR analysis of
knocked down p73,
cell lysate from knocked down and control scrambled siRNA cells
were subjected
to RNeasy qiagen kit for RNA purification using company’s
protocol. Resulted
-
34
RNA was then used to make cDNA using QuantiTect Rev.
Transcription kit by
qiagen using their protocol. P73 primer set (Forward:
5′-CACGTTTGA-
GCACCTCTGGA and Reverse: 5′ GAACTGGGCCATGACAGATG) was used
in combination with promega (Madison, WI, USA) GoTaq real time
PCR kit for
quantification. GAPDH and 18S are two primers used as the
internal control in
these experiments. The resulted read outs were normalized using
the internal
controls resulting in Δct. The Δcts were then used for ΔΔct and
fold change (2^-
(ΔΔCT) calculations. qPCR experiments were done in
triplicates.
Statistical analysis
The synergistic effect [combination index (CI)
-
35
in the range that was previously reported by our lab to be
non-toxic to PBMNCs
and BMMNCs (Saha et al., 2013). To confirm the anti-WM potential
of PRIMA-
1met, primary cells derived from two previously untreated WM
patients with
more than 90% bone marrow involvement were treated with DMSO
control or
increasing doses of PRIMA-1met for 48 hours. Cells were then
examined for
viability by MTT assay. A significant decrease in the viability
of WM primary
cells was observed with similar or even lower IC50 values as
were observed in the
cell line (Figure1). To explore whether this reduction in cell
survival in WM cells
was due to apoptosis, we performed Annexin V/PI staining to
measure the
percentage of apoptotic cells. PRIMA-1met (25μM) induced more
than 50%
apoptosis in BCWM-1 cells which is in complete accordance with
the results
obtained from cell survival assay (Figure2).
PRIMA-1met inhibits colony formation and migration in WM
cells
Having shown the effect of PRIMA-1met on viability and
apoptosis, we next
examined the effects of PRIMA-1met on WM cells migration and
colony
formation. PRIMA-1met significantly inhibited colony formation
in BCWM-1
cells in a dose-dependent manner (Figure4A, P
-
36
in a significant decrease in cell survival compared with the
single agents (P<
0.005) after 72h treatment (Figure5A and B). When combined with
low
concentrations of these drugs, synergistic effects were observed
(CI
-
37
Discussion:
In this report for the first time we demonstrated the anti-tumor
activity of
PRIMA-1met in WM cell line and patient samples. Treatment of WM
cells with
PRIMA-1met resulted in significant inhibition of viability
associated with
apoptosis induction. PRIMA-1met also inhibited colony formation
and migration
of WM cells in a dose-dependent manner. These observations
pinpoint the
potential antiproliferative and apoptotic effects of PRIMA-1met
on WM cells. It
also prompts us to speculate that it may antagonize WM cells
viability and
migration in the context of bone marrow microenvironment which
is known to
play an important role in WM pathogenesis (Agarwal and Ghobrial,
2013).
Importantly, similar effects of PRIMA-1met have also been
observed in other
tumor cell types (Bao et al., 2011; Messina et al., 2012; Aryee
et al., 2013)
We found that PRIMA-1met induced apoptosis in BCWM-1 cells was
associated
with downregulation of Bcl-xL and cleavage of caspase 9 but not
caspase 8 (Data
not shown), implying the activation of intrinsic/ mitochondrial
pathway of
apoptosis. These findings are in accordance with previous
reports in breast cancer
and melanoma cells treated with PRIMA-1met (Bao et al., 2011;
Liang et al.,
2009; Supiot et al., 2008). Although PRIMA-1met was initially
discovered as a
p53 reactivating agent (lambert et al., 2009), further studies
especially in
hematological malignancies could not confirm the role of p53 in
PRIMA-1met-
induced apoptosis (Nahi et al., 2004; Supiot et al., 2008; Ali
et al., 2011; Saha et
al., 2013). Our initial western blot analysis did not show any
significant change in
p53 level after PRIMA-1met treatment. Furthermore, selective
knockdown of p53
may not have a direct role in PRIMA-1met- induced apoptosis of
WM cells.
