Practice Exam 1 - Canvas Login

Biology 200, Autumn 2014 Practice Exam 1

How to Use this Practice Exam:

I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows.

1. Do NOT answer the questions as a problem set. 2. Study material using your lecture and lab notes and do problem sets FIRST. 3. When you feel you are fairly prepared, put away all of your notes and sit down in a

quiet place where you will not be interrupted for at least an hour or two. 4. "Take" the exam without stopping to check notes or the book. 5. At the end of the exam, "grade" your responses. THEN go back and try and figure out

the ones you answered incorrectly. Use your notes/book if you need to at this point. 6. If you are still confused, contact an instructor or TA during their office hours or by email

so that you can get your questions answered. NOTE: This exam may or may not reflect the content of the exam as presented this quarter, nor will it necessarily be the same length (in fact, this one is WAY longer – I've added several questions for your practice). Use these questions as a guideline as to the types of questions that may appear on your exams. THEREFORE YOU MAY FIND QUESTIONS ON MATERIAL WE HAVE NOT COVERED, OR THERE MAY BE MATERIAL NOT EXAMINED IN THESE TESTS THAT YOU WILL BE RESPONSIBLE FOR.

Biology 200, Autumn 2014 Practice Exam 1

PRACTICE EXAM 1 *************************************************************************************************** Note: The codon table and the respiration intermediates are printed on the last 2 pages for your reference. 1. Fill in the blanks: All questions refer to the four molecules diagrammed below: a) Molecule “A” fits best into which category of biological macromolecules? b) “B” fits best in which category of biological macromolecules? c) “C” fits best in which category of biological macromolecules? d) Which molecule would best be described as a fatty acid? ________ e) Which of these molecules could be a steroid hormone? ________ f) Which of these molecules has the most energy stored in its bonds that could be used to make ATP? _________ Multiple true/false – CIRCLE ALL THAT ARE CORRECT! 2. Unsaturated oils…

a) have no double bonds. b) are liquid at room temperature. c) cannot store energy that cells could use to make ATP. d) are more often found in animals than plants.

3. A tRNA carrying the amino acid Arg (arginine)...

a. may bind to the codon 5’ ACA 3’. b. can have the anticodon 5’ GCC 3’. c. will bind to the E site of a ribosome. d. can have the anticodon 3’ UCC 5’.

A

B

C

D

Biology 200, Autumn 2014 Practice Exam 1 4. Answer questions based on this diagram a. Which part of the diagram to the right

represents the outside of a eukaryotic cell? (Circle one) A B C

b. Which of the molecules in the diagram

is in the same category of biological macromolecules as the molecule below?

(Circle one): D E F c. Which of the molecules in the diagram is in the same category of biological molecules as the

molecule below? (Circle one): D E F d. Molecule D in the diagram pumps chloride against its gradient using the energy stored in a

sodium ion concentration gradient. This process is called: ________________________ e. On the diagram, where would cholesterol molecules most commonly be found? (Circle one) A B C f. Which of the following molecules are permeable through a membrane made purely of

molecule E? (Circle ALL that are correct – the molecule on the right is one of your choices) H2O CO2 glucose Na+ CH4

A

C

B

D E

F

Biology 200, Autumn 2014 Practice Exam 1 5. The following graph shows the results of a student assay testing “mandase” enzyme

activity in the presence of various concentrations of salt. Use these results to answer the questions below.

a) At which salt concentration does

mandase enzyme work the most effectively?

______ b) At what salt concentration is

enzyme activity completely inhibited? _______ c) Which of the following interactions will most likely be affected first by addition of salt? (Circle one) hydrophobic interactions disulfide bonds ionic bonds d) The graph below shows the pathway of the reaction that mandase enzyme catalyzes in the

presence of intact enzyme. Draw on the graph a reaction pathway in the absence of intact mandase. 6. Fill in the blank. For each, write TWO different answers that fit the description given. (There may be more than 2 answers. Please write only TWO!) a. Catalyst that breaks a bond between i. __________________ ii. __________________ an amino acid and a tRNA. b. Anticodon for a tRNA that gets attached to i. __________________ ii. __________________ the amino acid ‘His’. (include 5’ and 3’ labels!) c. Something that is transcribed but is not i. __________________ ii. __________________ translated.

G

Progress of the reaction ->

Biology 200, Autumn 2014 Practice Exam 1 7.As you saw in your problem sets, chemotrypsin is an enzyme which catalyzes the hydrolysis

of peptide bonds. The first step of the reaction is shown to your right. Use this to answer the following questions.

a) Describe briefly how an decrease in pH would affect

the enzyme’s interaction with substrate (not the enzyme’s structure.) (Answer in 1-2 sentences)

b) Adding chemotrypsin speeds up this

reaction by changing: (Circle all that apply) ΔG of the reaction ΔH of the reaction EA of the reaction G of the T.S.I. c) Draw a molecule in the space below that could act as a competitive inhibitor of chemotrypsin. d) In what organelle might you find an enzyme that performs a similar function to

chemotrypsin? __________________________________ e) Imagine that Gly-193 is changed to Alanine:

Describe how you would expect the reaction to change (if at all) and why. (Answer in 1-2 sentences)

substrate

enzyme

Biology 200, Autumn 2014 Practice Exam 1 8. The diagram below shows the translation of the protein phosphofructokinase (PFK),

the enzyme that catalyzes step 3 of glycolysis (which occurs in the cytoplasm). This image comes from a eukaryotic cell.

