Plant and Animal Plant and Animal Breeding Breeding
Nov 14, 2014
Plant and Animal Plant and Animal BreedingBreeding
Artificial Selection & Artificial Selection & Breeding for selected traitsBreeding for selected traitsselection of plants or animals for
desirable traits by humans through carefully planned breeding
Artificial Selection & Breeding for Artificial Selection & Breeding for selected traitsselected traits
Isolation of natural populations↓
Selective breeding of organisms showing traits useful of humans
↓Useful genotypes exits more often
(producing more offspring) than other genotype
↓Change in allele frequency towards
genotypes useful to humans
Aims of artificial selection Aims of artificial selection
1. create new breeds or varieties
Aims of artificial selection Aims of artificial selection preserve good species
Aims of artificial selection Aims of artificial selection domesticate wild plants and
animals Wildebeest Ostrich
Common types of artificial Common types of artificial selectionselectionInbreedingOutbreedingPolyploidy
InbreedingInbreedingmating between genetically
closely related individualsincrease the number of
homozygous genotypes ◦reduced variability◦decrease in heterozygosity
InbreedingInbreedingself-fertilizationcrossing the offspring of the
same parentsbackcrossing with one of the
parents
InbreedingInbreedingdecrease heterozygous
genotypes by 50% in each generation
Problems of inbreedingProblems of inbreedingreduce in fertilityInbreeding depression - vigour of
the population is gradually reduced
OutbreedingOutbreedingmating between genetically
closely unrelated individualsincrease the number of
heterozygosity ◦more variations◦produce offspring with superior
character (hybrid vigour)
use in combining two beneficial characteristics
PolyploidyPolyploidyAutopolyploidy
◦chromosome sets derived from the same species
◦created by spontaneous duplication
Allopolyploidy
PolyploidyPolyploidyAutopolyploidy
◦chromosome sets derived from the same species
◦created by spontaneous duplication
PolyploidyPolyploidyAllopolyploidy
◦two different diploid species are interbred
AllopolyploidyAllopolyploidythe hybrid form is sterile
◦different sets of chromosomes from both parents are not homologous
◦no pairing during meiosis
AllopolyploidyAllopolyploidyduplicate the genomethe tetraploid became fertile
AllopolyploidyAllopolyploidyget the advantage of inheriting
desirable characteristics from both parents
can be induced artificially by colchicine◦inhibit spindle formation
Methods commonly used in Methods commonly used in plant breedingplant breedingSelectionBackcrossHybridizationPolyploid breeding Mutation breeding
Methods commonly used in Methods commonly used in animal breedinganimal breedingSelectionArtificial insemination
Artificial insemination Artificial insemination Collection of semen from a maleDilution and artificial introduction
of sperm into female reproductive tract
Horses - Artificial Insemination
Artificial insemination Artificial insemination the semen can be stored in liquid
nitrogen for a long timeone male can be used to fertilize
a large number of females semen can be sent over long
distances commonly used in cattle
breeding
Plant cloningPlant cloningA clone is a group of genetically
identical cells or an individual derived from a single ancestral cell, tissue or individual by repeated asexual divisions
Cloning is the production of genetically identical individuals
Cloning is naturally Cloning is naturally occurring occurring Organisms which reproduce
asexually give rise to progeny by mitotic nuclear divisione.g. binary fission, vegetative propagation
produces exact copies of the parental genotype
Gardeners frequently maintain clones of desirable varieties of plants by vegetative propagation.
Plant cloningPlant cloning
Materials needed for cloning:
Somatic cells (primordial cells)
Culture medium
Tissue cultureTissue culture• Each somatic cell contains all the
information required to code for an entire organism.
• The cells to be cloned are allowed to grow in a medium containing suitable nutrients and hormones to form a mass of genetically identical cells called callose.
