Positively Charged Residues at the Five-Fold Symmetry Axis of Cell Culture-Adapted Foot-and-Mouth Disease Virus Permit Novel Receptor Interactions

  Published Ahead of Print 5 June 2013. 2013, 87(15):8735. DOI: 10.1128/JVI.01138-13. J. Virol. 

Chamberlain, Nick J. Knowles and Terry JacksonRhiannon Silk, Julian Seago, Jemma Wadsworth, Kyle Stephen Berryman, Stuart Clark, Naresh K. Kakker, Virus Permit Novel Receptor InteractionsCulture-Adapted Foot-and-Mouth DiseaseFive-Fold Symmetry Axis of Cell Positively Charged Residues at the

http://jvi.asm.org/content/87/15/8735Updated information and services can be found at:

These include:

REFERENCEShttp://jvi.asm.org/content/87/15/8735#ref-list-1at:

This article cites 54 articles, 37 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

on June 10, 2014 by guest

http://jvi.asm.org/

Dow

nloaded from

Positively Charged Residues at the Five-Fold Symmetry Axis of CellCulture-Adapted Foot-and-Mouth Disease Virus Permit NovelReceptor Interactions

Stephen Berryman, Stuart Clark, Naresh K. Kakker,* Rhiannon Silk, Julian Seago, Jemma Wadsworth, Kyle Chamberlain,Nick J. Knowles, Terry Jackson

Pirbright Institute, Pirbright, Surrey, United Kingdom

Field isolates of foot-and-mouth disease virus (FMDV) have a restricted cell tropism which is limited by the need for certainRGD-dependent integrin receptors. In contrast, cell culture-adapted viruses use heparan sulfate (HS) or other unidentified mol-ecules as receptors to initiate infection. Here, we report several novel findings resulting from cell culture adaptation of FMDV. Incell culture, a virus with the capsid of the A/Turkey/2/2006 field isolate gained the ability to infect CHO and HS-deficient CHOcells as a result of a single glutamine (Q)-to-lysine (K) substitution at VP1-110 (VP1-Q110K). Using site-directed mutagenesis, theintroduction of lysine at this same site also resulted in an acquired ability to infect CHO cells by type O and Asia-1 FMDV. How-ever, this ability appeared to require a second positively charged residue at VP1-109. CHO cells express two RGD-binding integ-rins (�5�1 and �v�5) that, although not used by FMDV, have the potential to be used as receptors; however, viruses with theVP1-Q110K substitution did not use these integrins. In contrast, the VP1-Q110K substitution appeared to result in enhanced in-teractions with �v�6, which allowed a virus with KGE in place of the normal RGD integrin-binding motif to use �v�6 as a re-ceptor. Thus, our results confirmed the existence of nonintegrin, non-HS receptors for FMDV on CHO cells and revealed anovel, non-RGD-dependent use of �v�6 as a receptor. The introduction of lysine at VP1-110 may allow for cell culture adapta-tion of FMDV by design, which may prove useful for vaccine manufacture when cell culture adaptation proves intractable.

Foot-and-mouth disease (FMD) is endemic in many regions ofthe world and is one of the most widespread, epizootic trans-

boundary animal diseases, affecting many species of wildlife andlivestock, such as cattle, sheep, goats, and pigs. The significanteconomic losses that result from FMD are due to the high mor-bidity of infected animals and stringent trade restrictions imposedon affected countries (1). Vaccination plays a major role in con-trolling FMD, either to lessen the effects of an outbreak in FMD-free countries or for control and eradication in regions where it isendemic. The etiological agent of FMD, foot-and-mouth diseasevirus (FMDV), exists as seven distinct serotypes (O, A, C, Asia-1,and the Southern African Territories [SAT] serotypes SAT-1,SAT-2, and SAT-3). Within each serotype, a large number of an-tigenic variants exist (2). Intraserotype diversity is driven by a highmutation rate during replication that is caused by an error-proneviral RNA-dependent RNA polymerase (3) and thus complicatesefforts to control disease by vaccination due to incomplete protec-tion between some antigenic variants (4). Hence, the most effec-tive vaccines closely match the outbreak virus, which can necessi-tate the development of new vaccine strains. The current vaccinesare inactivated virus preparations grown in large-scale cell culture.Therefore, the production of a new vaccine is critically dependentupon adaptation of viruses from the field for growth in cell cul-ture, which can prove problematical for some viruses.

Foot-and-mouth disease virus is the type species of the Aphtho-virus genus of the Picornaviridae, a family of nonenveloped, sin-gle-stranded positive-sense RNA viruses. The viral capsid isformed by 60 copies each of four structural proteins (VP1 to VP4)arranged in icosahedral symmetry. The outer capsid surfaces areformed by VP1, which surrounds the five-fold symmetry axis, andVP2 and VP3, which alternate around the three-fold axis (5). VP4is myristoylated and located inside the capsid and is thought to

play an essential role in the final stage of assembly and in endo-somal membrane penetration by the viral RNA (6, 7). In vivo,FMDV has a strong tropism for epithelial cells, which is in part dueto the epithelial cell-restricted expression of integrin �v�6, whichis the principal receptor used by field viruses to initiate infec-tion (8–12). Integrin binding is mediated by a highly conservedarginine-glycine-aspartic acid (RGD) motif located at the apex ofa structurally disordered loop (the GH loop of VP1). The integrinspecificity of FMDV has been the subject of several studies, andthree other RGD-dependent integrins (�v�1, �v�3, and �v�8)have also been reported to be receptors for field strains of the virus(13–15); however, the role of these integrins in pathogenesis isunclear, and we have found that �v�3 is a poor receptor forFMDV in vitro (16). Furthermore, despite recognizing their li-gands via the RGD motif, two other RGD-dependent integrins(�v�5 and �5�1) do not appear to serve as receptors for FMDV(17). This may be in part due to the residues that flank the viralRGD that are known to influence integrin-ligand interactions(10). Structural analyses of FMDV and FMDV-derived peptideshave shown that the integrin-binding loop consists of a short re-gion of a �-strand followed by the RGD, which is in turn is fol-lowed by a helical structure (16, 18–22). Typically, native ligands

Received 26 April 2013 Accepted 24 May 2013

Published ahead of print 5 June 2013

Address correspondence to Terry Jackson, [email protected].

* Present address: Naresh K. Kakker, Department of Veterinary Microbiology, CCSHaryana Agricultural University, Hisar, Haryana, India.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.01138-13

August 2013 Volume 87 Number 15 Journal of Virology p. 8735–8744 jvi.asm.org 8735

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

for �v�6 have leucine (L) or methionine (M) at the RGD �1 siteand leucine or isoleucine (I) at the RGD �4 site (16, 23, 24).FMDV may be highly adapted to use �v�6 as a receptor, as it hasa similar conserved sequence (L, M, or arginine at the RGD �1 siteand L or I at the RGD �4 site) following the RGD. This region isknown to be important for binding to �v�6, as ligands that lack acomplete RGD have been shown to bind �v�6 via a DLXXL motif(where X indicates any amino acid) (24), and we have shown thatalanine substitutions at either the RGD �1 or �4 site reduces thepotency of FMDV-derived peptides as anti-�v�6 antagonists(16). The integrity of the helix after the RGD is also important forbinding to �v�6, as it maintains the RGD �1 and RGD �4 resi-dues in orientations accessible for direct interactions with the in-tegrin (18, 25). These observations suggest that the helix and theidentity of the residues at the RGD �1 and �4 sites play impor-tant roles in defining the integrin specificity of FMDV.

A major driving force for cell culture adaptation of FMDV isthat the availability of receptors and passage through cultured cellsoften results in the selection of variants with altered receptor pref-erences (5). For example, cell culture growth often selects for vi-ruses that use heparan sulfate (HS) as a receptor; HS can initiateinfection via an integrin-independent process (26–33). As a result,cell culture-adapted viruses have an increased virulence and ex-panded host range for cultured cells. This has led to HS-bindingviruses being characterized by their ability to infect CHO cells,which lack all of the known integrin receptors of FMDV, com-bined with an inability of these viruses to infect HS-deficient CHOcells (30).

