Plastids stids (derived from proplastids) Chromoplast Chloroplast Amyloplast Leucoplast Elaioplast Etioplast In plants, meristamatic cells contain 10-14 proplastids, each carrying 1-2 nucleoids per proplastid, whereas leaf cells may contain 100 chloroplasts, with 10-14 nucleoids each. There are several ptDNA per nucleoid. Thus proplastids contain lower copies of ptDNA than chloroplasts. Plastid nucleoid ptDNA copies
23
Embed
Plastids Plastids (derived from proplastids) 1.Chromoplast 2.Chloroplast 3.Amyloplast 4.Leucoplast 5.Elaioplast 6.Etioplast In plants, meristamatic cells.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
In plants, meristamatic cells contain 10-14 proplastids, each carrying 1-2 nucleoids per proplastid, whereas leaf cells may contain 100 chloroplasts, with 10-14 nucleoids each. There are several ptDNA per nucleoid. Thus proplastids contain lower copies of ptDNA than chloroplasts.
Plastidnucleoid
ptDNA copies
The Structure of of O. sativa Chloroplast Genome
~120 genes~50 transcription units
Two inverted repeatsOne large single copy regionOne small single copy region
These are salient features of any higher plant plastids
Conserved Features of Chloroplast Genomes in Higher Plants
LSC IRB SSC IRA
86,686 25,341 18,571 25,341
82,355 22,748 22,74812,536
80,592 20,799 20,79912,334
81,095 10,058 10,058 19,813
65,696 495 49553,021
19,799 22,735 22,7354759
Tobacco (155,939 bp)
Maize (140,387 bp)
Rice (134,525 bp)
Marchantia (121,024 bp)
Black pine (119,707 bp)
Epifagus (70,028)
LSC= Large single copy region SSC= small single copy region
Genes Encoded in the Chloroplast Genomes in Higher Plants
Gene Designation Gene Product I. Genetic System Chloroplast RNA genes
rbcL RUBISCO large subunitatpA, B, E ATP synthetase CF1, , subunitsatpF, H, I ATP synthetase CF0I, III, IV subunitspsaA, B, C Photosystem I A1, A2, 9-kDa proteinpsbA, B, C, D, E Photosystem II D1, 51 kDa, 44 kDa, D2, Cytb559-
9kDapsbF, G, H, I Photosystem II Cytb559-4kDa, G, 10Pi, I proteinspetA, B, D Electron transport Cytf, Cytb6, IV subunits
Respiratory proteinsndhA, B, C, D NADH dehydrogenase (ND) subunits 1, 2, 3, 4ndhE, F NDL4L, 5
III. Others Maturase matK
Protease clpPEnvelope membrane protein cemA
Organization of chloroplast genes into operons
psbB
psbT psbH
petB
Intron
Intron
petD
psbN
Polycistronic mRNA
Monocistronic mRNA
The Endosymbiont Theory
Common ancestor of plastidand modern cyanobacteria
Common ancestor of mitochondiraand -group of modern
proteobacteria
Protoeukaryotic cell
Photosynthetic eukaryotic cell
Flowering plant
Photosynthetic C-reductionRespiration
The Endosymbiont Theory
Supporting Evidences
1. Molecular architecture and genome replication a) Plastid genomes are naked covalently closed circular DNA molecules (devoid of
histones).
b) Replication of plastid DNA is independent of the nuclear genome replication
c) Promoters of most chloroplast genes contain DNA sequences similar to the E. coli ‘-10’ and ‘-35’ promoter motifs.
d) Chloroplast open reading frames are polycistronic.
e) Plastid genomes contain few moderately or highly repetitive sequences
f) Chloroplast genomes of Euglena, Chlamydomonas and most angiosperms carry 2 or 3 rRNA genes which are similar in size to their prokaryotic homologs (23S, 16S,
5S)
Chloroplast promoters
psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT
psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT
rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG
atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT
trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA
Mustard
Spinach
“-35” “-10”
1) Chloroplast promoters- similar to bacterial minimal promoter.
psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT
psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT
rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG
atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT
trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA
Mustard
Spinach
“-35” “-10”
Features of chloroplast transcription
2) Polycistronic.