The callose are then separated and induced to produce new individuals
Advantages of plant Advantages of plant cloningcloningmaintain desirable traits in
selected plantsrapid way of propagating plants
in a short period of timeplants are grown in sterile
medium (disease-free)
Advantages of plant Advantages of plant cloningcloningplants are grown in sterile
medium (disease-free)
Advantages of plant Advantages of plant cloningcloningmaintain the genetic uniformityless space is needed
Animal cloningAnimal cloningFirst clone animal (1997)by Professor Ian Wilmut works at
the Roslin Institute in Edinburgh, which specializes in research on farm and other animals
Animal cloning - DollyAnimal cloning - DollyAn unfertilized egg was collected
from a Scottish blackface sheep
Animal cloning - DollyAnimal cloning - DollyThe nucleus of the unfertilized
egg cells was removed (enucleated)
Animal cloningAnimal cloningThe nucleus from a mammary
gland cell taken from a sheep Y.
Cloning of DollyCloning of DollyThe nucleus transfer to the
enucleated cell.An electro fusion was given
Cloning of DollyCloning of DollyIncubate the new cell in a culture
medium for 6 days ◦ embryo formed
Cloning of DollyCloning of DollyThe embryo was implanted into
the uterus of another blackface sheep (surrogate / foster mother)
Cloning of DollyCloning of DollyThe foster mother gave birth to
Dolly (baby sheep)
Implications of animal cloningmaintain the desirable traits in
selected animals Increase the population of
endangered species
Cloning on extinct animal -Thylacine - the largest known
carnivorous marsupial of modern times
Native to Australia and New Guinea
What’s the next?
Implications of animal cloningtissue from cloning of human
embryo for curing Parkinson’s disease
Implications of animal cloning
Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to
a self-replicating chromosome (usually in bacteria)
2. Amplification of the resulting recombinant DNA molecule
Recombinant DNA Recombinant DNA technologytechnology
Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to
a self-replicating chromosome (usually in bacteria)
2. Amplification of the resulting recombinant DNA molecule
Recombinant DNA Recombinant DNA technologytechnologyalso called gene manipulation genetic engineering
Genetic Engineering
Basic steps of recombinant Basic steps of recombinant DNA technologyDNA technologyidentifying a target geneisolating the target geneinserting the target gene into a
vector transferring the vector containing
the target gene into a host cell for producing a certain gene product
harvesting and purifying the gene product
Isolate the target geneIsolate the target geneuse restriction enzymesproduced by bacteria which cut
on the DNA at particular sites (recognition sites)
1978 Nobel Prize Physiology or Medicine
Werner Arber
Hamilton Smith
Daniel Nathans
Restriction enzymesRestriction enzymescan be extracted from bacterial
culturescut the double helix at specific
sites along the sequencesmost recognize sequences of
DNA with 4, 6 or 8 bases
Donor DNA
(Target DNA)
Restriction enzymes
(restriction endonucleases)
Break at specific site
Restriction enzymesRestriction enzymesact as powerful scissors create sticky ends
Formation of recombinant Formation of recombinant DNA moleculeDNA moleculeapply the restriction enzyme in
vitro with 2 different DNA fragments
DNA ligaseDNA ligasecan join ‘sticky ends’ of the DNA
fragments
Ways to locate the genes Ways to locate the genes Short gun sequencingTop-down sequencing
Shotgun approach
Genome from an organism
Restriction enzymes
Fragments of DNA
(some just contains the base sequences of a gene)
Gene probe
Desired base sequence
Shotgun approachShotgun approach• not specific
• but useful when no idea about the sequence of the desired gene
Shotgun Shotgun sequencingsequencingDNA is broken up randomly into
numerous small segmentssequenced using the chain
termination method Multiple overlapping reads for the
target DNA are obtained
Shotgun Shotgun sequencingsequencingStrand Sequence
Original XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
First shotgun sequence
XXXAGCATGCTGCAGTCATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAGGCTAXXXX
