Pregnane X receptor is essential for normal progression of liver regeneration

LIVER INJURY/REGENERATION

Pregnane X Receptor Is Essential for NormalProgression of Liver Regeneration

Guoli Dai, Lin He, Pengli Bu, and Yu-Jui Yvonne Wan

Pregnane X receptor (PXR) mediates xenobiotic and endobiotic metabolism as well ashepatocyte proliferation. To determine the role of PXR in liver regeneration, 2/3 partialhepatectomy (PH) was performed on wild-type and PXR-null mice. Our results showed thathepatic steatosis was markedly suppressed in mice lacking PXR 36 hours after PH, concom-itant with reduction of hepatocyte proliferation at the same time point. Gene expressionanalysis revealed the role of PXR in regulating the transcription of genes involved in lipiduptake, transport, biosynthesis, oxidation, and storage during liver regeneration. WhenPXR was absent, the second wave of hepatocyte proliferation was severely suppressed, whichwas accompanied by the inactivation of STAT3. Lack of PXR inhibited the second phase ofliver growth, leading to 17% less liver mass at the anticipated end point of liver regeneration(day 10). Conclusion: PXR is required for normal progression of liver regeneration bymodulating lipid homeostasis and regulating hepatocyte proliferation. (HEPATOLOGY 2008;47:1277-1287.)

An unique feature of the liver is its remarkable abil-ity to regenerate in response to liver mass loss dueto a variety of injuries. Whether the regenerative

process is able to appropriately initiate, sustain, and com-plete determines the final outcome of liver damage.Therefore, elucidation of the mechanisms responsible forhepatic compensatory growth will ultimately lead tonovel clinical therapeutic strategies for chemical, trau-matic, or infectious liver injuries.

Molecular mechanisms governing the initiation, ex-pansion, and termination of liver regeneration includecomplex and well-orchestrated signaling cascades involv-ing cytokines, growth factors, and matrix remodeling.1-4

Among the concurrent early signaling events are produc-

tion of interleukin-6 and tumor necrosis factor alpha andactivation of urokinase, Notch, �-catenin, signal trans-ducer and activator of transcription protein 3 (STAT3),nuclear factor-kappa B, c-fos, c-jun, hepatocyte growthfactor receptor, and epidermal growth factor receptor.These hemodynamic changes that occur in the first fewhours after liver mass loss relate directly or indirectly topreparative events for the entry of hepatocytes into thecell cycle. Continuing from or following those earlyresponse events are the production of direct mitogens,including hepatocyte growth factor and transforminggrowth factor alpha, and substances enhancing the ef-fect of the direct mitogens, such as tumor necrosis fac-tor and norepinephrine. These factors form complexcommunication networks between hepatocytes andnonparenchymal cells in autocrine, paracrine, or endo-crine manners, rendering the hepatocytes to enter intoand progress through the cell cycle. Subsequent to theexpansion phase is the termination of liver regrowth,known to be partly regulated by transforming growthfactor beta and activins. These termination factors in-hibit hepatocyte proliferation, induce hepatocyte apo-ptosis, and regulate hepatic organ mass.4-7

In addition to cytokines and growth factors originatedintrahepatically or extrahepatically, nuclear receptor–me-diated metabolic signals have been integrated into themachinery modulating liver regeneration. Farnesoid X re-ceptor (FXR)–dependent bile acid homeostatic signalinghas been proposed to be required for both initiation andtermination of liver regeneration.8 Disruption of peroxi-some proliferator-activated receptor alpha (PPAR�)–me-

Abbreviations: ACC-1, acetyl-CoA-carboxylase 1; FAE, long chain free fatty acidelongase; FXR, farnesoid X receptor; mRNA, messenger RNA; PH, partial hepatec-tomy; PPAR�, peroxisome proliferator-activated receptor alpha; PXR, pregnane Xreceptor; qRT-PCR, quantitative real-time polymerase chain reaction; SD, stan-dard deviation; STAT3, signal transducer and activator of transcription protein 3.

From the Department of Pharmacology, Toxicology and Therapeutics, Universityof Kansas Medical Center, Kansas City, KS.

Received July 24, 2007; accepted November 1, 2007.Supported by NIH grants AA14147, CA53596, P20RR016475 from the IN-

BRE Program of the National Center for Research Resources, P20 RR015563 fromCOBRE Center for Cancer Experimental Therapeutics, and COBRE P20RR021940 as well as the Molecular Biology Core under the COBRE.

Address reprint requests to: Yu-Jui Yvonne Wan, Ph.D., Department of Phar-macology, Toxicology and Therapeutics, University of Kansas Medical Center, Kan-sas City, KS 66160. E-mail: [email protected]; fax: 913-588-7501.

Copyright © 2007 by the American Association for the Study of Liver Diseases.Published online in Wiley InterScience (www.interscience.wiley.com).DOI 10.1002/hep.22129Potential conflict of interest: Nothing to report.

1277

diated lipid signaling pathway delays the initiation of liverregeneration.9,10 Mice nullizygous for constitutive andro-stane receptor, one of the major xenobiotic receptors,show a transient delay in hepatocyte proliferation.8 Selec-tive ablation of retinoid X receptor alpha in hepatocytesshortens hepatocyte lifespan during liver regeneration.11

These findings indicate that these nuclear receptors andpotentially others participate in the hepatic regenerativeresponse to liver mass loss, functioning in combinationwith cytokines and growth factors. Thus, the liver is like“a car with multiple cylinders,” possessing overlappingsystems that trigger regeneration in response to a varietyof problems.12

Pregnane X receptor (PXR), which is highly expressedin the liver, was identified as one of the major nuclearreceptors sensing the insults of xenobiotics, such as drugsand toxins, and regulating the subsequent metabolic re-sponse.13-17 Further investigation uncovered the role forPXR in metabolism of endobiotics, such as bile acid16,18,19

and bilirubin.20,21 Activated PXR transactivates a networkof genes encoding phase I and phase II enzymes as well astransporters for detoxification and elimination of poten-tially harmful compounds.22 Additionally, activation ofPXR stimulates hepatocyte proliferation and liver growthby an unknown mechanism, leading to an increase ofhepatic metabolic capacity.18,23 Moreover, a recent find-ing showed that PXR plays an important role in regulat-ing lipid homeostasis by activating genes that facilitatelipogenesis and suppress fatty acid �-oxidative pathway.24

Taken together, the importance of PXR in mediatingmetabolic signaling and the association of PXR with he-patocyte proliferation led us to hypothesize that PXRplays a role in liver regeneration. To test this hypothesis,the current study was performed using a widely used par-tial hepatectomy (PH) model combined with a geneticapproach. Our data demonstrated that PXR is a criticalregulator ensuring normal progression of liver regenera-tion.

