Porcine circovirus-2 capsid protein induces cell death in PK15 cells · 2017. 2. 21. · PK15 cells in 12-well plates. Cells were incubated for 90 min at 37 1Cin5%CO 2, and fresh

Porcine circovirus-2 capsid protein induces cell death in PK15 cells

Rupali Walia 1, Rkia Dardari n,1, Mark Chaiyakul, Markus CzubFaculty of Veterinary Medicine, University of Calgary, Alberta, Canada

a r t i c l e i n f o

Article history:Received 15 May 2014Returned to author for revisions6 June 2014Accepted 28 July 2014Available online 28 August 2014

Keywords:PCV2Capsid proteinCell death

a b s t r a c t

Studies have shown that Porcine circovirus (PCV)-2 induces apoptosis in PK15 cells. Here we report thatcell death is induced in PCV2b-infected PK15 cells that express Capsid (Cap) protein and this effect isenhanced in interferon gamma (IFN-γ)-treated cells. We further show that transient PCV2a and 2b-Capprotein expression induces cell death in PK15 cells at rate similar to PCV2 infection, regardless of Capprotein localization. These data suggest that Cap protein may have the capacity to trigger differentsignaling pathways involved in cell death. Although further investigation is needed to gain deeperinsights into the nature of the pathways involved in Cap-induced cell death, this study provides evidencethat PCV2-induced cell death in kidney epithelial PK15 cells can be mapped to the Cap protein andestablishes the need for future research regarding the role of Cap-induced cell death in PCV2pathogenesis.

& 2014 Elsevier Inc. All rights reserved.

Introduction

Porcine circovirus (PCV)-2 has been identified as the primarycausative agent of Post-weaning Multisystemic Wasting Syndrome(PMWS), a clinical syndrome of progressive wasting that mainlyaffects 6- to 12-week-old pigs (Allan et al., 1999; Bolin et al., 2001).PMWS is characterized by an extensive lymphoid cell depletionand granulomatous inflammation (Chianini et al., 2003; Darwichet al., 2002; Sarli et al., 2001) that correlate positively with highPCV2 viral load in affected animals (Ladekjaer-Mikkelsen et al.,2002). PCV2 is the smallest known autonomously replicating non-enveloped virus with a 1.7-kb single-stranded circular DNA gen-ome, which has three well-characterized open reading frames(ORFs). ORF1 encodes two proteins involved in genome replica-tion, Rep and the splice variant Rep', while ORF2 encodes thedominant immunogenic and only structural capsid protein, Cap(Nawagitgul et al., 2002). The third ORF encodes a non-structuralprotein called ORF3 that has been characterized as a pro-apoptoticprotein (Liu et al., 2005).

Having a limiting coding capacity implies that PCV2 mustencode for multifunctional products to ensure replication withinthe host. In fact, beside its role as the only structural proteininvolved in virus assembly, PCV2 Cap protein plays a role in

controlling viral replication via its interaction with Rep proteinin the nucleoplasm, may be by influencing DNA synthesis(Finsterbusch et al., 2005; Timmusk et al., 2006). Several othercellular proteins involved in different aspects of viral replicationsuch as transcriptional regulation and intracellular transport werealso found interacting with Cap protein (Finsterbusch andMankertz, 2009). Along the same lines, it has been reported thatPCV2 manipulates the autophagy machinery to enhance viralreplication; and Cap protein was found responsible for that effect,by promoting the formation of autophagosome (Zhu et al., 2012).

Several studies have linked viral replication with cell death andviral dissemination, although the outcome seems to be virus andcell specific (Berens and Tyler, 2011; Levine and Deretic, 2007).PCV2 has been shown to induce apoptosis in porcine kidneyepithelial PK15 cells (Liu et al., 2005). On one hand, ORF3 proteinwas identified as a contributing factor to apoptosis in PK15 cells(Liu et al., 2005); although, its role as the only factor causinglymphoid depletion has been a subject of controversy (Juhan et al.,2010). On the other hand, i) enhanced PCV2 replication wasassociated with cell death in PCV2 infected cells with a denselylocalized, perinuclear Cap protein expression (Dvorak et al., 2013),and ii) the ability of PCV2 to replicate and to induce cytopathiceffect in the host seems to be compromised by specific mutationsoccurring in Cap protein (Fenaux et al., 2004; Krakowka et al.,2012). Altogether, these data suggest that PCV2-Cap protein maybe involved in inducing cell death late in the replication cycle.Here we have investigated the hypothesis that Cap protein holdsthe capacity to induce cell death in pig cells, as a result of viralreplication. Our objectives were to determine whether i) enhan-cing PCV2 replication with interferon gamma (IFN-γ) treatment in

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/yviro

Virology

http://dx.doi.org/10.1016/j.virol.2014.07.0510042-6822/& 2014 Elsevier Inc. All rights reserved.

n Correspondence to: Department of Comparative Biology and ExperimentalMedicine Faculty of Veterinary Medicine, University of Calgary, 3300 HospitalDrive, NW, HRIC building, room 2AC68, AB, Calgary, Canada T2N 4N1.Tel.: 1 403 210 7190.

