This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
RESEARCH ARTICLE
Plastidial NAD-Dependent Malate Dehydrogenase: A Moonlighting Protein Involved in Early Chloroplast Development Through its Interaction with an FtsH12-FtsHi Protease Complex Tina B. Schreier1, Antoine Cléry2, Michael Schläfli1, Florian Galbier1, Martha Stadler1, Emilie Demarsy3,4, Daniele Albertini1, Benjamin A. Maier1, Felix Kessler3, Stefan Hörtensteiner5, Samuel C. Zeeman1* and Oliver Kötting1 1 Institute of Molecular Plant Biology, ETH Zurich, Universitätstrasse 2, CH-8092 Zurich, Switzerland. 2 Institute of Molecular Biology and Biophysics, Department of Biology, ETH Zurich, CH-8093 Zurich, Switzerland. 3 Laboratory of Plant Physiology, University of Neuchâtel, CH-2000 Neuchâtel, Switzerland 4 Department of Botany and Plant Biology, University of Geneva, 30 Quai E. Ansermet, CH-1211 Geneva, Switzerland. 5 Institute of Plant Biology, University of Zürich, Zollikerstrasse 107, CH-8008 Zürich, Switzerland. *Corresponding Author: [email protected] Short title: Moonlighting role of plastidial NAD-MDH One-sentence summary: Plastid NAD-dependent malate dehydrogenase is essential for chloroplast development, not because of its enzymatic activity, but because it interacts with FtsH proteases at the inner envelope membrane. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Samuel C. Zeeman ([email protected]). ABSTRACT Malate dehydrogenases (MDH) convert malate to oxaloacetate using NAD(H) or NADP(H) as a cofactor. Arabidopsis thaliana mutants lacking plastidial NAD-dependent MDH (pdnad-mdh) are embryo-lethal, and constitutive silencing (miR-mdh-1) causes a pale, dwarfed phenotype. The reason for these severe phenotypes is unknown. Here, we rescued the embryo lethality of pdnad-mdh via embryo-specific expression of pdNAD-MDH. Rescued seedlings developed white leaves with aberrant chloroplasts and failed to reproduce. Inducible silencing of pdNAD-MDH at the rosette stage also resulted in white newly emerging leaves. These data suggest that pdNAD-MDH is important for early plastid development, which is consistent with the reductions in major plastidial galactolipid, carotenoid and protochlorophyllide levels in miR-mdh-1 seedlings. Surprisingly, the targeting of other NAD-dependent MDH isoforms to the plastid did not complement the embryo lethality of pdnad-mdh, while expression of enzymatically inactive pdNAD-MDH did. These complemented plants grew indistinguishably from the wild type. Both active and inactive forms of
Plant Cell Advance Publication. Published on June 22, 2018, doi:10.1105/tpc.18.00121
pdNAD-MDH interact with a heteromeric AAA-ATPase complex at the inner membrane of the chloroplast envelope. Silencing the expression of FtsH12, a key member of this complex, resulted in a phenotype that strongly resembles miR-mdh-1. We propose that pdNAD-MDH is essential for chloroplast development due to its moonlighting role in stabilizing FtsH12, distinct from its enzymatic function. INTRODUCTION 1
Supplemental Data Set 1 Complete list of proteins identified in immunoprecipitates 982
by MS/MS. 983
984
ACKNOWLEDGMENTS 985
986
This work was funded by the Swiss National Foundation (SNF) (Grant Number 987
31003A_156987 to O.K. and S.C.Z.) and by ETH Zurich. We thank Claudia Di 988
Césaré from the Neuchâtel Platform of Analytical Chemistry for technical assistance, 989
as well as Peter Hunziker, Yolanda Joho-Auchli and Simone Wüthrich from the 990
Functional Genomic Centre Zurich (FGCZ) for mass spectrometry analysis. We 991
thank Masato Nakai for sharing his unpublished work and his thoughts with us, 992
Enrico Martinoia and Alisdair Fernie for fruitful discussions during the course of this 993
work and Andrea Ruckle for help in plant culture. 994
995
AUTHOR CONTRIBUTIONS 996
997
T.B.S., S.C.Z., and O.K. conceived and directed the research; T.B.S., A.C., S.C.Z., 998
and O.K. designed the experiments; T.B.S., A.C., E.D., M.S., F.G., M.S., F.K., S.H., 999
D.A., and B.A.M. performed research and analysed data; T.B.S. and S.C.Z. wrote1000
the manuscript with input from all of the authors. 1001
1002
REFERENCES 1003 1004
Bahl, J., Francke, B., and Monéger, R. (1976). Lipid composition of envelopes, prolamellar bodies 1005 and other plastid membranes in etiolated, green and greening wheat leaves. Planta 129: 193–1006 201. 1007
Beeler, S., Liu, H.-C., Stadler, M., Schreier, T., Eicke, S., Lue, W.-L., Truernit, E., Zeeman, S.C., 1008 Chen, J., and Kotting, O. (2014). Plastidial NAD-Dependent Malate Dehydrogenase Is Critical 1009 for Embryo Development and Heterotrophic Metabolism in Arabidopsis. Plant Physiol. 164: 1010 1175–1190. 1011
Berkemeyer, M., Scheibe, R., and Ocheretina, O. (1998). A novel, non-redox-regulated NAD-1012 dependent malate dehydrogenase from chloroplasts of Arabidopsis thaliana L. J. Biol. Chem. 1013 273: 27927–27933. 1014
Birktoft, J.J. and Banaszak, L.J. (1983). The presence of a histidine-aspartic acid pair in the active 1015 site of 2-hydroxyacid dehydrogenases. X-ray refinement of cytoplasmic malate dehydrogenase. 1016 J. Biol. Chem. 258: 472–482.1017
Bodi, Z., Zhong, S., Mehra, S., Song, J., Graham, N., Li, H., May, S., and Fray, R.G. (2012). 1018 Adenosine Methylation in Arabidopsis mRNA is Associated with the 3′ End and Reduced Levels 1019 Cause Developmental Defects. Front. Plant Sci. 3: 1–10. 1020
Botelho Calado, S., Tatsuta, T., Von Heijne, G., and Kim, H. (2013). Dislocation by the m-AAA 1021 protease increases the threshold hydrophobicity for retention of transmembrane helices in the 1022 inner membrane of yeast mitochondria. J. Biol. Chem. 288: 4792–4798. 1023
Breuninger, H., Rikirsch, E., Hermann, M., Ueda, M., and Laux, T. (2008). Differential Expression 1024 of WOX Genes Mediates Apical-Basal Axis Formation in the Arabidopsis Embryo. Dev. Cell 14: 1025
of Arabidopsis arogenate dehydratases suggests novel and non-enzymatic roles. J. Exp. Bot. 1028 68: 1425–1440. 1029
Candela, H., Pérez-Pérez, J.M., and Micol, J.L. (2011). Uncovering the post-embryonic functions of 1030 gametophytic- and embryonic-lethal genes. Trends Plant Sci. 16: 336–345. 1031
Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J.-P., Erhardt, M., Hayes, S., Terry, 1032 M.J., Genschik, P., and Achard, P. (2011). DELLAs Regulate Chlorophyll and Carotenoid 1033 Biosynthesis to Prevent Photooxidative Damage during Seedling Deetiolation in Arabidopsis. 1034 Plant Cell 23: 1849–1860. 1035
Clarke, A.R., Wigley, D.B., Chia, W.N., Barstow, D., Atkinson, T., and Holbrook, J.J. (1986). Site-1036 directed mutagenesis reveals role of mobile arginine residue in lactate dehydrogenase catalysis. 1037 Nature 324: 699–702. 1038
Comparot-Moss, S., Kötting, O., Stettler, M., Edner, C., Graf, A., Weise, S.E., Streb, S., Lue, W.-1039 L., MacLean, D., Mahlow, S., Ritte, G., Steup, M., Chen, J., Zeeman, S.C., and Smith A.M. 1040 (2010). A Putative Phosphatase, LSF1, Is Required for Normal Starch Turnover in Arabidopsis 1041 Leaves. Plant Physiol. 152: 685–697. 1042
Copley, S.D. (2015). An Evolutionary Perspective on Protein Moonlighting. Biochem Soc Trans. 42: 1043 1684–1691. 1044
Copley, S.D. (2003). Enzymes with extra talents: Moonlighting functions and catalytic promiscuity. 1045 Curr. Opin. Chem. Biol. 7: 265–272. 1046
Cvetić, T., Veljović-Jovanović, S., and Vučinić, Ž (2008) Characterization of NAD-dependent 1047 malate dehydrogenases from spinach leaves, Protoplasma 232:247-253. 1048
Demishtein-Zohary, K. and Azem, A. (2017). The TIM23 mitochondrial protein import complex: 1049 function and dysfunction. Cell Tissue Res. 367: 33–41. 1050
Deng, X.W., Caspar, T., and Quail, P.H. (1991). Cop1 : a regulatory locus involved m hght-controlled 1051 development and gene expression in Arabidopsis. Genes Dev. 5: 1172–1182. 1052
Despres, B., Delseny, M., and Devic, M. (2001). Partial complementation of embryo defective 1053 mutations: A general strategy to elucidate gene function. Plant J. 27: 149–159. 1054
Drescher, A., Stephanie, R., Calsa, T., Carrer, H., and Bock, R. (2000). The two largest chloroplast 1055 genome-encoded open reading frames of higher plants are essential genes. Plant J. 22: 97–1056 104. 1057
Engdahl, S., Aronsson, H., Sundqvist, C., Timko, M.P., and Dahlin, C. (2001). Association of the 1058 NADPH:protochlorophyllide oxidoreductase (POR) with isolated etioplast inner membranes from 1059 wheat. Plant J. 27: 297–304. 1060
Emanuelsson, O., Nielsen, H., Brunak, S., and Von Heijne, G. (2000). Predicting subcellular 1061 localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300: 1005–1062 1016. 1063
Feng, J., Fan, P., Jiang, P., Lv, S., Chen, X., and Li, Y. (2014). Chloroplast-targeted Hsp90 plays 1064 essential roles in plastid development and embryogenesis in Arabidopsis possibly linking with 1065 VIPP1. Physiol. Plant. 150: 292–307. 1066
Ferro, M. et al. (2010). AT_CHLORO, a Comprehensive Chloroplast Proteome Database with 1067 Subplastidial Localization and Curated Information on Envelope Proteins. Mol. Cell. Proteomics 1068 9: 1063–1084. 1069
Franzmann, L.H., Yoon, E.S., and Meinke, D.W. (1995). Saturating the Genetic-Map of Arabidopsis 1070 thaliana with Embryonic Mutations. Plant J. 7: 341–350. 1071
