-
PITX2 Insufficiency Leads to Atrial Electrical andStructural
Remodeling Linked to Arrhythmogenesis
Ana Chinchilla, PhD; Houria Daimi, PhD; Estefana Lozano-Velasco,
BS; Jorge N. Dominguez, PhD;Ricardo Caballero, PhD; Eva Delpon,
PhD; Juan Tamargo, MD, PhD; Juan Cinca, MD, PhD;
Leif Hove-Madsen, PhD; Amelia E. Aranega, MD; Diego Franco,
PhD
BackgroundPitx2 is a homeobox transcription factor that plays a
pivotal role in early left/right determination duringembryonic
development. Pitx2 loss-of-function mouse mutants display early
embryonic lethality with severe cardiacmalformations, demonstrating
the importance of Pitx2 during cardiogenesis. Recently, independent
genome-wideassociation studies have provided new evidence for a
putative role of PITX2 in the adult heart. These studies
haveindependently reported several risk variants close to the PITX2
locus on chromosome 4q25 that are strongly associatedwith atrial
fibrillation in humans.
Methods and ResultsWe show for the first time that PITX2C
expression is significantly decreased in human patients
withsustained atrial fibrillation, thus providing a molecular link
between PITX2 loss of function and atrial fibrillation. Inaddition,
morphological, molecular, and electrophysiological characterization
of chamber-specific Pitx2 conditionalmouse mutants reveals that
atrial but not ventricular chamber-specific deletion of Pitx2
results in differences in theaction potential amplitude and resting
membrane potential in the adult heart as well as ECG
characteristics ofatrioventricular block. Lack of Pitx2 in atrial
myocardium impairs sodium channel and potassium channel
expression,mediated in part by miRNA misexpression.
ConclusionsThis study thus identifies Pitx2 as an upstream
transcriptional regulator of atrial electric function,
theinsufficiency of which results in cellular and molecular changes
leading to atrial electric and structural remodelinglinked to
arrhythmogenesis. (Circ Cardiovasc Genet. 2011;4:269-279.)Key
Words: Pitx2 arrhythmia atrial fibrillation gene regulation
polymorphism transcription factors
Pitx2 is a homeobox transcription factor that plays apivotal
role in early left/right determination during em-bryonic
development, downstream of the nodal/lefty signal-ing pathway.1 The
expression of Pitx2 is confined to the leftside of the embryo
within the lateral plate mesoderm. Withfurther development, it
continues to be mainly confined to theleft side in different
organs, such as the stomach and theheart.2,3 Pitx2 loss-of-function
mouse mutants displayed earlyembryonic lethality with severe
cardiac malformations,47demonstrating the importance of Pitx2
during cardiogenesis.
Clinical Perspective on p 279Recent genome-wide association
studies have suggested
new roles for Pitx2 in the adult heart.810 These authors
haveindependently reported several risk variants on chromosome4q25
that are strongly associated with atrial fibrillation (AF)in
distinct human populations. AF-associated risk variants areadjacent
to PITX2, and although these studies810 do not
provide any experimental evidence that links regulation ofPITX2
expression/activity to the risk variants, it is plausiblethat
modulation of the expression and/or activity of PITX2 inthe adult
heart have the potential to play a role in AF.
In the present study, we have confirmed the high preva-lence of
these genetic variants in a small cohort of AF patientsand
furthermore we demonstrate for the first time thatPITX2C expression
is significantly decreased in human pa-tients with sustained AF,
thus providing a molecular linkbetween loss of function of PITX2
and AF. In addition, wereport herein morphological, molecular, and
electrophysio-logical characterization of chamber-specific Pitx2
conditionalmouse mutants. Deletion of Pitx2 in the atrial
chambersresults in viable offspring. Electrophysiological studies
inPitx2 atrial chamberspecific adult hearts revealed differ-ences
in the resting membrane potential, action potentialamplitude, and
conductive disturbances as demonstrated byECG measurements.
Furthermore, lack of Pitx2 in the adult
Received June 10, 2010; accepted April 7, 2011.From the
Department of Experimental Biology, University of Jaen, Jaen, Spain
(A.C., H.D., E.L.-V., J.N.D., A.E.A., D.F.); the Department of
Pharmacology, Complutense University of Madrid, Madrid, Spain
(R.C., E.D., J.T.); the Cardiology Department, Hospital de Sant
Pau, Institute ofBiomedical Research IBB, Autonomous University of
Barcelona, Barcelona, Spain (J.C.); and the Cardiovascular Research
Centre CSIC-ICCC, Hospitalde la Santa Creu i Sant Pau, Barcelona,
Spain (L.H.-M.).