Most information regarding HS binding has come from stud-ies with type O FMDV. The HS-binding site is formed by a shallowdepression in the center of the biological protomer and accom-modates four or five sugar residues that make multiple contactswith all three outer capsid proteins (34). Remarkably, most of thisstructure is conserved in field viruses, and the switch to HS bind-ing arises from only one or two residue changes at the center of theHS-binding site that result in a net gain in positive charge (33, 34).The most important change is at VP3-56, which is typically histi-dine (H) in field viruses and switches to arginine (R) in cell cul-ture-adapted strains. The R is important for HS binding, as itallows ionic interactions with two sulfate groups. HS binding hasalso been demonstrated for other FMDV serotypes. In type CFMDV, the capsid residues that contribute to HS binding appearto be different from those of type O viruses and have not beenprecisely mapped, although the acquisition of a positive residue atVP3-173 has been strongly implicated to play a major role (26,27). Cell culture-adapted SAT viruses have also been reported touse HS as a receptor. As for the type C viruses, the capsid residuesthat bind HS are different from those of type O viruses and havebeen reported to cluster around the five-fold symmetry axis of thevirion (31, 32). For type A viruses, the mechanism of cell cultureadaption is less clear; we found that FMDV A1061 has an HS-binding site that is structurally similar to that of type O FMDV(28), whereas Rieder et al. found that cell culture adaption ofFMDV A12 selected for variants with residue changes near theRGD motif, which suggested that the virus may have altered itsintegrin specificity (35). Other nonintegrin, non-HS receptors canalso mediate FMDV infection, as type O and type C viruses havebeen described that lack the RGD motif and that infect HS-defi-cient cells by using an as-yet-unidentified receptor (26, 27, 36).For type C viruses, the site on the capsid associated with this phe-

notype has not been identified, while for type O viruses VP1 resi-dues that lie close to the five-fold symmetry axis have been impli-cated.

We previously described an FMDV infectious copy plasmid(pO1K-A) that carries genes for capsid proteins VP1, VP2, andVP3 of the A/Turkey/2/2006 field strain combined with VP4 andthe nonstructural proteins of a cell culture-adapted type O virus,O1Kaufbeuren B64 (O1KB64) (37). Virus (O1KA-A/BTY1) re-covered from this plasmid caused normal signs of FMD in cattleand pigs (37, 38). Here, we studied cell culture adaption of O1K-A/BTY1 and identified a single amino acid substitution (glu-tamine [Q] to lysine [K]) at VP1-110 that allows for integrin- andHS-independent infection of CHO cells. The introduction of K atthis same site into recombinant viruses with capsids derived fromfield isolates of type O and Asia-1 FMDV also allowed infection ofCHO cells. The only proviso is that CHO cell infection appeared toalso require a second positively charged residue (K or R) at VP1-109. However, with primary bovine thyroid cells (pBTY), whichexpress �v�6, the presence of lysine at VP1-110 appeared to resultin enhanced interactions with �v�6 that allowed virus with KGEin place of the integrin-binding RGD to use �v�6 as a receptor.

MATERIALS AND METHODSCells. BHK cells were cultured in Dulbecco’s modified Eagle’s medium,and CHO and heparan sulfate-deficient CHO cells (pgsD-677 and pgsA-745) were cultured in Ham’s F-12, with each medium supplemented with10% fetal calf serum (FCS), 20 mM glutamine, penicillin (100 SI units/ml), and streptomycin (100 �g/ml). Primary bovine thyroid (pBTY) cellswere prepared and cultivated as described previously (39).

Peptides, antibodies, and reagents. The FMDV 17-mer peptide (VPNLRGDLQVLAQKVAR) and the control RGE version were synthesizedat the Pirbright Institute. The FMDV 12-mer peptide (VPNLRGDLQVLA) and the control RGE version were synthesized at the Oxford Centrefor Molecular Science, Oxford, United Kingdom. GRGDSP and GRGESPwere purchased from Anaspec. Monoclonal antibody (MAb) P1F6(mouse anti-�v�5) and MAb 23C6 (mouse anti-�v�3) were from Chemi-con. MAb 6.8G6 (mouse anti-�v�6) was a gift from Biogen (40). MAbPB1 (mouse anti-hamster �5�1) was from the Developmental StudiesHybridoma Bank (University of Iowa) and purified with protein A(Pierce) according to the manufacturer’s instructions. MAb 2C2, whichrecognizes the FMDV 3A protein, was a gift from Emiliana Brocchi (IZS,Brescia, Italy) (41).

Infectious copy plasmids and rescue of infectious copy-derived vi-ruses. Construction of infectious copy plasmids O1K-A and O1K-OUKhas been described in detail previously (37). These plasmids are based onthe infectious copy plasmid pT7S3, which carries a cDNA copy of thefull-length viral RNA for FMDV O1K/B64. In plasmids O1K-A and O1K-OUK, the coding regions for VP2 (1B), VP3 (1C), VP1 (1D), and 2A ofO1K/B64 have been replaced by the corresponding coding sequencesof FMDV A/Turkey/2/2006 and O/UKG/34/2001, respectively. A stock ofFMDV Asia-1 BAR/9/2009 was obtained from the FAO World ReferenceLaboratory for FMD at the Pirbright Institute, Pirbright, United King-dom, and passaged once through pBTY cells. After a second round ofinfection of pBTY cells, RNA was extracted using TRIzol (Invitrogen) asrecommended by the manufacturer. Single-stranded cDNA, PCR, andconstruction of infectious copy plasmid O1K-Asia were carried out essen-tially as described for O1K-A and O1K-OUK, and the appropriate oligo-nucleotide primers used are listed in Table 1.

Infectious copy plasmids based on O1K-A and O1K-OUK were lin-earized by digestion with HpaI, and full-length RNA transcripts weremade with T7 RNA polymerase using an Ambion Megascript kit as de-scribed by the manufacturer. Due to the presence of multiple HpaI sites,RNA was synthesized from plasmids based on O1K-Asia without the lin-

Berryman et al.

8736 jvi.asm.org Journal of Virology

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

earization step. The RNAs were checked by using agarose gel electropho-resis and then introduced into BHK cells by electroporation, essentially asdescribed previously (42). Electroporated BHK cells were incubated for 24h and were harvested following freezing. In each case, a subsequent pas-sage of the virus onto BHK or pBTY cells was performed, and the appear-ance of cytopathic effect (CPE) was monitored. Mutations were intro-duced into infectious copy plasmids by using a QuikChange Lightningsite-directed mutagenesis kit (Agilent Technologies, CA) as described bythe manufacturer and the appropriate primer pairs as listed in Table 1.

Virus passage. Cell monolayers (�90% confluent) in 25-cm2 flaskswere infected with FMDV. At 24 to 48 h postinfection (i.e., when extensiveCPE was seen), the cells were freeze-thawed, and the lysate was clarifiedand stored at �80°C. Each infection used 1 ml of the previous infection ina total volume of 5 ml of virus growth medium (normal cell culture me-dium with 1% FCS).

Plaque assay. Subconfluent cell monolayers were incubated with se-rial dilutions of FMDV samples for 15 min. The cells were then overlaidwith 4 ml of Eagle’s overlay (0.6% indubiose, 5% tryptone phosphatebroth, 1% FCS in Eagle’s medium). At 48 h postinfection, the cells werefixed and stained with 4% formaldehyde and methylene blue.

Quantification of infection. The assay to quantify infection has beendescribed in detail previously (17). Briefly, cells in 96-well tissue cultureplates were grown until approximately 90% confluent. The cells wereincubated for 1 h at 37°C with FMDV at a multiplicity of infection (MOI)of 0.3 PFU/cell. The monolayers were washed and incubated with serum-free medium at 37°C for a further 3 h. Infection was stopped, and the cellswere fixed with 4% paraformaldehyde. The cells were permeabilized with0.1% Triton and incubated with blocking buffer (10 mM Tris-HCl [pH7.5], 140 mM NaCl, 1 mM CaCl2, 0.5 mM MgCl2, 10% normal goatserum, 1% fish gelatin). Infected cells were identified by sequential incu-bation with MAb 2C2, a biotinylated goat anti-mouse IgG secondary an-tibody (Southern Biotechnologies) and streptavidin-conjugated alkalinephosphatase (Caltag Laboratories), each for 1 h at room temperature,followed by alkaline phosphatase substrate (Bio-Rad) for 10 min. The cells

were then washed with distilled water and allowed to air dry. Infected cellsstained dark blue and were counted using an enzyme-linked immunosor-bent spot assay plate reader (Zeiss). Nonspecific labeling was determinedby either omitting MAb 2C2 or performing the assay with mock-infectedcells. For competition experiments, peptides or antibodies were added tothe cells for 0.5 h (peptides) or 1 h (antibodies) prior to the addition ofvirus and remained present during the virus incubation step. Each exper-iment was carried out with triplicate samples for each condition.

vRNA extraction, PCR, and DNA sequencing. Viral RNA (vRNA)was extracted to obtain 0.5 ml of infected cell lysate by using TRIzol andresuspended in 20 �l RNase-free water as per the manufacturer’s instruc-tions (Invitrogen). Single-stranded DNA was synthesized from RNA tem-plates by using the Invitrogen first-strand cDNA synthesis kit and primerO2B as per the instructions provided. PCR was performed using Kodpolymerase (Novagen) and primers O1A and O2B. The cycling conditionswere the following: 95°C for 2 min; 30 cycles of 95°C for 20 s, 52.6°C for 15s, and 70°C for 1 min; a final incubation at 70°C for 1 min. PCR productswere analyzed on standard agarose gels, extracted using the Illustra GFXPCR DNA and gel band purification kit (GE Healthcare), and eluted in 30�l of water. PCR products were sequenced using the BigDye Terminatorv3.1 cycle sequencing kit (Applied Biosystems) and the Applied Biosys-tems 3730 DNA analyzer.