Fujii, S., Kobayashi, K., Nagata, N., Masuda, T., and Wada, H. (2017). 1072 Monogalactosyldiacylglycerol Facilitates Synthesis of Photoactive Protochlorophyllide in 1073 Etioplasts. Plant Physiol. 174: 2183–2198. 1074
Fulton, D.C., Stettler, M., Mettler, T., Vauhjan, C.K., Li, J., Francisco, P., Gil, M., Reinhold, H., 1075 Eicke, S., Messerli, G., Dorken, G., Halliday, K., Smith, A.M., Smith, S.M., and Zeeman, S.C. 1076 (2008). ß-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown, Acts Upstream of 1077 Three Active ß-Amylases in Arabidopsis Chloroplasts. Plant Cell Online 20: 1040–1058. 1078
Fusari, C.M., Kooke, R., Lauxmann, M.A., Annunziata, M.G., Encke, B., Hoehne, M., Krohn, N., 1079 Becker, F.F.M., Schlereth, A., Sulpice, R., Stitt, M., and Keurentjes, J.J.B. (2017). Genome-1080 wide Association Mapping Reveals that Specific and Pleiotropic Regulatory Mechanisms Fine-1081 tune Central Metabolism and Growth in Arabidopsis. Plant Cell: tpc.00232.2017. 1082
Gómez, L.D., Gilday, A., Feil, R., Lunn, J.E., and Graham, I.A. (2010). AtTPS1-mediated trehalose 1083 6-phosphate synthesis is essential for embryogenic and vegetative growth and responsiveness 1084 to ABA in germinating seeds and stomatal guard cells. Plant J. 64: 1–13. 1085
33
Goward, C.R. and Nicholls, D.J. (1994). Malate dehydrogenase: A model for structure, evolution, 1086 and catalysis. Protein Sci. 3: 1883–1888. 1087
Grau, U.M., Trommer, W.E., and Rossmann, M.G. (1981). Structure of the active ternary complex of 1088 pig heart lactate dehydrogenase with S-lac-NAD at 2.7 Å resolution. J. Mol. Biol. 151: 289–307. 1089
Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R. (2010). A 1090 ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal 1091 stability and native protein distribution in transient and stable expression studies. Plant J. 64: 1092 355–365. 1093
Gujas, B., Cruz, T.M.D., Kastanaki, E., Vermeer, J.E.M., Munnik, T., and Rodriguez-Villalon, A. 1094 (2017). Perturbing phosphoinositide homeostasis oppositely affects vascular differentiation in 1095 Arabidopsis thaliana roots. Development: dev.155788. 1096
Hatch, M.D. and Osmond, C.B. (1976). Compartmentation and Transport in C4 Photosynthesis. In 1097 Stocking CR, Heber U, eds. Transport in plants III, Vol. 3. Berlin:Springer, pp. 144-184. 1098
He, H., Lee, M.-C., Zheng, L.-L., Zheng, L., and Luo, Y. (2013). Integration of the metabolic/redox 1099 state, histone gene switching, DNA replication and S-phase progression by moonlighting 1100 metabolic enzymes. Biosci. Rep. 33: e00018. 1101
Hebbelmann, I., Selinski, J., Wehmeyer, C., Goss, T., Voss, I., Mulo, P., Kangasjärvi, S., Aro, E.-1102 M., Oelze, M.-L., Dietz, K.-J., Nunes-Nesi, A., Do, P.T., Fernie, A.R., Talla, S.K., 1103 Raghavendra, A.S., Linke, V., and Scheibe, R. (2012). Multiple strategies to prevent oxidative 1104 stress in Arabidopsis plants lacking the malate valve enzyme NADP-malate dehydrogenase. J. 1105 Exp. Bot. 63: 1445–1459. 1106
Heber, U. (1974). Metabolite exchange between chloroplasts and cytoplasm. Annu. Rev. Plant 1107 Physiol. 25: 393–421. 1108
Hendriks, W., Mulders, J.W., Bibby, M. a, Slingsby, C., Bloemendal, H., and de Jong, W.W. 1109 (1988). Duck lens epsilon-crystallin and lactate dehydrogenase B4 are identical: a single-copy 1110 gene product with two distinct functions. Proc. Natl. Acad. Sci. U. S. A. 85: 7114–8. 1111
Heyno, E., Innocenti, G., Lemaire, S.D., Issakidis-Bourguet, E., and Krieger-Liszkay, A. (2014). 1112 Putative role of the malate valve enzyme NADP-malate dehydrogenase in H2O2 signalling in 1113 Arabidopsis. Philos. Trans. R. Soc. B Biol. Sci. 369: 20130228–20130228. 1114
Horrer, D., Flütsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., 1115 Lawson, T., and Santelia, D. (2016). Blue light induces a distinct starch degradation pathway in 1116 guard cells for stomatal opening. Curr. Biol. 26: 362–370. 1117
Huberts, D.H.E.W. and van der Klei, I.J. (2010). Moonlighting proteins: An intriguing mode of 1118 multitasking. Biochim. Biophys. Acta - Mol. Cell Res. 1803: 520–525. 1119
Jang, J.C. (1997). Hexokinase as a Sugar Sensor in Higher Plants. Plant Cell Online 9: 5–19. 1120 Jarvis, P., Dormann, P., Peto, C.A., Lutes, J., Benning, C., and Chory, J. (2000). Galactolipid 1121
deficiency and abnormal chloroplast development in the Arabidopsis MGD synthase 1 mutant. 1122 Proc. Natl. Acad. Sci. 97: 8175–8179. 1123
417. 1126 Journet, E.P., Neuburger, M., and Douce, R. (1981). Role of glutamate-oxaloacetate transaminase 1127
and malate dehydrogenase in the regeneration of NAD for glycine oxidation by spinach leaf 1128 mitochondria. Plant Physiol. 67: 467–469. 1129
Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAY™ vectors for Agrobacterium-mediated 1130 plant transformation. Trends Plant Sci. 7: 193–195. 1131
Kinoshita, H., Nagasaki, J., Yoshikawa, N., Yamamoto, A., Takito, S., Kawasaki, M., Sugiyama, 1132 T., Miyake, H., Weber, A.P.M., and Taniguchi, M. (2011). The chloroplastic 2-1133 oxoglutarate/malate transporter has dual function as the malate valve and in carbon/nitrogen 1134 metabolism. Plant J. 65: 15–26. 1135
Klement, H., Helfrich, M., Oster, U., Schoch, S., and Rüdiger, W. (1999). Pigment-free 1136 NADPH:protochlorophyllide oxidoreductase from Avena sativa L. Purification and substrate 1137 specificity. Eur. J. Biochem. 265: 862–874. 1138
Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M., and Ohta, H. (2007). Galactolipid synthesis 1139 in chloroplast inner envelope is essential for proper thylakoid biogenesis, photosynthesis, and 1140 embryogenesis. Proc. Natl. Acad. Sci. 104: 17216–17221. 1141
Langklotz, S., Baumann, U., and Narberhaus, F. (2012). Structure and function of the bacterial AAA 1142 protease FtsH. Biochim. Biophys. Acta - Mol. Cell Res. 1823: 40–48. 1143
Lebedev, N., Van Cleve, B., Armstrong, G., and Apel, K. (1995). Chlorophyll Synthesis in a 1144 Deetiolated (det340) Mutant of Arabidopsis without NADPH-Protochlorophyllide (PChlide) 1145
34
Oxidoreductase (POR) A and Photoactive PChlide-F655. Plant Cell 7: 2081–2090. 1146 Lee, C., Schwartz, M.P., Prakash, S., Iwakura, M., and Matouschek, A. (2001). ATP-dependent 1147
proteases degrade their substrates by processively unraveling them from the degradation signal. 1148 Mol. Cell 7: 627–637. 1149
Lee, Y., Rubio, M.C., Alassimone, J., and Geldner, N. (2013). A mechanism for localized lignin 1150 deposition in the endodermis. Cell 153: 402–412. 1151
Lu, X., Zhang, D., Li, S., Su, Y., Liang, Q., Meng, H., Shen, S., Fan, Y., Liu, C., and Zhang, C. 1152 (2014). FtsHi4 is essential for embryogenesis due to its influence on chloroplast development in 1153 Arabidopsis. PLoS One 9. 1154
Majsec, K., Bhuiyan, N.H., Sun, Q., Kumari, S., Kumar, V., Ware, D., and van Wijk, K. (2017). The 1155 Plastid and Mitochondrial Peptidase Network in Arabidopsis: A Foundation for Testing Genetic 1156 Interactions and Functions in Organellar Proteostasis. Plant Cell 29: 2687-2710. 1157
Mansfield, S.G. and Briarty, L.G. (1991). Early Embryogenesis in Arabidopsis thaliana .II. the 1158 Developing Embryo. Can. J. Bot. Can. Bot. 69: 461–476. 1159
Martin, A., Baker, T.A., and Sauer, R.T. (2005). Rebuilt AAA + motors reveal operating principles for 1160 ATP-fuelled machines. Nature 437: 1115–1120. 1161
Mascia, P.N. (1978). Studies of Chloroplast Development in Four Maize Mutants Defective in 1162 Chlorophyll Biosynthesis. Planta. 143: 207–211. 1163
Minárik, P., Tomaásková, N., Kollárová, M., and Antalík, M. (2002). Malate Dehydrogenases - 1164 Structure and function. Gen. Physiol. Biophys. 21: 257–265. 1165
Moore, B. (2003). Role of the Arabidopsis Glucose Sensor HXK1 in Nutrient, Light, and Hormonal 1166 Signaling. Science 300: 332–336. 1167
Moore, B.D. (2004). Bifunctional and moonlighting enzymes: Lighting the way to regulatory control. 1168 Trends Plant Sci. 9: 221–228. 1169
Musrati, R.A., Kollárová, M., Mernik, N., and Mikulášová, D. (1998). Malate Dehydrogenase: 1170 Distribution, Function and Properties. Gen. Physiol. Biophys. 17: 193–210. 1171
Nakai, M. (2018). New perspectives on chloroplast protein import. Plant and Cell Physiology, pcy083, 1172 doi.org/10.1093/pcp/pcy083. 1173
Nicholls, D.J., Miller, J., Scawen, M.D., Clarke, A.R., John Holbrook, J., Atkinson, T., and 1174 Goward, C.R. (1992). The importance of arginine 102 for the substrate specificity of Escherichia 1175 coli malate dehydrogenase. Biochem. Biophys. Res. Commun. 189: 1057–1062. 1176
Nickelsen, J. (2005). The Green Alga Chlamydomonas reinhardtii – A Genetic Model Organism. In 1177 Progress in Botany (Heidelberg, Springer-Verlag Berlin), pp. 68–89. 1178
Nielsen, H. and Engelbrecht, J. (1997). Identification of prokaryotic and eukaryotic signal peptides 1179 and prediction of their cleavage sites Artificial neural networks have been used for many 1180 biological. Protein Eng. 10: 1–6. 1181
Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants using artificial 1182 microRNAs and other small RNAs. Plant J. 53: 674–690. 1183
