Top Banner
portfolio portfolio [email protected]
54

portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

Aug 15, 2020

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

p o r t f o l i op o r t f o l i om a i l @ d e s i g n p e n d u l u m . c o m

Page 2: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

a n o t e o na n o t e o nthe practicethe practicem a i l @ d e s i g n p e n d u l u m . c o m

Design Pendulum is a spatial design firm engaged in housing, architecture, interior design and exhibition design consultancy. The firm also dabbles in related design disciplines at the ends of the scale spectrum, namely urban design and furniture design.

The design practice is headed by Sukhmani Brar and Siddharth Singh, graduates of the School of Architecture, CEPT Ahmedabad. Both share a career history of being Founding Partners at the Studio11 Architects’ Collaborative (’06-’13) and XPDS Architects (’13-’14) in Ahmedabad and were Senior Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years.

Sukhmani has housing and architectural projects of substantial scale to her credit: Green Meadows Housing, Sanand for Pacifica Developers and several under construction projects including LIG Housing, EWS Housing, CSI Housing and Sanskriti School in Chak Ganjaria, Lucknow and Takshila Foundation’s cultural institutions in Patna & Delhi. She has worked on many proposals for urban interventions, such as religious institutions, museums, mixed use commercial developments etc.

Sukhmani brings the dimension of research and a contemplative pace into the practice and prefers thoroughness in approach while dealing with building regulations, budgets estimations, project schedules and construction specifications.

To his credit, Siddharth has the upgradation of Taj Ganj: urban revitalization of the three access roads to the Taj Mahal, which was inaugurated in November ’16. He was also the project architect for the Mughal Museum (under construction in Agra) which was designed in collaboration with DCA, Berlin and the revitalization of the House of CG, Ahmedabad into a heritage hotel. He has worked on several large scale proposals across a wide range of project types: river fronts, forest and urban parks, cultural complexes and master planning.

Besides spatial design, Siddharth in involved in graphics and publications through his visual communication design enterprise compoundeye. He also conducts hand-on multimedia workshops on creative processes under the name image:medium:actor.

Together, the pair brings apparently contrasting dualities in to designs: meticulousness and rawness, flair and subtlety, newness and familiarity, exhilaration and pause, openness and enclosure, plurality and stability and so on and so forth.

Given the diversity of experience and interests of its principals, Design Pendulum’s strength, rather than specializing in any one, lies in its ability to grasp the conceptual roots across a variety of type, scale and nature of projects. Materials, light and aeration are retained natural as far as possible. These components are integrated with the structure, services and construction to give distinct identities to the elements of space and form.

Play of proportions and scales, rhythm and tempo and colors and textures are vital. The aesthetic experience thus created offers optimally necessary surprises to get inhabitants to emotionally engage with the place.

Page 3: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

arch itecture arch itecture m a i l @ d e s i g n p e n d u l u m . c o m

Page 4: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

A T E L I E R 4 6 6 g a n d h i n a g a r 2 0 0 9 A R C H I T E C T U R E 4 5 0 0 s q f t r e s i d e n c e

Page 5: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

A T E L I E R 4 6 6 This c omposite of studio apartments opens out towards a garden in the north-east and is protec ted by servic e bays along the south and west fac es. The building’s voc abulary is an expression of negotiations between program, c limate , struc ture and materials.

Page 6: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

A T E L I E R 4 6 6 Eac h apartment is laid out as a generous living bay aligned with a servic e bay that holds the toilet & bath and a kitc henette or a study. The building’s artic ulation – expansive exposed bric k c uboids, deep openings propped up by exposed c onc rete c irc ular c olumns, steel roof and fenestration in teak wood and glass – is an ode to Brutalism.

Page 7: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

B R A R H O U S E t a l w a n d i 2 0 1 1 A R C H I T E C T U R E 5 5 0 0 s q f t r e v i t a l i z a t i o n

Page 8: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

B R A R H O U S E The ornamental potential of brick masonry creates the architectural vocabulary in this rejuvenation of a half-a-century old house. Modern amenities have been added to the ancestral home which also help negotiate scale, dust, heat and noise, besides complex social hierarchies.

Page 9: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A N S K R I T I S C H O O L l u c k n o w A R C H I T E C T U R E 3 8 0 0 0 s q m s c h o o l c a m p u s

Page 10: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A N S K R I T I S C H O O L The 10 Acre site is located in the newly planned CG city at Lucknow. The school building is designed as a series of alternating exposed brick and concrete blocks connected by steel bridges.

site plansection

section

section

elevation

Page 11: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

The brick bars house the classrooms while the concrete bars house activities like the labs, library and multipurpose spaces. The section of the concrete blocks steps down towards the playgrounds on the northeast, creating an inter-mediate, multipurpose terrace which provides the necessary release/void between two classrom blocks.