RESULTSLysine at VP1-110 permits heparan sulfate-independent FMDVinfection of CHO cells. Previously, we described a recombinantvirus (O1K-A/BTY1) recovered from an infectious copy plasmid(pO1K-A) by transfection of in vitro-transcribed vRNA into BHKcells and one passage through pBTY cells (37). As expected for avirus with a capsid derived from a field isolate, O1K-A/BTY1 wasinfectious for pBTY and BHK cells but was not infectious for CHOcells (Table 2), as they lack all of the known integrin receptors ofFMDV. Similarly, after one further passage through BHK cells,

TABLE 1 Primer sequences for cDNA synthesis, mutagenesis, PCR, or sequencing

Virus Name 5=–3= sequence Assaya

A-Turkey/2006 A-VP1-Q110K-m1 CCGCCTACCACAAGAAGCCATTTACGAG MA-VP1-Q110K-m2 CTCGTAAATGGCTTCTTGTGGTAGGCGG MA-VP1-K109Q-m1 CCGCCTACCACCAGAAGCCATTTACGAG MA-VP1-K109Q-m2 CTCGTAAATGGCTTCTGGTGGTAGGCG MA-VP1-K109A-m1 CCGCCTACCACGCAAAGCCATTTACGAG MA-VP1-K109A-m2 CTCGTAAATGGCTTTGCGTGGTAGGCG MA-KGEm1 TACAACTGGTAATGGCAGAAAAGGTGAACTGGGGCCTCTTGCGGCGCG MA-KGEm2 CGCGCCGCAAGAGGCCCCAGTTCACCTTTTCTGCCATTACCAGTTGTA MAVP3F GCCGGTTGCTTGTACAGAC SAVP3R GTCTGTACAAGCAACCGGC S

OUKG O-VP1-A110K-m1 ACCAATCCAACGGCTTACCACAAGAAACCGCTCACCCGGCTTGCACTGCCT MO-VP1-A110K-m2 AGGCAGTGCAAGCCGGGTGAGCGGTTTCTTGTGGTAAGCCGTTGGATTGGT MO-Seq1 GGTGAGTTCCCTTCTAAG SO-Seq2 GCGAGCGTCAACTGGCA S

Asia-1/Bar9/2009 Asia-cDNA GACTGGGTCCTTTGACCGTGCT cDNAAsia/Bar/NheI CGCTGCTAGCTGACAAGAAAACAGAAGAGACA PCRAsia/Bar/ApaI AGAAGAAGGGCCCAGGGTTGGAC PCRAsiaVP1-Q110K-m1 AACCCAACTGCCTACCAGAAGAAGCCCATCACCCGCCTGGCG MAsiaVP1-Q110K-m2 CGCCAGGCGGGTGATGGGCTTCTTCTGGTAGGCAGTTGGGTT MAsia-1seq1 CCAACTGACTCTTTTCC SAsia-1seq2 CAGAGACTACAAGTGTGCA S

All viruses O1A AACAACTACTACATGCAGC SO2B CTCCTGCATCTGGTTGATGG S

a Assay abbreviations: cDNA, cDNA synthesis; M, mutagenesis; S, sequencing.

Cell Culture Adaptation of FMDV by Design

August 2013 Volume 87 Number 15 jvi.asm.org 8737

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

this virus (O1K-A/BTY1/BHK1) was not able to infect CHO cells.After three further passes through BHK cells, the resulting virus(O1K-A/BTY1/BHK4) had gained the ability to infect CHO cells,although the titer was �100-fold lower than on BHK cells (Table2), indicating a lower efficiency of infection of CHO cells. Thesequence of the entire capsid encoding region of O1K-A/BTY1/BHK4 was determined and revealed only one residue differencefrom the parental virus. In A/Turkey 2/2006, O1K-A/BTY1, andO1K-A/BTY1/BHK1, glutamine (Q) occupies VP1-110, while inO1K-A/BTY1/BHK4, lysine (K) is found at this site. To confirmthat this substitution confers the ability to infect CHO cells, weengineered the Q-to-K change into VP1-110 (VP1-Q110K) ofpO1K-A. After one passage through BHK cells, the rescued virus(O1K-A/VP1-Q110K/BHK1) had an identical capsid sequence asO1K-A/BTY1/BHK4 and was able to infect pBTY, BHK, and CHOcells. After two more passes through BHK cells, the resulting virus(O1K-A/VP1-Q110K/BHK3) retained K at VP1-110 and the abilityto infect CHO cells (data not shown).

A net gain of positive charge on the capsid is associated with HSbinding (see above). Therefore, we investigated whether viruseswith K at VP1-110 also required HS receptors to initiate infectionin CHO cells that were deficient in expression of HS (CHO-677)or expression of both HS and chondroitin sulfate (CS) (CHO-745). Consistent with the inability to infect CHO cells, viruseswith Q at VP1-110 (O1K-A/BTY1 and O1K-A/BTY1/BHK1) didnot infect CHO-677 or CHO-745 cells, whereas viruses with K atthis position (O1K-A/BTY1/BHK4 and O1K-A/VP1-Q110K/BHK1) were able to infect both cell lines (Table 2). We verifiedthat CHO-677 and CHO-745 cells lacked HS by showing that theywere not susceptible to infection by FMDV O1BFS/1860 (data notshown), a virus shown previously to rely solely on HS as the re-ceptor for infection of CHO cells (16, 30). These observationsshowed that the acquisition of K at VP1-110 allows for HS-inde-pendent infection of CHO cells. We also tested the ability of O1K-A/BTY1/BHK4 to infect CHO-lec2 cells, which are deficient insialic acid. These cells were also susceptible to infection (titer onCHO-lec2 cells, 1.8 � 105) by a virus with K at VP1-110.

Lysine at VP1-110 permits integrin-independent FMDV in-fection of CHO cells. Heparan sulfate is used as a receptor by

certain cell culture strains of FMDV that lack the need for the viralRGD or cellular integrins (see above). Therefore, it is possible thatK at VP1-110 also creates an integrin-independent cell attachmentsite. Alternatively, K at VP1-110 could serve to enhance integrin-mediated infection. The ability to infect CHO cells suggests theformer, as these cells do not express any of the known integrinreceptors of FMDV. However, CHO cells express two other RGD-binding integrins (�v�5 and �5�1) that are not normally used byFMDV (30, 43–45), and it is possible that the acquisition of K atVP1-110 may enhance use of these integrins as receptors. To in-vestigate this possibility, we carried out competition experimentsusing RGD-containing peptides, a short GRGDSP peptide andtwo longer peptides (a 12-mer and 17-mer) that have sequencesderived from the FMDV integrin-binding loop (and their controlRGE counterparts), along with function-blocking antibodies to�5�1 (PB1) (46) and �v�5 (P1F6) (40). The peptides have beenshown to block binding to a number of RGD-dependent integrins,including �v�1, �v�3, �v�5, �v�6, �v�8, and �5�1 (10, 14, 15,47–50), and the antibodies are known to be cross-reactive forhamster integrins (45, 46). CHO cells were pretreated with thesereagents prior to incubation with virus (O1K-A/VP1-Q110K/BHK1) for 1 h at 37°C. The cells were washed to remove extracel-lular virus, and infection continued for a further 3 h. The cellswere fixed and permeabilized, and infected cells were identifiedand quantified as described in Materials and Methods. Figure 1shows that the peptides (Fig. 1A) (compared to the correspondingcontrol RGE peptides) and anti-integrin antibodies (Fig. 1B) didnot inhibit infection of CHO cells, thereby showing that viruseswith K at VP1-110 do not use �5�1 or �v�5 as a receptor.

