Platelet-Derived Growth Factor Receptor Constitutive Activity Promotes Angiogenesis In Vivo and In Vitro

Platelet-Derived Growth Factor Receptor-� ConstitutiveActivity Promotes Angiogenesis In Vivo and In Vitro

Peetra U. Magnusson, Camilla Looman, Aive Åhgren, Yan Wu,Lena Claesson-Welsh, Rainer L. Heuchel

Objective—Knockout studies have demonstrated crucial roles for the platelet-derived growth factor-B and its cognatereceptor, platelet-derived growth factor receptor-� (PDGFR-�), in blood vessel maturation, that is, the coverage ofnewly formed vessels with mural cells/pericytes. This study describes the consequences of a constitutively activatingmutation of the PDGFR-� (PdgfrbD849V) introduced into embryonic stem cells with respect to vasculogenesis/angiogenesis in vitro and in vivo.

Methods and Results—Embryonic stem cells were induced to either form teratomas in vivo or embryoid bodies, an in vitromodel for mouse embryogenesis. Western blotting studies on embryoid bodies showed that expression of a single alleleof the mutant Pdgfrb led to increased levels of PDGFR-� tyrosine phosphorylation and augmented downstream signaltransduction. This was accompanied by enhanced vascular development, followed by exaggerated angiogenic sproutingwith abundant pericyte coating as shown by immunohistochemistry/immunofluorescence. PdgfrbD849V/� embryoid bodieswere characterized by increased expression of vascular endothelial growth factor (VEGF)-A and VEGF receptor-2;neutralizing antibodies against VEGF-A/VEGF receptor-2 blocked vasculogenesis and angiogenesis in mutant embryoidbodies. Moreover, PdgfrbD849V/� embryonic stem cell–derived teratomas in nude mice were more densely vascularizedthan wild-type teratomas.

Conclusion—Increased PDGFR-� kinase activity is associated with elevated expression of VEGF-A and VEGFreceptor-2, acting directly on endothelial cells and resulting in increased vessel formation. (Arterioscler Thromb VascBiol. 2007;27:2142-2149.)

Key Words: PDGF � PDGF receptor � signal transduction � embryonic stem cells � endothelial cells� vasculogenesis � angiogenesis

Platelet-derived growth factor (PDGF) describes a heparin-binding, heterodimerizing or homodimerizing family of

polypeptide growth factors denoted A, B, C, and D with a broadrange of target cells, notably mesoderm-derived cells, such aspericytes, glia cells, and mesangial cells (reviewed in References1 and 2). The PDGF isoforms bind to 2 distinct class III receptortyrosine kinases, PDGF receptor (PDGFR)-� and -�, whichdisplay a nonoverlapping expression pattern (reviewed in Ref-erence 3). Binding of dimeric ligand leads to autophosphoryla-tion of the receptors on tyrosine residues. This, in turn, allowsthe docking and activation of several downstream signalingmolecules, the net signaling outcome of which dictates thecellular response. For example, the binding of Grb2/Sos resultsin proliferation by activating the Ras/extracellular signal-regulated kinase (Erk)1/2 pathway, whereas the binding ofphosphatidylinositol 3-kinase activates actin cytoskeletal rear-rangements (migration and contraction), mainly via the smallGTPase Rac, as well as antiapoptotic signaling via the serine/

threonine kinase Akt (reviewed in Reference 1). Recently,mutations of a conserved aspartic acid residue in the activationloop of a number of class III receptor tyrosine kinases leading toligand-independent receptor activation have been observed inseveral human tumors (for a review, see Reference 4 andreferences in Reference 5). In gastrointestinal stromal tumors,for example, mutation of the aspartic acid residue at amino acidposition 842 for valine was detected in the highly homologousPdgfra.6 With the initial goal to generate an oncogenic mousemodel based on hyperactive PDGFR-� signaling, we introducedthe corresponding mutation (D849V) into the Pdgfrb. Embry-onic stem (ES) cells carrying this mutation, however, did noteven generate viable chimeric offspring, indicating a dominantlethal phenotype and the possibility that constitutive activationof the PDGFR-� was incompatible with ES cell pluripotency.

Pdgfb and Pdgfrb knockout experiments have pointedtoward a critical role for PDGF signaling in the establishmentof functional blood vessels by recruiting stabilizing mural

Original received December 15, 2006; final version accepted July 13, 2007.From the Department of Genetics and Pathology, Rudbeck Laboratory (P.U.M., L.C.-W.), and Ludwig Institute for Cancer Research (C.L., A.A.,

R.L.H.), Uppsala University, Uppsala, Sweden; Department of Experimental Therapeutics (Y.W.), ImClone Systems Incorporated, New York, NY.P.U.M. and C.L. contributed equally to this work.Correspondence to Rainer L. Heuchel, Ludwig Institute for Cancer Research, Uppsala University, BMC, Box 595, 751 24 Uppsala, Sweden. E-mail

[email protected]© 2007 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol. is available at http://atvb.ahajournals.org DOI: 10.1161/01.ATV.0000282198.60701.94

2142 by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

cells to the developing blood vessel (reviewed in Reference7). However, the role of PDGF/PDGFR-� during earlyvascular development has remained unexplored. In themouse, vascular development ensues around embryonic day7.5 by the establishment of blood islands in the yolk sac.These structures contain common hematopoietic/endothelialprecursor cells. The endothelial precursors differentiatethrough a process, denoted “vasculogenesis,” resulting in theformation of a primitive vascular plexus that is subsequentlypruned and reorganized through angiogenesis.8 These andslightly later stages of vascular development are faithfullymimicked in aggregates of differentiating stem cells calledembryoid bodies.9,10 Both vasculogensis and angiogenesisrequire the function of vascular endothelial growth factor(VEGF)-A and its receptors VEGF receptor (VEGFR)-1 and-2 in vivo and in vitro (reviewed in Reference 11). Geneinactivation of Vegfa as well as Vegfr2 leads to a halt invascular development and embryonic death. A similar re-quirement for intact VEGF-A/VEGFR-2 function has beendemonstrated in differentiating embryoid bodies.9,12,13 In thepresent study, we show that ES cells carrying a single alleleof the constitutive active D849V PDGFR-� are biased towardincreased vessel development in vitro and in vivo.

MethodsKnock-In of D849V Into ES CellsFor detailed information on the construction of the targeting vectorcontaining the codon exchange for amino acid 849 from aspartic acidto valine and the generation of targeted ES cells, please see theSupplemental Data online at http://atvb.ahajournals.org.

ES Cell Culture and AnalysesES cells were cultured on mitomycin-C–treated feeders in thepresence of leukemia inhibitory factor. Differentiation was inducedby removal of leukemia inhibitory factor and aggregation of cells inhanging drops. Embryoid bodies were flushed down on day 4 andused for continued culture on glass slides or in collagen gels,followed by immunohistochemical or immunofluorescent staining.For detailed description of methodology, please refer to the Supple-mental Data.