E-mail address: [email protected] (R. Dardari).1 The two authors contributed equally.

Virology 468-470 (2014) 126–132

www.sciencedirect.com/science/journal/00426822www.elsevier.com/locate/yvirohttp://dx.doi.org/10.1016/j.virol.2014.07.051http://dx.doi.org/10.1016/j.virol.2014.07.051http://dx.doi.org/10.1016/j.virol.2014.07.051http://crossmark.crossref.org/dialog/?doi=10.1016/j.virol.2014.07.051&domain=pdfhttp://crossmark.crossref.org/dialog/?doi=10.1016/j.virol.2014.07.051&domain=pdfhttp://crossmark.crossref.org/dialog/?doi=10.1016/j.virol.2014.07.051&domain=pdfmailto:[email protected]://dx.doi.org/10.1016/j.virol.2014.07.051

PK15 cells is associated with death in cells expressing Cap proteinand ii) Cap protein expression alone is capable of promoting thesame effect in the absence of the viral genome and other PCV2products. Here we report that Cap protein expression induces celldeath in the PK15 cell line and that effect is enhanced by IFN-γ. Acell death by “bystander” effect has also been observed in cellsdevoid of any sign of infection. Our results also show that thetransient PCV2 Cap protein expression induces cell death at similarrate to PCV2 infection, whether the expression is nuclear orcytoplasmic, suggesting Cap protein's ability to interact withdifferent cell death signaling pathways. This study provides thebasis for future research regarding the role of Cap-induced celldeath in PCV2 pathogenesis.

Materials and methods

Generation of recombinant eukaryotic expression vectors

Coding sequences of ORF2 were PCR-amplified from PCV2a(GenBank accession number: JQ994269) and PCV2b (GenBankaccession number: JQ994270) strains using oligonucleotide pri-mers (Table 1). The PCV2a and PCV2b full genomes were cloned inpcDNA plasmids that have been kindly provided by Dr. CarlGagnon (University of Montreal, Quebec, Canada). The anti-senseORF2 constructs served as negative experimental controls for Capexpression. PCR was performed with iProofTM Hi-Fidelity DNAPolymerase (BioRad, Mississauga, Ontario, Canada) in a Gen-eAmps PCR System 9700 (PE Applied Biosystems, Carlsbad, CA).PCR cycle profile consisted of a pre-denaturation step at 98 1C for30 s followed by 36 cycles of denaturation at 98 1C for 10 s,annealing at 60 1C for 30 s, extension at 72 1C for 60 s and a finalextension step at 72 1C for 10 min. After separation by agarose gelelectrophoresis, PCR products of expected size were purified usinga QIAquicks Gel Extraction Kit (QIAGEN). The NotI/SalI fragmentsof ORF2 were cloned into the corresponding sites of the eukaryoticexpression plasmid pCI (Clontech, Mountain View, CA) under thecontrol of a human cytomegalovirus (CMV) promoter (pCMV-PCV2bCap). A pCMV-HA plasmid (Clonetech, Mountain View, CA)was used to clone the full length and truncated Cap without thenuclear localization signal (ΔNLS-2bcap) under CMV promoterand HA tag. The first 41 amino acids at the N-terminal of fulllength Cap (Liu et al., 2001) were removed using suitable primers(Table 1) to generate ΔNLS-2bcap fragment. The NotI/SalI frag-ments of full length Cap and ΔNLS-2bcap were cloned into thecorresponding sites of the pCMV-HA. The resulting clones pCMV-HA-2bcap and pCMV-HA-ΔNLS-2bcap were confirmed by sequen-cing and the expression was confirmed by western blot usingRabbit anti-PCV2b-Cap. The ORFs cloned in this vector areexpressed under CMV promoter in mammalian cells as a taggedprotein with a N-terminal HA-tag.

Cell culture

PCV-free porcine kidney epithelial PK-15 cell line was main-tained in growth media (Eagle's minimum essential medium(Invitrogen), 10% fetal bovine serum (FBS) (Invitrogen), 2% peni-cillin–streptomycin solution (Invitrogen), 1% sodium pyruvate(Invitrogen), 1% essential amino acids (Invitrogen). The humanembryonic kidney epithelial 293T cell line was grown in Dulbec-co's modified Eagle medium (Invitrogen) supplemented with 10%FBS and 2% penicillin–streptomycin solution.

Infection and transfection

9�104 TCID50 of PCV2b were used to infect 60–70% confluentPK15 cells in 12-well plates. Cells were incubated for 90 min at37 1C in 5% CO2, and fresh culture medium was then added toPCV2b infected cells, which were further incubated for 48 h. Forthe purpose of increasing viral replication, PK15 were also treatedwith 500 U/ml of swine recombinant IFN-γ (Gibco) before or afterPCV2b infection. Non-infected PK15 cells treated with IFN-γ wereused as control. For transfection experiments, 12-well plates(3.8 cm2 per well) were coated with poly-D-lysine (Sigma-Aldrich)and cells were seeded one day prior to transfection in growthmedium without antibiotics (1 ml per well in a 12-well plate).When the cells were 70% to 80% confluent, 2 μg of DNA wastransfected into the cells with Lipofectamine 2000 (Invitrogen,Burlington, Ontario, Canada). The growth media is added 4 h post-transfection and cells were analyzed 48 h later.