To confirm that infection of CHO cells by viruses with K atVP1-110 does not require integrins, we attempted to generate amutant virus with K at VP1-110 and KGE in place of RGD. TheKGE sequence is commonly used as a negative control for RGD-dependent interactions, and recombinant FMDV with capsids de-rived from field isolates are rendered noninfectious by the KGE-for-RGD substitution (26, 27, 43, 44, 51). The KGE virus waspassaged twice through BHK cells (O1K-A/VP1-Q110K/KGE/BHK2) without visible signs of CPE. However, subsequent pas-sage on BHK cells resulted in extensive CPE. The capsid-coding

TABLE 2 Titers of infectious copy-derived viruses (A/Turkey/2/2006 capsid) with K/Q, K/K, or R/K at VP1 109/110

Infectious copy plasmid and virusVP1109/110a

Titer of virus in cell typeb

pBTY BHK CHO CHO-677 CHO-745

pO1K-A K/QO1K-A/BTY1 K/Q 3.5 � 106 2.5 � 105 0 0 0O1K-A/BTY1/BHK1 K/Q 2.5 �107 4 � 106 0 0 0O1K-A/BTY1/BHK4 K/K ND 1.9 � 107 1.7 � 105 2.0 � 105 2.0 � 105

pO1K-A/VP1-Q110K K/KO1K-A/VP1-Q110K/BHK1 K/K 3.0 � 106 1.0 � 107 2.0 � 105 2.0 � 104 2.0 � 104

pO1K-A/VP1-109AK110 A/KO1K-A/VP1-109AK110/BHK2 A/K ND 1.5 � 105 0 ND NDO1K-A/VP1-109AK110/BHK6 A/K ND CPE 0 ND ND

pO1K-A/VP1-109QK110 Q/KO1K-A/VP1-109QK110/BHK3 Q/K ND 2.5 � 106 0 ND NDO1K-A/VP1-109QK110/BHK6 R/K ND 4.0 � 107 1.0 � 104 1.0 � 103 ND

a Residues at VP1 109 and 110.b 0, no CPE; ND, not done; CPE, cytopathic effect seen but virus titer not determined.

Berryman et al.

8738 jvi.asm.org Journal of Virology

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

sequences of the BHK3 and BHK4 viruses (O1K-A/VP1-Q110K/KGE/BHK3 and O1K-A/VP1-Q110K/KGE/BHK4) were deter-mined. Both viruses showed only a single residue change com-pared to the input virus, one that resulted in an E-to-D change to

create KGD at the RGD site. Therefore, to obtain a virus with KGE,we passaged the O1K-A/VP1-Q110K/KGE/BHK2 stock (which didnot show signs of CPE on BHK cells; see above) through CHOcells. The first passage (O1K-A/VP1-Q110K/KGE/BHK2/CHO1)resulted in partial CPE at 48 h postinfection, while the next pas-sage (O1K-A/VP1-Q110K/KGE/BHK2/CHO2) resulted in com-plete CPE at 24 h. The capsid-coding sequence of this virus (O1K-A/VP1-Q110K/KGE/BHK2/CHO2) was determined, and wefound that both the KGE motif and the K at VP1-110 had beenretained and that no other residue changes were introduced dur-ing cell culture passage. The KGE virus infected pBTY, BHK,CHO, and HS-deficient CHO-677 cells (Table 3). Furthermore,infection of CHO cells was not inhibited by the GRGDSP peptideor the FMDV 17-mer peptides (data not shown). Together, theabove results confirm that the introduction of K at VP1-110 cre-ates a virus that does not require HS, the VP1 RGD motif, or �v�5or �5�1 integrins for infection of CHO cells.

A positively charged residue at VP1-109 is also required forinfection of CHO cells. Figure 2 shows the positions of the resi-dues at VP1-110. There is no structural information for theA/Turkey/2/2006 virus; therefore, the figure shows the location of

FIG 1 (A) CHO cells in 96-well plates were mock treated or treated withpeptides for 0.5 h and then infected with FMDV O1K-A/VP1-Q110K/BHK1 for1 h at an MOI of 0.3 in the absence or presence of peptide (17-mer, 12-mer,GRGDSP [6-mer], or counterpart RGE control peptides). (B) CHO cells in96-well plates were mock treated or treated with antibodies (20 �g/ml) for 1 hand then infected with FMDV O1K-A/VP1-110K/BHK3 for 1 h at an MOI of0.3 in the absence or presence of antibody (PIF6, �v�5; PB1, �5�1). At the endof each experiment (panels A and B), the monolayers were washed and infec-tion was continued for a further 3 h. Infection was stopped, the cells were fixedand permeabilized, and infected cells were identified as described in Materialsand Methods. The results were normalized to the mock-treated controls.Shown are the means � standard deviations for triplicate wells. Each panelshows one experiment representative of two conducted, each giving similarresults. Statistical significance was analyzed using an unpaired one-tailed t testwith a P value less that 0.05 taken to be significant. NS, not significant.

TABLE 3 Titers of infectious copy-derived viruses (A/Turkey/2/2006 capsid) with KK or KQ at VP1 109/110 and either KGD or KGE

Infectious copy plasmid and virusVP1109/110a RGDb

Titer of virus in cell typec

pBTY BHK CHO CHO-677

pO1K-A/VP1-Q110K/KGE K/K KGEO1K-A/VP1-Q110K/KGE/BHK2/CHO2 K/K KGE CPE 1.5 � 106 3.0 � 104 2.0 � 104

O1K-A/VP1-Q110K/KGD K/K KGD CPE 3.0 � 106 9.0 � 103 5.0 � 103

pO1K-A/KGE K/Q KGEO1K-A/KGD K/Q KGD CPE 8.5 � 107 0 0

a Residues at VP1 109 and 110.b Residues at the RGD motif site.c 0, no CPE; CPE, cytopathic effect seen but virus titer not determined.

FIG 2 (A) The crystallographic structure of a pentamer of FMDV A1061. Theresidues at VP1-109 and VP1-110 are highlighted in blue and red, respectively.Note that in A1061 the residues at VP1-109 and VP1-110 are K and A, respec-tively. Also shown is a closer view of the pore at the five-fold symmetry axis,looking down at the outer surface of the pentamer (B) and from a side-on view(C). The residues at these sites are solvent exposed and line the depressionsurrounding the pore.

Cell Culture Adaptation of FMDV by Design

August 2013 Volume 87 Number 15 jvi.asm.org 8739

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

VP1-110 modeled onto the structure of a related type A FMDV,A1061 (28). This shows that VP1-110 is surface exposed and lies ina depression at the five-fold symmetry axis (Fig. 2). Interestingly,in A/Turkey/2/2006 the adjacent residue at VP1-109 is also ex-posed and occupied by K. Thus, the acquisition of K at VP1-110creates a dense cluster of 10 positively charged residues that sur-round the pore at the five-fold symmetry axis. To determine ifinfection of CHO cells arises as a consequence of the VP1-Q110K

substitution alone, or if the K at VP1-109 also contributes to thisphenotype, we generated two further infectious copy plasmidswith either A or Q at VP1-109 followed by K at VP1-110 (pO1K-A/VP1-109AK110 and pO1K-A/VP1-109QK110, respectively). Vi-ruses rescued from these plasmids caused extensive CPE in BHKcells by the second or third passage, respectively (O1K-A/VP1-109AK110/BHK2 and O1K-A/VP1-109QK110/BHK3). The sequenceof the capsid-coding region was determined and showed that theVP1 109AK110 or 109QK110 sequences were faithfully retained andthat no further residue changes were introduced during cell cul-ture passage. Although these viruses were able to infect BHK cells,they were not infectious for CHO cells (Table 2). These observa-tions suggest that a K is also required at VP1-109 for CHO cellinfection. To support this conclusion, the above viruses were fur-ther passed through BHK cells to create BHK6 stocks. The viruswith 109AK110 was still noninfectious for CHO cells and retainedthe 109AK110 motif, while the virus with 109QK110 had gained theability to infect CHO cells (Table 2) and showed a single residuechange of Q to R at VP1-109, thereby creating an RK motif at VP1109 and 110. Thus, it appears that R or K at VP1-109 in combina-tion with K at VP1-110 is required for infection of CHO cells. Intype O FMDV, a histidine-to-R switch at VP3-56 essentially cre-ates an HS-binding site. Therefore, it is possible that the acquisi-tion of R at VP1-109 may also create such a site. However, weeliminated this possibility by showing that the virus with 109RK110

could infect CHO-677 cells, thereby showing that infection ofCHO cells was independent of HS (Table 2).