Generation and Analysis of TeratomasVasculogenic and angiogenic properties of wild-type and mutant EScells were examined after teratoma formation of ES cells in nudemice. Animal handling was performed with ethical permissionapproved by the Uppsala University Board of Animal Experimenta-tion. For further details, please refer to the Supplemental Data.

ResultsIntroduction of a Gain of Function Mutation IntoPdgfrb by Gene TargetingA gain-of-function mutation was introduced into the activa-tion loop of the Pdgfrb by changing the highly conservedaspartic acid at amino acid position 849 for valine (D849V)using the targeting vector depicted in Figure 1. The linearizedtargeting construct was electroporated into GS-1 ES cells.Correctly recombined clones were identified, and the pres-ence of the point mutation was confirmed by DNA sequenc-ing of PCR-amplified genomic DNA (data not shown).

Two independent PdgfrbD849V/� ES cell clones (D/V-1 andD/V-2) were used for repeated blastocyst injections. In total,

345 blastocysts injected with either of the 2 mutant ES celllines (290 D/V-1 or 55 D/V-2) were transferred into fostermothers without generating viable coat chimeras (data notshown). A correctly targeted (neo cassette in the correctposition) but otherwise wild-type ES cell clone from the sameelectroporation as the 2 mutant clones was injected in paralleland resulted in germline transmission at high frequency. Thisproved the high quality of the original ES cell line andindicated that introduction of the activating D849V mutationinto 1 Pdgfrb allele alone was incompatible with embryonicdevelopment.

The D849V Mutation Confers Increased PDGFR-�Kinase Activity In VitroBecause the PdgfrbD849V/� ES cells did not generate viablecoat chimeras, we decided to use the well-established in vitro

Figure 1. Characterization of the D849V PDGFR-� in differenti-ated ES cells. A, The intron/exon structure of the mouse Pdgfrbis schematically represented before (A�) and after (C�) homolo-gous recombination using the targeting vector depicted in B�.*D849V point mutation in exon 17. B, PDGFR-� protein levelsand extent of phosphorylation at tyrosine 856 determined from awild-type (Wt) and 2 PdgfrbD849V/� clones (D/V-1 and D/V-2) inthe absence (Basal) or presence of 50 ng/mL of PDGF-BB for10 minutes before lysis. Values above lanes indicate the specificphosphorylation of the PDGFR-� (pPDGFR-�/PDGFR-�). �-Actinwas used as a loading control. C, Analyses of Erk1/2 phosphor-ylation levels in wild-type and mutant embryoid bodies (D/V-1and D/V-2) under basal or stimulated conditions as in B. Thedata in B and C are representative for 1 of at least 4 individuallyperformed experiments.

Magnusson et al Constitutive PDGFR-� Kinase Activity in Stem Cells 2143

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

differentiation of ES cells into embryoid bodies for furtherstudies (reviewed in Reference 14 and Jakobsson et al.). Thissystem elegantly allows the investigation of otherwise lethalmutations with respect to early embryonic development andbiochemical consequences.

First, the expression of PDGFR-� protein, as well as thereceptor activity, estimated by the extent of tyrosine auto-phosphorylation, was compared between the mutant andwild-type ES cell clones. For this purpose, ES cells wereaggregated in the absence of leukemia inhibitory factor tocreate embryoid bodies that were cultured for 8 days beforeanalysis. Under basal conditions, there was a 4- to 5-foldincrease in the level of tyrosine-phosphorylated PDGFR-� inthe mutant embryoid bodies (Figure 1B). Both mutant andwild-type embryoid bodies retained responsiveness to exog-enous short-term stimulation with PDGF-BB as demonstratedby a further increase in receptor phosphorylation (Figure 1B).

To test whether the ligand-independent activity of theD849V receptor affected the basal activity level (ie, in theabsence of exogenous growth factor) of known downstreamtargets, we analyzed the phosphorylation status of Erk1/2. Asshown in Figure 1C, Erk1/2 phosphorylation was increasedby 2-fold in the PdgfrbD849V/� embryoid bodies compared withwild-type embryoid bodies. Moreover, mutant embryoid bod-ies responded to exogenous PDGF-BB with a further increasein phosphorylation of Erk1/2, the final levels of which weresimilar to those of the PDGF-BB-treated wild-type embryoidbodies. A similar although weaker tendency was also seen forAkt, with slightly increased basal phosphorylation in themutant embryoid bodies and a further increase in response toPGDF-BB (data not shown). Collectively, these data demon-strated that the D849V mutation of the PDGFR-� conferredincreased kinase activity and enhanced downstream signaltransduction in the absence of exogenous ligand in differen-tiating mouse ES cells.

Increased PDGFR-� Kinase Activity Is CoupledWith Increased Vascularization ofEmbryoid BodiesTo examine the influence of increased PDGFR-� kinaseactivity on vascular development, embryoid body cultureswere kept under basal conditions, or supplemented with theexogenous growth factors VEGF-A or PDGF-BB, as indi-cated, for 8 days. Interestingly, staining for expression of thevascular marker CD31 identified abundant vessel formationin the mutant clones even in the absence of exogenous growthfactors (basal; Figure 2A). In contrast, the wild-type embry-oid bodies lacked clear vessel structures and contained onlypoorly developed central blood islands, as one would expectin the absence of vasculogenic/angiogenic growth factors.The quantification of the length of vessel structures andvessel area in wild-type and PdgfrbD849V/� (D/V-1 and D/V-2)embryoid bodies under basal and growth factor–inducedconditions (Figure 2B and 2C) indicated that the mutant EScell clones were characterized by a very high inherentvasculogenic activity, which could not be further increased byPDGF-BB stimulation. Moreover, whereas addition of VEGFincreased the vessel area nearly 4-fold in wild-type embryoidbodies, there was no further increase recorded for the D/V-1

and -2 mutant embryoid bodies compared with respectivebasal. Vessel length increased 3-fold with the VEGF additionto wild-type embryoid bodies; there was also a slight furtherincrease in the mutant embryoid bodies. These data demon-strated that expression of only 1 copy of the D849V receptorwas sufficient to initiate vascular development and formationof vessels in this in vitro differentiation system.