Additionally, the same p53-independent effects of PRIMA-1met was
reported by
our group in MM and by others in AML, CLL and prostate cancer
cell lines (Nahi
et al., 2004; Saha et al., 2013; Nahi et al., 2006).
Interestingly, PRIMA-1met
treatment of WM cells resulted in activation of p73, another
member of p53 super
family which shares structural and functional similarities with
p53(levrero et al.,
-
38
2000). p73 is a well-known tumor suppressor which due to its
non-mutated state
in most cancers has attracted much attention as a potential drug
target. Our knock-
down study also demonstrated that p73-silenced cells did not
undergo apoptosis in
response to PRIMA-1met treatment supporting the possible role of
p73in PRIMA-
1met-induced appoptosis. Interestingly, the latter results are
consistent with the
findings in our previous study in multiple myeloma (Saha et al.,
2013). It should
be noted that other possible mediators of PRIMA-1met effects in
WM couldn’t be
ruled out, especially in light of recent findings highlighting
the significance of
ROS production in PRIMA-1met induced cell death25; thus it would
be interesting
to analyze the oxidative stress pathways in PRIMA-1met-treated
WM cells in
future studies.
Moreover, we also found down-regulation of anti-apoptotic marker
Bcl-xL in
WM cells following PRIMA-1met treatment. This finding together
with above-
mentioned cleavage of caspase 9 imply that
mitochondrial/intrinsic pathway of
apoptosis may be involved in PRIMA-1met-induced apoptosis in WM
cells. In
fact, involvement of latter pathway in PRIMA-1met-induced cell
death has been
indicated in lung cancer and MM cells (Zandi et al, 2011;Lambert
et al., 2010) .
Nonetheless, further investigation is required to decipher the
mechanism of
PRIMA-1met-induced apoptosis in WM cells.
Finally, we showed that PRIMA-1met-induced cell death could be
synergistically
enhanced in combination with dexamethasone or bortezomib. It is
interesting to
note that both agents are known to inhibit NF-κB which in turn
inhibits p53super
family (Mujtaba and Dou, 2011; Distelhorst, 2002) denoting a
possible
mechanism underlying the synergistic effects of PRIMA-1met in
combination
with dexamethasone or bortezomib.
Taken all together, our findings suggest that treatment of WM
cells with PRIMA-
1met leads to induction of p73-mediated, p53-independent
apoptosis by down-
regulation of Bcl-xL and possibly through the intrinsic pathway
of apoptosis. Our
-
39
study provides a rationale for a future in-depth investigation
into the molecular
mechanism of PRIMA-1met-induced cell death in WM and applying
to
established WM xenograft models.
Figures:
Figure1: The effect of PRIMA-1met on WM cell lines and patient
samples. The
growth suppressing effect of different concentrations of
PRIMA-1met in BCWM
(IC50= 21µM), Patient sample 1 (IC50= 10), Patient sample 2
(IC50= 30) was
studied using MTT assay after 48hour incubation; n= 3, error
bars show SEM.
-
40
Figure 2: The apoptotic effect of PRIMA-1met in BCWM-1 (wild
type P53). The
apoptotic effect of different concentrations of PRIMA-1met in
BCWM-1 was
studied using Annexin-V/PI Flowcytometry after 48 hour
incubation; n= 3, error
bars show SEM. * P=
-
41
Figure3: The effect of PRIMA-1met in BCWM-1 cells. Total levels
of the
indicated proteins were evaluated by Western blot analysis in
BCWM-1 cells after
treatment with 50µM PRIMA-1met 1Met at several time points.