The online-only Data Supplement is available at
http://circgenetics.ahajournals.org/cgi/content/full/CIRCGENETICS.110.958116/DC1.Correspondence
to Diego Franco, PhD, Department of Experimental Biology,
University of Jaen, 23071 Jaen, Spain. E-mail [email protected] 2011
American Heart Association, Inc.Circ Cardiovasc Genet is available
at http://circgenetics.ahajournals.org DOI:
10.1161/CIRCGENETICS.110.958116
269 by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from by guest on
April 2, 2015http://circgenetics.ahajournals.org/Downloaded from by
guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
atria alters sodium and potassium channel expression,
cor-roborating the electrophysiological findings. Thus, we pro-vide
evidence that Pitx2 is an upstream transcriptional regu-lator of
distinct signaling pathways that provide cellular,molecular, and
electrophysiological substrates linked to
atrialarrhythmogenesis.
MethodsHuman Tissue and DNA SamplesAtrial myocardial tissue
samples were obtained from patients under-going cardiac surgery.
The atrial samples were classified as patientswith (AF) and without
(no AF) a recorded history of AF. Detailedinformation regarding
tissue processing is provided in the online-only Data Supplement.
The study conforms to the principles outlinedin the Declaration of
Helsinki.
Genomic DNA samples from 47 patients diagnosed of having AFand
100 healthy donors with no cardiac structural and/or
functionaldiseases were obtained from the Spanish National DNA
Bank(BNADN, Salamanca). Polymerase chain reaction (PCR)
amplifica-tion of both single nucleotide polymorphisms (SNPs)
(rs2200733and rs13143308) was carried out using flanking
oligonucleotides, asdetailed in online-only Data Supplement Table
1, followed by directsequencing. This study was approved by the
Ethics Committees ofthe Spanish National DNA Bank (BNADN,
Salamanca) and of theUniversity of Jaen, and the investigation
conforms to the principlesoutlined in the Declaration of
Helsinki.
Transgenic Mouse Lines, Breeding Strategy, andMouse
GenotypingThe Pitx2floxed, NppaCre, and Mlc2vCre transgenic mouse
lineshave been previously described.5,11,12 Generation of
conditionalatrial (NppaCre) and ventricular (Mlc2vCre) mutant mice
wasperformed by intercrossing hemizygous Cre deletor mice
withhomozygous Pitx2floxed mice, which resulted in
atrial-specific(NppaCrePitx2/) and ventricular (Mlc2vCrePitx2/)
Pitx2mutant mice, respectively. DNA for PCR screening was
extractedfrom adult ear and/or tail samples and from the yolk sac
in embryos.Screening of Cre and Pitx2floxed alleles was routinely
done usingused specific primers, as detailed in online-only Data
SupplementTable 1. Further details are provided as in the
online-only DataSupplement. This investigation conforms to the
Guide for the Careand Use of Laboratory Animals published by the US
NationalInstitutes of Health.
Quantitative Reverse TranscriptasePCR AnalysesTissue sample
isolation and processing for RNA isolation wereperformed using
standard procedures. Reverse transcriptase (RT)-PCR was performed
in the Mx3005Tm QPCR System with anMxPro QPCR Software 3.00
(Stratagene) and SYBR Green detec-tion system. Detailed information
regarding mRNA and microRNAquantitative (q)RT-PCR analyses are
provided in the online-onlyData Supplement.
ECG Recordings andElectrophysiological MeasurementsMice were
anesthetized with 2 mg/kg Ketamine (Parker-Davis)intraperitoneally.
ECG recordings were registered and analyzedusing a digital
acquisition and analysis system (Power Laboratory/4SP;
www.adinstrument.com). Transmembrane action potentialswere recorded
in isolated left and right atria of male control mice
andatrial-specific Pitx2 conditional mice (n5 per group) and in
thinpapillary muscles from male control mice and
ventricular-specificPitx2 conditional mice (n5 per group) through
glass microelec-trodes filled with 3 mol/L KCl (tip resistance, 8
to 15 mol/L) usingprocedures described previously.13,14 Further
details are provided inthe online-only Data Supplement.