Differentiating PdgfrbD849V/� Embryoid Bodies AreCharacterized by Increased Expression ofVEGF-A, VEGFR-2, and RGS5To find a molecular explanation for the increased vasculo-genesis and angiogenesis conferred by the D849V receptor,the expression levels of the hematopoietic markers CD41 andTal-1, the vascular/endothelial markers CD31, VEGFR-2,VE-cadherin, and VEGF-A, as well as the mural cell markersRGS5, �-SMA, and PDGFR-�, were analyzed. A strikingconsequence of the PDGFR-� mutation was the increase inVegfa and Rgs5 transcript levels (Figure 3A). Moreover, themRNA levels of Tal-1 and Cd41 were markedly decreased indifferentiating PdgfrbD849V/� ES cells. In contrast, introductionof the D849V Pdgfrb did not affect the transcript levels ofCd31, VE-cadherin, Vegfr2, �-SMA, and the Pdgfrb itself.These data indicated that the production of endogenousVEGF-A and RGS5 were increased as a result of theactivating mutation of the PDGFR-� and, furthermore, thatthe mutation also affected mesodermal differentiation asjudged from the decrease in Tal-1 and CD41 transcript levels.

The expression of a number of receptors, includingVEGFR-2, have been found to be positively regulated by itscorresponding ligand.15,16 We, therefore, analyzed the expres-sion of VEGFR-2 in lysates from wild-type and PdgfrbD849V/�

embryoid bodies at day 8. The relative protein levels ofVEGFR-2 were slightly increased in the PdgfrbD849V/� embry-oid bodies, whereas the relative protein levels of VE-cadherinwere unchanged (Figure 3B). Furthermore, VEGFR-2 proteinexpression may be stabilized in a manner dependent on thepresentation of VEGF, which could contribute to the relativeincrease in VEGFR-2 expression in PdgfrbD849V/�-mutantcells.17

The elevated expression of the endothelial mitogenVEGF-A and its cognate receptor VEGFR-2 could be aplausible mechanism to explain the provascular phenotype ofthe PdgfrbD849V/� embryoid bodies. In agreement with thisidea, we found that neutralizing antibodies against VEGF-Aor VEGFR-2 essentially attenuated vascularization of thePdgfrbD849V/� embryoid bodies (Figure 3C and 3D).

Increased Angiogenic Sprouting and PericyteCoating by PdgfrbD849V/� ES CellsWe and others have previously described that embryoidbodies cultured in 3D collagen gels respond to exogenousVEGF-A by forming angiogenic, pericyte-covered sproutsinvading 3D collagen gels.17–19 The extent of sprouting of thePdgfrbD849V/� embryoid bodies, exemplified by the cloneD/V-1, was �3-fold increased compared with wild-typeembryoid bodies (Figure 4).

Pdgfrb gene inactivation results in decreased pericytecoating in vivo20,21 and in vitro.22 We, therefore, examined

2144 Arterioscler Thromb Vasc Biol. October 2007

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

sprouts from wild-type and PdgfrbD849V/� embryoid bodieswith a mixture of antibodies directed against 3 differentvascular smooth muscle cell markers (�-SMA, NG2, anddesmin). Angiogenic sprouts from the PdgfrbD849V/� embryoidbodies were, to a large extent, associated with mural cellswith a morphology resembling that of pericytes, whereas thecoverage was 2-fold lower in the wild-type embryoid body–derived sprouts (Figure 5). Thus, the gain-of-function pheno-type (enhanced PDGFR-� activity correlated with a moredense pericyte coating) corroborated the previously describedloss-of-function phenotype of Pdgfrb knockout animals (lossof PDGFR-� activity correlated with reduced pericytecoating).

Teratomas Generated From PdgfrbD849V/� ES CellsDisplay a Significantly Increased VascularizationThe subcutaneous injection of ES cells into nude mice resultsin the formation of benign tumors (teratomas) containing

differentiated structures of endodermal, mesodermal, andectodermal origin, as expected from such ectopic anatomicplacement of ES cells.23,24 We used this strategy to investi-gate the influence of the D849V PDGFR-� on the differen-tiation potential of ES cells in a complex in vivo environment.No qualitative differences between wild-type and PdgfrbD849V/�

ES cells, with respect to their differentiation into tissuesderived from the 3 germ layers, were detected (Figure S1).However, morphometric analysis identified a 2-fold largervessel area (vessel area per millimeter squared) in PdgfrbD849V/�

ES cell–derived teratomas compared with wild-type EScell–derived teratomas (Figure 6).

DiscussionIn the present work, we describe the effects of a gain-of-function mutation (D849V) of the PDGFR-�. ES cells het-erozygous for this mutation were unable to develop into

Figure 2. Increased vessel formation inPdgfrbD849V/� embryoid bodies. A, Embry-oid bodies created from wild-type (Wt)and PdgfrbD849V/�ES cell clones (D/V-1and D/V-2) were stained for expressionof CD31 to visualize endothelial vesselformation in the absence (Basal) or pres-ence of VEGF-A (30 ng/mL) or PDGF-BB(20 ng/mL) at day 8. Inserts show detailsof vessel structures at a higher magnifi-cation. Bars, 100 �m. Quantification ofCD31-positive length (B) and area (C) inwild-type and PdgfrbD849V/� (D/V-1 andD/V-2) embryoid bodies under basal andgrowth factor–induced conditions. All ofthe calculated values are set in relationto wild-type at the respective condition *and ** indicate significant difference(P�0.005) and (P�0.0001), respectively,between wild-type and D/V-mutantclones at the corresponding conditions.

Magnusson et al Constitutive PDGFR-� Kinase Activity in Stem Cells 2145

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

viable coat chimeras after blastocyst injection, indicating adominant lethal effect of the mutant allele. The consequencesof this hyperactive mutation on early embryonic developmentare unclear at this moment (Looman et al). In the highlyrelated Pdgfra, the homologous mutation has recently beenidentified in gastrointestinal stromal tumors, where it resultedin ligand-independent activity of the receptor.6 Interestingly,this particular mutation was never found as a germlinemutation, indicating that it is probably not compatible withembryonic development, similar to what we experienced withthe corresponding mutation in the Pdgfrb. It is, thus, conceiv-able, that the mutation restricts the differentiation potential ofthe otherwise pluripotent ES cells. To analyze the effect ofthe D849V mutation, we differentiated mutant ES cells into

embryoid bodies, which undergo a program of differentiationreminiscent of early embryogenesis.