For a-d CIRCLE the correct answer(s):

a. Which molecule has peptide bonds? D E b. Which is the 5’ end? A H c. Which end lies at “C”? N C 5’ 3’ d. Which bound to “D” FIRST? B G

e. Will release factor bind next in site "F"? Yes No You can't tell from figure

9. The DNA below represents the beginning of a protein-coding gene in a bacterial cell. a. What protein binds FIRST to the DNA to initiate transcription? _______________ b. Write out the first 6 nucleotides of the RNA strand made from this gene. Be sure to label the 5' and 3' ends of the strand. c. Is the start codon in these first 6 nucleotides? ______ d. What sequence signals that it is the end of the gene? __________________

A H

G F

E

D

C B

+1 3’ AGATACCAAGTTACATCTTCCTGTACGGGAGTAAACTATAAGGC 5’ 5’ TCTATGGTTCAATGTAGAAGGACATGCCCTCATTTGATATTCCG 3’

-10

Biology 200, Autumn 2014 Practice Exam 1 10. In studying a strain of yeast that is very sickly, you find that all of the enzymes in the cell

are functioning poorly. a) In your first experiment, you sequence the genes for 7 enzymes involved in lipid

metabolism. You find that they all have wild-type sequence. What can you rule out as a cause for this sick yeast? (Circle one)

i) mutations in the DNA coding for lipid-metabolizing enzymes ii) mutations in the mRNA coding for lipid-metabolizing enzymes iii) mutations in the lipid-metabolizing enzymes’ primary amino acid sequences

b) In your next experiment, you determine the amino acid sequence of each of the 7

proteins. In each one, the only difference you find is that the amino acid aspartic acid is sometimes found in the amino acid sequence when you should have a leucine. You conclude that this is not caused by an error of RNA polymerase during transcription. (RNA polymerase has an error rate of about 1 every 1,000 nucleotides.) How did you come to your conclusion?

c) In a final experiment, you find a single mutation in a gene unrelated to lipid metabolism

that accounts for the phenotype of this yeast strain.

i. What does this gene code for? __________________________________

ii. How has its protein function changed? (Describe in 1-2 sentences) 11. In organisms living on planet Mandoid, all of respiration is the same as on planet Earth except for one part: At every oxidation step of glycolysis, the linking step, and the Krebs cycle, FAD is the molecule that gets reduced. How many molecules ATP per molecule of glucose can a prokaryote living on planet Mandoid make? (Show all work for full credit.)

Biology 200, Autumn 2014 Practice Exam 1 12. On planet Rebus, the following reaction is catalyzed by a single enzyme as shown.

Other than this reaction, the rest of respiration occurs just as it does on Earth. a. What does molecule “X” have to be to balance this reaction? _________________ b. What is the total number of ATP that can be made from a molecule of glucose in a

eukaryote on planet Rebus? (Assume there is oxygen on Rebus and that there is an NADH FADH2 shuttle. Show all work for full credit.)

13. Imagine a eukaryotic cell in which there is a mutation in both copies of the gene for ATP synthase. In this mutant, the ATP synthase is not as efficient, requiring twice as many H+ to pass through to make a single ATP molecule compared to normal, wild type cells. How many ATP can the mutant organism make per glucose molecule? (Normal cells make ~30 ATP/glucose) - ATP from Substrate-level phosphorylation: _______ - ATP from Oxidative phosphorylation: _______

“X”

Biology 200, Autumn 2014 Practice Exam 1 14. Write in the one BEST category that describes each item below, using the letters in the box. a. _______ ribosomal RNA b. _______ glucose c. _______ sigma

d. _______ thymidine monophosphate (TMP) e. _______ promoter sequence f. _______ Na+ channel in membrane g. _______ cholesterol h. _______ inorganic phosphate (Pi) i. _______ quinone (Q) in the electron transport chain j. _______ NADH k. _______ release factor l. _______ ATP 15. Read the descriptions listed in the table and choose the appropriate molecule(s) from the list on the right that match (A-F). There is at least one answer for each description and there may be more than one for some. Write ALL correct answers. Not all the choices will necessarily be used. Description Answer(s)

a) Enzyme that uses ATP as a substrate

b) DNA-binding protein

c) Enzyme that has a carbohydrate as a substrate

d) Enzyme that catalyzes an exergonic reaction

e) Enzyme that spans the plasma membrane of bacterial cells

Category: P = amino acid or protein R = carbohydrate S = lipid T = nucleotide or nucleic acid U = other molecule or structure