Park, H., Kreunen, S.S., Cuttriss, A.J., DellaPenna, D., and Pogson, B.J. (2002). Identification of 1184 the Carotenoid Isomerase Provides Insight into Carotenoid Biosynthesis, Prolamellar Body 1185 Formation, and Photomorphogenesis. Plant Cell 14: 321–332. 1186
Patton, D.A., Franzmann, L.H., and Meinke, D.W. (1991). Mapping genes essential for embryo 1187 development in Arabidopsis thaliana. Mol. Gen. Genet. 227: 337–347. 1188
Patton, D.A., Schetter, A.L., Franzmann, L.H., Nelson, K., Ward, E.R., and Meinke, D.W. (1998). 1189 An Embryo-Defective Mutant of Arabidopsis Disrupted in the Final Step of Biotin Synthesis. 1190 Plant Physiol. 116: 935–946. 1191
Pracharoenwattana, I., Cornah, J.E., and Smith, S.M. (2007). Arabidopsis peroxisomal malate 1192 dehydrogenase functions in beta-oxidation but not in the glyoxylate cycle. Plant J. 50: 381–90. 1193
Pracharoenwattana, I., Zhou, W., and Smith, S.M. (2010). Fatty acid beta-oxidation in germinating 1194 Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate 1195 dehydrogenase is absent. Plant Mol. Biol. 72: 101–109. 1196
Ruppel, N.J. and Hangarter, R.P. (2007). Mutations in a plastid-localized elongation factor G alter 1197 early stages of plastid development in Arabidopsis thaliana. BMC Plant Biol. 7: 37. 1198
Ryberg, M. and Sundqvist, C. (1982). Characterization of prolamellar bodies and prothylakoids 1199 fractionated from wheat etioplasts. Physiol. Plant. 56: 125–132. 1200
Ryberg, M. and Sundqvist, C. (1988). The regular ultrastructure of isolated prolamellar bodies 1201 depends on the presence of membrane‐bound NADPH‐protochlorophyllide oxidoreductase. 1202 Physiol. Plant. 73: 218–226. 1203
Scheibe, R. (2004). Malate valves to balance cellular energy supply. Physiol. Plant. 120: 21–26. 1204 Scheibe, R. (1987). NADP+‐malate dehydrogenase in C3‐plants: Regulation and role of a light‐1205
Scheibe, R. (2014). The plastid-localized NAD-dependent malate dehydrogenase is crucial for 1208 energy homeostasis in developing Arabidopsis thaliana seeds. Mol. Plant 7: 170–186. 1209
Selstam, E., Schelin, J., Brain, T., and Williams, W.P. (2002). The effects of low pH on the 1210 properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of 1211 maize (Zea mays). Eur. J. Biochem. 269: 2336–2346. 1212
Seung, D., Thalmann, M., Sparla, F., Abou Hachem, M., Lee, S.K., Issakidis-Bourguet, E., 1213 Svensson, B., Zeeman, S.C., and Santelia, D. (2013). Arabidopsis thaliana AMY3 is a unique 1214 redox-regulated chloroplastic α-amylase. J. Biol. Chem. 288: 33620–33633. 1215
Seung D., Soyk, S., Coiro, M., Maier, B.A., Eicke, S., and Zeeman, S.C. (2015). PROTEIN 1216 TARGETING TO STARCH is required for localising GRANULE-BOUND STARCH SYNTHASE 1217 to starch granules and for normal amylose synthesis in Arabidopsis. PLoS Biol. 13:e1002080. 1218
Sew, Y.S., Ströher, E., Fenske, R., and Millar, A.H. (2016). Loss of Mitochondrial Malate 1219 Dehydrogenase Activity Alters Seed Metabolism Impairing Seed Maturation and Post-1220 Germination Growth in Arabidopsis. Plant Physiol. 171: 849–63. 1221
Silverstein, E. and Sulebele, G. (1969). Catalytic mechanism of pig heart mitochondrial malate 1222 dehydrogenase studied by kinetics at equilibrium. Biochemistry 8: 2543–50. 1223
Sokolenko, A., Pojidaeva, E., Zinchenko, V., Panichkin, V., Glaser, V.M., Herrmann, R.G., and 1224 Shestakov, S. V (2002). The gene complement for proteolysis in the cyanobacterium 1225 Synechocystis sp. PCC 6803 and Arabidopsis thaliana chloroplasts. Curr. Genet. 41: 291–310. 1226
Solymosi, K. and Aronsson, H. (2013). Etioplasts and their significance in chloroplast biogensis 36: 1227 155-167. 1228
Solymosi, K. and Schoefs, B. (2010). Etioplast and etio-chloroplast formation under natural 1229 conditions: The dark side of chlorophyll biosynthesis in angiosperms. Photosynth. Res. 105: 1230 143–166. 1231
Sperling, U., Franck, F., van Cleve, B., Frick, G., Apel, K., and Armstrong, G.A. (1998). Etioplast 1232 differentiation in arabidopsis: both PORA and PORB restore the prolamellar body and 1233 photoactive protochlorophyllide-F655 to the cop1 photomorphogenic mutant. Plant Cell 10: 283–1234 296. 1235
Spicher, L., Almeida, J., Gutbrod, K., Pipitone, R., Dörmann, P., Glauser, G., Rossi, M., and 1236 Kessler, F. (2017). Essential role for phytol kinase and tocopherol in tolerance to combined light 1237 and temperature stress in tomato. J. Exp. Bot. 68: 5845–5856. 1238
Taniguchi, M. and Miyake, H. (2012). Redox-shuttling between chloroplast and cytosol: Integration 1239 of intra-chloroplast and extra-chloroplast metabolism. Curr. Opin. Plant Biol. 15: 252–260. 1240
Tatsuta, T., Augustin, S., Nolden, M., Friedrichs, B., and Langer, T. (2007). m-AAA protease-1241 driven membrane dislocation allows intramembrane cleavage by rhomboid in mitochondria. 1242 EMBO J. 26: 325–335. 1243
Tomaz, T., Bagard, M., Pracharoenwattana, I., Linden, P., Lee, C.P., Carroll, A.J., Stroher, E., 1244 Smith, S.M., Gardestrom, P., and Millar, A.H. (2010). Mitochondrial Malate Dehydrogenase 1245 Lowers Leaf Respiration and Alters Photorespiration and Plant Growth in Arabidopsis. Plant 1246 Physiol. 154: 1143–1157. 1247
Tschopp, M.-A., Iki, T., Brosnan, C.A., Jullien, P.E., and Pumplin, N. (2017). A complex of 1248 Arabidopsis DRB proteins can impair dsRNA processing. RNA 23: 782–797. 1249
Wagner, R., Aigner, H., and Funk, C. (2012). FtsH proteases located in the plant chloroplast. 1250 Physiol. Plant. 145: 203–214. 1251
Wigley, D.B., Gamblin, S.J., Turkenburg, J.P., Dodson, E.J., Piontek, K., Muirhead, H., and 1252 Holbrook, J.J. (1992). Structure of a ternary complex of an allosteric lactate dehydrogenase 1253 from Bacillus stearothermophilus at 2.5 A resolution. J. Mol. Biol. 223: 317–35. 1254
Wistow, G.J., Mulders, J.W., and de Jong, W.W. (1987). The enzyme lactate dehydrogenase as a 1255 structural protein in avian and crocodilian lenses. Nature 326: 622–4. 1256
Yang, S.S. and Zhai, Q.H. (2017). Cytosolic GAPDH: a key mediator in redox signal transduction in 1257 plants. Biol. Plant. 61: 417–426. 1258
Yu, B., Wakao, S., Fan, J., and Benning, C. (2004). Loss of plastidic lysophosphatidic acid 1259 acyltransferase causes embryo-lethality in Arabidopsis. Plant Cell Physiol. 45: 503–510. 1260
Zaffagnini, M., Fermani, S., Costa, A., Lemaire, S.D., and Trost, P. (2013). Plant cytoplasmic 1261 GAPDH: redox post-translational modifications and moonlighting properties. Front. Plant Sci. 4: 1262 1–18. 1263
Zhang, X., Henriques, R., Lin, S.-S., Niu, Q.-W., and Chua, N.-H. (2006). Agrobacterium-mediated 1264 transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1: 641–6. 1265
36
Zhao, Y., Luo, L., Xu, J., Xin, P., Guo, H., Wu, J., Bai, L., Wang, G., Chu, J., Zuo, J., Hong, Y., 1266 Huang, X., and Li, J. (2018). Malate transported from chloroplast to mitochondrion triggers 1267 production of ROS and PCD in Arabidopsis thaliana. Cell Research 28 (4): 448-461. 1268
1269 1270
FIGURE LEGENDS 1271
Figure 1 Embryo-specific expression of pdNAD-MDH to rescue the embryo lethality 1272
of pdnad-mdh plants. 1273
(A) Schematic diagram of the PABI3:pdNAD-MDH-YFP and PpdNAD-MDH:pdNAD-MDH-1274
YFP constructs. For the former construct, the ABI3 promoter (PABI3) was placed 1275
upstream of the pdNAD-MDH coding sequence fused at its C-terminus to YFP. The 1276
latter construct was described by Beeler et al. (2014). 1277
(B) Opened siliques of pdNAD-MDH+/− plants transformed with the PABI3:pdNAD-1278
MDH-YFP construct. Siliques from the wild type (Ler), untransformed (UT) pdNAD-1279
MDH+/− plants, and pdNAD-MDH+/− transformed with the PpdNAD-MDH:pdNAD-MDH-1280
YFP construct are shown for comparison. White seeds are indicated with an arrow. 1281
Bar = 1 mm. 1282
(C) Expression of the PABI3:pdNAD-MDH-YFP construct in Arabidopsis embryos after 1283
transformation of pdNAD-MDH+/− plants. Expression was detected by fluorescence 1284
microscopy on embryos at three different developmental stages (globular, heart and 1285
torpedo). Bar = 50 µM. 1286
1287
1288
Figure 2 Phenotype of pdnad-mdh mutants rescued by the embryo-specific 1289
expression of pdNAD-MDH. 1290
(A) Photographs of 14-day-old seedlings of pdnad-mdh plants expressing the 1291
PABI3:pdNAD-MDH-YFP construct, grown on ½-strength MS agar plates under a 12-h 1292
light/12-h dark regime. The PABI3:pdNAD-MDH-YFP construct was transformed into 1293
pdNAD-MDH+/− plants, and a T3 population that was segregating for the pdnad-mdh 1294
T-DNA insertion but not for the PABI3:pdNAD-MDH-YFP construct was obtained. Two 1295
examples of pale plants that resembled the constitutive silencing line, miR-mdh-1, 1296
are shown, while the other plants resembled the wild-type Ler, or pdnad-mdh+/−. A 1297
pdnad-mdh −/− plant complemented with the PpdNAD-MDH:pdNAD-MDH-YFP construct 1298
is also shown. Bars = 500 µm. 1299
(B) Photographs of 4-week-old pdnad-mdh−/− seedlings rescued with the 1300
PABI3:pdNAD-MDH-YFP construct. Close-up images of their meristematic zones and 1301
37
their cotyledons are shown. Bars in the left-hand panels = 500 µm, Bars in the 1302
middle and right-hand panels = 100 µm. 1303
(C) Transmission electron micrographs of plastids in pdnad-mdh−/− seedlings 1304