Materials and Methods

Mice, PH, and Sample Preparation. Wild-type andPXR-null male mice (4-6 months old), having a mixedgenetic background of C57BL6 and SvJ129,16 were keptin steel microisolator cages at 22°C with a 12-hour/12-hour light/dark cycle. Food and water were provided adlibitum throughout the entire feeding period. Standardtwo-thirds liver resection was performed following theprocedure described by others.25 Briefly, using inhalationanesthesia (isoflurane), the 3 most anterior liver lobes(right upper, left upper, and left lower lobes), totaling68% of the liver, were tied at the origins of the lobes with

3 knots and then resected. The peritoneum was reap-proximated with a running suture and then the skin wasclosed. Sterile saline (3 mL) was administered subcutane-ously after closing the abdomen to replace fluid loss fromthe surgery. Mice were placed under warming lights whileawakening from anesthesia. All the experimental proce-dures were strictly standardized. The surgery was per-formed between 10:00 AM and 12:00 AM. Mice weresacrificed at the indicated time points. Livers were imme-diately excised, frozen in liquid nitrogen, and kept at�80°C until use. Liver samples were also fixed in 10%formalin, embedded in paraffin, and stained with hema-toxylin-eosin (H&E) for histological analysis. All of theanimal experiments were conducted in accordance withthe National Institutes of Health Guide for the Care andUse of Laboratory Animals.

Ki-67 Immunostaining. Ki-67 immunostaining wasperformed with primary Ki-67 antibody (NeoMarkers,Fremont, CA) according to the manufacturer’s instruc-tion to monitor hepatocyte proliferation. The number ofproliferating hepatocytes was determined by counting theKi-67–positive hepatocytes in at least 6 low-magnifica-tion (40�) microscope fields for each sample.

Liver Lipid Content. Liver triglyceride and choles-terol levels were measured as described elsewhere.24 Livertissue was homogenized in a buffer containing 18 mMTris (pH 7.5), 300 mM mannitol, 50 mM ethylene glycoltetraacetic acid, and 0.1 mM phenylmethysulfonyl fluo-ride. The homogenate (400 �L) was mixed with chloro-form/methanol (2:1, 4 mL) and incubated overnight atroom temperature with gentle shaking. After H2O (800�L) was added, the homogenates were vortexed and thencentrifuged for 5 minutes at 3000g. The lower lipid pelletswere dissolved in a mixture of tert-butyl alcohol (60 �L)and Triton X-114/methanol (2:1) mixture (40 �L). Tri-glyceride and cholesterol levels were then measured usingthe Stanbio Assay kit (Stanbio Laboratory, Boerne, TX)according to the manufacturer’s instruction.

Quantitative Real-Time Polymerase Chain Reac-tion. Total RNA was isolated from frozen liver tissueusing the TRIzol reagent according to the manufacturer’sprotocol (Invitrogen, Carlsbad, CA). ComplementaryDNAs were synthesized with total RNA (1 �g) from eachsample, diluted 10 times with water, and subjected toquantitative real-time polymerase chain reaction (qRT-PCR) to quantify messenger RNA (mRNA) levels usingTaqMan probe (Applied Biosystems, Foster City, CA).Primers and probes were designed using Primer Express2.0 (Applied Biosystems). The probe was labeled with thereporter dye 6-carboxyfluorescein. TaqMan UniversalPCR Master Mix (Applied Biosystems) was used to pre-pare the PCR mix. Primers and probes were added to a

1278 DAI ET AL. HEPATOLOGY, April 2008

final concentration of 90 and 125 nmol, respectively, in atotal volume of 20 �L. The amplification reactions werecarried out in the ABI-Prism 7900 sequence detectionsystem (Applied Biosystems) with initial hold steps (50°Cfor 2 minutes, followed by 95 °C for 10 minutes) and 40cycles of a 2-step PCR (92°C for 15 seconds, 60°C for 1minute). The primer (Integrated DNA Technologies,Coralvillem, IA) and probe (Sigma, St. Louis, MO) se-quences used for qRT-PCR are listed in Table 1. Therelative standard curve method was used for relative quan-tification of the amount of mRNA of each sample nor-malized to the albumin transcript level.

Western Blotting. Liver homogenate (40 �g) wasseparated by polyacrylamide gel electrophoresis under re-ducing conditions. Proteins from the gels were electro-phoretically transferred to nitrocellulose. Antibodies ofSTAT3 (Cell Signaling Technology, Danvers, MA),phosphor-STAT3 (Tyr705) (Cell Signaling Technology,Danvers, MA), and �-actin (Santa Cruz Biotechnology,Santa Cruz, CA) were used as probes. Immune complexeswere detected using the enhanced chemiluminescencesystem (Pierce, Rockford, IL).

STAT3 DNA Binding Activity Assay. Hepatic nu-clear extract was prepared using Cellytic Nuclear Extrac-tion kit (Sigma, St. Louis, MO) according to themanufacturer’s protocol. Briefly, frozen liver tissue (100mg) was homogenized in a hypotonic buffer supple-mented with a cocktail of protease and phosphatase in-hibitors (Pierce, Rockford, IL). The homogenates werecentrifuged for 20 minutes at 10,000g. The crude nucleipellets were resuspended in an extraction buffer (150 �L)containing protease and phosphatase inhibitors, shakengently for 30 minutes, and subsequently centrifuged for 5minutes at 20,000g. The supernatant (nuclear extract)was aliquoted, snap-frozen in liquid nitrogen, and storedat �80°C. STAT3 DNA binding activity was evaluatedusing an Upstate Non-Radioactive STAT3 EZ-TFA

Transcription Factor Assay kit (Upstate, Temecula, CA)according to the manufacture’s manual. Briefly, a double-stranded biotinylated oligonucleotide containing theSTAT consensus sequences (5�-TTCCCGTAA-3� and5�-TTCCGGGAA-3�) was mixed with hepatic nuclearextract (10 �g) in an assay buffer provided by the kit inthe wells of a 96-well streptavidin-coated plate. After 1hour incubation at room temperature, the unbound ma-terials were removed by washing. A rabbit anti-STAT3primary antibody was added and allowed for binding for 1hour at room temperature. After washing, a horseradishperoxidase-conjugated secondary antibody was thenadded to the assay wells and incubated at room tempera-ture for 30 minutes. Followed by washing, a chemilumi-nescent substrate was added to each assay well. Theluminescence of samples was measured with a microplateluminometer. The STAT3 DNA binding activity was ex-pressed as relative light units. Each sample was assayed astriplicates.