Flow cytometry-based intracellular staining of the cap expression

Mock and PCV2b-infected or transfected cells were trypsinizedand washed with phosphate-buffered saline (PBS). For intracellularstaining, cells were fixed in 4% formaldehyde and cell count wasdetermined using Petroff-Hausser Chamber (Hausser Scientific Part-nership) and phase contrast microscopy (CKX41, Olympus Canada).Cell were diluted to 106 cells/ml with PBS, treated with thepermeabilization buffer (PBS, 0.1% saponin, BSA) for 30 min at RTand stained for intracellular Cap expression using a rabbit polyclonalanti-PCV2b Cap as a primary antibody (1:7290) and Goat anti-Rabbit-FITC as a secondary antibody. The samples were analyzed by flowcytometry (Cell Lab quanta TM SC MPL, Beckman Coulter, Canada).

Cell cytotoxicity analysis

All cells including both detached and adherent cells werecollected, centrifuged at 2000 rpm for 5 min and washed twicewith PBS. The concentration was adjusted to 106 cells/ml. For eachtreatment, 100 μl of cell suspension was stained using molecularprobess live/deads fixable dead cell stain kits (Invitrogen) accord-ing to the manufacturer's protocol. The cells were then fixed with4% formaldehyde and intracellular staining for Cap was done asdescribed above. The samples were analyzed by flow cytometer andpercentage of live/dead cells among the Cap expressing cells werecalculated. Etoposide (Sigma-Aldrich), an apoptosis-inducing che-mical, was used as a positive control in this assay.

Immunofluorescence assay (IFA)

For Cap protein localization study, PK15 and 293T cells werewashed with PBS and fixed with 4% paraformaldehyde for 30 minat room temperature (RT). Cells were washed with PBS and treatedwith the permeabilization buffer (PBS, 0.1% saponin, BSA) for30 min at RT. The cells were incubated with a polyclonal rabbitanti-PCV2b Cap primary antibody (1:200-dilution) at 37 1C in darkfor 90 min. Cells were washed three times with PBS-T (PBS, 0.1%

Table 1Oligonucleotide primers used to generate/sequence recombinant Cap constructs.

Constructs Primer Sequence (50 to 30)

PCV2a Cap (sense) CCAAGGAGGR-AGTCGCGGCCGCTTCATTTAGGGTTTAAGTGGG

PCV2b Cap (sense) F-AGTCGTCGACTATGACGTATCCAAGGAGGR-AGTCGCGGCCGCGAGTTAAGGGTTAAGTGGG

PCV2a Cap (anti-sense) F-AGTCGCGGCCGCTATGACGTATCCAAGGAGGR-AGTCGTCGACTTCATTTAGGGTTTAAGTGGG

PCV2b Cap (anti-sense) F-AGTCGCGGCCGCTATGACGTATCCAAGGAGGR-AGTCGTCGACGAGTTAAGGGTTAAGTGGG

ΔNLS-PCV2bCap (SalI) F- AGTCGTCGACTatgAATGGCATCTTCAACR-AGTCGCGGCCGCGAGTTAAGGGTTAAGTGGG

HA-pCMV (sequencing primer) GATCCGGTACTAGAGGAACTGAAAAAC

R. Walia et al. / Virology 468-470 (2014) 126–132 127

Tween-20), and were incubated in the dark with Alexa Fluor 568-conjugated goat anti-rabbit IgG (Molecular probes, Invitrogen) at37 1C for an hour. Cells were washed three times with PBS-T,counterstain with 40-6-diamidino-2-phenylindole (DAPI) andvisualized with Olympus IX51 fluorescence microscope.

Statistical analysis

Statistical analyses were performed using SPSS 17.0 software.Independent samples t-test was performed and differences wereconsidered significant when P-value o or equal to 0.05. At leastthree independent trials were conducted for each experiment.

Results and discussion

IFN-γ enhances PCV2 replication that leads to cell death in PK15 cells

It has been shown that PCV2 replication induces apoptosis inthe PK15 cell line (Liu et al., 2005), although it remains unclearwhether cell death is a consequence of direct cytotoxicity, a“bystander” effect or both. Since IFN-γ is a pro-inflammatorycytokine that has been found to play a role in increasing PCV2replication in porcine cell lines (Ramamoorthy et al., 2009; Meertset al., 2005), PK15 cells were infected with PCV2, treated with IFN-γfor 48 h, subjected to a double staining with fixable live/dead dyeand anti-Cap antibody and analyzed by flow cytometry. Our resultsshow an initial rate of infection of 3% in PK15 cells, which increasesto 9% in IFN-γ treated cells regardless of whether the cytokine isadded before or after infection (Fig. 1). We further show that the2.5- to 3-fold increase in PCV2-Cap positive cells following IFN-γtreatment was accompanied by a higher rate of cell death whencompared to untreated cells (80% vs. 40%, po0.05) (Fig. 2).Notwithstanding the limited understanding of how IFN-γ modu-lates PK15 cells permissiveness to PCV2 (Meerts et al., 2005) andhow this leads to cell death, a study has reported IFN-γ0s ability todecrease Cyclin A (Cyc A) expression (Sibinga et al., 1999), whoseover-expression suppresses PCV2 replication by altering PCV2-Repsub-cellular localization (Tang et al., 2013). The down-regulation ofCyc A by IFN-γmay lead to cell cycle arrest which in turn can resultin apoptosis-induced cell death. Another study showed that PCV2activates the Mitogen-Activated Protein Kinase (MAPK) signalingpathways by phosphorylating Janus Kinases (JNK) 1/2 and p38 thatleads to enhanced viral replication and apoptosis (Wei et al., 2009).