rescued with the PABI3:pdNAD-MDH-YFP construct. Plastids from cotyledons are 1305
shown for the wild type (Ler) and pdnad-mdh −/−, and a plastid in a true leaf of pdnad-1306
mdh −/− is shown on the right. Bars = 500 nm. 1307
1308
Figure 3 Immunoblot and native-PAGE detection of pdNAD-MDH in Ler, miR-mdh-1 1309
and pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP construct. 1310
(A) Immunoblots were conducted with the pdNAD-MDH antibody. Equal amounts of 1311
soluble protein (5 µg) were loaded. The migration of molecular weight markers is 1312
indicated (left). 1313
(B) In-gel activity assay of the NAD-MDH. The two bands corresponding to pdNAD-1314
MDH activity are indicated (arrows, right). Equal amounts of protein (15 µg) were 1315
loaded. 1316
1317
Figure 4 β-estradiol-inducible silencing of pdNAD-MDH in mature plant rosettes. 1318
XVE OLEXA:miR-mdh-1 plants photographed before and after a 6 day treatment 1319
with β-estradiol or a mock treatment. 1320
(A) Photographs in the top row were taken before β-estradiol treatment (D0), and 1321
those in the bottom row after 6 days (D6). β-estradiol solution (20 µM) was sprayed 1322
every second day onto the entire rosette. β-estradiol was applied to wild-type (Col) 1323
plants as a control. Mock-treated samples were sprayed with water containing the 1324
same amount of DMSO as the treatment solution (used to dissolve the β-estradiol). 1325
Red arrows indicate examples of white, newly emerging leaves. 1326
(B) Immunoblot detection of pdNAD-MDH in total protein extracts of wild-type and 1327
XVE OLEXA:miR-mdh-1 plants before (D0) and 6 days into β-estradiol treatment 1328
(D6). For the treated XVE OLEXA:miR-mdh-1 plants, proteins were extracted from 1329
the old, green leaves (D6o) and young, white leaves (D6y) separately. Gels were 1330
loaded on an equal leaf area basis. The migration of molecular weight markers is 1331
indicated on the left. pdNAD-MDH and actin (as a loading control) were detected 1332
concurrently on the same membrane using secondary antibodies conjugated to 1333
different infrared fluorescence dyes (800CW for pdNAD-MDH and 680RD for actin). 1334
(C) As for (B), but with old leaves from mock-treated samples. 1335
38
1336
Figure 5 Etiolated growth of miR-mdh-1 and etioplast structure. 1337
(A) Wild-type (Col) and miR-mdh-1 seedlings were grown on ½-strength MS agar 1338
plates in different diel light conditions (24 h dark, 12 h light/12 h dark, 24 h light). Bar 1339
= 1 cm. 1340
(B) Quantification of the hypocotyl length of etiolated wild-type and miR-mdh-1 1341
seedlings. Values represent the mean ± SE of measurements conducted on n=89 1342
and n=86 seedlings for the wild type and miR-mdh-1, respectively. 1343
(C) Etioplast ultrastructure in cotyledons of etiolated wild-type and miR-mdh-1 1344
seedlings observed by transmission electron microscopy. Bars = 500 nm 1345
(D) Proportion of etioplasts showing normal, compromised, or absent prolamellar 1346
body structures in cotyledons of the wild type and miR-mdh-1. The first 139 and 256 1347
etioplasts, observed in wild-type and miR-mdh-1 cotyledons, respectively, were 1348
categorized based on their prolamellar body structure. 1349
1350
Figure 6 Protochlorophylide, galactolipid and β-carotene contents of miR-mdh-1 1351
seedlings. 1352
(A) Protochlorophyllide levels in 5-day-old wild-type (Col) and miR-mdh-1 etiolated 1353
seedlings, measured by fluorescence after excitation at 440 nm. Values are the 1354
means ± SE of three biological replicates, each measured with four technical 1355
replicates. Each biological replicate is a pool of 100-200 individual seedlings. 1356
(B) Immunoblot detection of protochlorophyllide oxidoreductase A (PORA) in total 1357
protein extracts from 6-day-old etiolated wild-type and miR-mdh-1 seedlings (upper 1358
panel). Immunoblots for actin was performed as a loading control (lower panel). Gels 1359
were loaded on an equal fresh weight basis. Three biological replicates are shown. 1360
Each biological replicate is a pool of 50-100 individual seedlings. 1361
(C-F) Lipids and carotenoids were extracted from 6-day-old wild-type and miR-mdh-1 1362
seedlings, either etiolated (e) or light grown (l; grown under a 12-h light/12-h dark 1363
AT4G13670 Plastid transcriptionally active 5 5 16 30
AT3G23920 Beta-amylase 1 0 0 12
AT5G53860 Embryo defective 2737 5 3 10
AT2G40300 Ferritin 4 10 3 9
AT1G48460 tRNA-processing ribonuclease BN 5 2 7
AT3G56090 Ferritin 3 5 0 5
AT5G22640 Embryo defective 1211, Tic100 0 0 5
AT5G63040 Transmembrane protein 3 2 4
AT4G17090 Beta-amylase 3 0 0 4
AT4G28210 Embryo defective 1923 2 2 4
AT5G01600 Ferritin 1
8 0 3
AT5G59500 Protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase
3 2 3
AT3G61780 Embryo defective 1703 0 0 3
AT1G31330 Photosystem I subunit F 0 0 2
ATCG00900 Chloroplast ribosomal protein S7 0 0 2
ATCG00830 Ribosomal protein L2 0 0 2
AT5G14320 Embryo defective 3137 0 0 2
ATCG00190 RNA polymerase subunit beta 2 0 0
AT5G16130 Ribosomal protein S7e family protein 2 0 0
AT3G18420 Slow green 1 3 0 0
Table 1 Proteins identified in anti-YFP immunoprecipitates from plants expressing pdNAD-MDH-YFP. IPs were conducted with anti-YFP beads on extracts of material harvested at three different developmental stages, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control samples (IPs from wild-type plant extracts) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.
AT1G01320 Tetratricopeptide repeat (TPR)-like superfamily protein
6 32
AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159
37 31
AT5G53860 Embryo defective 2737 13 26
ATCG00480 ATP synthase subunit beta 8 23
AT3G47520 pdNAD-MDH 5 22
AT1G07920 GTP binding Elongation factor Tu family protein 15 20
AT1G43170 Ribosomal protein 1 5 20
ATCG00120 ATP synthase subunit alpha 42 19
ATCG00490 Ribulose-bisphosphate carboxylase 48 16
AT5G01590 Histone-lysine N-methyltransferase ATXR3-like protein
14 16
AT2G41840 Ribosomal protein S5 family protein 6 16
Table 2 Proteins identified in anti-YFP immunoprecipitates from two independent lines overexpressing FtsH12-YFP. The IPs were conducted with anti-YFP beads on extracts of material harvested from rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control sample (IPs from wild-type plants) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.
AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159
29 0 0 0 0
Table 3 Proteins identified in IPs of YFP-tagged NAD-MDH proteins (AtpdNAD-MDH, AtcyMDH1, ScmMDH1, AtmMDH1 and AtpMDH) expressed in heterozygous pdnad-mdh plants. IPs were conducted with anti-YFP beads on extracts of rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins also identified in the control sample (Ler) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.
AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159
25 95 113 133
AT3G01510 like SEX4 1 159 58 105 23
AT5G53860 Embryo defective 2737 30 54 55 54
Table 4 Proteins identified in anti-HA immunoprecipitates from homozygous pdnad-mdh plants expressing non-catalytic versions of pdNAD-MDH. The IPs were conducted with anti-HA beads on extracts of rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control sample (IPs from wild-type [Ler] plant extracts) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.
46
1451
Figure 1 Embryo-specific expression of pdNAD-MDH to rescue the embryo lethality of pdnad-mdh plants.
(A) Schematic diagram of the PABI3:pdNAD-MDH-YFP and PpdNAD-MDH:pdNAD-MDH-YFP constructs. For the former construct,
the ABI3 promoter (PABI3) was placed upstream of the pdNAD-MDH coding sequence fused at its C-terminus to YFP. The
latter construct was described by Beeler et al. (2014).
(B) Opened siliques of pdNAD-MDH+/− plants transformed with the PABI3:pdNAD-MDH-YFP construct. Siliques from the wild
type (Ler), untransformed (UT) pdNAD-MDH+/− plants, and pdNAD-MDH+/− transformed with the PpdNAD-MDH:pdNAD-MDH-
YFP construct are shown for comparison. White seeds are indicated with an arrow. Bar = 1 mm.
(C) Expression of the PABI3:pdNAD-MDH-YFP construct in Arabidopsis embryos after transformation of pdNAD-MDH+/−
plants. Expression was detected by fluorescence microscopy on embryos at three different developmental stages (globular,
heart and torpedo). Bar = 50 µM.
A
1000 bp
Scale
C
Ler UT
PABI3:
pdNAD-MDH-
YFP
PpdNAD-MDH:
pdNAD-MDH-
YFP
pdnad-mdh+/- B
YFP pdNAD-MDH PABI3
YFP pdNAD-MDH PpdNAD-MDH
Figure 2 Phenotype of pdnad-mdh mutants rescued by the embryo-specific expression of pdNAD-MDH.
(A) Photographs of 14-day-old seedlings of pdnad-mdh plants expressing the PABI3:pdNAD-MDH-YFP construct, grown on ½-
strength MS agar plates under a 12-h light/12-h dark regime. The PABI3:pdNAD-MDH-YFP construct was transformed into
pdNAD-MDH+/− plants, and a T3 population that was segregating for the pdnad-mdh T-DNA insertion but not for the
PABI3:pdNAD-MDH-YFP construct was obtained. Two examples of pale plants that resembled the constitutive silencing line,
miR-mdh-1, are shown, while the other plants resembled the wild-type Ler, or pdnad-mdh+/−. A pdnad-mdh −/− plant
complemented with the PpdNAD-MDH:pdNAD-MDH-YFP construct is also shown. Bars = 500 µm.