Statistical Analysis. Data are given as mean � stan-dard deviation (SD). Statistical analysis was performedusing Student t test or one-way analysis of variance. Sig-nificance is defined by P � 0.05.

Results

Impact of PXR Absence on Liver Growth After PH.To evaluate the influence of PXR absence on PH-inducedliver regeneration, wild-type and PXR-null mice weresubjected to PH or sham operation. Mice were sacrificedafter surgery during the time frame of the first wave ofhepatocyte proliferation (24, 36, and 48 hours),2 withinthe period of the second wave of hepatocyte proliferation(5 days),26 and at the end point of liver regeneration (10days).27 Liver-to-body-weight ratio was monitored as aliver growth index. The results are summarized in Fig. 1.

Table 1. Sequences of Primers and Probes for Quantitative Real-Time PCR

Genes Primers (5�-3�) Probes (5�-3�)

PXR Forward: CAGTTGCTGCGCATCCAA [DFAM]TCGCACCCCTTTGCCACCCC[DBH1]Reverse: TGCTGCTAAATAACTCTTGCATGAG

Cyp3a11 Forward: TCACAGACCCAGAGACGATTAAGA [DFAM]TGTGCTAGTGAAGGAATGTTTTTCT[DBH1]Reverse: CCCGCCGGTTTGTGAAG

PPAR� Forward: GATTCAGAAGAAGAACCGGAACA [DFAM]TCTGTCGGGATGTCACACAATGCAATTC[DBH1]Reverse: TGCTTTTTCAGATCTTGGCATTC

PPAR� Forward: CCCAATGGTTGCTGATTACAAA [DFAM]CTGAAGCTCCAAGAATACCAAAGTGCGATC[DBH1]Reverse: GAGGGAGTTAGAAGGTTCTTCATGA

CD36 Forward: TCCAGCCAATGCCTTTGC [DFAM]TCACCCCTCCAGAATCCAGACAACCA[DBH1]Reverse: TGGAGATTACTTTTTCAGTGCAGAA

FAE Forward: TGACTATGAACTATGGCGTGCAT [DFAM]CCGTCATGTACTCTTACTACGCCTTGCG[DBH1]Reverse: CCGGGAGACTCGGAAACC

Albumin Forward: ACGAGAAGCTTGGAGAATATGGA [DFAM]CAAAATGCCATTCTAGTTCGCTACACCCAG[DBH1]Reverse: GCCCACTCTTCCTAGGTTTCTTG

HEPATOLOGY, Vol. 47, No. 4, 2008 DAI ET AL. 1279

The liver-to-body-weight ratio of wild-type mice in-creased progressively and reached 4.4% at 10 days aftersurgery, which is within the normal range of liver-to-body-weight ratio (Fig. 1A). However, mice lacking PXRexhibited aberrant liver regrowth (Fig. 1A). At 36 hoursfollowing PH, the liver-to-body-weight ratio of PXR-nullmice (1.9%) was significantly lower than that of wild-typemice (2.5%). Significant differences of liver-to-body-weight ratios were not observed at 48 hours and 5 daysbetween 2 genotypes of mice. However, 10 days after PH,when the liver is supposed to restore its original mass, theliver-to-body-weight ratio of PXR-null mice reached only3.6%, leading to approximately 17% less liver mass thanwild-type mice. Our data indicated that PXR knockoutcaused a temporary delay of liver growth at 36 hours afterPH and persistent inhibition of liver growth after day 5following PH, leading to a marked liver mass deficit of theregenerated livers at day 10 after surgery. Significant dif-ferences in liver-to-body-weight ratios were not observedbetween wild-type and PXR-null mice subjected to shamoperation at each time point after surgery (Fig. 1B). Our

findings showed that PXR is essential for the completionof liver regeneration.

Impact of PXR Absence on Hepatocyte Prolifera-tion During Liver Regeneration. Proliferation of hepa-tocytes constitutes the fundamental cellular event duringliver regeneration. It has been well demonstrated thatPXR activation induces hepatocyte proliferation.18,23

This finding prompted us to determine whether PXRexerts an effect on hepatocyte proliferative response toliver mass loss. Ki-67 immunostaining was performed onliver sections from the experiment described in Fig. 1.

At 36 hours after PH, the number of Ki67-positivehepatocytes in PXR-null livers was significantly reducedcompared with that in wild-type livers (Fig. 2). This ob-servation indicates that PXR participates in mediating theinitial hepatocyte proliferation in response to PH. Thus,the decreased liver-to-body-weight ratio 36 hours afterPH in PXR-null mice was due, at least in part, to thereduced hepatocyte proliferation (Fig. 1). More promi-nently, 5 days after PH, the number of Ki67-positivehepatocytes in wild-type mice was 3.4-fold higher thanthat in PXR-null mice. This finding revealed a critical roleof PXR in regulating the second wave of hepatocyte pro-liferation. The data are also consistent with the observa-tion that the increase of liver-to-body-weight ratio wasinhibited after 5 days following PH because of a lack ofPXR (Fig. 1). The representative liver sections immuno-histochemically stained for Ki67 are shown in Fig. 2B. Inaddition, hepatic mitotic figures were counted 48 hours(mitosis peak) and 5 days after PH. The result showedthat the number of hepatocytes undergoing mitosis wasnot significantly different between 2 genotypes of mice at48 hours (6.0 � 1.96 in wild-type mice versus 4.53 �2.12 in PXR-null mice), whereas lack of PXR resulted ina reduction of the number of cells undergoing mitosis at 5days (1.4 � 0.99 in wild-type mice versus 0.14 � 0.13 inPXR-null mice) following PH (Fig. 2C). The data areconsistent with Ki-67 immunostaining analysis.