S A N S K R I T I S C H O O L a r c h o h mclient: lucknow development authority

Page 12: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A N S K R I T I S C H O O L A variety of non-functional spaces for impromptu activities and interactions such as large steps, verandahs, wide corridors etc. have been provided, which is where actual learning takes place.

Page 13: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

M U G H A L M U S E U M a g r a 2 0 1 7 A R C H I T E C T U R E 2 0 0 0 0 S M t . i n s t i t u t i o n

Page 14: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

M U G H A L M U S E U Ma r c h o h m c o n s u l t s

Designed in collaboration with David Chipperfield Architects’ Berlin office, this institution is a necesary addition not only for the city of agra as an accesible & vibrant public place, but also in the national and global scheme of things as a resource center.

Page 15: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

C A F E S T R E E T a g r a 2 0 1 7 A R C H I T E C T U R E 3 0 0 0 S M t . r e c r e a t i o n a l

Page 16: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

C A F E S T R E E Ta r c h o h m c o n s u l t s

The symmetrically laid out steel building is an exclusive foodcourt comprising of cafes, restaurants and kiosks, all wrapped around a courtyard. A pavilion connects this central courtyard to the belt of green buffer between the building and the road running parallel to the site.

sing ofcac feees restaurants and kiosks allwrappededddededdddddeddddeededdedeeddeeed aaaaaaaaarosing offffffffffffffffffcacccccccccccc feeeeeeeeeeeeeees,ssssssssssssssssssssss restaurants annd kiosks, allwrappedeededeeededededededeeeededdee aaaaaaaaaaaaaaaaaaaaaaro

Page 17: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

h o u s i n g &h o u s i n g &u r b a n d e s i g n u r b a n d e s i g n m a i l @ d e s i g n p e n d u l u m . c o m

Page 18: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

TA J G A N J RED EV ELO PEM EN T a g ra 2 0 1 6 U RBA N H ERITA G E D ES IG N m u l t i - d is c ip l in a ry in t e rv e n t io n s

Page 19: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

TA J G A NJ REDEV ELO PM ENTThis infrastructure upgradation work, run as projet architect at archohm, addresses the long due need to revitalise Taj Mahal’s three access roads. The urban heritage landscaping involved streetscaping, signage, lighting, hortiulture and architecture

Page 20: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

TA J G A NJ REDEV ELO PM ENTThe over 6 KM road network was categorised into segments according to use and proximity to the world heritage monumnet. Vehicular carriageways have been narowed down and pedestrian paths maximised. Story Signages, designed by DFI, are strategically located

Page 21: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

TA J G A NJ REDEV ELO PM ENTSeveral architectural interventions have been built to accommodate amenities such as public toilets, a CCTV control room and community centers that cater Taj Ganj’s fifteen slums - neighbouring the great mousoleum to its south east

Page 22: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

T H E M E A D O W S a h m e d a b a d 2 0 1 3 H O U S I N G 1 0 0 A c r e s 9 6 u n i t s

Page 23: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

T H E M E A D O W S Atte mpting to e laborate the margin into a c ourtyard, the housing e volve d into c luste rs of de tac he d units; e ac h with a little front garde n and bac kyard. The ve randahs, balc onie s and roofs c re ate the ne c e ssary variations in the building language . s t u d i o 1 1 y g g gary variations in the building language . de n and bac yard. The ve randahs, bade n and bac kyard. The ve randahs, bbagfront gards t u d i o 1 1

Page 24: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

O R A N G E C A S T L E l u c k n o w A R C H I T E C T U R E 1 1 8 8 8 3 s q m h o u s i n g

Page 25: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

O R A N G E C A S T L E The design and landscape for this private builder housing was developed in collaboration with MVRDV, Rotterdam and Topotek1, Berlin respectively. There are total of 437 units with a mix of typologies (56 different types) from 3bhk standard apartments to 3 & 4bhk units with exclusive terraces as well as luxurious 5bhk penthouses with private terraces.

site

towers arranged in a ring around a

central open space

the arrangement of the cores

diagram showing vertical distribution of units. 3bhk standard units

occupy the first 7 floors, duplexes and penthouses appear on the

higher floors.

a r c h o h mc l i e n t : S u r a j B u i l d e r s

Page 26: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

O R A N G E C A S T L E Breaking away from the separate tower morphology of typical housing, the towers are contiguously arranged in a peripheral ring around a central open space which is the size of two football fieds. The built form begins to modulate at the higher floors making room for the private terraces, creating a playful profile.