(B) Photographs of 4-week-old pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP construct. Close-up images
of their meristematic zones and their cotyledons are shown. Bars in the left-hand panels = 500 µm, Bars in the middle and
right-hand panels = 100 µm.
(C) Transmission electron micrographs of plastids in pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP
construct. Plastids from cotyledons are shown for the wild type (Ler) and pdnad-mdh −/−, and a plastid in a true leaf of pdnad-
mdh −/− is shown on the right. Bars = 500 nm.
C
Ler (cotyledon)
pdnad-mdh−/− PABI3:pdNAD-
MDH-YFP #1 (cotyledon)
pdnad-mdh−/− PABI3:pdNAD-
MDH-YFP #1 (true leaf)
Ler pdnad-mdh+/− pdnad-mdh
PABI3:pdNAD-MDH-YFP (T3 gen.)
A miR-mdh-1
pdnad-mdh −/− PpdNAD-MDH:
pdNAD-MDH-
YFP
B pdnad-mdh −/− PABI3:pdNAD-MDH-YFP #1
pdnad-mdh −/− PABI3: pdNAD-MDH-YFP #2
Figure 3 Immunoblot and native-PAGE detection of pdNAD-MDH in Ler, miR-mdh-1 and pdnad-mdh−/− seedlings rescued
with the PABI3:pdNAD-MDH-YFP construct.
(A) Immunoblots were conducted with the pdNAD-MDH antibody. Equal amounts of soluble protein (5 µg) were loaded. The
migration of molecular weight markers is indicated (left).
(B) In-gel activity assay of the NAD-MDH. The two bands corresponding to pdNAD-MDH activity are indicated (arrows, right).
Equal amounts of protein (15 µg) were loaded.
A
Ler
pdnad-mdh−/− PABI3:pdNAD-
MDH-YFP #2
miR-
mdh-1 kDa
35 pdNAD-
MDH
B
55
Figure 4 β-estradiol-inducible silencing of pdNAD-MDH in mature plant rosettes. XVE OLEXA:miR-mdh-1 plants photographed
before and after a 6 day treatment with β-estradiol or a mock treatment.
(A) Photographs in the top row were taken before β-estradiol treatment (D0), and those in the bottom row after 6 days (D6).
β-estradiol solution (20 µM) was sprayed every second day onto the entire rosette. β-estradiol was applied to wild-type (Col)
plants as a control. Mock-treated samples were sprayed with water containing the same amount of DMSO as the treatment
solution (used to dissolve the β-estradiol). Red arrows indicate examples of white, newly emerging leaves.
(B) Immunoblot detection of pdNAD-MDH in total protein extracts of wild-type and XVE OLEXA:miR-mdh-1 plants before (D0)
and 6 days into β-estradiol treatment (D6). For the treated XVE OLEXA:miR-mdh-1 plants, proteins were extracted from the
old, green leaves (D6o) and young, white leaves (D6y) separately. Gels were loaded on an equal leaf area basis. The
migration of molecular weight markers is indicated on the left. pdNAD-MDH and actin (as a loading control) were detected
concurrently on the same membrane using secondary antibodies conjugated to different infrared fluorescence dyes (800CW
for pdNAD-MDH and 680RD for actin).
(C) As for (B), but with old leaves from mock-treated samples.
A
XVE OLEXA:miR-mdh-1
Col #1-2 #2-3
XVE OLEXA:miR-mdh-1
Col #1-2 #2-3
β-estradiol treatment mock treatment
kDa
55
35 pdNAD-MDH
actin
Col
XVE OLEXA:miR-mdh-1
D0 D6
1 2 1 2 1 2 1 2 1 2 1 2
D0 D6 D0
#1-2 #2-3
D6
C
B
pdNAD-
MDH
kDa
55
35
Col
XVE OLEXA:miR-mdh-1
D0 D6
1 2 1 2 1 2 1o 1y 2o 2y 1 2
D0 D6 D0 D6
#1-2
1o 1y 2o 2y
#2-3
actin
miR-mdh-1
miR-mdh-1
miR-mdh-1
Col
Col
miR-mdh-1
Col D
88.5
3.9
1.4
59.8
10.1
36.3
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Col miR-mdh-1
normal compromised absent
Prolamellar body (PLB) structure
0
2
4
6
8
10
12
14
16
18
20
Col-0 miR-mdh-1
hypocoty
l le
ngth
[m
m]
Col miR-mdh-1
Figure 5 Etiolated growth of miR-mdh-1 and etioplast structure.
(A) Wild-type (Col) and miR-mdh-1 seedlings were grown on ½-strength MS agar plates in different diel light conditions (24 h
dark, 12 h light/12 h dark, 24 h light). Bar = 1 cm.
(B) Quantification of the hypocotyl length of etiolated wild-type and miR-mdh-1 seedlings. Values represent the mean ± SE of
measurements conducted on n=89 and n=86 seedlings for the wild type and miR-mdh-1, respectively.
(C) Etioplast ultrastructure in cotyledons of etiolated wild-type and miR-mdh-1 seedlings observed by transmission electron
microscopy. Bars = 500 nm
(D) Proportion of etioplasts showing normal, compromised, or absent prolamellar body structures in cotyledons of the wild
type and miR-mdh-1. The first 139 and 256 etioplasts, observed in wild-type and miR-mdh-1 cotyledons respectively, were
categorized based on their prolamellar body structure.
A B
C
Col miR-mdh-1
Col miR-mdh-1
24 h dark
12 h light/12 h dark
24 h light
100
90
80
70
60
50
40
30
20
10
Perc
enta
ge o
f etiopla
sts
[%
]
A B
0
0.5
1
1.5
2
2.5
Col-0 miR-mdh-1
Flu
ore
sce
nce
/mg
FW
Col miR-mdh-1
E F
0
50
100
150
200
250
300
350
Col-0, lightgrown
Col-0, darkgrown
miR-mdh-1,light grown
miR-mdh-1,dark grown
β-carotene
Re
l. q
uantifica
tion
Col miR-mdh-1
e e l l
* *
C
Re
l. q
uantifica
tion
*
α-PORA
Col
miR-
mdh-1 Col
miR-
mdh-1 Col
miR-
mdh-1
α-actin
Protochlorophyllide
Figure 6 Protochlorophylide, galactolipid and β-carotene content of miR-mdh-1 seedlings.
(A) Protochlorophyllide levels in 5-day-old wild-type (Col) and miR-mdh-1 etiolated seedlings, measured by fluorescence after
excitation at 440 nm. Values are the means ± SE of three biological replicates, each measured with four technical replicates.
Each biological replicate is a pool of 50-100 individual seedlings.
(B) Immunoblot detection of protochlorophyllide oxidoreductase A (PORA) in total protein extracts from 6-day-old etiolated
wild-type and miR-mdh-1 seedlings (upper panel). Immunoblots for actin was performed as a loading control (lower panel).
Gels were loaded on an equal fresh weight basis. Three biological replicates are shown. Each biological replicate is a pool of
50-100 individual seedlings.
(C-F) Lipids and carotenoids were extracted from 6-day-old wild-type and miR-mdh-1 seedlings, either etiolated (e) or light
grown (l; grown under a 12-h light/12-h dark regime). Levels of Diacylglycerol (DAG) (C), MGDG 18:3/16:3 (D) DGDG
18:3/18:3 (E) and β-carotene (F) are shown. For the lipids, only the most common species (in terms of fatty acid chain
composition) is shown; similar trends were seen in other detected species (Supplemental Table 1). All lipids and carotenoids
were quantified relative to an internal standard, and values were corrected for differences in fresh weight (see Methods for
details). Values are the mean ± SE from four biological replicates. Each biological replicate is a pool of 50-100 individual
seedlings. Significant differences (p < 0.05) within the respective light-grown and etiolated samples of miR-mdh-1 and the
wild type, determined using a two-tailed t-test, are indicated with an asterisk.
Re
l. q
uantifica
tion
D
Re
l. q
uantifica
tion
0
500
1000
1500
2000
2500
Col-0, lightgrown
Col-0, darkgrown
miR-mdh-1,light grown
miR-mdh-1,dark grown
MGDG-18:3/16:3
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
Col-0, lightgrown
Col-0, darkgrown
miR-mdh-1,light grown
miR-mdh-1,dark grown
DAG-18:0/18:0
e e l l
Col miR-mdh-1
e e l l
*
*
Col miR-mdh-1
0
200
400
600
800
1000
1200
Col-0, lightgrown
Col-0, darkgrown
miR-mdh-1,light grown
miR-mdh-1,dark grown
DGDG-18:3/18:3
Col miR-mdh-1
e e l l
*
*
Figure 7 Complementation test with various NAD-MDH isoforms expressed in pdnad-mdh.
(A) Constructs encoding NAD-MDH isoforms under the control of the pdNAD-MDH promoter. The plastidial transit
peptide from RubisCO small subunit was fused to the N-terminus of each isoform. The constructs shown are tagged at
the C-terminus with YFP. Similar constructs were cloned with the Flag-HA tag in place of YFP.
(B) Genotyping results of the T2 progeny from T1 plants heterozygous for the pdnad-mdh mutation and expressing the
different NAD-MDH isoforms. Numbers above the bars indicate the number of BASTA-resistant T2 plants that were
genotyped.
(C) Chloroplast localization of the NAD-MDH isoforms. Similar constructs to those shown in A, except with the 35S
promoter in place of the native promoter, were transiently expressed in Nicotiana benthamiana leaves and imaged using
confocal microscopy. Bar = 5µm.
1000 bp
Scale
A
PpdNAD-MDH TP
YFP
PpdNAD-MDH TP
PpdNAD-MDH TP
YFP
PpdNAD-MDH AtpMDH1 TP
YFP
YFP
AtmMDH1
ScmMDH1
AtcyMDH1
0%
25%
50%
75%
100%
At
CY
MD
H-Y
FP
Sc M
MD
H-Y
FP
At
MM
DH
-YF
P
At
PM
DH
-YF
P
At
CY
MD
H-F
lag
HA
Sc M
MD
H-F
lag
HA
At
MM
DH
-Fla
gH
A
At
PM
DH
-Fla
gH
A
pdnad-mdh+/-
He Wt Ho
Pe
rcenta
ge o
f T
2 s
eedlin
gs [%
]
+/− +/+ −/− pdnad-mdh genotype:
B
150 149 180 180 149 122 149 150
AtcyMDH
-YFP
ScmMDH
-YFP
AtmMDH
-YFP
AtpMDH
-YFP
YF
P
YF
P +
Ch
l B
F +
Ch
l
C
Figure 8 Enzymatically-inactive pdNAD-MDH proteins can complement the embryo lethality and growth defects of the pdnad-mdh
mutant.