IFN-γ also activates these signaling pathways in macrophage andendothelial cells, resulting in autophagy activation (Matsuzawaet al., 2014; Valledor et al., 2008). Thus, it is possible that PCV2may take advantage of IFN-γ-induced JNK1/2 and p38 activationand subsequently the autophagy activation to enhance viral replica-tion leading to cell death. Our results also showed that the IFN-γenhances “bystander” cell death in PCV2-Cap negative cells withinPCV2 infected cell cultures (25%) as compared to untreated cultures(5%) (po0.05), which indicate that IFN-γ may sensitize non-infected cells to subsequent cell death signals (e.g. Fas-mediatedapoptosis). These findings raise the possibility that this “bystander”effect may be taking place in PCV2-infected animals and maycontribute to lymphoid cell depletion in vivo, since a high numberof apoptotic lymphocytes in the lymphoid tissues of PMWS-affectedpigs did not show any sign of productive infection (Shibahara et al.,2000).

IFN-γ enhances nuclear localization of the PCV2 cap protein

Studies have shown that the nucleo-cytoplasmic shuttling ofviral proteins is a frequent event that accompanies the inductionof apoptosis-induced cell death (Blachon et al., 2005; Heilman etal., 2006). To determine whether IFN-γ treatment has any effect onCap shuttling, cells were infected with PCV2 and were either pre-or post- treated with IFN-γ and then stained for Cap proteinexpression. Our results show a clear change in the intracellulardistribution of Cap protein 48 h post-infection, with a major shiftin the ratio of cytoplasmic-to-nuclear Cap protein localizationfrom 2:1 in untreated cells to approximately 1:11 in IFN-γ pre-treated cells and 1:5.6 in IFN-γ post-treated cells (Fig. 3). Although,PCV2-Cap has an NLS that tags this protein for nuclear transloca-tion (Cheung and Bolin, 2002), the exact mechanism behind thenuclear import of Cap protein remains unclear. It was hypothe-sized that the phosphorylation of the NLS regulates the import ofNLS cargo proteins through nuclear pores (Harreman et al., 2004).Whether the Cap-NLS has a kinase phosphorylation site orwhether the phosphorylation of NLS may enhance or decreasethe nuclear localization is unknown.

PCV2-cap protein expression induces cell death

To rule out the possibility that the PCV2 induced-cell deathmight be due to ORF3 expression, we sought to determine whetherthe expression of PCV2-Cap protein expression alone is capable ofinducing cell death in the absence of viral replication. To mimic thelate stage of PCV2 infection, the Cap protein of PCV2a and PCV2b,

Fig. 1. IFN-γ effect on PCV2 replication in PK15. Mock- and PCV2-infected cellswere pre- and post-treated with 500 U/ml of IFN-γ. Cells were collected 48 hpi,processed for indirect intracellular staining of Cap protein and analyzed by flowcytometry. Results are expressed as the mean7SD from three independentexperiments.

Fig. 2. IFN-γ effect on cell death in PCV2 infected PK15. Mock- and PCV2-infectedPK15 cells were pre- or post-treated with 500 U/ml of IFN-γ. Cells were collected48 hpi and stained using molecular probess live/deads fixable dead cell stain kits(Invitrogen) followed by a staining for Cap protein expression. Cell death valuesthat are significantly different (Po0.05) from the cell death values of non-treatedcontrol (n) are indicated above the bars.

R. Walia et al. / Virology 468-470 (2014) 126–132128

the two major pathogenic genetic variants that differ only in theCap amino acid sequence, was expressed under the control of theCMV promoter and used to transiently transfect PK15 and 293Tcells. Cells were collected 48 h post-transfection and analyzed by