In cell lysates of nonstimulated PdgfrbD849V/� embryoidbodies, we observed a significantly increased tyrosine phos-phorylation of the major autophosphorylation site (Y856)indicative of increased PDGFR-� kinase activity. This prop-erty translated into elevated Erk1/2 phosphorylation underthese conditions but not when PDGF-BB–stimulated wild-type and PdgfrbD849V/� embryoid bodies were compared,emphasizing especially the increased basal activity of themutant PDGFR-� kinase (Figure 1B and 1C). Similar obser-vations have been made in patient material from gastrointes-tinal stromal tumors carrying the corresponding D842VPdgfra.6 This indicates that the exchange of the conserved

Figure 3. Transcript and protein levels in embryoid bodies and effects of neutralizing antibodies against VEGF-A and VEGFR-2. A,mRNA expression profiles of hematopoietic and vascular marker genes assessed by real-time RT-PCR in unstimulated embryoid bod-ies at day 8 of differentiation. The ratio of test transcript/�-actin transcript levels from wild-type embryoid bodies was set to 1. B, Quan-tification of endothelial markers VEGFR-2 and VE-cadherin by immunoblotting. �-Catenin was used as internal control for equal proteinloading/quantification. One representative of 4 experiments is shown. C, PdgfrbD849V/� embryoid bodies under basal conditions weretreated with rat IgG control serum or neutralizing antibodies against VEGF-A (�-VEGF-A) or VEGFR-2 (�-VEGFR-2) between day 6 and8 of differentiation. Inserts show details of vessel structures at a higher magnification. Bars, 100 �m. D, Quantification of the CD31-positive area of control and neutralizing antibody–treated PdgfrbD849V/� embryoid bodies. *Significant difference between control andVEGF-A/VEGFR-2 neutralization (P�0.0042 for VEGF-A and P�0.0001 for VEGFR-2).

2146 Arterioscler Thromb Vasc Biol. October 2007

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

aspartic acid for valine in the activation loop of the kinasedomain transforms both the PDGFR-� and the PDGFR-� intoligand-independent tyrosine kinases with augmented down-stream signaling. Interestingly, Erk1/2, as well as Akt, whichalso showed increased basal phosphorylation in mutant em-bryoid bodies (data not shown), have both been found toinduce VEGF-A expression in Ras-transformed fibroblastsand epithelial cells, respectively.25

VEGF-A and its cognate receptor VEGFR-2 are bothessential for vascular development in vivo and in vitro.9,10,26–28

It was, therefore, surprising that embryoid bodies derivedfrom PdgfrbD849V/� ES cells developed abundant vascularplexi in the absence of VEGF-A stimulation, which wasessential for vascularization of wild-type embryoid bodies(Figure 2).9,22 We identified elevated Vegfa mRNA expres-sion and increased levels of VEGFR-2 protein in mutantembryoid bodies as candidates to explain the increasedvasculogenic propensity of the PdgfrbD849V/� ES cells (Figure3A and 3B). This notion was strongly supported by the effectsof neutralizing antibodies against VEGF-A or VEGFR-2,which dramatically reduced the ability of mutant ES cells todevelop a vascular plexus (Figure 3C and 3D). Interestingly,blocking VEGFR-2 had a much more complete effect thanblocking VEGF-A. This might be a result of blocking the

effects of several ligands to VEGFR-2, such as VEGF-C and-D, which, in their processed forms, may bind to VEGFR-2(reviewed in Reference 11). Furthermore, VEGF-C has beenshown to induce heterodimers between VEGFR-2 and

Figure 6. Teratomas derived from PdgfrbD849V/� ES cells arecharacterized by increased vascularization. A, Sections fromPDGFR-� wild-type (Wt) and PdgfrbD849V/� (D/V-1) teratomaswere immunostained with antibodies against CD31 to visualizethe blood vessel compartment. B, The total area covered byvessels and the number of vessels was significantly increased inPdgfrbD849V/� teratomas (*P�0.05 in both cases), whereas theaverage vessel perimeter was slightly decreased compared withwild-type teratomas (*P�0.05).

Figure 4. Enhanced invasion of angiogenic sprouts in collagengel by PdgfrbD849V/� embryoid bodies. Wild-type (Wt) embryoidbodies (A) cultured in collagen I from day 4 to day 10 in thepresence of VEGF-A showed fewer CD31-positive sprouts (red)invading the collagen gel compared with PdgfrbD849V/� (D/V-1)embryoid bodies (B). Right panel shows details of CD31-positivesprouts at higher magnification. Bars, 100 �m. C, Quantificationof CD31-positive sprouts in wild-type and D/V-1 embryoid bod-ies. *P�0.008.

Figure 5. Angiogenic sprouts from PdgfrbD849V/� embryoid bod-ies cultured in collagen I display increased pericyte coverage. A,Pericytes were visualized using a mixture of antibodies recog-nizing the pericyte markers �-SMA, NG2, and desmin (green).Endothelial cells appear in red (CD31 staining) and nuclei in blue(4�,6-diamidino-2-phenylindole). Bars, 25 �m. B, The amount of�-SMA/NG2/desmin-positive cells associated with CD31-positive sprouts was significantly increased (*P�0.0001) in thePdgfrbD849V/� embryoid bodies.

Magnusson et al Constitutive PDGFR-� Kinase Activity in Stem Cells 2147

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

VEGFR-3,29 which also would be blocked as a consequenceof VEGFR-2 neutralization. As expected from the increasedVEGF-A/VEGFR-2 expression, we found enhanced angio-genic activity of the mutant ES cells in a 3D collagen assayfor vascular sprouting (Figure 4). Moreover, sprouts frommutant embryoid bodies were more densely covered by muralcells/pericytes (Figure 5). In accordance, the transcript levelfor Rgs5, a member of the RGS family of GTPase-activatingproteins, was 2-fold increased in mutant embryoid bodies(Figure 3A). RGS5 has been identified as a marker fordifferentiating pericytes, which is dramatically downregu-lated in pericyte-deficient Pdgfb and Pdgfrb null embryos.30

The increased vasculo/angiogenic activity might, however,not only be based on the increased production of VEGF-A.We demonstrated recently that PDGF-BB stimulation ofPDGFR-�–expressing early hematopoietic/endothelial pre-cursor cells (hemangioblasts) resulted in increased endothe-lial cell lineage commitment and restricted differentiation ofhematopoietic precursors.22 Using a mouse model with asimilar but weaker and, thus, viable activating mutation in thePdgfrb (D849N), we observed increased vascular remodelingand reduced numbers of CD41-positive hematopoietic cells inhomozygous mutant yolk sacs compared with wild-type yolksacs.5,22 We, therefore, suggest that also the ligand-independent activity of the D849V PDGFR-� leads to adevelopmental shift toward endothelial cell commitment atthe expense of hematopoietic differentiation. This hypothesisis strongly supported by the fact that expression of D849VPDGFR-� was accompanied by marked decrease in expres-sion of Tal-1 and Cd41 (Figure 3A). Tal-1, a basic helix-loop-helix transcription factor expressed in erythroid, my-eloid, megakaryocytic, and hematopoietic stem cells, iscritical in embryonic hematopoietic development, and itsgene inactivation leads to developmental arrest at the heman-gioblastic stage. CD41 (corresponding with the � subunit ofthe �IIb�3 intergrin complex), a putative target gene for Tal-1,is a classical megacaryocyte/platelet-specific marker.31–33