Lysine substitution at VP1-110 permits CHO cell infectionby Asia-1 and type O FMDV. The above results showed that whenoccupied by positively charged residues, VP1 109 and 110 create adense patch of positive charge at the five-fold symmetry axis thatappears to allow infection of CHO cells by a type A FMDV. There-fore, we investigated if the introduction of K at the same sites alsoconferred the ability to infect CHO cells upon infection with typeO or Asia-1 FMDV. For this, we used infectious copy plasmidspO1K-OUK (37) and pO1K-Asia (see Materials and Methods),which encode the capsid-coding region (VP1, VP2, and VP3) ofeither the type O 2001 United Kingdom outbreak strain (O/UKG/34/2001) or an Asia-1 field isolate (Asia-1/BAR/9/2009), respec-tively, in the genetic background of O1K/B64. Similar to A/Tur-key/2/2006, both parental viruses O/UKG34 and Asia-1/BAR/9/2009 and the viruses derived from the corresponding infectiouscopy plasmids pO1K-OUK and pO1K-Asia have K at VP1-109;thus, a K substitution at VP1-110 would create a 109KK110 motif.Lysine substitutions were introduced at VP1-110 in pO1K-OUKand pO1K-Asia, generating pO1K-Asia/VP1-Q110K and pO1K-OUK/VP1-A110K, respectively. Viruses were rescued from the pa-rental plasmids (pO1K-Asia and pO1K-OUK) and from pO1K-Asia/VP1-Q110K and pO1K-OUK/VP1-A110K. The Asia-1 viruseswere propagated through BHK cells. As cell culture growth of typeO FMDV can select viruses that bind HS, the type O viruses wereinitially passaged through pBTY cells (because they express �v�6)

and then BHK cells. The sequence of the capsid-coding region ofthe resulting viruses (O1K-Asia/BHK1, O1K-Asia/VP1-Q110K/BHK1, O1K-OUK/BTY2/BHK3, and O1K-OUK/VP1-A110K/BTY2/BHK2) were determined and showed that for all viruses theamino acid sequence encoded by the input vRNA was faithfullyretained. The viruses with wild-type (wt) capsids (O1K-Asia/BHK1 and O1K-OUK/BTY2/BHK3) were not infectious for CHOcells, whereas the viruses with K at VP1-110 (O1K-Asia/VP1-Q110K/BHK1 and O1K-OUK/VP1-A110K/BTY2/BHK2) hadgained the ability to infect CHO cells (Table 4). Thus, it appearsthat in addition to type A FMDV, the ability to infect CHO cells istransferable to type O and Asia-1 FMDV by the creation of a KKmotif at VP1 109 and 110.

Influence of the VP1-Q110K substitution on use of integrin�v�6. The KGD virus recovered from O1K-A/VP1-Q110K/KGE/BHK3 was named O1K-A/VP1-Q110K/KGD, and as expected itwas infectious for BHK, CHO, and CHO-677 cells (Table 3). Wealso attempted to recover a virus with the RGD-to-KGE change byusing pO1K-A (which has the wt Q at VP1-110) on BHK cells. Thefirst and second passages did not show signs of CPE, whereas thethird and fourth passages resulted in extensive CPE within 24 h.The capsid-coding sequences of the BHK3 and BHK4 viruses weredetermined. Similar to the virus with K at VP1-110 (see above),the BHK3 virus showed only a single residue difference, whichresulted in a partial reversion at the RGD site to create a KGDmotif. This virus was named O1K-A/KGD, and as expected for avirus with Q at VP1-110, it was not infectious for CHO or HS-deficient CHO-677 cells (Table 3). The virus recovered at thefourth passage through BHK cells showed a further residue change(K to R) that restored the RGD domain. As described above, werecovered virus with KGE in place of the RGD when K was presentat VP1-110 when we used CHO cells. Presumably, this was madepossible by the lack of selective pressure to restore the RGD due tothe absence of appropriate integrin receptors on CHO cells.Therefore, we also attempted to recover virus with KGE and Q atVP1-110 by using O1K-A/KGE/BHK2 (which did not show signsof CPE on BHK cells) and CHO cells. However, after four passeswe did not see CPE. This was repeated with the same outcome, andinfectious virus was not recovered. These observations are consis-tent with previous reports that replacement of the RGD by KGE

TABLE 4 Titers of infectious copy-derived viruses (Asia-1 BAR/9/2009and O/UKG/34/2001 capsids) with K/Q, K/A, or K/K, at VP1 109/110

Infectious copy plasmid and virusVP1109/110a

Titer of virus in celltypeb

BHK CHO

pO1K-Asia K/QO1K-Asia/BHK-1 K/Q 2.5 � 107 0

pO1K-Asia/VP1-Q110K K/KO1K-Asia/VP1-Q110K/BHK-1 K/K 1.5 � 107 1 � 104

pO1K-OUK K/AO1K-OUK/BTY2/BHK3 K/A 4 � 106 0

pO1K-OUK/VP1-A110K K/KO1K-OUK/VP1-A110K/BTY2/BHK2 K/K 2 � 106 7.5 � 104

a Residues at VP1 109 and 110.b 0, no CPE.

Berryman et al.

8740 jvi.asm.org Journal of Virology

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

renders viruses with capsids of FMDV field isolates noninfectious(26, 27, 43, 44, 51). Together, the above observations show that wecould recover infectious virus with KGD at the RGD site wheneither Q or K were present at VP1-110, but we could only recovera KGE virus if VP1-110 was occupied by K.

Next, we investigated the receptors that mediate infection bythe KGD and KGE viruses. The observation that the viruses withKGD or KGE infect BHK cells to a higher titer than CHO orCHO-677 cells suggests they may retain the ability to use integrinsas receptors despite not having a complete canonical RGD integ-rin-binding motif. To determine if this is the case, we could notuse BHK cells, as cross-reactive antibodies for hamster integrinsare limited and the integrins expressed on BHK cells have not beenestablished. Instead we used pBTY cells, as FMDV is known to use�v�6 as the major receptor to initiate infection (16). Primary BTYcells were incubated with RGD-containing peptides and then in-fected with FMDV (with RGD, KGD, or KGE) in the continuedpresence of the peptide for 1 h. The cells were washed to removepeptide and extracellular virus, and after a further 3 h, infectionwas quantified as described in Materials and Methods. Consistentwith our previous observations (16), Fig. 3A shows that the FMDV17-mer peptide inhibited infection by the virus with the wt capsid(O1K-A/BTY1/BHK1, which has an RGD and Q at VP1-110). Thevirus with an RGD motif and K at VP1-110 (O1K-A/VP1-Q110K/BHK1) was also inhibited by the peptide. However, infection bythe VP1-Q110K-substituted virus was inhibited less efficientlythan virus with the wt capsid. In addition, Fig. 3A shows thatinfection by the viruses with KGD in place of the RGD (with eitherQ or K at VP1-110) was inhibited by the peptide, suggesting thatthese viruses also use an RGD-dependent integrin as a receptor.We also found that the peptide was a very efficient inhibitor ofinfection by the virus with KGE (O1K-A/VP1-Q110K/KGE/BHK2/CHO2). At peptide concentrations of 0.25 �M, infection by theKGE virus was completely inhibited.

The above observations showed an apparent reduced sensitiv-ity to peptide competition by the virus with an RGD motif and theVP1-Q110K substitution. This finding could result from the abilityof the virus to use alternative receptors due to the presence of theK at VP1-110. Alternatively, this resistance could be explained ifthe K at VP1-110 had a positive influence on FMDV-integrin in-teractions. If the former were the case, the KGE, which also has theVP1-Q110K substitution, would be expected to be similarly resis-tant to the peptide. However, under the conditions tested, infec-tion by these viruses was completely inhibited, suggesting that theresistance to peptide competition results from a more efficient useof integrin receptors. Together, these results indicate that the pri-mary receptor used by the VP1-Q110K-substituted virus (O1K-A/VP1-Q110K/BHK1) to infect pBTY cells is most likely an integrinand that the VP1-Q110K substitution has a positive influence onintegrin use.

We showed previously that �v�6 is the primary integrin recep-tor used by FMDV to infect pBTY cells (16). Therefore, the above

FIG 3 (A) pBTY cells in 96-well plates were mock treated or treated with theFMDV 17-mer peptide (or RGE control) for 0.5 h and then infected withFMDV (O1K-A/BTY1/BHK1, O1K-A/KGD, O1K-A/VP1-Q110K/BHK1,O1K-A/VP1-Q110K/KGD, or O1K-A/VP1-Q110K/KGE/BHK2/CHO2) for 1 hat an MOI of 0.3 in the absence or presence of peptide. (B) pBTY cells in96-well plates were mock treated or treated with antibodies at the indicatedconcentrations for 1 h and then infected with O1K-A/BTY1/BHK1, O1K-A/KGD, O1K-A/VP1-Q110K/BHK1, or O1K-A/VP1-Q110K/KGD for 1 h at anMOI of 0.3 in the absence or presence of antibody (6.8G6, �v�6; 23C6, �v�3).(C) pBTY cells in 96-well plates were mock treated or treated with MAb 6.8G6for 1 h and then infected with O1K-A/BTY1/BHK1 or O1K-A/VP1-Q110K/KGE/BHK2/CHO2 for 1 h at an MOI of 0.3 in the absence or presence ofantibody. At the end of each experiment, the monolayers were washed andinfection was continued for a further 3 h. Infection was stopped, the cells fixed

and permeabilized, and infected cells were identified as described in Materialsand Methods. The results were normalized to the results with the mock-treatedcontrols. Shown are the means � standard deviations for triplicate wells. Eachpanel shows one experiment representative of two conducted, each givingsimilar results. Statistical significance was analyzed using an unpaired one-tailed t test with a P value less than 0.05 taken to be significant. *, P 0.05; **,P 0.01; ***, P 0.001; ****, P 0.0001.