-
42
Figure 4: Anti-tumour activities of PRIMA-1met in WM cells. Dose
dependent
decrease in BCWM-1 colony formation abilities was measured by
colony assay
after 7 days. Dose dependent decrease in BCWM-1 cell migratory
abilities was
measured by Boyden chamber assay after 8 hours of incubation.;
n= 3, error
bars=SEM, * P=
-
43
Figure5: Effects of PRIMA-1met in combination with current WM
therapeutics
(A) Synergism was assessed by (CI) combination index analysis
for
dexamethasone and RIMA-1 after 72hrs, CI=0.63. (B)RIMA-1met has
synergistic
B
-
44
effects with bortezomib(velcade) on BCWM-1
cells,72hrs,CI=0.85.Error
bars=SEM, ** P=
-
45
Figure7: PRIMA-1met cytotoxicity is P73 dependent. (A) si-p73
knock down
was confirmed by q-PCR analysis of p73 m-RNA (B) PRIMA-1met was
unable to
reduce the cell survival measured by MTT assay in p73-silenced
cells as much as
scrambled control. Error bars=SEM, * P=
-
46
Chapter 3
Discussion
Current standard treatment regimens for WM have been unable to
cure the disease and drug
induced toxicities remain a major concern for clinicians in the
field (Buske et al., 2013). The
most promising combinations so far for WM patients have been
bortezomib combinations used
in clinical trials with ORR of 80-90% but few CRs and with long
term third grade neurological
toxicities for many patients under the treatment (Treon, 2013).
p53 is capable of induction of cell
cycle arrest, apoptosis and senescence as the major sensor of
cellular stress. Given the mutated
status of p53 in more than 50% of all cancer types, in the past
decade, considerable energy has
been focused on p53 apoptotic effects and developing p53
activating agents both at preclinical
and clinical level (Wang and Sun, 2010). Most of these compounds
are only cytotoxic toward
cancer cells. PRIMA-1met is one of these therapeutics used in
various cancer types, especially
hematological malignancies, that has shown great potential
(Aryee et al., 2013; Bao et al., 2011;
Ali et al., 2011; Nahi et al., 2008). This thesis is focused on
determining PRIMA-1met’s
therapeutic potential and mode of action in WM. Using various
functional assays; our results
demonstrate that PRIMA-1met is a very potent therapeutic agent
for WM.
In the first section of this thesis, I aimed to validate the
anti-tumorigenic effects of PRIMA-1met
on WM cells using various functional assays which to our
knowledge has never been
investigated before. In this study we used the BCWM-1 cell line,
one of the two existing cell
lines of WM that bears wild type p53 the same as 95% of WM
population (Kristinsson et al.,
2009). The first objective was pursued through studying the
effects of PRIMA-1met on three
major aspects of WM pathogenesis: viability, clonogenecity and
migration. Following subjection
of BCWM-1 cells to PRIMA-1met, we detected reduction in cell
viability, an increase in cell
surface staining with Annexin V, and an induction of PARP
cleavage which collectively point
out the induction of apoptosis in WM by PRIMA-1met. More
importantly, a more significant
decrease in cell viability was discovered in primary WM samples
grown in the presence of
PRIMA-1met. The rise in cell death in response to PRIMA-1met in
BCWM-1 cells was observed
in dosage range previously reported to have no cytotoxicity
toward Peripheral Blood
-
47
Mononuclear cell (PBMNCs) and Bone Marrow Mononuclear cells
(BMMNCs) and was well
below 300 µM which is the in-vitro equivalent of the reported
maximum tolerated dose set by a
recent phase I/II clinical trial for PRIMA-1met (Saha et
al.,2013a; Lehmann et al., 2012). Earlier
reports also demonstrate reduction in cell viability and
induction of cell cycle arrest in various
solid tumors such as breast, lung cancer, and hematological
malignancies closely related to WM,
e.g. CLL and MM, in response to PRIMA-1met ((Aryee et al., 2013;
Bao et al., 2011; Ali et al.,
2011; Nahi et al., 2008; Nahi et al., 2008; Saha et al.,
2013a).