flow cytometry for cell death and Cap protein expression. Regard-less of which PCV2 variant had been used for transfection, cell deathwas induced in 60% of PK15 cells expressing Cap protein with thesame extent as etoposide (a potent inducer of cell death), (Fig. 4).Neither PCV2 Cap transfection nor etoposide treatment were stronginducers of cell death in human 293T cells (Fig. 4), despite a 4- to 5-fold higher rate of expression of Cap protein in 293T cells (20–30%)as compared to PK15 cells (5-6%) (Fig. 5). The difference incytotoxicity of PCV2-Cap between PK15 and 293T cell lines cannotbe explained by the levels of Cap expression, as both PCV2a- andPCV2b-Cap constructs expressed the protein at a very similar levelin both cell lines (data not shown). These data suggest that 293Tcells may be specifically resistant to the PCV2-Cap protein effect, asthey had been previously found to be sensitive to the pro-apoptoticeffect of PCV2-ORF3 (Chaiyakul et al., 2010), and which furtherindicate that the mechanism through which PCV2-ORF3 and PCV2-Cap induce cell death may be distinct. The ability of Cap proteinalone to induce cell death suggests that PCV2-induced apoptosismay reflect the need for Cap protein accumulation late in thereplication cycle to induce cell death. No difference between PCV2aand PCV2b Cap cytotoxicity in transfected PK15 and 293T cells,although the ability of these two strains to propagate in VR1BL cellsseems to be different (Dvorak et al., 2013). It has been suggestedthat the difference in the replication kinetic of PCV2 strains can be

Fig. 3. Subcellular localization of Cap protein expression in PCV2b-infected PK15 pre- or post-treated with IFN-γ. The PCV2b infected PK15 cells were pre- or post-treatedwith 500 U/ml IFN-γ analyzed by IFA for Cap protein expression 48 h later. Representative images of three independent experiments are shown. Cap staining (red) indifferent treatment groups was visualized with Olympus IX 51 fluorescence microscope. Blue represents nuclei stained with DAPI. Using Image J analysis the percentage ofCap nuclear and cytoplasmic staining was studied, cytoplasmic localization (C) of Cap, nuclear localization (N). Statistics of localization of Cap fluorescence was performed onsix different randomized fields under fluorescent microscope.

Fig. 4. Cell death in PK15 and 293T cell lines tranfected with PCV2a and PCV2b-Cap. PK15 and 293T cells were transfected with full length Cap-ORF from PCV2aand PCV2b under the CMV promoter. Empty pCI plasmid and antisense Cap-ORF's(AS) were used as negative controls and etoposide (50 μM and 100 μM) was used asa positive control. Cells were collected 48 h after transfection and stained usingmolecular probess live/deads fixable dead cell stain kits (Invitrogen) followed bystaining for Cap protein expression. Values that are significantly different (Po0.05)from the values for negative controls, e.g., mock- or antisense controls (n) areindicated above the bars. This is a representative data set from one of threeindependent experiments. Error bars represent the mean standard deviation ofintra-assay replicates.

Fig. 5. Cap protein expression in PK15 and 293T cells. PK15 and 293T cells weretransfected with full length Cap-ORF from PCV2a and PCV2b under the CMVpromoter. Cells were collected 48 hpi, processed for indirect intracellular stainingof Cap protein and analyzed by flow cytometry. Results are expressed as themean7SD from three independent experiments.

R. Walia et al. / Virology 468-470 (2014) 126–132 129

compromised by a lower efficiency of PCV2 entry or Cap proteinsusceptibility to serine proteases cleavage that occurs in theendosome-lysosome system upon infection (Misinzo et al., 2008).Although further comparative analysis of Cap protein-induced celldeath from different strains is needed, our data provide evidencethat cytotoxicity can be mapped to the Cap protein and can be citedas a virulence determinant for PCV2.

Cell death is not dictated by specific cap protein sub-localization

Given that i) PCV2 replicates in PK15 but not in 293T cells(Hattermann et al., 2004), ii) Cap protein is expressed in both PK15and 293T cells and iii) cell death is induced only in PK15 but not in293T cells prompted us to investigate whether the differencebetween PK15 and 293T cells observed with regard to cell deathis due to specific sub-cellular localization of Cap protein. The PK15and 293T transfected cells were collected, assessed for Cap proteinexpression by IFA and a difference in the Cap protein sub-cellularlocalization has been found between PK15 and 293T cells. Inter-estingly enough, Cap protein was localized preferentially in thenucleus of PK15 cells (Fig.6), whereas its expression was predo-minantly cytoplasmic in 293T cells (Fig.6). Next we sought to

analyze whether the nuclear localization of Cap protein wasassociated with cell death in PK15. For this purpose, we generateda construct to express a truncated form of Cap protein devoid ofNLS, this deletion will restrict the expression to the cytoplasm (Liuet al., 2001). Both PK15 and 293T were transfected with pCMV-HA-2bcap and pCMV-HA-ΔNLS-2bcap and analyzed for Cap pro-tein expression and cell death. Our data shows that the truncatedform of Cap was expressed in the cytoplasm, whereas the fulllength Cap protein was detected predominantly in the nucleus(Fig.7). Of note, the expression of Cap protein using pCMV-HA-2bcap and pCMV-HA-ΔNLS-2bcap constructs induce similar celldeath rate in transfected PK15 cells (Fig. 8), suggesting that thecell death in our cell model is not dictated by specific Cap proteincell localization. This seems also to be true for PCV2 infected cellspre or post-treated with IFN-γ. Although, a difference wasobserved in the cytoplasmic-to-nuclear Cap protein localizationratio between IFN-γ pre- or post-treated cells (1:11 vs. 1:5.6),similar induced-cell death rate has been observed. These datasuggest that Cap protein is capable of triggering different celldeath signaling pathways in PK15 cells. Studies have indeeddemonstrated Cap protein localization in the nucleoli, recognizedas a site for ribosome biogenesis, which also holds components

Fig. 6. Sub-cellular localization of Cap protein in PK15 and 293T cells. Recombinant construct with PCV2b-Cap under CMV promoter was transfected into PK15 and 293Tcells. Cells were collected 48 h and analyzed by IFA. Representative images of three independent experiments are shown. In PK15 cells the Cap is localized predominantly inthe nucleus (4Nn), whereas in 293T (4Cn) cells it is mostly cytoplasmic.