Cell Culture Adaptation of FMDV by Design

August 2013 Volume 87 Number 15 jvi.asm.org 8741

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

observations suggest that viruses with KGD or KGE may also use�v�6 as a receptor to initiate infection. To investigate this, wecarried out further competition experiments using function-blocking antibodies (in place of the peptides) that were cross-reactive for bovine integrins �v�6 and �v�3 (Fig. 3B). Similar tothe peptide study above, viruses with an intact RGD and either Qor K at VP1-110 were included in these studies. An antibody to�v�6, but not one to �v�3, inhibited infection of pBTY cells bythe viruses with an intact RGD. As seen with the peptide, infectionby the VP1-Q110K-substituted virus (O1K-A/VP1-Q110K/BHK1)was inhibited less efficiently by the �v�6 antibody than infectionby the virus with Q at this site (O1K-A/BTY1/BHK1). This obser-vation supports our conclusion that K at VP1-110 appears to en-hance the ability of FMDV to use �v�6 as a receptor. The antibodyagainst �v�6, but not that against �v�3, also inhibited infectionby viruses with KGD or KGE, which confirmed that they use �v�6as the receptor. Infection by the virus with KGE was inhibitedefficiently (95%) by the antibody to �v�6 when used at 20�g/ml (data not shown). To confirm this observation, Fig. 3Cshows the results of a further competition experiment in which weused a range of concentrations of the �v�6 antibody. These resultsshowed that infection by the KGE virus was inhibited by the anti-�v�6 antibody, but not by the anti-�v�3 antibody. Thus, when Kis present at VP1-110, FMDV with KGE appears to retain theability to use �v�6 as its receptor on pBTY cells, albeit with anapparent reduced affinity.

DISCUSSION

Adaptation to cell culture is an essential first step in the develop-ment of new vaccines, and for FMDV this often involves selectionof variants with altered receptor specificity that are no longer de-pendent upon integrins for infection. This is reflected by a strongpredisposition toward selection of variants that bind HS and in-fect CHO cells. However, cell culture-adapted viruses have alsobeen reported that use receptors that are neither integrin nor HS(26, 27, 36). Here, we have shown that a single amino acid substi-tution at VP1-110 (VP1-Q110K) allows for HS-independent infec-tion of CHO cells. This was initially shown when we used a recom-binant virus with the capsid of the A/Turkey/2/2006 field isolate,and it was subsequently confirmed when we used viruses withcapsids derived from field isolates of type O and Asia-1 FMDV.CHO cells express two RGD-binding integrins (�5�1 and �v�5)that are not normally used by FMDV as receptors. Here we haveshown that viruses with the VP1-Q110K substitution do not ac-quire the ability to use these integrins as receptors, thereby con-firming that infection of CHO cells does not require integrins.However, despite showing that infection of CHO cells by the VP1-Q110K-substituted virus was integrin independent, the primaryreceptor on pBTY cells was shown to be the integrin �v�6, as at alow MOI, the infection by the VP1-Q110K-substituted virus wasinhibited to near completion by an RGD peptide (Fig. 3). TheVP1-Q110K substitution also appeared to allow for enhanced in-teractions with integrin �v�6, which allowed a virus with KGE inplace of the normal RGD integrin-binding motif to use this integ-rin as a receptor.

The A/turkey/2/2006 virus naturally has K at VP1-109. Conse-quently, the introduction of K at the adjacent residue creates adense patch of positive charge that surrounds the five-fold sym-metry axis. Interestingly, the ability to infect CHO cells was lost ifthe K at VP1-109 was replaced by A, despite retaining the K at

VP1-110, showing that both of the K residues at VP1 109 and 110are required for infection of CHO cells. However, when the K atVP1-109 was replaced by Q (creating 109Q/K110), virus infectiousfor CHO cells was recovered, but this virus had acquired an R inplace of the Q at VP1-109, thereby creating a 109R/K110 motif.Thus, the ability to infect CHO cells appears to require positivelycharged residues at both VP1 109 and 110 and is tolerant to eitherR or K at VP1-109. The attachment receptor on CHO cells for theVP1-Q110K-substituted virus is not known. However, the cluster-ing of positive residues at the five-fold symmetry axis could me-diate cell attachment through interactions with negatively chargedmolecules at the cell surface. The major negatively charged moi-eties at the cell surface are sialic acid and glycosaminoglycans(GAGs) such as HS and CS. However, our results suggest thatnone of these molecules serves as a virus attachment receptor, asthe VP1-Q110K-substituted virus was infectious for CHO-677cells, which lack HS, CHO-745 cells, which lack HS and CS, andCHO-lec2 cells, which lack sialic acid. However, given the inher-ent tolerance to either K or R at VP1-109, it is possible that thereceptor interaction mediated by the residues at VP1 109 and 110lacks specificity and that more than one type of negatively chargedmolecule could be used; thus, a lack of only one type of moleculemay not be sufficient to prevent infection.

As stated above, the VP1-Q110K substitution appeared to en-hance virus interactions with �v�6. The main evidence to supportthis conclusion came from the observations that �v�6 antagonists(RGD peptide and anti-�v�6 antibody) were less effective inhib-itors of infection by the VP1-Q110K-substituted virus than viruswith the wt capsid (i.e., with Q at VP1-110) and from the obser-vations that a virus with KGE at the RGD site could use �v�6 as areceptor if K was present at VP1-110. The VP1-Q110K substitutioncould lead to enhanced interactions with �v�6 if the presence of Kaltered the conformation of the VP1 GH loop (the integrin-bind-ing loop) to one more favorable for integrin binding. However, wethink this unlikely, as viruses with the VP1-Q110K substitution didnot gain the ability to use �v�5 or �5�1 as receptors on CHO cells.Alternatively, cell attachment of the VP1-Q110K-substituted viruscould serve to effectively concentrate virus at the cell surface, mak-ing recruitment and subsequent virus endocytosis by �v�6 morelikely. This could explain why �v�6 is the predominant receptoron pBTY cells and the relatively low infectivity of VP1-Q110K-substituted viruses for CHO cells (Table 2), because in the absenceof �v�6, viruses held at the cell surface may be internalized inef-ficiently.

Our results show that viruses with KGD in place of the RGDcan use �v�6 as a receptor. It is highly likely that this results frombinding of the KGD motif at the normal RGD-binding site onintegrin. This conclusion is supported by the observations thatinfection of pBTY cells with the KGD viruses was inhibited byantagonists that specifically target the RGD-binding site on theintegrin, i.e., an RGD-containing peptide and a function-blockingantibody that acts as a ligand mimetic due to an RGD motif incomplementarity determining region H3 (40). The conclusionthat the KGD viruses interact with �v�6 at the RGD-binding siteis further supported by reports that ligands containing a DLXXLmotif can bind �v�6 in the absence of a full RGD (24). The integ-rin-binding loop of FMDV A/Turkey/2/2006 includes the se-quence RGDLGPL, and therefore the KGD viruses could use �v�6due to the presence of the DLGPL sequence. Other viable FMDVshave been described with mutations in the RGD (28, 52, 53), and

Berryman et al.

8742 jvi.asm.org Journal of Virology

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

some of these retain the D of the RGD motif and the conservedresidues normally found after the RGD (see the introduction). Formost of these viruses, integrin binding has not been investigated;however, a type A virus described by Rieder et al. (52) with SGDwas shown to preferentially infect cells transfected to express�v�6, implying that this integrin may be used as a receptor. TheSGD virus used in these studies had an M (and not L) immediatelyafter the RGD, which suggests that the DMXXL motif may alsobind �v�6. This conclusion is in agreement with our studies,which have shown that peptides with L, M, or R immediately afterthe RGD are equally effective as �v�6 antagonists (16).