3) Cis-elements located in the 5’-UTR.
4) Nuclear-encoded transcription factors.
Features of chloroplast translation (similar to prokaryotic translation)
1) Makes use of 70S ribosomes.
2) Uses fMet-initiator tRNA for the translation initiation codon.
3) The mRNAs are not capped.
4) The mRNAs are not poly-adenylated.
5) Ribosome binding occur in Shine-Delgarno-like sequence motif in the 5’-UT of mRNA.
6) Not coupled to transcription and trnaslational units can occur as stable ribonucleoprotein complexes.
The Endosymbiont Theory (cont.)
Supporting Evidences
2) Transcriptiona) RNA polymerases from cyanobacteria (e.g. Chlamydomonas) and higher plants (e.g. maize) are more similar to the eubacterial than to the nuclear homologs.
b) Genes encoding for proteins of related functions are organized into operons and thus are co-transcribed.
c) The limiting regulatory step of gene expression is at post-transcriptional and translational level.
d) Transcription terminators are more similar to bacterial sequences.
d) A minor fraction of chloroplast mRNAs are polyadenylated.
The Endosymbiont Theory (cont.)
Supporting Evidences
3) Translation
a) Plastid ribosomes are more similar to prokaryotic ribosomes than to their cytoplasmic counterparts: cytoplasmic ribosomes- 80S (40S + 60S subunits)
Plastid and prokaryotic ribosomes- 70S (30S + 50S subunits) Antibodies raised against 70S and 30S
subunits of plastid ribosomes are active against E. coli
b) Plastid ribosomal RNA gene sequences are more similar to modern cyanobacteria (e.g. Synechococcus lividus) than to their nuclear counterparts.
The Endosymbiont Theory (cont.)
Supporting Evidences
4) Others (biflagellate protists)The case of Cyanophora paradoxa (and other types of marine nudibrachs or sea slugs)
EndosymbioticCyanobacterium
PhotosyntheticCyanelle
Cyanophora paradoxa
Plastid transformation
Basic Requirements:1) Method of delivery (Biolistic method)
2) Selectable marker (dominant marker)
Firing pin
Helium gasNylon macro-projectile
Micro-projectileDNA-coated gold particles
Vents
Plate to stop nylon projectile
Target cellsor tissues
3”-adenylyltransferase (aadA)
Spectinomycin inhibits protein biosynthesis (70S ribosomes)
Spectinomycin Adenylylspectinomycin (inactive protein synthesis inhibitor)
AMP
Construct:
“-35” “-10” 5’-UTR SD aadA-ORF 3’-UTR
First successful plastid transformation was reported in 1988 for chlamydomonas. Then in 1990 for tobacco. Since then only tomato has been added to the list of reproducible systems, though reports exist for cotton, wheat etc.
A transformed plastid genome is formed bytwo recombination events that are targeted byhomologous sequences. The plastid genomesegments that are included in the vector aremarked as the left (LTR) and right targetingregions (RTR).
Chloroplast Genetic EngineeringChloroplast Genetic EngineeringProkaryotic – No need for codon optimization10, 000 copies per cell – high expressionMaternal inheritanceNot expressed in fruits ?Multigene engineering
Homologous recombination
Advantages of Chloroplast Advantages of Chloroplast TransformationTransformation
Gene Gene ContainmentContainment
MaternalMaternalInheritanceInheritance
No GeneNo GeneSilencingSilencing
No PositionNo PositionEffectEffect
Hyper-Hyper-expressionexpression
MultigeneMultigeneEngineeringEngineering
No VectorNo VectorSequencesSequences
NoNoPleiotropicPleiotropic
EffectsEffects
Cry2Aa2 Single Gene Expression
00.050.1
0.150.2
0.250.3
0.350.4
Control young mature oldTransgenic Leaf Age
% T
ota
l So
lub
le P
rote
in
Cry2Aa2 Operon Expression
01020
304050
Control young mature oldTransgenic Leaf Age%
To
tal S
olu
ble
Pro
tein
A.