Fig. 7. Sub-cellular localization of Cap protein in PK15 under HA tag. (a) Full length PCV2bCap (HA-2b) and (b) truncated Cap without NLS (HA-ΔNLS-2b). Recombinantconstructs with full length PCV2b-Cap and PCV2b-Cap without NLS under HA tag and CMV promoter were transfected into PK15 cells. Cells were collected 48 h post-transfection and analyzed by IFA. The full length Cap protein is observed in different subcellular levels cytoplasm(Cn), nucleus (Nn) and also in the nucleolus (Nun) of somecells. In the absence of NLS the Cap is localized in the cytoplasm (Cn) alone.

R. Walia et al. / Virology 468-470 (2014) 126–132130

that play a role in executing active cell death (Horký et al., 2002).In addition, virus-like particles have been shown to interactwith the inner and outer membranes of mitochondria, the cellularorganelles intrinsically involved in the apoptotic pathway(Rodriguez-Cariño and Segalés, 2009; Rodríguez-Cariño et al.,2010).

We conclude that Cap protein individually expressed has theability to induce cell death in PK15 cells, and that effect mayaccount for nearly all the cell death observed in PCV2 infectedcells. The Cap protein's ability to cause cell death regardless whereit is expressed raises the possibility that cell death may betriggered in the nucleus by immature virions and enhanced bymature virions in the cytoplasm to promote the virus release.Although further investigation is needed to gain insights into thenature of the pathways involved in Cap-induced cell death, thisstudy provides the basis for future research regarding the role ofCap-induced cell death in PCV2 pathogenesis.

Acknowledgments

We thank Dr Carl Gagnon from University of Montreal (Quebec,Canada) for providing PCV2a and PCV2b DNA clones, Dr SabineGilch (University of Calgary, Calgary, Canada) for reviewing thismanuscript, and all the laboratory members. This work wassupported by the Alberta livestock Meat Agency (ALMA)(2011R016R), Canadian Swine Health Board (CSHB) and Universityof Calgary Faculty of Veterinary Medicine.

References

Allan, G.M., Mc Neilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Bøtner, A., Charreyre, C.E., 1999. Isolation andcharacterisation of circoviruses from pigs with wasting syndromes in Spain,Denmark and Northern Ireland. Vet. Microbiol. 66, 115–123.

Berens, H.M., Tyler, K.L., 2011. The proapoptotic Bcl-2 protein Bax plays animportant role in the pathogenesis of reovirus encephalitis. J. Virol. 85,3858–3871.

Blachon, S., Bellanger, S., Demeret, C., Thierry, F., 2005. Nucleo-cytoplasmicshuttling of high risk human Papillomavirus E2 proteins induces apoptosis. J.Biol. Chem. 280, 36088–36098.

Bolin, S.R., Stoffregen, W.C., Nayar, G.P., Hamel, A.L., 2001. Postweaning multi-systemic wasting syndrome induced after experimental inoculation of cesar-ean-derived, colostrum-deprived piglets with type 2 porcine circovirus. J. Vet.Diagn. Invest. 13, 185–194.

Chaiyakul, M., Hsu, K., Dardari, R., Marshall, F., Czub, M., 2010. Cytotoxicity of ORF3proteins from a nonpathogenic and a pathogenic porcine circovirus. J. Virol. 84,11440–11447.

Cheung, A.K., Bolin, S.R., 2002. Kinetics of porcine circovirus type 2 replication.Arch. Virol. 147, 43–58.

Chianini, F., Majó, N., Segalés, J., Domínguez, J., Domingo, M., 2003. Immunohisto-chemical characterisation of PCV2 associate lesions in lymphoid and non-lymphoid tissues of pigs with natural postweaning multisystemic wastingsyndrome (PMWS). Vet. Immunol. Immunopathol. 94, 63–75.

Darwich, L., Segalés, J., Domingo, M., Mateu, E., 2002. Changes in CD4(þ), CD8(þ),CD4(þ) CD8(þ), and immunoglobulin M-positive peripheral blood mono-nuclear cells of postweaning multisystemic wasting syndrome-affected pigsand age-matched uninfected wasted and healthy pigs correlate with lesionsand porcine circovirus type 2 load in lymphoid tissues. Clin. Diagn. Lab.Immunol. 9, 236–242.

Dvorak, C.M., Puvanendiran, S., Murtaugh, M.P., 2013. Cellular pathogenesis ofporcine circovirus type 2 infection. Virus Res. 174, 60–68.

Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F., Meng, X.J., 2004. Two aminoacid mutations in the capsid protein of type 2 porcine circovirus (PCV2)enhanced PCV2 replication in vitro and attenuated the virus in vivo. J. Virol.78, 13440–13446.

Finsterbusch, T., Mankertz, A., 2009. Porcine circoviruses–small but powerful. VirusRes. 143, 177–183.

Finsterbusch, T., Steinfeldt, T., Caliskan, R., Mankertz, A., 2005. Analysis of thesubcellular localization of the proteins Rep, Rep' and Cap of porcine circovirustype 1. Virology 343, 36–46.

Harreman, M.T., Kline, T.M., Milford, H.G., Harben, M.B., Hodel, A.E., Corbett, A.H.,2004. Regulation of nuclear import by phosphorylation adjacent to nuclearlocalization signals. J. Biol. Chem. 279, 20613–20621.

Hattermann, K., Roedner, C., Schmitt, C., Finsterbusch, T., Steinfeldt, T., Mankertz, A.,2004. Infection studies on human cell lines with porcine circovirus type 1 andporcine circovirus type 2. Xenotransplantation 11, 284–294.

Heilman, D.W., Teodoro, J.G., Green, M.R., 2006. Apoptin nucleocytoplasmicshuttling is required for cell type-specific localization, apoptosis, and recruit-ment of the anaphase-promoting complex/cyclosome to PML bodies. J. Virol.80, 7535–7545.

Horký, M., Kotala, V., Anton, M., Wesierska-Gadek, J., 2002. Nucleolus andapoptosis. Ann. N. Y. Acad. Sci. 973, 258–264.

Juhan, N.M., LeRoith, T., Opriessnig, T., Meng, X.J., 2010. The open reading frame 3(ORF3) of porcine circovirus type 2 (PCV2) is dispensable for virus infection butevidence of reduced pathogenicity is limited in pigs infected by an ORF3-nullPCV2 mutant. Virus Res. 147, 60–66.

Krakowka, S., Allan, G., Ellis, J., Hamberg, A., Charreyre, C., Kaufmann, E., Brooks, C.,Meehan, B., 2012. A nine-base nucleotide sequence in the porcine circovirustype 2 (PCV2) nucleocapsid gene determines viral replication and virulence.Virus Res. 164, 90–99.

Ladekjaer-Mikkelsen, A.S., Nielsen, J., Stadejek, T., Storgaard, T., Krakowka, S., Ellis, J.,McNeilly, F., Allan, G., Bøtner, A., 2002. Reproduction of postweaning multi-systemic wasting syndrome (PMWS) in immunostimulated and non-immunostimulated 3-week-old piglets experimentally infected with porcinecircovirus type 2 (PCV2). Vet. Microbiol. 89, 97–114.

Levine, B., Deretic, V., 2007. Unveiling the roles of autophagy in innate and adaptiveimmunity. Nat. Rev. Immunol. 7, 767–777.

Liu, J., Chen, I., Kwang, J., 2005. Characterization of a previously unidentified viralprotein in porcine circovirus type 2-infected cells and its role in virus-inducedapoptosis. J. Virol. 79, 8262–8274.

Liu, Q., Tikoo, S.K., Babiuk, L.A., 2001. Nuclear localization of the ORF2 proteinencoded by porcine circovirus type 2. Virology 285, 91–99.

Matsuzawa, T., Fujiwara, E., Washi, Y., 2014. Autophagy activation by interferon-γvia the p38 mitogen-activated protein kinase signalling pathway is involved inmacrophage bactericidal activity. Immunology 141, 61–69.

Meerts, P., Misinzo, G., Nauwynck, H.J., 2005. Enhancement of porcine circovirus2 replication in porcine cell lines by IFN-gamma before and after treatment andby IFN-alpha after treatment. J. Interferon Cytokine Res. 25, 684–693.

Misinzo, G., Delputte, P.L., Nauwynck, H.J., 2008. Inhibition of endosome-lysosomesystem acidification enhances porcine circovirus 2 infection of porcine epithe-lial cells. J. Virol. 82, 1128–1135.

Nawagitgul, P., Harms, P.A., Morozov, I., Thacker, B.J., Sorden, S.D., Lekcharoensuk,C., Paul, P.S., 2002. Modified indirect porcine circovirus (PCV) type 2-based andrecombinant capsid protein (ORF2)-based enzyme-linked immunosorbentassays for detection of antibodies to PCV. Clin. Diagn. Lab. Immunol. 9, 33–40.

Ramamoorthy, S., Huang, F.F., Huang, Y.W., Meng, X.J., 2009. Interferon-mediatedenhancement of in vitro replication of porcine circovirus type 2 is influenced byan interferon-stimulated response element in the PCV2 genome. Virus Res. 145,236–243.

Rodriguez-Cariño, C., Segalés, J., 2009. Ultrastructural findings in lymph nodes frompigs suffering from naturally occurring postweaning multisystemic wastingsyndrome. Vet. Pathol. 46, 729–735.

Rodríguez-Cariño, C., Sánchez-Chardi, A., Segalés, J., 2010. Subcellular immunolo-calization of porcine circovirus type 2 (PCV2) in lymph nodes from pigs withpost-weaning multisystemic wasting syndrome (PMWS). J. Comp. Pathol. 142,291–299.