Page 27: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

C S I T O W E R S l u c k n o w A R C H I T E C T U R E 5 0 5 7 5 s q m t h o u s i n g f o r I A S o f f i c e r s

Page 28: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

The 5 acre site is located adjacent to the Sanskriti School in CG City, Lucknow. 5 towers - each G+14 storeys high with two apartments on each floor - are organised around a large green central space. The angular orientaion of the towers allows each apartment views of the central green spaceand beyond without compromising on privacy.

unit plan 4bhk even lvl unit plan 4bhk odd lvl

site plan

C S I T O W E R Sa r c h o h mclient: lucknow development authority

Page 29: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

L I G - E W S H O U S I N G l u c k n o w A R C H I T E C T U R E 5 5 , 5 6 0 s q m 8 6 4 u n i t s l o w c o s t h o u s i n g

Page 30: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

L I G - E W S H O U S I N G

site plan

lig housing6.17acre 512 units

ews

lig ews

The sites for lig and ews housing are situated adjacent to each other separated by a 30m wide road, in the cg city at lucknow. In the g+3 towers the section has been split to create a stiltted parking space under one half of the tower, while in the other half, units occupy the ground and open out to the central,vehical free community space through stepped plinths.

ews housing3.84 acre 352 units

client: lucknow development authoritya r c h o h m

Page 31: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

lig-cluster plan ground floor lvl

lig-cluster plan second floor lvl

lig-unit plans

In the LIG housing, two rows of towers are connected by bridge units which span the community space, giving it an intimate scale and at the same time freeing up the ground while achieving the required density.L I G H O U S I N G

Page 32: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

ews-cluster plan ground floor lvl

ews-cluster plan first floor lvl

ews-cluster plan third floor lvl ews-unit plans

E W S H O U S I N GThe sectional typology of the tower is repeated in the EWS housing allowing a seggregation of vehicular and pedestrain movement and creation of a community space. The form of the block is further modified by by shifting the bedroom module on the 2nd and 3rd floor to create terraces.

Page 33: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

KA N PUR RIV ERFRO N T D EV ELO PM EN T p ro p o s a l 2 0 1 7 URBA N LA N D SC A PE & A RC HITEC TURE 3 KM re c re a tio n a l

Page 34: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

KA N PUR RIV ERFRO N T D EV ELO PM EN Ta r c h o h m c o n s u l t s

The de sign propose s a limite d inte rve ntion approac h in the fragile e c ology of a rive r bank, while inc orporating urban ame nitie s that will he lp in the me e ting of the c ity and the rive r in a se nsitive way

Page 35: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

KA N PUR RIV ERFRO N T D EV ELO PM EN TBesides the typical amenities, the proposal reinterprets the ghat as a compact building and introduces an interpretation center to inform vistors about the natural, bult, cultural and industrial heritage of the region

a compactbbbbbbbbbbbbbbbbbbbbbbbuiuiuiuiuiuiuuuiuuuuuuuuuuiuuuuildlldl ininnggggggggggggggggggg aananaand introduceseeeseseseeseeeeeseeees aaaaaaaaaaanaaatttttttttasaaaggggggggggggg ggggggggggggggg

a compactbbbbbbbbbbbbbbbbbbuiuiiiiiuiiiuiiiiuiiuuuuuuu ldldldldldldlldlldldddldddddddddddininnnnininnnnnnnnninnninnnnnnnnnnnnnngggggggggg gggggggg and introduceseseseesesesesesseseeeesseesss aaaaaaaaaaaaaaaaaanaaaatttttttttttt aaaaaaasaaaal and industtttttttsttttsttttttrirrirririrriiririririrrrrirrrirrrrralalalalalalalaalalaalaalalalalalalallalaalalalalhhhhhhhhhhhhhhhhhhhhhhhheerererererrererererererererrerrrereereeeritiititiititititiititiiititiittitititiitttiittagagagagagagaagagagagagagagagaagagaaagagagagaagagagagge eeeeeeeeeeeeeeeeee of the rrregegegegegegegegeggggeggegggggggggggggioioiioioiioiioioiooiioioioioioiioioioioioiooiooioiooioooooonultura

Page 36: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

TA J G A NJ REDEV ELO PM ENTOne of the most exciting interventions was the Taj Ganj Visitors’ Center, proposed barely 100 m from the East Gate, to accommodate not only tourist facilities but also a sub-terranian gallery, workshop spaces and plaza with trees

Page 37: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

e x h i b i t i o n &e x h i b i t i o n &interiordesigninteriordesignm a i l @ d e s i g n p e n d u l u m . c o m

Page 38: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

B 4 0 3 S H I V A N S H I a h m e d a b a d 2 0 0 8 I N T E R I O R D E S I G N 1 0 0 0 s q f t r e s i d e n c e

Page 39: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

B 4 0 3 S H I V A N S H I This sm a ll p ro je c t e m p lo ys furniture , p a rtitio n sc re e ns a nd slid ing d o o rs a s the p rim a ry e le m e nts to c re a te o p e n a nd a d a p ta b le sp a c e s tha t o ffe r d e e p p e rsp e c tive s a nd wa rm ta c tility.