I next examined the effects of PRIMA-1met on WM cologenicity
through a methylcellulose
based colony assay. We observed a significant decline in the
number of resulted colonies which
suggest a strong anti-clonogenic effect for PRIMA-1met. These
results are supported by previous
reports of reduced clonogenicity in MM after PRIMA-1met
treatment (Saha et al., 2013a). We
recognize the importance of a serial replating assay to further
confirm our result but practical
limitations such as low number of resulted colonies and slow
doubling time prevented us from
doing so. These results, however, lead us to speculate that
PRIMA-1met not only affects general
WM cancer cells but it also affect the tumor initiating
cells.
Bone marrow regulates the growth, proliferation and drug
resistance in WM cells, therefore, their
homing to the bone marrow through migratory mechanism is
essential for WM pathogenesis
(Ngo et al., 2008; Poulain et al., 2009). Moreover, in 20% of WM
cases which are also more
aggressive in nature, WM cells use their migratory abilities to
disseminate throughout the body
(Shaheen et al., 2012). Hence, in the next step, we noticed a
declining trend in migration for
PRIMA-1met treated WM cells as evidence for yet another
important anti-tumorigenic effect of
PRIMA-1met in WM. In their investigations of PRIMA-1met on MM,
Saha et al. also described
similar results to our migration assay findings (Saha et al.,
2013a). CXCR4 is a lymphocyte cell
surface adhesion molecule which is highly expressed in WM and is
recently found to be one of
the drivers of WM tumor progression (Treon et al., 2014a; Hunter
et al., 2014). Since
CXCR4/SDF1 is known to be the major player in MM migration and
homing and in light of data
pertain to its importance in WM pathogenesis, we speculate that
one of the mechanism through
-
48
which PRIMA-1met is inhibiting migration in WM is through
regulating the levels of surface
CXCR4 (Alsayed et al., 2007).
To gain insight into the mechanism of PRIMA-1met induced
apoptosis, we evaluated the
expression of number of apoptotic markers. First, we detected
elevated levels of PARP and
caspase 9 cleavage which led us to believe that the
mitochondrial pathway of apoptosis is
involved in PRIMA-1met-induced cell death. Changes in expression
of various members of
mitochondrial pathway of apoptosis after PRIMA-1met treatment
have previously been
demonstrated by several groups. Zandi et al. reported that Bax
level was elevated while Bcl-2
was reduced in several small cell lung cancer cell lines
following treatment with PRIMA-1met
(zandi et al., 2011). In another study, an si-RNA knock down of
Noxa in MM render the cells
incapable of undergoing apoptosis in response to PRIMA-1met
treatment leading to the author’s
conclusion that Noxa is a major player in causing apotosis in
these cell lines (Saha et al., 2013a).
We on the other hand were unable to detect any changes in the
levels of Noxa (data not shown)
and only came across decreasing levels of Bcl-xL after
PRIMA-1met treatment. Therefore, it
seems that although PRIMA-1met exerts its apoptotic effects
through intrinsic pathway of
apoptosis, the exact executioner in this pathway is cell type
specific.
PRIMA-1 and its more potent form PRIMA-1met were initially
discovered as activators of
mutant p53 in Saos-2 cells (Bykov et al, 2002; Bykov et al.,
2005). In a later study, Bao et al.
discovered that PRIMA-1met was more effective in inducing
apoptosis in wild type p53
melanoma cells (Bao et al., 2011); while, several recent studies
have indicated the PRIMA-
1met’s potency in p53 null or knocked-down cell lines especially
in hematological malignancies
(Ali et al., 2011; Supiot et al., 2008). To elucidate the role
of p53, we evaluated the effects of
p53 knockdown in PRIMA-1met cytotoxicity towards WM. Following
the knockdown in
BCWM-1 cells, they were able to undergo apoptosis in response to
PRIMA-1met to the same
extent as before the knockdown, leading us to conclude that
PRIMA-1met effects are p53
independent. P73 is another member of the p53 tumor suppressor
superfamily which shares 80%
structural and some functional similarities with p