Sarli, G., Mandrioli, L., Laurenti, M., Sidoli, L., Cerati, C., Rolla, G., Marcato, P.S., 2001.Immunohistochemical characterisation of the lymph node reaction in pigpost-weaning multisystemic wasting syndrome (PMWS). Vet. Immunol. Immu-nopathol. 83, 53–67.

Fig. 8. Cell death of cytoplasmic versus nuclear expression of 2bcap in PK15. Cellswere transfected with full length Cap-ORF (PCV2b) and truncated cap (ΔNLS-PCV2b) under HA tag. Cells were collected 48 h after transfection and stained usingmolecular probess live/deads fixable dead cell stain kits (Invitrogen) followed by astaining for Cap protein expression. Values that are significantly different (Po0.05)from the values for negative controls, e.g., mock- or empty vector controls (n) areindicated above the bars.

R. Walia et al. / Virology 468-470 (2014) 126–132 131

http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref1http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref1http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref1http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref1http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref2http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref2http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref2http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref3http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref3http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref3http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref4http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref4http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref4http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref4http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref5http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref5http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref5http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref6http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref6http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref7http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref7http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref7http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref7http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref8http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref9http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref9http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref10http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref10http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref10http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref10http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref11http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref11http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref12http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref12http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref12http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref13http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref13http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref13http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref14http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref14http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref14http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref15http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref15http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref15http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref15http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref16http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref16http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref17http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref17http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref17http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref17http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref18http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref18http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref18http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref18http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref19http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref19http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref19http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref19http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref19http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref20http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref20http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref21http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref21http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref21http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref22http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref22http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref23http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref23http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref23http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref23http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref24http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref24http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref24http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref25http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref25http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref25http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref26http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref26http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref26http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref26http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref27http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref27http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref27http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref27http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref28http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref28http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref28http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref29http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref29http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref29http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref29http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref30http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref30http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref30http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref30

Shibahara, T., Sato, K., Ishikawa, Y., Kadota, K., 2000. Porcine circovirus induces Blymphocyte depletion in pigs with wasting disease syndrome. J. Vet. Med. Sci.62, 1125–1131.

Sibinga, N.E., Wang, H., Perrella, M.A., Endege, W.O., Patterson, C., Yoshizumi, M.,Haber, E., Lee, M.E., 1999. Interferon-gamma-mediated inhibition of cyclin Agene transcription is independent of individual cis-acting elements in thecyclin A promoter. J. Biol. Chem. 274, 12139–12146.

Tang, Q., Li, S., Zhang, H., Wei, Y., Wu, H., Liu, J., Wang, Y., Liu, D., Zhang, Z., Liu, C.,2013. Correlation of the cyclin A expression level with porcine circovirus type2 propagation efficiency. Arch. Virol. 158, 2553–2560.

Timmusk, S., Fossum, C., Berg, M., 2006. Porcine circovirus type 2 replicase bindsthe capsid protein and an intermediate filament-like protein. J. Gen. Virol. 87,3215–3223.

Valledor, A.F., Sánchez-Tilló, E., Arpa, L., Park, J.M., Caelles, C., Lloberas, J., Celada, A.,2008. Selective roles of MAPKs during the macrophage response to IFN-gamma.J. Immunol. 180, 4523–4529.

Wei, L., Zhu, Z., Wang, J., Liu, J., 2009. JNK and p38 mitogen-activated protein kinasepathways contribute to porcine circovirus type 2 infection. J. Virol. 83,6039–6047.

Zhu, B., Xu, F., Li, J., Shuai, J., Li, X., Fang, W., 2012. Porcine circovirus type 2 exploresthe autophagic machinery for replication in PK-15 cells. Virus Res. 163,476–485.

R. Walia et al. / Virology 468-470 (2014) 126–132132

http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref31http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref31http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref31http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref32http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref32http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref32http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref32http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref33http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref33http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref33http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref34http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref34http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref34http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref35http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref35http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref35http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref36http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref36http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref36http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref37http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref37http://refhub.elsevier.com/S0042-6822(14)00368-7/sbref37

Porcine circovirus-2 capsid protein induces cell death in PK15 cellsIntroductionMaterials and methodsGeneration of recombinant eukaryotic expression vectorsCell cultureInfection and transfectionFlow cytometry-based intracellular staining of the cap expressionCell cytotoxicity analysisImmunofluorescence assay (IFA)Statistical analysis

Results and discussionIFN-γ enhances PCV2 replication that leads to cell death in PK15 cellsIFN-γ enhances nuclear localization of the PCV2 cap proteinPCV2-cap protein expression induces cell deathCell death is not dictated by specific cap protein sub-localization

AcknowledgmentsReferences