Page 40: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

B 4 0 3 S H I V A N S H I The sp a tia lity c a n c ha ng e fro m a sing le to a d o ub le - b a y la yo ut c o rre sp o nd ing to the ne e d fo r b uffe r fro m o utd o o r c o nd itio ns. Ko ta h sto ne , Va lsa d i te a k wo o d , e xp o se d a nd p a inte d p lywo o d , p la in a nd fig ure g la ss a nd fa b ric s m a ke up the m a te ria l p a le tte .

Page 41: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

C S I A S T E E L k o l k a t a 2 0 0 6 I N T E R I O R D E S I G N 2 0 0 0 s q f t o f f i c e

Page 42: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

C S I A S T E E L s t u d i o 1 1

The simple and ac c ommodative plan addresses the need for both formal and informal nature of spac es and movement. The design explores and expresses three signific ant arc hitec tural c onc erns: texture , multiplic ity of frames & integrity of e lements.

Page 43: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

H I G H S T R E E T F O O D a h m e d a b a d 2 0 1 0 I N T E R I O R D E S I G N 3 0 0 0 S F t . r e s t a u r a n t

Page 44: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

H I G H S T R E E T F O O DThe c e ntra l c olumn is tra nsforme d into a tre e a nc horing the public squa re ; its folia g e offe ring lig hting both be low & a bove . Furniture is la id out dia g ona lly in fre e spa c e , while se a ting plinths a long the e dg e offe r a c ounte rpoint in ma ss, c re a ting a dyna mic te nsion in spa c e .

s t u d i o 1 1

Page 45: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

V A R I E T E A b a r o d a 2 0 0 9 I N T E R I O R D E S I G N 7 5 0 s q f t C A F E

Page 46: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

V A R I E T E A The design translates the c lient’s ‘images’ into disc ernible e lements c reating a warm, soft and vibrant interior spac e within the limited floor spac e and time frame. The shop front and the mural on the walls inside integrate the other two extremes of the business (retail and produc tion) with the c afé , whic h is intended to offer a distinc t experienc e of the produc t.

s t u d i o 1 1

Page 47: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A F A L P R E L U D E a h m e d a b a d 2 0 1 0 I N T E R I O R D E S I G N 1 8 0 0 s q f t f o y e r

Page 48: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A F A L P R E L U D EThe design infuses a subtle tac tility in the experienc e of an entranc e foyer within a c ommerc ial offic e building. The large west-fac ing volume avails a play of light and shadow on generous planes; making it an exerc ise in rendering surfac es - floor, walls, the entranc e door, c anopy and a benc h. s t u d i o 1 1

Page 49: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

S A F A L P R E L U D EThe design pays partic ular attention to the material palette and nature of finishes: teak frames and iron-filing sandwic hed in glass panels for the fenestration, travertine for the walls and the floor and a mural of steel-plates. The lighting design enhanc es the ric hness and austerity of the spatial experienc e.

Page 50: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

D A D H A N I Y A R E S I D E N C E a h m e d a b a d 2 0 1 0 I N T E R I O R D E S I G N 1 8 0 0 s q f t r e s i d e n c e

Page 51: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

D A D H A N I Y A

R E S I D E N C E

The c entral double volume dining spac e is the c ore of this generous apartment. The proc ess started with showing the c lients how invaluable the spac e is and c onvinc ing them against their idea of introduc ing a mezzanine to c reate an additional room. The straight flight stairc ase along one of the walls of this spac e is a navigation devic e leading a viewer’s sight upward.

Page 52: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

D X D 2 0 U N D E R 3 5 n e w d e l h i 2 0 1 3 E X H I B I T I O N D E S I G N s p a t i a l d e s i g n p r a c t i c e

Page 53: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

D X D 2 0 U N D E R 3 5We c hose to oc c upy the c ourtyard, sinc e we wanted to c reate inhabitable spac e and not just dec orate it. We wanted to announc e ourselves (proc laim even) but without ending up as a mere announc ement; we wanted to be the event as well. We sprang out from below ground – to be visible and also to invite everyone to the sub-terrain. s t u d i o 1 1

Page 54: portfoliopo r t f o l i o - Design Pendulum...Architects at Archohm, NOIDA (’14-’17). The couple brings a combined experience in design of nearly thirty years. Sukhmani has housing

D X D 2 0 U N D E R 3 5

The pavilion didn’t just exhibit what we did but it demonstrated it too: minimal and modern in integrating aesthetic and struc ture , e laborating the program to ac c ommodate not just func tion but also event and exaggerating the form and spac e to perform and c elebrate . The struc ture was made from rented sc affolding and bamboo, so we c ould c arry bac k only the exhibition panels to our studio.