Second shotgun sequence
XXXAGCATGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTGCAGTCATGCTTAGGCTAXXXX
Reconstruction
XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
Bottom up sequencing Bottom up sequencing
Complementary DNA Complementary DNA (cDNA)(cDNA)conversion of mRNA into DNA can be used to find out the
location of gene
Protein
Amino acids sequence
Nucleotides sequence
Only restricted to small gene with short DNA
Structure of mRNAStructure of mRNA
with a poly A tail d
all eukaryotic mRNA molecules contain a poly-A tail
for stabilization of mRNA molecule during transcription
cDNAcDNAusing a poly-T oligomer as a
primer(Primer is a short single-stranded DNA or RNA that functions as the starting site for the elongation of a new chain)
cDNAcDNAThe poly-T oligomer binds to the
complementary poly-A tail of mRNA
Formation of cDNAFormation of cDNAIn the presence of
enzyme ,reverse transcriptase a single strand of cDNA copy is formed
Release of the cDNARelease of the cDNAcDNA can be released by the
addition of alkali
Synthesis of DNA double Synthesis of DNA double helixhelixwith the help of DNA polymerase
VectorsVectorsa self-replicating DNA molecule
that carries a foreign DNA segment to a host cell for amplification
come from bacterial plasmids and viruses
PlasmidPlasmida small circular molecule of
double stranded DNA present in bacterial cell
carries a minor fraction of the bacterial genome ◦code important traits
Advantages of using plasmid Advantages of using plasmid as vectoras vectorlow molecular weight (contains
several thousand base pairs)
Advantages of using plasmid Advantages of using plasmid as vectoras vectorplasmid replicates autonomouslyindependent of the chromosomes
in bacteria
Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontains antibiotic resistance
genes which facilities selection
Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontain a number of unique
cleavage sites for the actions of several different restriction enzymes
Isolation of plasmid from Isolation of plasmid from bacteriabacteriaby breaking up the bacterial cellsseparation by centrifugation
Cleavage of plasmid Cleavage of plasmid cleavage by the same restriction
enzyme used in cutting the short length of DNA (target gene) to be inserted
form the same sticky ends
Insertion of plasmid to Insertion of plasmid to host cellhost cellwith the help of DNA ligase
Insertion of plasmid to Insertion of plasmid to host cellhost cellthe resulting plasmids can be
replicated if they are introduced into a bacterial host cells
Introducing the target gene Introducing the target gene into the host cellinto the host cellDNA molecules can be taken up
by pre-treating the bacterial cells with a solution containing Ca2+ ions followed by a rapid heat shock(42oC)
Introducing the target gene Introducing the target gene into the host cellinto the host cellapply a brief electrical shock that
generates temporary pores in the bacterial cell membrane
Production of human insulin Production of human insulin from genetically engineered from genetically engineered bacteriabacteriaType I Diabetes
◦failed to produce sufficient insulin ◦due to insufficient insulin by Islets of
Langerhans in the pancreas ◦can only get insulin from the
panaceas from cows or pigs
Problems of using insulin Problems of using insulin from other animalsfrom other animalsthough the insulin is biologically
active but the amino acid sequences are slightly different from those of humans
some patients are stimulated to produce antibodies against the injected insulin
Structure of human insulin Structure of human insulin consists of two separate
polypeptides chains: A and Bjoined together by special
disulphide bridges (S~S)A-chain contains 21 amino acidsB-chain is 30 amino acids long
Structure of human insulin Structure of human insulin two chains originate from a large
gene product called preproinsulin
Structure of human insulin Structure of human insulin function of C-chain is to bring the
A-chain and B-chain together in the correct alignment
Structure of human insulin Structure of human insulin A-chain and B-chain will join to