Modulation of Hepatic Lipid Homeostasis by PXRDuring Liver Regeneration. A marked change of he-patic lipid homeostasis occurs during liver regenera-tion.28,29 Triglyceride and cholesterol esters accumulatedin hepatocytes are proposed to serve as an energy sourcesupporting cell proliferation and tissue regrowth.30 PXRactivation results in an increased hepatic deposit of trig-lycerides.24 These reports led us to determine whetherPXR plays a role in regulating lipid homeostasis duringliver regeneration. Liver histology was examined and he-patic triglyceride and cholesterol contents were quantifiedin wild-type and PXR-null mice subjected to PH.

At 36 hours after PH, wild-type mice accumulatedlarge lipid droplets in the hepatocyte cytosol, whereas the

Fig. 1. Liver-to-body-weight ratio in wild-type (WT) and PXR-null (KO)mice after partial hepatectomy (PH). WT or KO mice were subjected to PH(A) or sham operation (B). Mice were sacrificed at indicated time pointsfollowing surgery. Liver-to-body weight ratio was recorded as a livergrowth index. Results are shown as mean of liver-to-body-weight ratios �SD (n � 3-6 for each genotype at each time point). *P � 0.05.


Fig. 2. Hepatocyte proliferation during partial hepatectomy (PH)-induced liver regeneration in wild-type (WT) and PXR-null (KO) mice. (A)Ki-67 immunostaining was performed with the formalin-fixed and paraf-fin-embedded tissue sections prepared from the livers harvested in theexperiment described in Fig. 1. Ki-67–positive hepatocytes were counted(40� optical field), and the results are shown as mean � SD (n � 3to 6 for each genotype at each time point, *P � 0.05; ***P � 0.001).(B) The representative liver sections immunohistochemically stained forKi-67 were shown for WT and KO mice 36 h and 5 days after PH. (C)Hepatic mitotic figures were counted (40� optical field) in the livers ofboth genotypes of mice at 48 hours and 5 days after PH. The data areshown as mean � SD (n � 3 to 6 for each genotype at each time point,***P � 0.001).

Fig. 3. Hepatic lipid content during partial hepatectomy (PH)-inducedliver regeneration in wild-type (WT) and PXR-null (KO) mice. Hematoxylin-eosin staining of liver sections of WT and KO mice sacrificed 36 hoursafter PH or sham operation (sham) was used for morphological analysis(A). Hepatic triglyceride (B) and cholesterol (C) content was measuredusing the livers harvested from the experiment described in Fig. 1. Theresults are shown as mean � SD (n � 3 to 6 for each genotype at eachtime point). *P � 0.05; ***P � 0.001.


lipid accumulation was drastically reduced in the livers ofmutant mice (Fig. 3A). Lipid droplets were not seen in thelivers of sham-operated control mice for each genotype(Fig. 3A). The morphology of hepatic lipid accumulationwas not markedly different between the two genotypes ofmice at other time points studied (data not shown). Cor-responding biochemical data supported the morphologi-cal observation (Fig. 3B,C). In wild-type mice, bothtriglyceride and cholesterol reached peak levels 36 hoursafter liver resection. In contrast, the elevation of hepatictriglyceride and cholesterol levels was not seen in thePXR-null mice. At other time points studied, absence ofPXR did not alter the hepatic triglyceride and cholesterollevels (Fig. 3B,C). These observations demonstrated thatPXR plays a temporal role in regulating lipid homeostasisduring liver regeneration. Decreased hepatic triglyceride andcholesterol accumulation in PXR-null mice 36 hours afterPH might also explain the decreased liver-to-body-weightratio of PXR-null mice at the same time point (Fig. 1).

The mRNA Expression of PXR and Cyp3a11 Dur-ing Liver Regeneration. On activation, PXR transacti-vates the expression of itself as well as its targets such asCyp3a11.31 To determine the functional status of PXRduring normal liver regeneration, hepatic PXR andCyp3a11 mRNA levels were quantified. The resultshowed that PXR and Cyp3a11 mRNA levels in regener-ating livers were 4-fold and 2.5-fold higher, respectively,than that in sham-operated controls 24 hours after sur-gery (Fig. 4A,B). PH did not significantly change themRNA levels of PXR and Cyp3a11 at the other timepoints (data not shown). Simultaneous induction of PXRand Cyp3a11 mRNA expression suggests that PXR is ac-tivated 24 hours after PH.

Expression of Genes Involved in Lipid MetabolismDuring Liver Regeneration. In an attempt to explorethe molecular mechanism underlying PXR-mediated

lipid metabolism during liver regeneration, expression ofgenes known to be critical in lipogenesis, �-oxidation,and transport was profiled by relative qRT-PCR. Theaverage hepatic mRNA level of each gene in wild-typelivers at 24 hours after sham operation was set as 1.0.

PPAR� is a critical regulator of hepatic lipid oxida-tion.32 Our data showed that PXR deficiency resulted inreduced PPAR� mRNA levels in the livers of sham-oper-ated mice (Fig. 5A). This observation suggests that PXRcontrols the basal PPAR� mRNA level. Twenty-fourhours after PH when PXR expression is activated (Fig. 4),wild-type livers expressed 17.4-fold lower PPAR� tran-script than PXR-null livers, indicating that PXR activa-tion suppressed PPAR� expression. Beyond 24 hoursafter PH, wild-type regenerating livers expressed slightlyhigher PPAR� mRNA levels than PXR-null regeneratinglivers. These results indicate that PXR activation mark-edly suppresses the mRNA expression of PPAR� 24 hoursafter PH.

PPAR� is involved in the regulation of hepatic lipidstorage.33,34 PXR-null mice subjected to sham operationor PH consistently expressed lower levels of hepaticPPAR� mRNA than wild-type mice at every studied timepoint after surgery (Fig. 5B). These observations indi-cated that deletion of PXR leads to down-regulation ofPPAR� expression. At 36 hours after PH, although thehepatic PPAR� mRNA expression was up-regulated inboth genotypes of mice, the PPAR� transcript level inwild-type livers was more than 2-fold higher than that inPXR-null livers.