(A) Catalytic centre of the Arabidopsis pdNAD-MDH structure. The pdNAD-MDH protein sequence (without cTP) was modelled
using the human malate- and NADH-bound MMDH2 crystal structure (PDB: 2DFD) as a template. Left panel shows NADH (red)
and malate (yellow), and the relative position of the conserved catalytic amino acid residues of pdNAD-MDH. A detailed view of the
malate-binding site is shown in the upper right panel. The surface of the catalytic pocket is shown in the lower right panel.
(B) An in-vitro activity assay was performed using purified recombinant proteins. The proteins (10 µg) were incubated with an
excess of cofactor (NADH) at 22°C. The reaction was started by the addition of excess substrate (oxaloacetate). The velocity was
determined by measuring the decrease in absorbance at 340 nm resulting from the conversion of NADH to NAD+. Error bars
indicate mean ± SE (n=3).
(C) Genotyping results of T2 progeny from T1 plants heterozygous for pdnad-mdh and expressing the enzymatically-inactive
pdNAD-MDH proteins. Numbers above the bars indicate the number of BASTA-resistant T2 plants that were genotyped.
(D) Photographs showing 3-week-old rosettes of homozygous pdnad-mdh plants complemented with enzymatically-inactive pdNAD-
MDH mutants. For comparison, wild-type (Ler) plants are shown. Plants were grown under long days (16 h light/8 h dark).
(E) NAD-MDH activity observed by native-PAGE. Equal amounts of protein (15 µg) were loaded per lane, and all lanes were run on
the same gel. pdNAD-MDH runs in distinct activity bands (a,b,c). While the fastest migrating band (c) corresponding to the free
dimer is masked by other NAD-MDH activity, the two slower migrating bands that correspond to NAD-MDH in protein complexes
can be easily observed (a,b). Additional activity bands (a’, b’) are observed for plants heterozygous for the pdnad-mdh T-DNA
insertion expressing the catalytic-inactive pdNAD-MDH variants, possibly due to dimer formation between an inactive pdNAD-MDH
with an endogenous form of pdNAD-MDH protein.
H258
D231
R162
R168
R234
D231
R234
H258
R168
R162
D115
0.00
0.02
0.04
0.06
0.08
0.10
0.12
ve
loctiy [m
in-1
]
pdNAD-MDH
WT R162Q R234Q R162Q
R234Q
blank
A
C
E
0%
25%
50%
75%
100%
pdNAD-MDHR162Q
pdNAD-MDHR234Q
pdNAD-MDHR162QR234Q
pdnad-mdh+/-
He Wt Ho
Pe
rcenta
ge o
f T
2 s
eedlin
gs [%
]
R162Q R234Q R162Q
R234Q
pdNAD-MDH
construct:
+/− +/+ −/− pdnad-mdh genotype:
pdnad-mdh background
Le
r
#2
-3-1
#3
-1-1
7
#2
-3-2
1
+/− −/−
R162Q pdNAD-MDH construct:
pdnad-mdh genotype:
#2
-4-1
#2
-4-1
3
#3
-6-2
0
#3
-4-1
#3
-4-3
#4
-5-2
8
+/− −/−
R234Q
+/− −/−
R162Q R234Q
B
D
Ler pdnad-mdh-/-
R162Q R234Q
R162Q
R234Q
pdNAD-MDH construct: 73 69 78
Co
l
miR
-
md
h-1
a
b
c
a’
b’
+3259 +3279
5’UTR 3’UTR
+1 +5333bp
At1G79560
GAGACAAGCTGTGATATTTAT
CCGTGAGTTGACAAGGTATAT
+4777 +4797 amiRNA target A
amiRNA target B
A
B
C
Figure 9 Constitutive and inducible silencing of the FtsH12 protein.
(A) In Arabidopsis, the FtsH12 gene consists of 19 exons and 18 introns. The sequence and position of the target for
artificial microRNA silencing are indicated. Numbers represent nucleotide positions relative to the translational start site
+1.
(B) Constitutive silencing of FtsH12 resulted in plants with varying degrees of paleness and delayed growth phenotype
in the T1 generation. Plants were grown under a 12-h light/12-h dark regime for 6 weeks. Both amiRNA constructs
produced plants with comparable phenotypes. The identical wild type (Col) plant was used for both the left and right
panels. Bar = 2 cm.
(C) Immunoblot analysis of total protein extracts from the amiRNA FtsH12 lines, using the FtsH12 antibody (upper
panel), pdNAD-MDH antibody (lower panel) and actin antibody as a loading control (both panels). The migration of
molecular weight markers is indicated (left). The gel was loaded on an equal protein (15 µg) basis.
miR-mdh-1
amiRNA
FtsH12 A 3-1
amiRNA
FtsH12 B 2-1
Col
Col amiRNA FtsH12 A
14-1 11-1
Col amiRNA FtsH12 B
4-1 1-1
Col amiRNA FtsH12 A
actin
FtsH12
actin
14-1 11-1 3-1 1 2
70
100
130
55
55
35
kDa
pdNAD-MDH
miR-
mdh-1
amiRNA FtsH12 B
4-1 1-1 2-1
Figure 10 Isothermal titration calorimetry (ITC) thermograms of NADH titrated into the pdNAD-MDH WT
and inactive proteins.
(A) ITC profile of NADH injected into a solution of recombinant His-pdNAD-MDH WT protein at 25°C. The
upper panel shows the raw calorimetric data. The plot below shows the integrated enthalpy as a function of
the NADH/pdNAD-MDH molar ratio. Reactions are exothermic.
(B-D) Experiments were conducted as described for (A) with the His-pdNAD-MDH R162Q protein (B), the
His-pdNAD-MDH R234Q protein (C), and the His-pdNAD-MDH R162Q R234Q protein (D).
pdNAD-MDH R234Q pdNAD-MDH R162Q R234Q
A B
C D
pdNAD-MDH WT pdNAD-MDH R162Q
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
-6
-4
-2
0
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5-6
-4
-2
0
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6
-4
-2
0
2
-0.6
-0.5
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6
-4
-2
0
-0.7
-0.6
-0.5
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
-6
-4
-2
0
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5-6
-4
-2
0
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6
-4
-2
0
2
-0.6
-0.5
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6
-4
-2
0
-0.7
-0.6
-0.5
-0.4
-0.3
-0.2
-0.1
0.0
0.10 25 50 75 100 125 150 175 200 225
Time (min)
µca
l/sec
Molar ratio
kcal/m
ole
of in
ject
ant
Figure 11 A model for the interaction of pdNAD-MDH with the heteromeric FtsH12-FtsHi AAA-
ATPase complex at the chloroplast inner envelope membrane, which plays an essential role in
chloroplast development.
Ycf2
pdNAD-
MDH
stroma
putative Zinc
binding domain
ATPase
domain
inner chloroplast membrane
outer chloroplast membrane
pdNAD-
MDH
Chloroplast
development
Prolamellar body
formation
FtsH12/FtsHi1/FtsHi2/
FtsHi4/FtsHi5 complex
Parsed CitationsBahl, J., Francke, B., and Monéger, R. (1976). Lipid composition of envelopes, prolamellar bodies and other plastid membranes inetiolated, green and greening wheat leaves. Planta 129: 193–201.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Beeler, S., Liu, H.-C., Stadler, M., Schreier, T., Eicke, S., Lue, W.-L., Truernit, E., Zeeman, S.C., Chen, J., and Kotting, O. (2014).Plastidial NAD-Dependent Malate Dehydrogenase Is Critical for Embryo Development and Heterotrophic Metabolism in Arabidopsis.Plant Physiol. 164: 1175–1190.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Berkemeyer, M., Scheibe, R., and Ocheretina, O. (1998). A novel, non-redox-regulated NAD-dependent malate dehydrogenase fromchloroplasts of Arabidopsis thaliana L. J. Biol. Chem. 273: 27927–27933.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Birktoft, J.J. and Banaszak, L.J. (1983). The presence of a histidine-aspartic acid pair in the active site of 2-hydroxyaciddehydrogenases. X-ray refinement of cytoplasmic malate dehydrogenase. J. Biol. Chem. 258: 472–482.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bodi, Z., Zhong, S., Mehra, S., Song, J., Graham, N., Li, H., May, S., and Fray, R.G. (2012). Adenosine Methylation in Arabidopsis mRNA isAssociated with the 3′ End and Reduced Levels Cause Developmental Defects. Front. Plant Sci. 3: 1–10.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Botelho Calado, S., Tatsuta, T., Von Heijne, G., and Kim, H. (2013). Dislocation by the m-AAA protease increases the thresholdhydrophobicity for retention of transmembrane helices in the inner membrane of yeast mitochondria. J. Biol. Chem. 288: 4792–4798.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Breuninger, H., Rikirsch, E., Hermann, M., Ueda, M., and Laux, T. (2008). Differential Expression of WOX Genes Mediates Apical-BasalAxis Formation in the Arabidopsis Embryo. Dev. Cell 14: 867–876.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bross, C.D., Howes, T.R., Rad, S.A., Kljakic, O., and Kohalmi, S.E. (2017). Subcellular localization of Arabidopsis arogenatedehydratases suggests novel and non-enzymatic roles. J. Exp. Bot. 68: 1425–1440.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Candela, H., Pérez-Pérez, J.M., and Micol, J.L. (2011). Uncovering the post-embryonic functions of gametophytic- and embryonic-lethalgenes. Trends Plant Sci. 16: 336–345.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J.-P., Erhardt, M., Hayes, S., Terry, M.J., Genschik, P., and Achard, P. (2011).DELLAs Regulate Chlorophyll and Carotenoid Biosynthesis to Prevent Photooxidative Damage during Seedling Deetiolation inArabidopsis. Plant Cell 23: 1849–1860.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Clarke, A.R., Wigley, D.B., Chia, W.N., Barstow, D., Atkinson, T., and Holbrook, J.J. (1986). Site-directed mutagenesis reveals role ofmobile arginine residue in lactate dehydrogenase catalysis. Nature 324: 699–702.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Comparot-Moss, S., Kötting, O., Stettler, M., Edner, C., Graf, A., Weise, S.E., Streb, S., Lue, W.-L., MacLean, D., Mahlow, S., Ritte, G.,Steup, M., Chen, J., Zeeman, S.C., and Smith A.M. (2010). A Putative Phosphatase, LSF1, Is Required for Normal Starch Turnover inArabidopsis Leaves. Plant Physiol. 152: 685–697.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Copley, S.D. (2015). An Evolutionary Perspective on Protein Moonlighting. Biochem Soc Trans. 42: 1684–1691.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Copley, S.D. (2003). Enzymes with extra talents: Moonlighting functions and catalytic promiscuity. Curr. Opin. Chem. Biol. 7: 265–272.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cvetić, T., Veljović-Jovanović, S., and Vučinić, Ž (2008) Characterization of NAD-dependent malate dehydrogenases from spinach