Our results also showed that a virus with KGE in place of theRGD can use �v�6 as a receptor. This was somewhat unexpected,as previous observations showed that FMDV is rendered nonin-fectious by the switch from RGD to KGE (26, 27, 43, 44, 51).However, these observations were made using viruses with capsidsderived from field isolates, which rely solely on integrins for infec-tion. Indeed, our inability to recover infectious virus with KGE inthe context of the wt capsid (i.e., when VP1 110 is Q) is consistentwith these observations. Thus, it appears that the presence of K atVP1-110 facilitates both recovery of the KGE virus using CHOcells and the ability to use �v�6 to initiate infection of pBTY cells.Previously, we proposed a two-step model for FMDV binding to�v�6, in which the initial interaction by the RGD was rapidlystabilized by a second synergistic interaction (16, 18). This syner-gistic interaction is dependent upon the residues at the RGD �1and RGD �4 sites and the integrity of the helical structure imme-diately after the RGD that orientates the RGD �1 and RGD �4residues into positions available for integrin recognition (16, 18,25). Based upon the arguments presented above for the KGD vi-ruses, we believe that KGE viruses are also likely to bind at thenormal RGD attachment site on �v�6, as infection was also inhib-ited by the RGD-containing peptide and anti-�v�6 antibody;however, the binding affinity for �v�6 would be expected to belowered, as infection by the KGE virus was shown to be exquisitelysensitive to competition by these reagents. A type O FMDV withKGE in place of the RGD has been described previously (36). Thisvirus also had mutations in VP1 that included the acquisition ofaromatic amino acids at positions 108 and 174 and positivelycharged residues at positions 83 and 172 that mapped close to thefive-fold symmetry axis; however, this virus was shown not to useintegrin receptors, as infection was resistant to an RGD-contain-ing peptide. More recent studies using SAT serotype FMDVs havedescribed viruses that acquired positively charged residues at VP1110 and 112 during cell culture adaptation (31, 32). However, incontrast to our results, these changes were reported to create anHS-binding site. Similar observations have also been reported forcoxsackievirus A9 and some other members of the human entero-virus B species, as the presence of positively charged residues atVP1-132 has been shown to create an HS-binding site at the five-fold symmetry axis that allows for an expanded tropism for cul-tured cells (54).

In conclusion, we have identified a single amino acid change(VP1-110, glutamine to lysine) at the five-fold symmetry axis ofthe FMDV capsid that allows for integrin- and HS-independentinfection of CHO cells. The same change resulted in enhancedinteractions with �v�6 in cells expressing this integrin, which al-lowed a virus with KGE in place of the integrin-binding RGD touse �v�6 as a receptor. The introduction of positively chargedresidues at VP1 109 and 110 may allow for cell culture adaptation

of FMDV by design, which may prove useful for vaccine manu-facture when cell culture adaptation proves intractable.

ACKNOWLEDGMENTS

This work was supported financially by the Department for the Environ-ment, Food and Rural Affairs (Defra; project number SE 2720). N.J.K. ispartially supported by the BBSRC funded Livestock Viral Diseases pro-gram. N.J.K. and J.W. are partially funded by Defra SE2939.

We thank Emiliana Brocchi for MAb 2C2 and Shelia M. Violette (Bio-gen Idec) for MAb 6.8G6.

REFERENCES1. Paton DJ, Sumption KJ, Charleston B. 2009. Options for control of

foot-and-mouth disease: knowledge, capability and policy. Philos. Trans.R. Soc. Lond. B Biol. Sci. 364:2657–2667.

2. Carrillo C, Tulman ER, Delhon G, Lu Z, Carreno A, Vagnozzi A, KutishGF, Rock DL. 2006. High throughput sequencing and comparativegenomics of foot-and-mouth disease virus. Dev. Biol. 126:23–30.

3. Domingo E, Escarmis C, Baranowski E, Ruiz-Jarabo CM, Carrillo E,Nunez JI, Sobrino F. 2003. Evolution of foot-and-mouth disease virus.Virus Res. 91:47– 63.

4. Brehm KE, Kumar N, Thulke HH, Haas B. 2008. High potency vaccinesinduce protection against heterologous challenge with foot-and-mouthdisease virus. Vaccine 26:1681–1687.

5. Jackson T, King AM, Stuart DI, Fry E. 2003. Structure and receptorbinding. Virus Res. 91:33– 46.

6. Goodwin S, Tuthill TJ, Arias A, Killington RA, Rowlands DJ. 2009.Foot-and-mouth disease virus assembly: processing of recombinant cap-sid precursor by exogenous protease induces self-assembly of pentamersin vitro in a myristoylation-dependent manner. J. Virol. 83:11275–11282.

7. Knipe T, Rieder E, Baxt B, Ward G, Mason PW. 1997. Characterizationof synthetic foot-and-mouth disease virus provirions separates acid-mediated disassembly from infectivity. J. Virol. 71:2851–2856.

8. Arzt J, Juleff N, Zhang Z, Rodriguez LL. 2011. The pathogenesis offoot-and-mouth disease I: viral pathways in cattle. Transbound. Emerg.Dis. 58:291–304.

9. Arzt J, Pacheco JM, Rodriguez LL. 2010. The early pathogenesis offoot-and-mouth disease in cattle after aerosol inoculation. Identificationof the nasopharynx as the primary site of infection. Vet. Pathol. 47:1048 –1063.

10. Jackson T, Sheppard D, Denyer M, Blakemore W, King AM. 2000. Theepithelial integrin �v�6 is a receptor for foot-and-mouth disease virus. J.Virol. 74:4949 – 4956.

11. Monaghan P, Gold S, Simpson J, Zhang Z, Weinreb PH, Violette SM,Alexandersen S, Jackson T. 2005. The �v�6 integrin receptor for foot-and-mouth disease virus is expressed constitutively on the epithelial cellstargeted in cattle. J. Gen. Virol. 86:2769 –2780.

12. O’Donnell V, Pacheco JM, Gregg D, Baxt B. 2009. Analysis of foot-and-mouth disease virus integrin receptor expression in tissues from naive andinfected cattle. J. Comp. Pathol. 141:98 –112.

13. Berinstein A, Roivainen M, Hovi T, Mason PW, Baxt B. 1995. Anti-bodies to the vitronectin receptor (integrin alpha v beta 3) inhibit bindingand infection of foot-and-mouth disease virus to cultured cells. J. Virol.69:2664 –2666.

14. Jackson T, Clark S, Berryman S, Burman A, Cambier S, Mu D,Nishimura S, King AM. 2004. Integrin �v�8 functions as a receptor forfoot-and-mouth disease virus: role of the beta-chain cytodomain in integ-rin-mediated infection. J. Virol. 78:4533– 4540.

15. Jackson T, Mould AP, Sheppard D, King AM. 2002. Integrin alphav-beta1 is a receptor for foot-and-mouth disease virus. J. Virol. 76:935–941.

16. Burman A, Clark S, Abrescia NG, Fry EE, Stuart DI, Jackson T. 2006.Specificity of the VP1 GH loop of foot-and-mouth disease virus for �vintegrins. J. Virol. 80:9798 –9810.

17. Berryman S, Clark S, Monaghan P, Jackson T. 2005. Early events inintegrin �v�6-mediated cell entry of foot-and-mouth disease virus. J. Vi-rol. 79:8519 – 8534.

18. Dicara D, Burman A, Clark S, Berryman S, Howard MJ, Hart IR,Marshall JF, Jackson T. 2008. Foot-and-mouth disease virus forms ahighly stable, EDTA-resistant complex with its principal receptor, integrin�v�6: implications for infectiousness. J. Virol. 82:1537–1546.

19. Parry N, Fox G, Rowlands D, Brown F, Fry E, Acharya R, Logan D,

Cell Culture Adaptation of FMDV by Design

August 2013 Volume 87 Number 15 jvi.asm.org 8743

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from

Stuart D. 1990. Structural and serological evidence for a novel mechanismof antigenic variation in foot-and-mouth disease virus. Nature 347:569 –572.

20. Rowlands D, Logan D, Abu-Ghazaleh R, Blakemore W, Curry S, Jack-son T, King A, Lea S, Lewis R, Newman J, et al. 1994. The structure ofan immunodominant loop on foot and mouth disease virus, serotype O1,determined under reducing conditions. Arch. Virol. Suppl. 9:51–58.

21. Verdaguer N, Mateu MG, Andreu D, Giralt E, Domingo E, Fita I. 1995.Structure of the major antigenic loop of foot-and-mouth disease viruscomplexed with a neutralizing antibody: direct involvement of the Arg-Gly-Asp motif in the interaction. EMBO J. 14:1690 –1696.

22. Verdaguer N, Schoehn G, Ochoa WF, Fita I, Brookes S, King A,Domingo E, Mateu MG, Stuart D, Hewat EA. 1999. Flexibility of themajor antigenic loop of foot-and-mouth disease virus bound to a Fabfragment of a neutralising antibody: structure and neutralisation. Virol-ogy 255:260 –268.

23. Gagnon MK, Hausner SH, Marik J, Abbey CK, Marshall JF, Sutcliffe JL.2009. High-throughput in vivo screening of targeted molecular imagingagents. Proc. Natl. Acad. Sci. U. S. A. 106:17904 –17909.

24. Kraft S, Diefenbach B, Mehta R, Jonczyk A, Luckenbach GA, GoodmanSL. 1999. Definition of an unexpected ligand recognition motif for �v�6integrin. J. Biol. Chem. 274:1979 –1985.