The PDGFR-� has been identified as an important drugtarget in tumor therapy because of the fact that PDGF-BB issecreted by many solid tumors, PDGFR-� is expressed onendothelial cells of certain tumors, and capillaries in mostsolid tumors are surrounded by PDGFR-� expressing tumorpericytes (reviewed in Reference 34). To address the conse-quence of the hyperactive D849V PDGFR-� in an embryonictumor model, ES cells were grown subcutaneously in nudemice to create teratomas. We found that teratomas induced byPdgfrbD849V/� ES cells displayed a significantly increasedvascularization (Figure 6), supporting our in vitro data.However, in contrast to these, we did not observe increasedpericyte coating of vessels in PdgfrbD849V/� teratomas, nor didwe detect increased Vegfa mRNA levels in PdgfrbD849V/�

versus wild-type teratoma tissues (data not shown). Themechanistic interpretation of increased vascularization inmutant teratomas is complicated by the fact that vessels in thetumors are likely of mixed origin (ie, both host and ES cellderived). In general, teratomas are highly complex structuresmade up of many different cell and tissue types comparedwith the relatively well-defined in vitro culture system ofembryoid bodies. Interestingly however, we found slightly

increased Cd31, �-SMA, and Rgs5 mRNA levels and �5-folddecreased levels of Cd41 mRNA in PdgfrbD849V/� teratomatissues (data not shown). This observation would support thenotion of a narrowly defined developmental shift of earlyhematopoietic/endothelial precursor cells toward an endothe-lial cell lineage commitment without affecting the generaldifferentiation of the mutant ES cells into other cell lineagesderived from the 3 germ layers (Figure S1).

We, therefore, hypothesize that the increased vasculogenic/angiogenic activity of the PdgfrbD849V/� ES cells would, depend-ing on the cellular/environmental context, result from in-creased angiogenic VEGF signaling or increased endothelialcell commitment because of ligand-independent, constitutivesignaling by the mutant PDGFR-�.

AcknowledgmentsWe thank the Uppsala and Umeå Transgenic Facilities for ES cellelectroporation and blastocyst injections/transfers and ImClone foranti-VEGFR-2 antibodies.

Sources of FundingThis study was supported by funds from the Swedish Cancer Society(project No. 3820-B04-09XAC) and the Swedish Research Council(project No. K2005-32X-12552-08A) for L.C.-W. and by LudwigInstitute for Cancer Research for C.L., A.Å., and R.L.H.

DisclosuresY.W. is an employee of ImClone Systems Inc.

References1. Heldin CH, Westermark B. Mechanism of action and in vivo role of

platelet-derived growth factor. Physiol Rev. 1999;79:1283–1316.2. Fredriksson L, Li H, Eriksson U. The PDGF family: four gene products

form five dimeric isoforms. Cytokine Growth Factor Rev. 2004;15:197–204.

3. Tallquist M, Kazlauskas A. PDGF signaling in cells and mice. CytokineGrowth Factor Rev. 2004;15:205–213.

4. Jones AV, Cross NC. Oncogenic derivatives of platelet-derived growthfactor receptors. Cell Mol Life Sci. 2004;61:2912–2923.

5. Chiara F, Goumans MJ, Forsberg H, Ahgren A, Rasola A, Aspenstrom P,Wernstedt C, Hellberg C, Heldin CH, Heuchel R. A gain of functionmutation in the activation loop of platelet-derived growth factor beta-receptor deregulates its kinase activity. J Biol Chem. 2004;279:42516–42527.

6. Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, JosephN, Singer S, Griffith DJ, Haley A, Town A, Demetri GD, Fletcher CD,Fletcher JA. PDGFRA activating mutations in gastrointestinal stromaltumors. Science. 2003;299:708–710.

7. von Tell D, Armulik A, Betsholtz C. Pericytes and vascular stability. ExpCell Res. 2006;312:623–629.

8. Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol. 1995;11:73–91.

9. Magnusson P, Rolny C, Jakobsson L, Wikner C, Wu Y, Hicklin DJ,Claesson-Welsh L. Deregulation of Flk-1/vascular endothelial growthfactor receptor-2 in fibroblast growth factor receptor-1-deficient vascularstem cell development. J Cell Sci. 2004;117:1513–1523.

10. Yamashita J, Itoh H, Hirashima M, Ogawa M, Nishikawa S, Yurugi T,Naito M, Nakao K, Nishikawa S. Flk1-positive cells derived fromembryonic stem cells serve as vascular progenitors. Nature. 2000;408:92–96.

11. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptorsignalling - in control of vascular function. Nat Rev Mol Cell Biol.2006;7:359–371.

12. Nilsson I, Rolny C, Wu Y, Pytowski B, Hicklin D, Alitalo K,Claesson-Welsh L, Wennstrom S. Vascular endothelial growth factorreceptor-3 in hypoxia-induced vascular development. FASEB J. 2004;18:1507–1515.

2148 Arterioscler Thromb Vasc Biol. October 2007

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

13. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J.Vascular-specific growth factors and blood vessel formation. Nature.2000;407:242–248.

14. Rathjen J, Rathjen PD. Mouse ES cells: experimental exploitation ofpluripotent differentiation potential. Curr Opin Genet Dev. 2001;11:587–594.

15. Kremer C, Breier G, Risau W, Plate KH. Up-regulation of flk-1/vascularendothelial growth factor receptor 2 by its ligand in a cerebral sliceculture system. Cancer Res. 1997;57:3852–3859.

16. Clark AJ, Ishii S, Richert N, Merlino GT, Pastan I. Epidermal growthfactor regulates the expression of its own receptor. Proc Natl Acad SciU S A. 1985;82:8374–8378.

17. Jakobsson L, Kreuger J, Holmborn K, Lundin L, Eriksson I, Kjellen L,Claesson-Welsh L. Heparan sulfate in trans potentiates VEGFR-mediatedangiogenesis. Dev Cell. 2006;10:625–634.

18. Feraud O, Cao Y, Vittet D. Embryonic stem cell-derived embryoid bodiesdevelopment in collagen gels recapitulates sprouting angiogenesis. LabInvest. 2001;81:1669–1681.

19. Magnusson PU, Ronca R, Dell’Era P, Carlstedt P, Jakobsson L, PartanenJ, Dimberg A, Claesson-Welsh L. Fibroblast growth factor receptor-1expression is required for hematopoietic but not endothelial cell devel-opment. Arterioscler Thromb Vasc Biol. 2005;25:944–949.

20. Hellstrom M, Kalen M, Lindahl P, Abramsson A, Betsholtz C. Role ofPDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cellsand pericytes during embryonic blood vessel formation in the mouse.Development. 1999;126:3047–3055.

21. Soriano P. Abnormal kidney development and hematological disorders inPDGF beta-receptor mutant mice. Genes Dev. 1994;8:1888–1896.

22. Rolny C, Nilsson I, Magnusson P, Armulik A, Jakobsson L, Wentzel P,Lindblom P, Norlin J, Betsholtz C, Heuchel R, Welsh M, Claesson-WelshL. Platelet-derived growth factor receptor-{beta} promotes early endo-thelial cell differentiation. Blood. 2006.

23. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cellsfrom mouse embryos. Nature. 1981;292:154–156.

24. Martin GR. Isolation of a pluripotent cell line from early mouse embryoscultured in medium conditioned by teratocarcinoma stem cells. Proc NatlAcad Sci U S A. 1981;78:7634–7638.

25. Rak J, Mitsuhashi Y, Sheehan C, Tamir A, Viloria-Petit A, Filmus J,Mansour SJ, Ahn NG, Kerbel RS. Oncogenes and tumor angiogenesis:

differential modes of vascular endothelial growth factor up-regulation inras-transformed epithelial cells and fibroblasts. Cancer Res. 2000;60:490–498.

26. Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, GertsensteinM, Fahrig M, Vandenhoeck A, Harpal K, Eberhardt C, Declercq C,Pawling J, Moons L, Collen D, Risau W, Nagy A. Abnormal blood vesseldevelopment and lethality in embryos lacking a single VEGF allele.Nature. 1996;380:435–439.

27. Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O’Shea KS,Powell-Braxton L, Hillan KJ, Moore MW. Heterozygous embryoniclethality induced by targeted inactivation of the VEGF gene. Nature.1996;380:439–442.

28. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, BreitmanML, Schuh AC. Failure of blood-island formation and vasculogenesis inFlk-1-deficient mice. Nature. 1995;376:62–66.

29. Dixelius J, Makinen T, Wirzenius M, Karkkainen MJ, Wernstedt C,Alitalo K, Claesson-Welsh L. Ligand-induced vascular endothelialgrowth factor receptor-3 (VEGFR-3) heterodimerization with VEGFR-2in primary lymphatic endothelial cells regulates tyrosine phosphorylationsites. J Biol Chem. 2003;278:40973–40979.

30. Bondjers C, Kalen M, Hellstrom M, Scheidl SJ, Abramsson A, Renner O,Lindahl P, Cho H, Kehrl J, Betsholtz C. Transcription profiling of plate-let-derived growth factor-B-deficient mouse embryos identifies RGS5 asa novel marker for pericytes and vascular smooth muscle cells. Am JPathol. 2003;162:721–729.

31. Ferkowicz MJ, Starr M, Xie X, Li W, Johnson SA, Shelley WC, MorrisonPR, Yoder MC. CD41 expression defines the onset of primitive anddefinitive hematopoiesis in the murine embryo. Development. 2003;130:4393–4403.

32. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The Tcell leukemia oncoprotein SCL/tal-1 is essential for development of allhematopoietic lineages. Cell. 1996;86:47–57.

33. Robb L, Elwood NJ, Elefanty AG, Kontgen F, Li R, Barnett LD, BegleyCG. The scl gene product is required for the generation of all hemato-poietic lineages in the adult mouse. EMBO J. 1996;15:4123–4129.

34. Ostman A. PDGF receptors-mediators of autocrine tumor growth andregulators of tumor vasculature and stroma. Cytokine Growth Factor Rev.2004;15:275–286.

Magnusson et al Constitutive PDGFR-� Kinase Activity in Stem Cells 2149

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from

1

Online supplement

Online supplemental Figure 1.

Suppl. Fig. 1 Wild-type and D/V mutant ES cell-derived teratoma display equal tissue

type distributions.

Equal representation of the three germ layers (mesoderm-derived muscle, endoderm-

derived digestive and respiratory tract lining cells and ectoderm-derived nerve and skin

tissue) was observed in wild-type and PdgfrbD849V/+–mutant teratoma indicating that the

developmental pathways giving rise to these somatic tissues are not altered, at least in a

model which does not depend on embryonic survival. Representative HE-stained sections

are shown.

2

Methods

Knock in of D849V in ES cells

The mutation of aspartic acid 849 to valine was introduced into subcloned genomic DNA

by oligonucleotide directed mutagenesis using the QuickChange Kit (Stratagene)

according to the manufacturer’s recommendations. The mutation primers used were as

follows: 5’-GACTTCGGCCTGGCTCGAGtCATTATGAGGGACTCAAACTACA-3’

and 5’-TGTAGTTTGAGTCCCTCATAATGaCTCGAGCCAGGCCGAAGTC-3’ (base

exchange resulting in amino acid mutation indicated in lower case letters). The targeting

vector consisted of a 1.7 kb EcoRV-Spel genomic 5’-fragment, followed by a

PGKneobpA expression cassette flanked by loxP sites, a 5 kb Spel-XhoI genomic 3’-

fragment containing the point mutated exon-18 and a herpes simples virus thymidine

kinase (HSV-TK) expression cassette in pBluescript SK(+) backbone. The construct was

linearized (NotI) for electroporation into GS-1 ES cells (Genome Systems) and colonies

were selected using G418 and gancyclovir. Homologous recombination events were

screened by PCR, as described 1, using primers for the neo gene (5’-

TGGCTACCCGTGATATTGCT-3’) and genomic sequence outside the targeting

construct (5’-CCGAAATGTGTACCAGTCTGAAA-3’), resulting in a 3 kb amplification

product for correct integration. Positive ES cell clones were tested by Southern blot, as

described 1, using a 177 bp PCR amplification product corresponding to nucleotides 1957

to 2133 of the mouse Pdgfrb cDNA, which hybridizes to genomic DNA 5’ outside the

targeting construct (5.2 kb wild type allele; 6.9 kb mutant allele). The point mutation was

confirmed by sequencing of a PCR-amplified DNA fragment from targeted ES cells. Two

3

PdgfrbD849V/+ ES cell clones denoted D/V-1 and D/V-2, were selected for further

characterization. These clones were compared with a GS-1 ES cell clone with the neo

cassette in the corresponding locus, but lacking the D849V mutation (denoted wild type).

ES cell culture

ES cells were grown on growth-arrested murine embryonic fibroblast feeder cells in ES

cell medium composed of Dulbecco’s modified Eagle’s medium/glutamax

(Invitrogen/Gibco) supplemented with 15% fetal bovine serum, 25 mM HEPES, 1.2 mM

Na-pyruvate, 19 µM monothioglycerol and 1,000 U/ml recombinant leukemia inhibitory

factor (LIF, Chemicon International Inc.) as described 2. Prior to differentiation, the ES

cells were cultured for 1-2 passages on gelatine-coated tissue culture plastic to remove

feeder cells. Differentiation of embryoid bodies started at day 0 when LIF was withdrawn

from the medium. Growth factors were added as indicated from this point (30 ng/ml

VEGF-A165, PeproTech Inc., or 20 ng/ml PDGF-BB; generous donation from Amgen

Inc.). Formation of embryoid bodies was induced in hanging droplets and on day 4, the

embryoid bodies were flushed down and plated on 8-well glass culture slides (Becton

Dickinson Biosciences/Falcon) or on tissue culture plastic dishes. All analyses were

performed on four or more embryoid bodies at three or more individual occasions, unless

stated otherwise.