Long-chain free fatty acid elongase (FAE), a lipogenicenzyme highly expressed in the liver, has been shown to beup-regulated by activation of PXR.24 Our data showedthat, 36 hours after PH, hepatic FAE mRNA level inwild-type mice was 5.2-fold higher than that in PXR-nullmice (Fig. 5C). Thus, PH-induced FAE mRNA expres-sion at 36 hours after PH is PXR dependent.

CD36 is a free fatty acid transporter responsible for theuptake of fatty acid.35-37 A recent report demonstratedthat CD36 is a direct PXR target gene.24 At 24 hours and48 hours post-PH, wild-type livers expressed at least3-fold higher CD36 mRNA than PXR-null livers (Fig.5D). At 36 hours after surgery, PH induced hepaticCD36 gene expression to similar levels regardless of geno-types (Fig. 5D). These data confirmed that CD36 is aPXR target gene. However, PH-induced CD36 gene ex-pression might be PXR-independent.

Acetyl-CoA-carboxylase 1 (ACC-1) is a lipogenic en-zyme known to be regulated by sterol regulatory element-binding protein 1c.38 Marked induction of ACC-1 geneexpression was seen in both wild-type and PXR-null livers36 hours after surgery. However, the level of hepatic

Fig. 4. PXR and Cyp3a11 mRNA levels during liver regeneration.Wild-type mice were subjected to sham operation (sham) or partialhepatectomy (PH) and sacrificed 24 hours following surgery. The hepaticmRNA levels of PXR (A) and Cyp3a11 (B) were quantified by real-timePCR and are expressed as mean of fold changes compared with sham-operated controls � SD (n � 3 for each surgery group). *P � 0.05.


ACC-1 transcript was consistently lower in PXR-nullmice than that in wild-type mice. The data indicated thatPXR is involved in the regulation of ACC-1 gene expres-sion during liver regeneration.

PXR-Dependent STAT3 Activity During Liver Re-generation. Cytokine signaling, transduced by the Ja-nus-activated kinase/STAT3 pathway, promotes liverregeneration.39,40 Evidence suggests that PXR may mod-

Fig. 5. Expression of genes involved in lipid metabolism during liver regeneration. Total RNA was extracted from the livers collected in theexperiment described in Fig. 1. The hepatic mRNA levels of PPAR� (A), PPAR� (B), FAE (C), CD36 (D), and ACC-1 (E) of wild-type (WT) and PXR-null(KO) mice at the indicated time points after partial hepatectomy (PH) or sham operation (Sham) were measured by quantitative real-time PCR. Dataare expressed as mean of fold changes compared with sham controls of wild-type mice 24 hours after surgery � SD (n � 3-6 for each surgery groupof each genotype at each time point). *P � 0.05; **P � 0.01; ***P � 0.001.


ulate cytokine signaling during inflammation.41 To eval-uate whether absence of PXR affects STAT3-mediatedsignaling during liver regeneration, hepatic functional sta-tus of STAT3 was analyzed by Western blotting andSTAT3 DNA binding activity assay (Fig. 6).

At 36 hours after PH, abundant phosphorylatedSTAT3 was detected in the livers of both wild-type andPXR-null mice, suggesting that PXR may not have aneffect on cytokine signaling during the first peak of cellproliferation. However, 5 days after PH, phophorylatedSTAT3 was only detected in wild-type, but not in PXR-null, mice. The findings demonstrated the essential role ofPXR in regulating STAT3-mediated signaling pathwayduring the second wave of hepatocyte proliferation. As acontrol, total STAT3 protein was abundant in all of thesamples regardless of genotypes and time points examined(Fig. 6A). To further confirm the functional status ofSTAT3, DNA-binding activity of STAT3 was evaluatedusing liver nuclear extracts prepared from the livers ofwild-type and PXR-null mice sacrificed 36 hours and 5days after PH. The result showed that hepatic STAT3DNA binding activity was not different between the 2

genotypes of mice at 36 hours, whereas PXR absence re-sulted in significantly reduced STAT3 DNA binding ac-tivity 5 days after the surgery (Fig. 6B). The data areconsistent with Western blot analysis.

DiscussionThis study demonstrates the essential role of PXR in

mediating the normal hepatic regenerative response toliver mass loss. During the first 5 days of growth, a tran-sient drop of liver-to-body-weight ratio because of lack ofPXR was evident 36 hours after PH. This observation canbe explained by significantly reduced fat accumulationand hepatocyte proliferation due to PXR absence. Subse-quently, the liver growth was comparable between wild-type and PXR-null mice 48 hours and 5 days after PH.This suggests that the role of PXR in the first phase of liverregeneration can be compensated. Beyond 5 days, how-ever, loss of PXR led to persistent inhibition of livergrowth, which resulted in a significant liver mass deficit10 days after PH. In agreement with this observation, thesecond wave of hepatocyte proliferation, which drives thelate phase liver growth, was largely reduced as a conse-quence of PXR absence. Further investigation revealedthe inactivation of STAT3 5 days after PH in PXR-nulllivers, which contributes at least in part to the mecha-nisms responsible for PXR-dependent suppression of thesecond wave of hepatocyte proliferation. We concludethat PXR is an essential regulator for hepatocyte prolifer-ation and liver growth, especially during the late stage ofliver regeneration.

Our finding expanded the roles of nuclear receptors inliver regeneration. Genetically associated and functionallyoverlapped with PXR, xenobiotic receptor constitutiveandrostane receptor has been shown to participate in theearly period of the hepatic regenerative response to PH.8

Mice lacking constitutive androstane receptor exhibited amodest decrease in liver growth only at day 1 after PH.8

FXR, a nuclear receptor mediating bile acid signaling, hasbeen demonstrated to be required for normal liver regen-eration.8 At the early stage of liver regeneration (the first 3days after PH), FXR absence causes a strong inhibition ofliver growth accompanied by decreased hepatocyte prolif-eration.8 At the late stage, liver growth somehow catchesup, and liver regeneration is able to complete even in theabsence of FXR.8 The role of PXR in the hepatic regen-erative response to PH was examined by Huang et al.8

Liver regrowth was estimated using a percentage of orig-inal liver weight, which may be more sensitive than usingthe liver-to-body-weight ratio to detect liver growth in thefirst few days after PH because the denominator used,liver rather than body weight, is smaller. As a result, nodefect in liver regrowth was observed in PXR-null mice.