Molecule name A. RNA polymerase B. sigma C. ATP synthase

D. β-galactosidase E. enzyme that makes CDP from CMP F. enzyme that catalyzes the first step of glycolysis

Biology 200, Autumn 2014 Practice Exam 1 16. This is the same reaction mechanism as the one you saw in Quiz 2. The complete reaction mechanism is shown. NEW INFORMATION: This enzyme is composed of a single polypeptide and is found in humans. a. If this enzyme were treated with high salt concentrations, which levels of protein structure would be disrupted? (Circle ALL that apply) 1° 2° 3° 4° b. If this enzyme were treated with high salt concentrations, which types of bonds would be disrupted? (Circle ALL that apply) peptide disulfide H-bonds ionic bonds bonds bonds c. Which of the following is TRUE? (Circle ALL) A. G of the reactants > G of the products B. EA of the reaction with enzyme > EA without enzyme C. ΔG of the reaction is positive D. G of enzyme at beginning > G of enzyme at end d. Which of the following molecules would be the BEST competitive inhibitor of this enzyme? (Circle ONE)

e. If Gly26 were changed to the amino acid shown below, would the reaction rate increase, decrease, or stay the same? Give one specific reason using a few words.

f. Bacteria that live at 100°C in hot springs have an enzyme that carries out the same reaction. How would you expect the enzyme structure to be different?

Step 1

Step 2

B

A

Asp79

Asp134

His97

Asp52

Gly26

Biology 200, Autumn 2014 Practice Exam 1 17. Fill in the blanks: a. Where is ATP synthase in a eukaryotic cell? (Be specific!) ________________________ b. You have 1 gram of glucose, 1 gram of protein, and 1 gram of fat. Which has the most energy that cells can use to make ATP? __________________ c.Name one way you could change a lipid bilayer to make it less permeable. ____________________________________ d. In a membrane protein, what is the characteristic of the R-groups that come in contact with the interior of the phospholipid bilayer? ____________________ e. Name one molecule that is permeable through a lipid bilayer: ________________________ 18. On planet Spensoid, organisms primarily use the carbohydrate "erythrose" as an energy source for respiration. Eukaryotic cells on Spensoid have enzymes that carry out the following reactions: a. How many pairs of high energy electrons does erythrose have? ________ b. Should any of the reactions in the diagram shown above have NAD+ as a substrate as well? Explain your answer in a few words. c. Starting with one molecule of erythrose, fill in the table below with the number of each molecule produced in a eukaryotic cell on Spensoid. Assume that all Earth enzymes are present and that Spensoid organisms have an NADH-> FADH2 shuttle. (Respiration diagram shown on p. 1).

ATP from substrate level phosphorylation

NADH FADH2 CO2

Glycolysis

Linking Step/ Krebs Cycle

2

2 HSCoA

erythrose

2 H2O

Biology 200, Autumn 2014 Practice Exam 1 19. Consider the following statements in the context of a fully active mitochondrion that is steadily producing ATP. Then mark the blank under True or False for each statement. True False ____ _____ H+ concentration is higher in the matrix than outside of the matrix.

____ _____ Movement of H+ into the matrix is facilitated diffusion.

____ _____ Movement of H+ into the matrix requires energy.

____ _____ Quinone (Q) moves H+ out of the matrix using energy from ATP.

____ _____ Oxygen is reduced by gaining electrons from Complex IV.

____ _____ ATP synthase goes through changes in conformation that catalyze ATP synthesis.

20. Below is the sequence of a complete mRNA transcribed from a gene in bacteria. a. Write the protein sequence that is translated from this mRNA on the line below, and label the amino (N) and carboxyl (C) ends of the protein. (Codon table is on p. 6) b. Circle all of the sequences below that are present in the mRNA above: (Circle ALL that apply) - promoter - ribosome binding site - anticodon - stop codon c. Imagine that you have a bacterial cell in which one of the aa-tRNA synthetase enzymes is mutated. This aa-tRNA synthetase normally binds to the tRNA with a 3'UAG5' anticodon but now ALL COPIES of this enzyme bind to the tRNA with a 3'GAG5' anticodon instead, even though its amino acid binding site is the same. i. Would the mRNA from part "a" be translated differently in a mutant cell? Why or why not? ii. Which of the following statements is TRUE about the mutant cell? (Circle ALL that apply) - There would be more tRNAs with 3'GAG5' anticodons in the mutant cell than tRNAs with 3'UAG5' anticodons. - There would be some tRNAs in the mutant cell that would never become attached to an amino acid. - Proteins in the mutant cell would have all Glu amino acids replaced by Asp - Proteins in the mutant cell would have some Leu amino acids replaced by Ile. - There would be more release factor tRNAs in the mutant cell.

5' GACGGAAGGUAGCGCUAAUGUUUGAGGGUAUAUAGUAUGAACCAGCAA 3'

Biology 200, Autumn 2014 Practice Exam 1 FOR YOUR REFERENCE ONLY. NOTHING WILL BE GRADED ON THIS PAGE.

Codon Table

Biology 200, Autumn 2014 Practice Exam 1 FOR REFERENCE ONLY:

The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.

12

5

5

6

6 6

12

12

12

5

5

5

5

4 9 9

8

7 7

6

6