25. DiCara D, Rapisarda C, Sutcliffe JL, Violette SM, Weinreb PH, Hart IR,Howard MJ, Marshall JF. 2007. Structure-function analysis of Arg-Gly-Asp helix motifs in alpha v beta 6 integrin ligands. J. Biol. Chem. 282:9657–9665.

26. Baranowski E, Ruiz-Jarabo CM, Sevilla N, Andreu D, Beck E, DomingoE. 2000. Cell recognition by foot-and-mouth disease virus that lacks theRGD integrin-binding motif: flexibility in aphthovirus receptor usage. J.Virol. 74:1641–1647.

27. Baranowski E, Sevilla N, Verdaguer N, Ruiz-Jarabo CM, Beck E, Do-mingo E. 1998. Multiple virulence determinants of foot-and-mouth dis-ease virus in cell culture. J. Virol. 72:6362– 6372.

28. Fry EE, Newman JW, Curry S, Najjam S, Jackson T, Blakemore W, LeaSM, Miller L, Burman A, King AM, Stuart DI. 2005. Structure offoot-and-mouth disease virus serotype A10 61 alone and complexed witholigosaccharide receptor: receptor conservation in the face of antigenicvariation. J. Gen. Virol. 86:1909 –1920.

29. Gutierrez-Rivas M, Pulido MR, Baranowski E, Sobrino F, Saiz M. 2008.Tolerance to mutations in the foot-and-mouth disease virus integrin-binding RGD region is different in cultured cells and in vivo and dependson the capsid sequence context. J. Gen. Virol. 89:2531–2539.

30. Jackson T, Ellard FM, Ghazaleh RA, Brookes SM, Blakemore WE,Corteyn AH, Stuart DI, Newman JW, King AM. 1996. Efficient infectionof cells in culture by type O foot-and-mouth disease virus requires bindingto cell surface heparan sulfate. J. Virol. 70:5282–5287.

31. Maree FF, Blignaut B, Aschenbrenner L, Burrage T, Rieder E. 2011.Analysis of SAT1 type foot-and-mouth disease virus capsid proteins: in-fluence of receptor usage on the properties of virus particles. Virus Res.155:462– 472.

32. Maree FF, Blignaut B, de Beer TA, Visser N, Rieder EA. 2010. Mappingof amino acid residues responsible for adhesion of cell culture-adaptedfoot-and-mouth disease SAT type viruses. Virus Res. 153:82–91.

33. Sa-Carvalho D, Rieder E, Baxt B, Rodarte R, Tanuri A, Mason PW.1997. Tissue culture adaptation of foot-and-mouth disease virus selectsviruses that bind to heparin and are attenuated in cattle. J. Virol. 71:5115–5123.

34. Fry EE, Lea SM, Jackson T, Newman JW, Ellard FM, Blakemore WE,Abu-Ghazaleh R, Samuel A, King AM, Stuart DI. 1999. The structureand function of a foot-and-mouth disease virus-oligosaccharide receptorcomplex. EMBO J. 18:543–554.

35. Rieder E, Baxt B, Mason PW. 1994. Animal-derived antigenic variants offoot-and-mouth disease virus type A12 have low affinity for cells in cul-ture. J. Virol. 68:5296 –5299.

36. Zhao Q, Pacheco JM, Mason PW. 2003. Evaluation of genetically engi-neered derivatives of a Chinese strain of foot-and-mouth disease virusreveals a novel cell-binding site which functions in cell culture and inanimals. J. Virol. 77:3269 –3280.

37. Botner A, Kakker NK, Barbezange C, Berryman S, Jackson T, BelshamGJ. 2011. Capsid proteins from field strains of foot-and-mouth diseasevirus confer a pathogenic phenotype in cattle on an attenuated, cell-culture-adapted virus. J. Gen. Virol. 92:1141–1151.

38. Lohse L, Jackson T, Botner A, Belsham GJ. 2012. Capsid coding se-quences of foot-and-mouth disease viruses are determinants of pathoge-nicity in pigs. Vet. Res. 43:46.

39. Snowdon WA. 1966. Growth of foot-and mouth disease virus in mono-layer cultures of calf thyroid cells. Nature 210:1079 –1080.

40. Weinreb PH, Simon KJ, Rayhorn P, Yang WJ, Leone DR, Dolinski BM,Pearse BR, Yokota Y, Kawakatsu H, Atakilit A, Sheppard D, VioletteSM. 2004. Function-blocking integrin �v�6 monoclonal antibodies: dis-tinct ligand-mimetic and nonligand-mimetic classes. J. Biol. Chem. 279:17875–17887.

41. De Diego M, Brocchi E, Mackay D, De Simone F. 1997. The non-structural polyprotein 3ABC of foot-and-mouth disease virus as a diag-nostic antigen in ELISA to differentiate infected from vaccinated cattle.Arch. Virol. 142:2021–2033.

42. Nayak A, Goodfellow IG, Woolaway KE, Birtley J, Curry S, Belsham GJ.2006. Role of RNA structure and RNA binding activity of foot-and-mouthdisease virus 3C protein in VPg uridylylation and virus replication. J. Vi-rol. 80:9865–9875.

43. Mason PW, Baxt B, Brown F, Harber J, Murdin A, Wimmer E. 1993.Antibody-complexed foot-and-mouth disease virus, but not poliovirus,can infect normally insusceptible cells via the Fc receptor. Virology 192:568 –577.

44. Neff S, Sa-Carvalho D, Rieder E, Mason PW, Blystone SD, Brown EJ,Baxt B. 1998. Foot-and-mouth disease virus virulent for cattle utilizes theintegrin �v�3 as its receptor. J. Virol. 72:3587–3594.

45. Weinacker A, Chen A, Agrez M, Cone RI, Nishimura S, Wayner E,Pytela R, Sheppard D. 1994. Role of the integrin alpha v beta 6 in cellattachment to fibronectin. Heterologous expression of intact and secretedforms of the receptor. J. Biol. Chem. 269:6940 – 6948.

46. Brown PJ, Juliano RL. 1985. Selective inhibition of fibronectin-mediatedcell adhesion by monoclonal antibodies to a cell-surface glycoprotein.Science 228:1448 –1451.

47. Jackson T, Blakemore W, Newman JW, Knowles NJ, Mould AP,Humphries MJ, King AM. 2000. Foot-and-mouth disease virus is a ligandfor the high-affinity binding conformation of integrin �5�1: influence ofthe leucine residue within the RGDL motif on selectivity of integrin bind-ing. J. Gen. Virol. 81:1383–1391.

48. Jackson T, Sharma A, Ghazaleh RA, Blakemore WE, Ellard FM, Sim-mons DL, Newman JW, Stuart DI, King AM. 1997. Arginine-glycine-aspartic acid-specific binding by foot-and-mouth disease viruses to thepurified integrin �v�3 in vitro. J. Virol. 71:8357– 8361.

49. Koivunen E, Gay DA, Ruoslahti E. 1993. Selection of peptides binding tothe alpha 5 beta 1 integrin from phage display library. J. Biol. Chem.268:20205–20210.

50. Uchio E, Kimura R, Huang YH, Fuchigami A, Kadonosono K, HayashiA, Ishiko H, Aoki K, Ohno S. 2007. Antiadenoviral effect of the alpha 5beta 1 integrin receptor ligand, GRGDSP peptide, in serotypes that causeacute keratoconjunctivitis. Ophthalmologica 221:326 –330.

51. McKenna TS, Lubroth J, Rieder E, Baxt B, Mason PW. 1995. Receptorbinding site-deleted foot-and-mouth disease (FMD) virus protects cattlefrom FMD. J. Virol. 69:5787–5790.

52. Rieder E, Henry T, Duque H, Baxt B. 2005. Analysis of a foot-and-mouth disease virus type A24 isolate containing an SGD receptor recog-nition site in vitro and its pathogenesis in cattle. J. Virol. 79:12989 –12998.

53. Taboga O, Tami C, Carrillo E, Nunez JI, Rodriguez A, Saiz JC, BlancoE, Valero ML, Roig X, Camarero JA, Andreu D, Mateu MG, Giralt E,Domingo E, Sobrino F, Palma EL. 1997. A large-scale evaluation ofpeptide vaccines against foot-and-mouth disease: lack of solid protectionin cattle and isolation of escape mutants. J. Virol. 71:2606 –2614.

54. McLeish NJ, Williams CH, Kaloudas D, Roivainen MM, Stanway G.2012. Symmetry-related clustering of positive charges is a common mech-anism for heparan sulfate binding in enteroviruses. J. Virol. 86:11163–11170.

Berryman et al.

8744 jvi.asm.org Journal of Virology

on June 10, 2014 by guesthttp://jvi.asm

.org/D

ownloaded from