Fig. 6. Hepatic STAT3 activity after partial hepatectomy (PH) inwild-type (WT) and PXR-null (KO) mice. (A) Total and phosphorylatedSTAT3 were assessed by western blot in the livers of WT and KO micesacrificed 36 hours and 5 days after PH. Beta-actin is included as aloading control. (B) STAT3 DNA binding activity was studied using nuclearextracts prepared from the livers of 2 genotypes of mice at the same timepoints after PH as described. Data are expressed as mean of relative lightunits (RLU) � SD (n � 3 for each genotype at each time point). ***P �0.001.


The PXR-null mice used by us and by Huang et al. havethe same genetic background and were distributed fromthe same source.16 In this study, we chose to use liver-to-body-weight ratio because the body weight obtained fromthe experimental animals might be more accurate thanusing the original liver weight, which has to be estimatedfrom nonexperimental animals. Using liver-to-body-weight ratio and the number of Ki-67–positive hepato-cytes as a cell proliferation index, our data indicate thatPXR is an essential regulator for liver regeneration. Func-tional loss of PXR results in suppression of liver growth,concomitant with the reduction of hepatocyte prolifera-tion and the inactivation of STAT3. Taken together,these nuclear receptors and potentially others may func-tion coordinately at the same time or at different stages toensure normal progress of liver regeneration. Identifica-tion of the roles of these nuclear receptors in liver regen-eration provides considerable insights into the molecularmechanisms by which the liver is able to restore its origi-nal mass, structure, and function in response to injury.

Intracellular lipid droplet formation (steatosis) occursduring early liver regeneration.28 Hepatocytes accumulatetriglyceride and cholesterol esters in the lipid droplets,which are proposed to serve as an energy source support-ing cell proliferation and tissue regrowth.30 The role of fatin liver regeneration has been studied in different models.Reduced lipid droplet accumulation attributable to lackof caveolin-1, an essential component of distinct domains(caveolae) of plasma membrane, causes failure of cell di-vision and consequent animal death in response to PH.29

Leptin supplementation reduces hepatocellular fat accu-mulation and glucocorticoid increases cellular fat accu-mulation during adipocyte differentiation. Suppressionof hepatocellular fat accumulation, by administration ofleptin or genetic deletion of glucocorticoid receptor, im-pairs hepatocyte proliferation and liver regeneration afterPH.28 These findings support the notion that fat accumu-lation is required for normal liver regeneration. However,pathological preexistence of steatosis severely compro-mises the hepatic regenerative response to PH, which hasbeen demonstrated using genetically based models of ste-atosis, such as ob/ob mice (leptin deficiency)42-44 anddb/db mice (leptin receptor deficiency).45 In addition,preexistence of steatosis and obesity induced by chronicexposure to a high-fat diet caused significant impairmentof liver regeneration after PH.46 Clinically, obese patientswith fatty livers tend to have poor outcomes after liverresection, liver transplantation, or other types of liver in-juries.47 These observations suggest that preexisting ste-atosis harms subsequent liver regeneration. In contrast,animals with steatosis induced by other special diets, suchas the methionine-choline-deficient diet48,49 or orotic-ac-

id–supplemented diet,50 showed normal or only slightlydelayed liver regeneration. These conflicts need to be fur-ther analyzed to comprehensively evaluate the roles of“pathological” versus “physiological” steatosis in liver re-generation. In our study, lack of PXR reduces hepatic fataccumulation accompanied by suppressed hepatocyteproliferation 36 hours after PH, leading to a reduction ofliver-to-body-weight ratio in PXR-null mice. These re-sults suggest that PXR-mediated lipid accumulation isrequired for the hepatic regenerative response to liver re-section. Further investigation is needed to understand themechanism by which PXR-mediated lipid homeostasisregulates hepatocyte proliferation.

Steatosis can be observed as early as 12 hours and per-sists until 48 hours after PH by histological examina-tion.28 We found that steatosis was most dramatic at 36hours after PH by histological and biochemical analyses.However, the liver regeneration–induced steatosis peakwas not present because of a lack of PXR (Fig. 3). Thefinding indicated that PXR is responsible for the peakformation of fat accumulation in the regenerating liver.Xie’s group demonstrated a novel function of PXR inregulating hepatic lipid homeostasis.24 Activation of PXRresults in hepatic lipid accumulation by inhibition ofPPAR� and up-regulation of PPAR�, FAE, and CD36,and these responses are independent of sterol regulatoryelement-binding protein 1c.24

The current study demonstrated that PXR regulatesthe mRNA levels of these genes involved in multiple as-pects of lipid metabolism during liver regeneration.Twenty-four hours after PH, when PXR is activated,wild-type mice have reduced mRNA levels of PPAR� andincreased mRNA levels of PPAR�, CD36, and ACC-1 incomparison with PXR-null mice. These PXR-dependentchanges of gene expression might lead to inhibition oflipid �-oxidation and enhancement of lipid uptake, stor-age, and biosynthesis, which contribute at least in part tothe subsequent peak formation of lipid accumulation.Thirty-six hours after PH, when lipid accumulationreached peak, wild-type mice expressed higher mRNAlevels of PPAR�, FAE, and ACC-1 than PXR-null mice,which might facilitate lipid storage and biosynthesis.Hence, PXR might have a stage-specific effect on lipidmetabolism during liver regeneration, which is concomi-tant with hepatocyte proliferation.