Embryoid bodies in 3-dimensional collagen I gels and immunofluorescence staining

Embryoid bodies were cultured as described above. Briefly, on day 0 ES cells were

cultured in hanging droplets in the presence of serum with or without 30 ng/ml VEGF-A

4

(PeproTech Inc.). After 4 days, the embryoid bodies were seeded in groups of

approximately 10 embryoid bodies on a layer of polymerised collagen type I solution

(Ham’s F12 medium (PromoCell GmbH), 5 mM NaOH, 20 mM HEPES, 0,225%

NaHCO3, 1% Glutamax-1 (Invitrogen/Gibco) and 1.5 mg/ml collagen type I (Cohesion

Technologies Inc.). Immediately thereafter, a second layer of collagen solution was added

on top. After the second layer had solidified, medium with or without 30 ng/ml of VEGF-

A was added and the culture continued for 6 or 8 days. Cultures were fixed in 4 %

paraformaldehyde for 30 minutes and then blocked and permeabilized in 3 % BSA, 0.2 %

Triton X-100 in phosphate buffered saline (PBS). Endothelial cells were stained with a

rat anti-mouse PECAM1/CD31 antibody (Becton Dickinson Biosciences/Falcon) and

pericytes were stained using a mixture of a fluorescein isothiocyanate (FITC)-conjugated

mouse anti-α-SMA antibody (Sigma), a rabbit anti-NG2 chondroitin sulphate

proteoglycan antibody (Chemicon International Inc.) and a mouse anti-desmin antibody

(DAKO). CD31 antibodies were detected using an anti-rat Alexa 568 antibody

(Invitrogen/Molecular Probes) and NG2 and desmin antibodies were detected using anti-

rabbit and anti-mouse Alexa 488 antibodies (both from Invitrogen/Molecular Probes). All

antibodies were diluted in 3 % BSA/PBS and all antibody incubations were carried out at

4 ºC over night. Nuclei were stained by DAPI (1 µg/ml) in PBS. The number of CD31-

positive sprouts per embryoid body (n = 11 both for wild type and D/V-1 ES cells) and

the number of pericytes (desmin+, α-SMA+ or NG2+ cells) associated with CD31+ sprouts

(n = 14 and 15 sprouts from wild type and mutant embryoid bodies, respectively) were

counted using a Leica DM4000 B/M microscope. P values were calculated using

Student’s t-test, two-sample unequal variance/two-tailed distribution.

5

In all experiments involving embryoid bodies, four embryoid bodies were analyzed per

condition and genotype and repeated at least three times, if not mentioned otherwise.

Western blotting

Cell lysates from embryoid bodies were analyzed by western blotting to examine the

activity and downstream signaling components of wild type and the mutant PDGFR-β.

Embryoid bodies were plated out on day 4 in plastic tissue culture dishes to allow

attachment. After indicated time points of culture in medium without LIF and

exogenously added growth factors, cultures were lysed in 20 mM Tris HCl (pH 7.5), 150

mM NaCl, 10% glycerol, 1% Nonidet P40, 2 mM EDTA, 500 µM Na3VO4, 1% aprotinin,

10 µg/ml leupeptin and 1 mM phenylmethyl sulfonylfluoride. When indicated, growth

factor-treated embryoid bodies were starved for 16 hours in 0.2% fatty-acid free bovine

serum albumin (BSA; Sigma-Aldrich) in ES cell medium without LIF and then

stimulated with PDGF-BB (50 ng/ml) for 10 minutes prior to cell lysis. Cell lysates were

centrifuged for 15 minutes at 4°C and the protein concentration of the supernatant was

measured using the BCA protein detection kit (Pierce Chemicals). Total cell lysates were

separated by reducing SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using 7%

and 12% gels and transferred to Hybond C-Extra nitrocellulose membrane (Amersham

Biosciences). The membranes were blocked in Tris-buffered saline /0.1% Tween 20

containing 3% BSA (TBS/BSA), for 3 hours, and then incubated with one of the

following antisera: rabbit anti-mouse PDGFR-β antibody (sc432; Lot.L060; Santa Cruz

Biotechnology), rabbit anti-mouse p-Akt and Akt (#9271, #9272; Cell Signaling

6

Technology), rabbit anti-mouse p-Erk1/2 and Erk1/2 (#9101; Cell Signaling

Technology), rat anti-mouse VEGFR-2 antibody (Becton Dickinson Biosciences/Falcon),

goat anti-mouse VE-cadherin antibody (R&D Systems) or rabbit anti-human β-catenin

antibody (#9562; Cell Signaling Technology), rabbit anti-β-actin (#A-2066; Sigma) over

night at 4°C. The pPDGFR-β antibody 4 used, was generated against the phosphorylated

form of the major autophosophorylation site3 (Y857 in human, Y856 in the mouse) of the

PDGFR-β. After vigorous washing with TBS and blocking in TBS/BSA, the membrane

was incubated with peroxidase-conjugated anti-rabbit antibody, anti-rat antibody

(Amersham Biosciences) or anti-goat antibody (Santa Cruz Biotechnology).

Immunoreactive bands were visualized using the ECL Western blotting detection

reagents (Amersham Biosciences). For digital data analyses a FUJI CCD camera LAS-

1000 was used in combination with Advanced Image Data Analyzer (AIDA) software,

Version 3.10.

Immunohistochemistry

Embryoid bodies were fixed in zinc fix (0.1 M Tris HCl, pH 7.5, 3 mM calcium acetate,

23 mM zinc acetate and 37 mM zinc chloride) over night at 4°C. Quenching of

endogenous peroxidase activity was performed by 3% H2O2 in methanol during 30

minutes followed by blocking in TBS/BSA. Samples were incubated with rat anti-mouse

CD31 antibody (Becton Dickinson Biosciences/Falcon) diluted in blocking buffer and

incubated over night at 4°C. The primary antibody incubation was followed by washes

and incubation for one hour at room temperature with secondary biotinylated goat anti-rat

antibody (Vector Laboratories Inc.) diluted in blocking buffer and finally, a 30-minutes

7

incubation with streptavidin-HRP (Vector Laboratories Inc.). Immune reactivity was

visualized by the use of the chromogen substance (AEC kit from Vector Laboratories

Inc.). Slides were mounted with Ultramount aqueous mounting medium (DAKO) and

photographed in a Nikon Eclipse E1000 microscope. Quantification

of the area or length of CD31 staining (n=5 for each ES cell line and condition) was

performed with Easy Image Analysis software (Rainfall). Compensation for background

was performed to avoid quantification of unspecific staining. Statistical analysis was

done by unpaired Student’s t-test using the Stat View computer program.