B.
100 fold higher expression obtained by plastid transformation (B) compared to nuclear transformation (A)
Accelerated gold particlecoated with transforming DNA
~10,000 plastidgenomes/cell
Primary plastidtransformation event (change
ofsingle plastid
DNAmolecule)
Cell and organelle
divisions under antibiotic selection
(heteroplasmy)
Several cycles of
antibiotic selection
(homoplasmy)
Heteroplasmy vs homoplasmy
nucleus
chloroplast proplastid
sorting
biogenesis
Selection of transplastomic clones by spectinomycin resistance. (A) Spectinomycin inhibits callus formation, greening, and shoot regeneration from tobacco leaf segments on shoot regeneration medium. Transplastomic clones are resistant to spectinomycin and are identified as green shoots or calli. (B) The shoots are chimeric, visualized by accumulation of green fluorescent protein in transplastomic sectors. Spectinomycin resistance is not cell autonomous as sensitive sectors are also green. (C) Spontaneous spectinomycin resistant mutants are sensitive (top), transplastomic clones are resistant to streptomycin (bottom) when cultured on a selective streptomycin (500 mg/L) medium.
Comparison of the nuclear and plastid genomes of angiosperms
Nuclear genome Plastid genome
Chromosomes Two copies of each of ~60 copies of a single circularmany chromosomes; chromosome per plastidthe number of ~50–60 chloroplasts per cellchromosomes per diploid cell is species-specific
Genes per chromosome Could be thousands ~120–150
Arrangement and Each gene is separate Many genes are in operons transcription of genes (individually transcribed ) (transcribed together)
Currently known primary markers are resistance to spectinomycin, streptomycin, and kanamycin, which inhibit protein synthesis on prokaryotic-type plastid ribosomes. These antibiotics inhibit greening, cell division, and shoot formation in tobacco culture. Therefore, greening, faster proliferation, and shoot formation were used to identify transplastomic clones on a selective medium. The first transplastomic clones were obtained by spectinomycin selection. Because spectinomycin allows slow proliferation of nontransformed tobacco cells it was assumed that the choice of a drug that enables such "nonlethal" selection is important to recover transplastomic clones. However, transplastomic clones were soon identified by kanamycin selection using an antibiotic concentration that is considered "lethal" (50 mg/L). Thus, slow proliferation of nontransformed cells on a selective medium is not an essential feature of the selection scheme. Initial transformation vectors carried a plastid 16S rRNA (rrn16) gene with point mutations that prevent binding of spectinomycin or streptomycin to the 16S rRNA. The rrn16 target site mutations are recessive, and were 100-fold less efficient than the currently used dominant aadA gene. Streptomycin resistance encoded in the rps12 ribosomal protein gene was also included in an early vector. The neo (aph(3')IIa) gene encodes neomycin phosphotransferase II [NPTII; APH(3')-II], and was used to select transplastomic clones in tobacco. The aphA-6 gene encodes aminoglycoside phosphotransferase or APH(3')-VI, and was used to select transplastomic clones by kanamycin and amikamycin resistance in Chlamydomonas and by kanamycin resistance in tobacco. Direct selection for spectinomycin resistance and for highly expressed kanamycin resistance genes, on average, yield one transplastomic line in a bombarded leaf sample.
Selection markers
Most of the lecture material is derived from:
1. Pal Maliga (2004) PLASTID TRANSFORMATION IN HIGHER PLANTS. Annual Review of Plant Biology. 55: 289-313.
2. Pal Maliga (2002) Engineering the plastid genome of higher plants. Current Opinion in Plant Biology 2002, 5:164–172