It is unclear how PXR deficiency suppresses the secondwave of hepatocyte proliferation, leading to inhibition ofthe second phase of liver growth. Studies on liver regen-eration using the PH model largely focus on the molecularand cellular events that occur in the first few days after thesurgery. The regulation of the second wave of hepatocyteproliferation has yet to be characterized. STAT3 plays a


crucial role in organ development and cell proliferation.51

Activated by cytokines and growth factors, STAT3 is rap-idly activated after PH.52 Liver-specific STAT3 knockoutmice have normal liver development but demonstrate ir-regular immediate-early gene activation and have reducedmitogenic response after PH.40 These observations indi-cate that STAT3 contributes to the acute phase hepaticresponse and hepatocyte proliferation during liver regen-eration. Among the STAT family members (STAT1-6),hepatic STAT1, STAT3, and STAT5 proteins could bedetected. However, only STAT3 was activated 36 hoursand 5 days after PH in wild-type mice. Lack of PXR didnot significantly affect hepatic total protein levels ofSTAT1, STAT3, and STAT5, but led to STAT3 inacti-vation day 5 after PH (data not shown and Fig. 6). Inac-tivation of hepatic STAT3 was closely associated withreduction of hepatocyte proliferation in PXR-null mice atday 5 following PH. The data suggested that STAT3 mayalso be an important regulator of second wave of hepato-cyte proliferation, responsible for the later phase growthof regenerating livers.

In summary, our study demonstrates that PXR is acritical regulator of liver regeneration. During the earlystage of liver growth, PXR participates in mediation ofhepatocyte proliferation, and modulation of lipid metab-olism by regulating the transcription of genes responsiblefor lipid uptake, transport, biosynthesis, and oxidation.During the late stage of liver mass restoration, PXR reg-ulates hepatocyte proliferation possibly by modulatingSTAT3 activity, ensuring the sustaining of liver growth.Lack of PXR impairs normal progression of liver regener-ation.

Acknowledgment: We thank Dr. Wen Xie, Centerfor Pharmacogenetics and Department of PharmaceuticalSciences, University of Pittsburgh, for providing us withthe PXR-null mice. We thank Matthew Wortham andBarbara Brede for critical review of the manuscript.

References1. Fausto N, Campbell JS, Riehle KJ. Liver regeneration. HEPATOLOGY 2006;

43:S45–53.2. Michalopoulos GK, DeFrances M. Liver regeneration. Adv Biochem Eng

Biotechnol 2005;93:101-134.3. Zimmermann A. Regulation of liver regeneration. Nephrol Dial Trans-

plant 2004;19(Suppl 4):iv6–10.4. Michalopoulos GK. Liver regeneration. J Cell Physiol 2007;213:286-300.5. Nakamura T, Sakata R, Ueno T, Sata M, Ueno H. Inhibition of trans-

forming growth factor beta prevents progression of liver fibrosis and en-hances hepatocyte regeneration in dimethylnitrosamine-treated rats.HEPATOLOGY 2000;32:247-255.

6. Villevalois-Cam L, Rescan C, Gilot D, Ezan F, Loyer P, Desbuquois B, etal. The hepatocyte is a direct target for transforming-growth factor betaactivation via the insulin-like growth factor II/mannose 6-phosphate re-ceptor. J Hepatol 2003;38:156-163.

7. Date M, Matsuzaki K, Matsushita M, Tahashi Y, Sakitani K, Inoue K.Differential regulation of activin A for hepatocyte growth and fibronectinsynthesis in rat liver injury. J Hepatol 2000;32:251-260.

8. Huang W, Ma K, Zhang J, Qatanani M, Cuvillier J, Liu J, et al. Nuclearreceptor-dependent bile acid signaling is required for normal liver regen-eration. Science 2006;312:233-236.

9. Anderson SP, Yoon L, Richard EB, Dunn CS, Cattley RC, Corton JC.Delayed liver regeneration in peroxisome proliferator-activated receptor-alpha-null mice. HEPATOLOGY 2002;36:544-554.

10. Rao MS, Peters JM, Gonzalez FJ, Reddy JK. Hepatic regeneration inperoxisome proliferator-activated receptor alpha-null mice after partialhepatectomy. Hepatol Res 2002;22:52-57.

11. Imai T, Jiang M, Kastner P, Chambon P, Metzger D. Selective ablation ofretinoid X receptor alpha in hepatocytes impairs their lifespan and regen-erative capacity. Proc Natl Acad Sci U S A 2001;98:4581-4586.

12. Vogel G. Two unexpected players add twists to liver’s comeback story.Science 2006;312:178.

13. Blumberg B, Sabbagh W Jr., Juguilon H, Bolado J Jr., van Meter CM, OngES, et al. SXR, a novel steroid and xenobiotic-sensing nuclear receptor.Genes Dev 1998;12:3195-3205.

14. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, etal. An orphan nuclear receptor activated by pregnanes defines a novelsteroid signaling pathway. Cell 1998;92:73-82.

15. Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, KliewerSA. The human orphan nuclear receptor PXR is activated by compoundsthat regulate CYP3A4 gene expression and cause drug interactions. J ClinInvest 1998;102:1016-1023.

16. Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, etal. Humanized xenobiotic response in mice expressing nuclear receptorSXR. Nature 2000;406:435-439.

17. Bertilsson G, Heidrich J, Svensson K, Asman M, Jendeberg L, Sydow-Backman M, et al. Identification of a human nuclear receptor defines a newsignaling pathway for CYP3A induction. Proc Natl Acad Sci U S A 1998;95:12208-12213.

18. Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI,LaTour A, et al. The nuclear receptor PXR is a lithocholic acid sensor thatprotects against liver toxicity. Proc Natl Acad Sci U S A 2001;98:3369-3374.

19. Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES,et al. An essential role for nuclear receptors SXR/PXR in detoxification ofcholestatic bile acids. Proc Natl Acad Sci U S A 2001;98:3375-3380.

20. Xie W, Yeuh MF, Radominska-Pandya A, Saini SP, Negishi Y, BottroffBS, et al. Control of steroid, heme, and carcinogen metabolism by nuclearpregnane X receptor and constitutive androstane receptor. Proc Natl AcadSci U S A 2003;100:4150-4155.

21. Saini SP, Mu Y, Gong H, Toma D, Uppal H, Ren S, et al. Dual role oforphan nuclear receptor pregnane X receptor in bilirubin detoxification inmice. HEPATOLOGY 2005;41:497-505.

22. Stanley LA, Horsburgh BC, Ross J, Scheer N, Wolf CR. PXR and CAR:nuclear receptors which play a pivotal role in drug disposition and chemicaltoxicity. Drug Metab Rev 2006;38:515-597.

23. Staudinger J, Liu Y, Madan A, Habeebu S, Klaassen CD. Coordinateregulation of xenobiotic and bile acid homeostasis by pregnane X receptor.Drug Metab Dispos 2001;29:1467-1472.

24. Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, Toma D, et al. A novel pregnaneX receptor-mediated and sterol regulatory element-binding protein-inde-pendent lipogenic pathway. J Biol Chem 2006;281:15013-15020.

25. Greene AK, Puder M. Partial hepatectomy in the mouse: technique andperioperative management. J Invest Surg 2003;16:99-102.

26. Koniaris LG, McKillop IH, Schwartz SI, Zimmers TA. Liver regeneration.J Am Coll Surg 2003;197:634-659.

27. Bucher NL. Regeneration of mammalian liver. Int Rev Cytol 1963;15:245-300.

28. Shteyer E, Liao Y, Muglia LJ, Hruz PW, Rudnick DA. Disruption ofhepatic adipogenesis is associated with impaired liver regeneration in mice.HEPATOLOGY 2004;40:1322-1332.


29. Fernandez MA, Albor C, Ingelmo-Torres M, Nixon SJ, Ferguson C, Kur-zchalia T, et al. Caveolin-1 is essential for liver regeneration. Science 2006;313:1628-1632.

30. Fausto N, Riehle KJ. Mechanisms of liver regeneration and their clinicalimplications. J Hepatobiliary Pancreat Surg 2005;12:181-189.

31. Maglich JM, Stoltz CM, Goodwin B, Hawkins-Brown D, Moore JT,Kliewer SA. Nuclear pregnane x receptor and constitutive androstane re-ceptor regulate overlapping but distinct sets of genes involved in xenobioticdetoxification. Mol Pharmacol 2002;62:638-646.

32. Berger J, Moller DE. The mechanisms of action of PPARs. Annu Rev Med2002;53:409-435.

33. Yu S, Matsusue K, Kashireddy P, Cao WQ, Yeldandi V, Yeldandi AV, et al.Adipocyte-specific gene expression and adipogenic steatosis in the mouseliver due to peroxisome proliferator-activated receptor gamma1 (PPAR-gamma1) overexpression. J Biol Chem 2003;278:498-505.

34. Gavrilova O, Haluzik M, Matsusue K, Cutson JJ, Johnson L, Dietz KR, etal. Liver peroxisome proliferator-activated receptor gamma contributes tohepatic steatosis, triglyceride clearance, and regulation of body fat mass.J Biol Chem 2003;278:34268-34276.

35. Abumrad NA, el-Maghrabi MR, Amri EZ, Lopez E, Grimaldi PA. Clon-ing of a rat adipocyte membrane protein implicated in binding or transportof long-chain fatty acids that is induced during preadipocyte differentia-tion: homology with human CD36. J Biol Chem 1993;268:17665-17668.

36. Abumrad N, Harmon C, Ibrahimi A. Membrane transport of long-chainfatty acids: evidence for a facilitated process. J Lipid Res 1998;39:2309-2318.

37. Bonen A, Campbell SE, Benton CR, Chabowski A, Coort SL, Han XX, etal. Regulation of fatty acid transport by fatty acid translocase/CD36. ProcNutr Soc 2004;63:245-249.

38. Shimano H, Yahagi N, Amemiya-Kudo M, Hasty AH, Osuga J, TamuraY, et al. Sterol regulatory element-binding protein-1 as a key transcriptionfactor for nutritional induction of lipogenic enzyme genes. J Biol Chem1999;274:35832-35839.

39. Hirano T, Ishihara K, Hibi M. Roles of STAT3 in mediating the cellgrowth, differentiation and survival signals relayed through the IL-6 familyof cytokine receptors. Oncogene 2000;19:2548-2556.

40. Li W, Liang X, Kellendonk C, Poli V, Taub R. STAT3 contributes to themitogenic response of hepatocytes during liver regeneration. J Biol Chem2002;277:28411-28417.

41. Teng S, Piquette-Miller M. The involvement of the pregnane X receptor inhepatic gene regulation during inflammation in mice. J Pharmacol ExpTher 2005;312:841-848.

42. Yang SQ, Lin HZ, Mandal AK, Huang J, Diehl AM. Disrupted signalingand inhibited regeneration in obese mice with fatty livers: implications fornonalcoholic fatty liver disease pathophysiology. HEPATOLOGY 2001;34:694-706.

43. Leclercq IA, Field J, Farrell GC. Leptin-specific mechanisms for impairedliver regeneration in ob/ob mice after toxic injury. Gastroenterology 2003;124:1451-1464.

44. Selzner M, Clavien PA. Failure of regeneration of the steatotic rat liver:disruption at two different levels in the regeneration pathway. HEPATOL-OGY 2000;31:35-42.

45. Yamauchi H, Uetsuka K, Okada T, Nakayama H, Doi K. Impaired liverregeneration after partial hepatectomy in db/db mice. Exp Toxicol Pathol2003;54:281-286.

46. DeAngelis RA, Markiewski MM, Taub R, Lambris JD. A high-fat dietimpairs liver regeneration in C57BL/6 mice through overexpression of theNF-kappaB inhibitor, IkappaBalpha. HEPATOLOGY 2005;42:1148-1157.

47. Powell EE, Jonsson JR, Clouston AD. Steatosis: co-factor in other liverdiseases. HEPATOLOGY 2005;42:5-13.

48. Zhang BH, Weltman M, Farrell GC. Does steatohepatitis impair liverregeneration? A study in a dietary model of non-alcoholic steatohepatitis inrats. J Gastroenterol Hepatol 1999;14:133-137.

49. Rao MS, Papreddy K, Abecassis M, Hashimoto T. Regeneration of liverwith marked fatty change following partial hepatectomy in rats. Dig DisSci 2001;46:1821-1826.

50. Picard C, Lambotte L, Starkel P, Sempoux C, Saliez A, Van den Berge V,et al. Steatosis is not sufficient to cause an impaired regenerative responseafter partial hepatectomy in rats. J Hepatol 2002;36:645-652.

51. Levy DE, Lee CK. What does Stat3 do? J Clin Invest 2002;109:1143-1148.

52. Cressman DE, Diamond RH, Taub R. Rapid activation of the Stat3 transcrip-tion complex in liver regeneration. HEPATOLOGY 1995;21:1443-1449.


Pregnane X receptor is essential for normal progression of liver regeneration

Documents