leaves, Protoplasma 232:247-253.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Demishtein-Zohary, K. and Azem, A. (2017). The TIM23 mitochondrial protein import complex: function and dysfunction. Cell TissueRes. 367: 33–41.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Deng, X.W., Caspar, T., and Quail, P.H. (1991). Cop1 : a regulatory locus involved m hght-controlled development and gene expressionin Arabidopsis. Genes Dev. 5: 1172–1182.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Despres, B., Delseny, M., and Devic, M. (2001). Partial complementation of embryo defective mutations: A general strategy to elucidategene function. Plant J. 27: 149–159.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Drescher, A., Stephanie, R., Calsa, T., Carrer, H., and Bock, R. (2000). The two largest chloroplast genome-encoded open readingframes of higher plants are essential genes. Plant J. 22: 97–104.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Engdahl, S., Aronsson, H., Sundqvist, C., Timko, M.P., and Dahlin, C. (2001). Association of the NADPH:protochlorophyllideoxidoreductase (POR) with isolated etioplast inner membranes from wheat. Plant J. 27: 297–304.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Emanuelsson, O., Nielsen, H., Brunak, S., and Von Heijne, G. (2000). Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300: 1005–1016.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Feng, J., Fan, P., Jiang, P., Lv, S., Chen, X., and Li, Y. (2014). Chloroplast-targeted Hsp90 plays essential roles in plastid developmentand embryogenesis in Arabidopsis possibly linking with VIPP1. Physiol. Plant. 150: 292–307.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ferro, M. et al. (2010). AT_CHLORO, a Comprehensive Chloroplast Proteome Database with Subplastidial Localization and CuratedInformation on Envelope Proteins. Mol. Cell. Proteomics 9: 1063–1084.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Franzmann, L.H., Yoon, E.S., and Meinke, D.W. (1995). Saturating the Genetic-Map of Arabidopsis thaliana with Embryonic Mutations.Plant J. 7: 341–350.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fujii, S., Kobayashi, K., Nagata, N., Masuda, T., and Wada, H. (2017). Monogalactosyldiacylglycerol Facilitates Synthesis of PhotoactiveProtochlorophyllide in Etioplasts. Plant Physiol. 174: 2183–2198.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fulton, D.C., Stettler, M., Mettler, T., Vauhjan, C.K., Li, J., Francisco, P., Gil, M., Reinhold, H., Eicke, S., Messerli, G., Dorken, G.,Halliday, K., Smith, A.M., Smith, S.M., and Zeeman, S.C. (2008). ß-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown,Acts Upstream of Three Active ß-Amylases in Arabidopsis Chloroplasts. Plant Cell Online 20: 1040–1058.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fusari, C.M., Kooke, R., Lauxmann, M.A., Annunziata, M.G., Encke, B., Hoehne, M., Krohn, N., Becker, F.F.M., Schlereth, A., Sulpice, R.,Stitt, M., and Keurentjes, J.J.B. (2017). Genome-wide Association Mapping Reveals that Specific and Pleiotropic RegulatoryMechanisms Fine-tune Central Metabolism and Growth in Arabidopsis. Plant Cell: tpc.00232.2017.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gómez, L.D., Gilday, A., Feil, R., Lunn, J.E., and Graham, I.A. (2010). AtTPS1-mediated trehalose 6-phosphate synthesis is essential forembryogenic and vegetative growth and responsiveness to ABA in germinating seeds and stomatal guard cells. Plant J. 64: 1–13.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Goward, C.R. and Nicholls, D.J. (1994). Malate dehydrogenase: A model for structure, evolution, and catalysis. Protein Sci. 3: 1883–1888.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Google Scholar: Author Only Title Only Author and Title
Grau, U.M., Trommer, W.E., and Rossmann, M.G. (1981). Structure of the active ternary complex of pig heart lactate dehydrogenasewith S-lac-NAD at 2.7 Å resolution. J. Mol. Biol. 151: 289–307.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R. (2010). A ubiquitin-10 promoter-based vector set forfluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies.Plant J. 64: 355–365.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gujas, B., Cruz, T.M.D., Kastanaki, E., Vermeer, J.E.M., Munnik, T., and Rodriguez-Villalon, A. (2017). Perturbing phosphoinositidehomeostasis oppositely affects vascular differentiation in Arabidopsis thaliana roots. Development: dev.155788.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hatch, M.D. and Osmond, C.B. (1976). Compartmentation and Transport in C4 Photosynthesis. In Stocking CR, Heber U, eds. Transportin plants III, Vol. 3. Berlin:Springer, pp. 144-184.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
He, H., Lee, M.-C., Zheng, L.-L., Zheng, L., and Luo, Y. (2013). Integration of the metabolic/redox state, histone gene switching, DNAreplication and S-phase progression by moonlighting metabolic enzymes. Biosci. Rep. 33: e00018.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hebbelmann, I., Selinski, J., Wehmeyer, C., Goss, T., Voss, I., Mulo, P., Kangasjärvi, S., Aro, E.-M., Oelze, M.-L., Dietz, K.-J., Nunes-Nesi,A., Do, P.T., Fernie, A.R., Talla, S.K., Raghavendra, A.S., Linke, V., and Scheibe, R. (2012). Multiple strategies to prevent oxidativestress in Arabidopsis plants lacking the malate valve enzyme NADP-malate dehydrogenase. J. Exp. Bot. 63: 1445–1459.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Heber, U. (1974). Metabolite exchange between chloroplasts and cytoplasm. Annu. Rev. Plant Physiol. 25: 393–421.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hendriks, W., Mulders, J.W., Bibby, M. a, Slingsby, C., Bloemendal, H., and de Jong, W.W. (1988). Duck lens epsilon-crystallin andlactate dehydrogenase B4 are identical: a single-copy gene product with two distinct functions. Proc. Natl. Acad. Sci. U. S. A. 85: 7114–8.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Heyno, E., Innocenti, G., Lemaire, S.D., Issakidis-Bourguet, E., and Krieger-Liszkay, A. (2014). Putative role of the malate valve enzymeNADP-malate dehydrogenase in H2O2 signalling in Arabidopsis. Philos. Trans. R. Soc. B Biol. Sci. 369: 20130228–20130228.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Horrer, D., Flütsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., Lawson, T., and Santelia, D. (2016). Bluelight induces a distinct starch degradation pathway in guard cells for stomatal opening. Curr. Biol. 26: 362–370.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Huberts, D.H.E.W. and van der Klei, I.J. (2010). Moonlighting proteins: An intriguing mode of multitasking. Biochim. Biophys. Acta - Mol.Cell Res. 1803: 520–525.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jang, J.C. (1997). Hexokinase as a Sugar Sensor in Higher Plants. Plant Cell Online 9: 5–19.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jarvis, P., Dormann, P., Peto, C.A., Lutes, J., Benning, C., and Chory, J. (2000). Galactolipid deficiency and abnormal chloroplastdevelopment in the Arabidopsis MGD synthase 1 mutant. Proc. Natl. Acad. Sci. 97: 8175–8179.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jeffery, C.J. (1999). Moonlighting proteins. Trends Biochem. Sci. 24: 8–11.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jeffery, C.J. (2003). Moonlighting proteins: Old proteins learning new tricks. Trends Genet. 19: 415–417.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Journet, E.P., Neuburger, M., and Douce, R. (1981). Role of glutamate-oxaloacetate transaminase and malate dehydrogenase in theregeneration of NAD for glycine oxidation by spinach leaf mitochondria. Plant Physiol. 67: 467–469.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAY™ vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7:193–195.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kinoshita, H., Nagasaki, J., Yoshikawa, N., Yamamoto, A., Takito, S., Kawasaki, M., Sugiyama, T., Miyake, H., Weber, A.P.M., andTaniguchi, M. (2011). The chloroplastic 2-oxoglutarate/malate transporter has dual function as the malate valve and in carbon/nitrogenmetabolism. Plant J. 65: 15–26.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Klement, H., Helfrich, M., Oster, U., Schoch, S., and Rüdiger, W. (1999). Pigment-free NADPH:protochlorophyllide oxidoreductase fromAvena sativa L. Purification and substrate specificity. Eur. J. Biochem. 265: 862–874.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M., and Ohta, H. (2007). Galactolipid synthesis in chloroplast inner envelope isessential for proper thylakoid biogenesis, photosynthesis, and embryogenesis. Proc. Natl. Acad. Sci. 104: 17216–17221.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Langklotz, S., Baumann, U., and Narberhaus, F. (2012). Structure and function of the bacterial AAA protease FtsH. Biochim. Biophys.Acta - Mol. Cell Res. 1823: 40–48.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lebedev, N., Van Cleve, B., Armstrong, G., and Apel, K. (1995). Chlorophyll Synthesis in a Deetiolated (det340) Mutant of Arabidopsiswithout NADPH-Protochlorophyllide (PChlide) Oxidoreductase (POR) A and Photoactive PChlide-F655. Plant Cell 7: 2081–2090.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee, C., Schwartz, M.P., Prakash, S., Iwakura, M., and Matouschek, A. (2001). ATP-dependent proteases degrade their substrates byprocessively unraveling them from the degradation signal. Mol. Cell 7: 627–637.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee, Y., Rubio, M.C., Alassimone, J., and Geldner, N. (2013). A mechanism for localized lignin deposition in the endodermis. Cell 153:402–412.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu, X., Zhang, D., Li, S., Su, Y., Liang, Q., Meng, H., Shen, S., Fan, Y., Liu, C., and Zhang, C. (2014). FtsHi4 is essential for embryogenesisdue to its influence on chloroplast development in Arabidopsis. PLoS One 9.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Majsec, K., Bhuiyan, N.H., Sun, Q., Kumari, S., Kumar, V., Ware, D., and van Wijk, K. (2017). The Plastid and Mitochondrial PeptidaseNetwork in Arabidopsis: A Foundation for Testing Genetic Interactions and Functions in Organellar Proteostasis. Plant Cell 29: 2687-2710.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mansfield, S.G. and Briarty, L.G. (1991). Early Embryogenesis in Arabidopsis thaliana .II. the Developing Embryo. Can. J. Bot. Can. Bot.69: 461–476.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Martin, A., Baker, T.A., and Sauer, R.T. (2005). Rebuilt AAA + motors reveal operating principles for ATP-fuelled machines. Nature 437:1115–1120.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mascia, P.N. (1978). Studies of Chloroplast Development in Four Maize Mutants Defective in Chlorophyll Biosynthesis. Planta. 143:207–211.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Minárik, P., Tomaásková, N., Kollárová, M., and Antalík, M. (2002). Malate Dehydrogenases - Structure and function. Gen. Physiol.Biophys. 21: 257–265.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Moore, B. (2003). Role of the Arabidopsis Glucose Sensor HXK1 in Nutrient, Light, and Hormonal Signaling. Science 300: 332–336.