Real-time RT-PCR analysis

Total RNA was extracted from day 8 wild type, D/V-1 and D/V-2 embryoid bodies.

Contaminating genomic DNA was digested with DNase I (Amersham Biosciences) and 1

µg total RNA was used for first strand cDNA synthesis using oligo dT primer and the

Advantage RT-for-PCR-Kit (Clontech Laboratories, Inc.). Primers used are listed in

Table 1. β-actin was used as endogenous reference and non-reverse transcribed RNA was

used as a negative control. The PCR samples, containing cDNA, primers (0.25 µM final

concentration) and 2x SYBR Green PCR master mix (Applied Biosystems), were run in

triplicate on an ABI Prism 7700 Sequence Detection System instrument (Applied

Biosystems) with an initial 10-minute activation at 95°C, followed by 45 cycles at 95°C

for 15 seconds and 60°C for 1 minute. The threshold cycle (CT) value was calculated for

each sample by the ABI Prism 7700 instrument. Transcript levels were then normalized

against β-actin levels and changes in transcript levels were expressed as relative values.

8

For each gene transcript and genotype single samples were run in triplicate from three

different embryoid body preparations. One such representative result is shown.

Generation and analysis of teratomas and immunofluorecsence staining

1 x 106 of wild type or PdgfrbD849V/+ ES cells diluted in 100 µl PBS were injected

subcutaneously on the dorsal side of female NMRI-nu mice (M&B Animal Models) and

teratomas were grown until they reached a size of approximately 1 cm3 (24 - 46 days).

Acetone-fixed frozen 6 µm sections were used for fluorescent staining for the endothelial

marker CD31. The sections were blocked in 3 % BSA in PBS and incubated with rat anti-

mouse CD31 antibody (Becton Dickinson Biosciences/Falcon) for 1 hour at room

temperature followed by incubation with goat anti-rat Alexa 568 (Molecular Probes),

both diluted in 3 % BSA/PBS. Nuclei were stained by Hoechst 33342 (1 µg/ml) in PBS.

Results were analyzed using a Nikon Eclipse E1000 microscope. For morphometric

analysis, 7 µm sections from paraformaldehyde-fixed, paraffin-embedded teratomas were

used for chromogenic staining for the endothelial marker CD31. Sections were

deparaffinized and pre-treated in 10 mM citrate buffer (pH 6.0) for 2 x 7 minutes at 750

W in a microwave oven for antigen retrieval. Following quenching of tissue peroxidase

activity in 3 % H2O2 in PBS for 10 minutes and blocking in 20 % rabbit serum, the

sections were incubated with goat anti-mouse CD31 antibody (Santa Cruz

Biotechnology) at 4 °C over night. CD31 antibodies were detected using biotinylated

rabbit anti-goat antibodies and visualized by Vectastain ABC-AP kit (Vector

Laboratories). Five wild type and five PdgfrbD849V/+ teratomas were used for

9

morphometric analysis. Images were captured using a Leica DM4000 B/M microscope

equipped with a Leica 40X PH2 objective. The Leica Qwin V3 software was used to

measure the density of blood vessels (average number of vessels/mm2), average blood

vessel perimeter, and total blood vessel area (vessel area/ mm2). The teratomas were

analyzed pattern wise by 19 to 29 microscopy fields covering the total vascularized

section area and an average value was calculated for each tumor. P values were

calculated using Student’s t-test, two-sample unequal variance/two-tailed distribution.

We did not observe any difference in the relative contribution from the three embryonic

germ lineages between wild type and PdgfrbD849V/+ teratomas.

Table 1

Real-time RT-PCR primers

Gene product Accession No Sense primer (5’-3’) Antisense primer (5’-3’)

α−SMA X13297 CTGACAGAGGCACCACTGAA AGAGGCATAGAGGGACAGCA

β-actin XD3765 CACTATTGGCAACGAGCGG TCCATACCCAAGAAGGAAGGC

CD31 NM_008816 TACTGCAGGCATCGGCAAA GCATTTCGCACACCTGGAT

CD41 NM_010575 TGGCATGTTTCCAACCAGC TCCCCGGTAACCATCGAA

PDGFR-β NM_008809 GTGGTGAACTTCCAATGGACG GTCTGTCACTGGCTCCACCAG

RGS5 NM_009063 TCATTTCAATCCTGCCCTTC TGACAGGAGGCATCTGAGTG

Tal-1 NM_011527 GGCAGACAGAGACTGATCCTG AGAAGCAAACACAGCTTTGGA

VE-cadherin X83930 AGGACAGCAACTTCACCCTCA AACTGCCCATACTTGACCGTG

VEGF-A NM_009505 AAGGAGAGCAGAAGTCCCATGA CTCAATTGGACGGCAGTAGCT

VEGFR-2 X59397 ACAGACCCGGCCAAACAA TTCCCCCCTGGAAATCCTC

10

References

1. Heuchel R, Berg A, Tallquist M, Ahlen K, Reed RK, Rubin K, Claesson-Welsh L,

Heldin CH, Soriano P. Platelet-derived growth factor beta receptor regulates

interstitial fluid homeostasis through phosphatidylinositol-3' kinase signaling.

Proc Natl Acad Sci U S A. 1999;96:11410-11415.

2. Magnusson P, Rolny C, Jakobsson L, Wikner C, Wu Y, Hicklin DJ, Claesson-

Welsh L. Deregulation of Flk-1/vascular endothelial growth factor receptor-2 in

fibroblast growth factor receptor-1-deficient vascular stem cell development. J

Cell Sci. 2004;117:1513-1523.

3. Kazlauskas A, Cooper JA. Autophosphorylation of the PDGF receptor in the

kinase insert region regulates interactions with cell proteins. Cell. 1989;58:1121-

1133.

4. Chiara F, Goumans MJ, Forsberg H, Ahgren A, Rasola A, Aspenstrom P,

Wernstedt C, Hellberg C, Heldin CH, Heuchel R. A gain of function mutation in

the activation loop of platelet-derived growth factor beta-receptor deregulates its

kinase activity. J Biol Chem. 2004;279:42516-42527.

Rainer L. HeuchelPeetra U. Magnusson, Camilla Looman, Aive Åhgren, Yan Wu, Lena Claesson-Welsh and

In Vivo and In Vitro Constitutive Activity Promotes AngiogenesisβPlatelet-Derived Growth Factor Receptor-

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2007 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/01.ATV.0000282198.60701.942007;27:2142-2149; originally published online July 26, 2007;Arterioscler Thromb Vasc Biol. 

http://atvb.ahajournals.org/content/27/10/2142World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2007/09/20/01.ATV.0000282198.60701.94.DC1.htmlData Supplement (unedited) at:

  http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

  http://www.lww.com/reprints

Information about reprints can be found online at: Reprints: 

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on August 18, 2015http://atvb.ahajournals.org/Downloaded from