form a mature insulin
Genetically engineered Genetically engineered human insulinhuman insulinisolate 2 synthetic DNA
fragments (genes)◦encoding A-chain and B-chain
Introduce the 2 genes into plasmids
Genetically engineered Genetically engineered human insulinhuman insulinthe plasmids are introduced into
2 E. coli bacteriaproduce the chain A and chain B
polypeptides separately
Genetically engineered Genetically engineered human insulinhuman insulinthe polypeptides are extracted
and purifiedmixed under appropriate
conditions to produce functional human insulin
Applications of recombinant Applications of recombinant DNA technologyDNA technology
Production of therapeutic proteins for pharmaceutical uses◦Human insulin◦Blood clotting factor VIII◦Human growth hormone◦Protein coat of hepatitis B virus
Diagnosis of genetic Diagnosis of genetic diseasesdiseasescompare the nucleotides
sequences of affected patients and unaffected individuals◦diabetes◦pancreas cancer◦cystic fibrosis◦haemophilia◦AIDS
Production of enzymes for Production of enzymes for industrial applicationsindustrial applicationsbiological detergents
◦protease and amylaseBrewing industryTextile industryBaking industry
◦cellulaseLeather industry
Transgenic technologyTransgenic technologytransfer a desirable gene from
another species to a recipient organism
form a new character which is beneficial to human
produce transgenic animals and transgenic plants Genetically Modified Organisms (GMO)
• Introducing new genes from another Introducing new genes from another organismorganism
Bt gene
DNA Fingerprinting
Sir Professor Alec Jeffreys
Background information
No. of base pairs in human: 3 billion
No. of coding gene: 30,000
about 95% of the base pairs are non-coding
about 30-40% of the base pairs consists of short sequence of repeats
some of the repeats are joined together in cluster (tandem)
DNA fingerprintingDNA fingerprintingOn the DNA there are region
which do not code for polypeptides ◦Exon – coded for polypeptide◦Intron – non-coding DNA sequences
Non-coding sequenceNon-coding sequencemake up over 90% of the
genomeabout half of them carry short
repetitive sequences of nucleotides – tandem repeats
The tandem repeats are known as satellite DNA.
Some just have a small number of repeats: minisatillites.
• Different individual have a different number of tandem repeated
• Minisatillate known as variable number tandem repeats (VNTRs)
Procedure
Extraction
Amplification:
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR)
1. Denature: made single-stranded
2. Add DNA polymerase
3. Add primer (a short DNA sequence)
Treatment with restriction enzyme
• cut DNA into smaller fragments
• contain minisatellites
• length of the DNA fragments remains unchanged
Agrose gel electrophoresis
• agrose gel with pores
• Separate the DNA fragments according to size
• DNA carries negative charge and will move to positive pole if a voltage is applied to it.
• Smaller size: move faster
• Bigger size: move slower
Splitting the DNA into single strands
• by alkaline treatment
Addition of a radioactive probe
• Identify the location of the minisatillites
• number of tandem repeats can be shown as bands
Applications of DNA fingerprinting
• Identification of criminal
• very sensitiveType of sample Amount of DNA (ng); 1ng = 10-9 g
Blood 20,000 – 40 000 ng / ml
Stain 1 cm2 in area ~ 200 ng
Stain in 1 mm2 area ~ 2 ng
Semen 150, 000 – 300, 000 ng / ml
Postcoital vaginal swab 0 – 3, 000 ng
Hair
Plucked 1 – 750 ng / hair
shed 1 –12 ng / hair
Saliva 1, 000 – 10, 000 ng / ml
Urine 1 – 20 ng / ml
Fig. 8 DNA content in biological sample
Number of Bands Odds against a chance match
4 250 to 1
6 4000 to 1
8 65000 to 1
10 1 million to 1
12 17 million to 1
14 268 million to 1
16 4300 million to 1
18 68000 million to 1
20 1 million million to 1
Fig. 9 The chance occurrence of Band matching
Chance occurrence of band matching
Settling paternity disputesSettling paternity disputes• every child must inherit one copy
of a pair of homologous chromosome from each parent
Mother Father
Genetic disorder and its diagnosis
• due to mutation
Sickle cell anaemia
Haemophilia