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Moore, B.D. (2004). Bifunctional and moonlighting enzymes: Lighting the way to regulatory control. Trends Plant Sci. 9: 221–228.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Musrati, R.A., Kollárová, M., Mernik, N., and Mikulášová, D. (1998). Malate Dehydrogenase: Distribution, Function and Properties. Gen.Physiol. Biophys. 17: 193–210.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakai, M. (2018). New perspectives on chloroplast protein import. Plant and Cell Physiology, pcy083, doi.org/10.1093/pcp/pcy083.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nicholls, D.J., Miller, J., Scawen, M.D., Clarke, A.R., John Holbrook, J., Atkinson, T., and Goward, C.R. (1992). The importance ofarginine 102 for the substrate specificity of Escherichia coli malate dehydrogenase. Biochem. Biophys. Res. Commun. 189: 1057–1062.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nickelsen, J. (2005). The Green Alga Chlamydomonas reinhardtii – A Genetic Model Organism. In Progress in Botany (Heidelberg,Springer-Verlag Berlin), pp. 68–89.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nielsen, H. and Engelbrecht, J. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavagesites Artificial neural networks have been used for many biological. Protein Eng. 10: 1–6.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants using artificial microRNAs and other small RNAs. Plant J. 53:674–690.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Park, H., Kreunen, S.S., Cuttriss, A.J., DellaPenna, D., and Pogson, B.J. (2002). Identification of the Carotenoid Isomerase ProvidesInsight into Carotenoid Biosynthesis, Prolamellar Body Formation, and Photomorphogenesis. Plant Cell 14: 321–332.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Patton, D.A., Franzmann, L.H., and Meinke, D.W. (1991). Mapping genes essential for embryo development in Arabidopsis thaliana. Mol.Gen. Genet. 227: 337–347.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Patton, D.A., Schetter, A.L., Franzmann, L.H., Nelson, K., Ward, E.R., and Meinke, D.W. (1998). An Embryo-Defective Mutant ofArabidopsis Disrupted in the Final Step of Biotin Synthesis. Plant Physiol. 116: 935–946.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pracharoenwattana, I., Cornah, J.E., and Smith, S.M. (2007). Arabidopsis peroxisomal malate dehydrogenase functions in beta-oxidationbut not in the glyoxylate cycle. Plant J. 50: 381–90.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pracharoenwattana, I., Zhou, W., and Smith, S.M. (2010). Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported byperoxisomal hydroxypyruvate reductase when malate dehydrogenase is absent. Plant Mol. Biol. 72: 101–109.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ruppel, N.J. and Hangarter, R.P. (2007). Mutations in a plastid-localized elongation factor G alter early stages of plastid development inArabidopsis thaliana. BMC Plant Biol. 7: 37.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ryberg, M. and Sundqvist, C. (1982). Characterization of prolamellar bodies and prothylakoids fractionated from wheat etioplasts.Physiol. Plant. 56: 125–132.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ryberg, M. and Sundqvist, C. (1988). The regular ultrastructure of isolated prolamellar bodies depends on the presence of membrane‐bound NADPH‐protochlorophyllide oxidoreductase. Physiol. Plant. 73: 218–226.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Scheibe, R. (2004). Malate valves to balance cellular energy supply. Physiol. Plant. 120: 21–26.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Scheibe, R. (1987). NADP+‐malate dehydrogenase in C3‐plants: Regulation and role of a light‐activated enzyme. Physiol. Plant. 71: 393–400.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Selinski, J., König, N., Wellmeyer, B., Hanke, G.T., Linke, V., Ekkehard Neuhaus, H., and Scheibe, R. (2014). The plastid-localized NAD-dependent malate dehydrogenase is crucial for energy homeostasis in developing Arabidopsis thaliana seeds. Mol. Plant 7: 170–186.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Selstam, E., Schelin, J., Brain, T., and Williams, W.P. (2002). The effects of low pH on the properties of protochlorophyllideoxidoreductase and the organization of prolamellar bodies of maize (Zea mays). Eur. J. Biochem. 269: 2336–2346.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seung, D., Thalmann, M., Sparla, F., Abou Hachem, M., Lee, S.K., Issakidis-Bourguet, E., Svensson, B., Zeeman, S.C., and Santelia, D.(2013). Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase. J. Biol. Chem. 288: 33620–33633.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seung D., Soyk, S., Coiro, M., Maier, B.A., Eicke, S., and Zeeman, S.C. (2015). PROTEIN TARGETING TO STARCH is required forlocalising GRANULE-BOUND STARCH SYNTHASE to starch granules and for normal amylose synthesis in Arabidopsis. PLoS Biol.13:e1002080.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sew, Y.S., Ströher, E., Fenske, R., and Millar, A.H. (2016). Loss of Mitochondrial Malate Dehydrogenase Activity Alters Seed MetabolismImpairing Seed Maturation and Post-Germination Growth in Arabidopsis. Plant Physiol. 171: 849–63.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Silverstein, E. and Sulebele, G. (1969). Catalytic mechanism of pig heart mitochondrial malate dehydrogenase studied by kinetics atequilibrium. Biochemistry 8: 2543–50.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sokolenko, A., Pojidaeva, E., Zinchenko, V., Panichkin, V., Glaser, V.M., Herrmann, R.G., and Shestakov, S. V (2002). The genecomplement for proteolysis in the cyanobacterium Synechocystis sp. PCC 6803 and Arabidopsis thaliana chloroplasts. Curr. Genet. 41:291–310.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Solymosi, K. and Aronsson, H. (2013). Etioplasts and their significance in chloroplast biogensis 36: 155-167.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Solymosi, K. and Schoefs, B. (2010). Etioplast and etio-chloroplast formation under natural conditions: The dark side of chlorophyllbiosynthesis in angiosperms. Photosynth. Res. 105: 143–166.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sperling, U., Franck, F., van Cleve, B., Frick, G., Apel, K., and Armstrong, G.A. (1998). Etioplast differentiation in arabidopsis: bothPORA and PORB restore the prolamellar body and photoactive protochlorophyllide-F655 to the cop1 photomorphogenic mutant. PlantCell 10: 283–296.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Spicher, L., Almeida, J., Gutbrod, K., Pipitone, R., Dörmann, P., Glauser, G., Rossi, M., and Kessler, F. (2017). Essential role for phytolkinase and tocopherol in tolerance to combined light and temperature stress in tomato. J. Exp. Bot. 68: 5845–5856.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Taniguchi, M. and Miyake, H. (2012). Redox-shuttling between chloroplast and cytosol: Integration of intra-chloroplast and extra-chloroplast metabolism. Curr. Opin. Plant Biol. 15: 252–260.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Google Scholar: Author Only Title Only Author and Title
Tatsuta, T., Augustin, S., Nolden, M., Friedrichs, B., and Langer, T. (2007). m-AAA protease-driven membrane dislocation allowsintramembrane cleavage by rhomboid in mitochondria. EMBO J. 26: 325–335.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tomaz, T., Bagard, M., Pracharoenwattana, I., Linden, P., Lee, C.P., Carroll, A.J., Stroher, E., Smith, S.M., Gardestrom, P., and Millar,A.H. (2010). Mitochondrial Malate Dehydrogenase Lowers Leaf Respiration and Alters Photorespiration and Plant Growth inArabidopsis. Plant Physiol. 154: 1143–1157.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tschopp, M.-A., Iki, T., Brosnan, C.A., Jullien, P.E., and Pumplin, N. (2017). A complex of Arabidopsis DRB proteins can impair dsRNAprocessing. RNA 23: 782–797.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wagner, R., Aigner, H., and Funk, C. (2012). FtsH proteases located in the plant chloroplast. Physiol. Plant. 145: 203–214.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wigley, D.B., Gamblin, S.J., Turkenburg, J.P., Dodson, E.J., Piontek, K., Muirhead, H., and Holbrook, J.J. (1992). Structure of a ternarycomplex of an allosteric lactate dehydrogenase from Bacillus stearothermophilus at 2.5 A resolution. J. Mol. Biol. 223: 317–35.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wistow, G.J., Mulders, J.W., and de Jong, W.W. (1987). The enzyme lactate dehydrogenase as a structural protein in avian andcrocodilian lenses. Nature 326: 622–4.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang, S.S. and Zhai, Q.H. (2017). Cytosolic GAPDH: a key mediator in redox signal transduction in plants. Biol. Plant. 61: 417–426.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yu, B., Wakao, S., Fan, J., and Benning, C. (2004). Loss of plastidic lysophosphatidic acid acyltransferase causes embryo-lethality inArabidopsis. Plant Cell Physiol. 45: 503–510.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zaffagnini, M., Fermani, S., Costa, A., Lemaire, S.D., and Trost, P. (2013). Plant cytoplasmic GAPDH: redox post-translationalmodifications and moonlighting properties. Front. Plant Sci. 4: 1–18.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang, X., Henriques, R., Lin, S.-S., Niu, Q.-W., and Chua, N.-H. (2006). Agrobacterium-mediated transformation of Arabidopsis thalianausing the floral dip method. Nat. Protoc. 1: 641–6.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhao, Y., Luo, L., Xu, J., Xin, P., Guo, H., Wu, J., Bai, L., Wang, G., Chu, J., Zuo, J., Hong, Y., Huang, X., and Li, J. (2018). Malatetransported from chloroplast to mitochondrion triggers production of ROS and PCD in Arabidopsis thaliana. Cell Research 28 (4): 448-461.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
DOI 10.1105/tpc.18.00121; originally published online June 22, 2018;Plant Cell
Oliver KöttingDaniele Albertini, Benjamin A Maier, Felix Kessler, Stefan Hörtensteiner, Samuel C. Zeeman and
Tina B Schreier, Cléry Antoine, Michael Schläfli, Florian Galbier, Martha Stadler, Emilie Demarsy,Chloroplast Development Through its Interaction with an FtsH12-FtsHi Protease Complex
Plastidial NAD-Dependent Malate Dehydrogenase: A Moonlighting Protein Involved in Early
This information is current as of September 17, 2018
Supplemental Data /content/suppl/2018/06/27/tpc.18.00121.DC2.html /content/suppl/2018/06/21/tpc.18.00121.DC1.html