Cell Culture and Transfection AssaysHL-1 mouse immortalized
atrial myocardial cells were used to assaymicroRNA-1
gain-of-function experiments as well as Pitx2c gain-and
loss-of-function assays. Transfection experiments were per-formed
using standard condition as detailed in the online-only
DataSupplement.
Statistical AnalysesqRT-PCR data statistical analyses were
performed using unpairedStudent t test. Probability values 0.05
were considered statisticallysignificant and are stated on each
corresponding figure legend.Deviation from the Hardy-Weinberg
equilibrium was tested byFisher exact test. General linear models
were carried out for testingthe genotype dependence on the
independent age and group vari-ables, as detailed in the
online-only Data Supplement Methods.Allele frequencies were
estimated from genotype frequencies bygene counting. Further detail
information regarding the statisticalanalyses is provided in the
online-only Data Supplement.
Resultsrs2200733 and rs13143308 Correlate With AFWe performed a
direct resequencing approach to study thefrequency of 2 SNPs
previously associated with AF8 in a smallcohort of Caucasian
patients with AF. A total 47 patients (25men and 22 women) with
paroxysmal or permanent AF wererecruited for the study (online-only
Data Supplement Table 2).Thirty patients presented isolated AF; 17
patients were alsodiagnosed with cardiomyopathy and/or
valvulopathy. Agesranged from 38 to 90 years (6811 years); 100
patients (44 menand 56 women) without any cardiac structural or
electrophysi-ological diagnosis were recruited as the control
population.Control ages ranged from 43 to 69 years (526 years)
(online-only Data Supplement Table 3). rs2200733 (C/T or T/T)
wasobserved in 20 of 47 (42%) AF patients and 22 of 100
(22%)control patients (odds ratio [OR], 2.607; 95% confidence
inter-val [CI, 1.158 to 5.908; Fisher exact test; P0.01; Table
1).rs13143308 (T/T or T/G) was observed in 26 of 47 (55%)
AFpatients and was present in 10 of 100 (10%) control patients(OR,
10.900; 95% CI, 4.325 to 29.594; Fisher exact test;P0.001; Table 1)
(online-only Data Supplement Figure 1).Thus, the data demonstrate a
highly significant prevalence ofrs2200733 (C/T or T/T) and
rs13143308 (T/T or T/G) in patientswith AF compared with control
subjects. No significant differ-ences were obtained related to age
for rs2200733 (C/T or T/T) orfor rs13143308 (T/T or T/G),
respectively, using general linearmodels. Furthermore, an increased
frequency of rs2200733 (C/Cor C/T) but not of rs13143308 is
obtained if patients aresubdivided into isolated AF (rs2200733,
16/30; 53%) and AFpatients with valvulopathy and/or cardiomyopathy
(rs2200733,4/17; 23%), although none of them reached statistical
significance.
PITX2c Expression Is Impaired in PatientsWith AFTo test if AF is
linked to changes in the expression levels ofPITX2, we analyzed the
expression levels of PITX2C, themajor PITX2 isoform expressed in
the adult heart, in rightand left atrial appendage biopsies of
human patients diag-nosed with AF compared with samples from
patients withouta history of AF (no AF) (online-only Data
Supplement Table4). Importantly, PITX2C expression, as revealed by
qRT-PCR, is decreased in right atria of AF patients (n5) as
270 Circ Cardiovasc Genet June 2011
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
compared with control subjects (n5; Figure 1). Similarly,PITX2C
expression is also decreased in left atria of AFpatients (n4)
compared with control subjects (n4; Figure1) (online-only Data
Supplement Table 5). Importantly,ENPEP, gene coding for glutamyl
aminopeptidase A, whichis located in the vicinity of PITX2 in
chromosome 4q25,display randomized expression levels in AF patients
(online-only Data Supplement Figure 2). Thus, these data provide
forthe first time evidence of an association between loss
offunction of PITX2 and AF in human patients.
Atrial and Ventricular Chamber-Specific Pitx2Deletion Leads to
Chamber-Specific DefectsTo obtain a suitable model of Pitx2 loss of
function, we havegenerated conditional tissue-specific Pitx2 mutant
mice byintercrossing a Pitx2 floxed mouse line5 with 2 distinct
Credeletor mouse lines, which rendered atrial-specific
(NppaCre)11and ventricular-specific (Mlc2vCre)12 Pitx2 mutant
models,respectively. Deletion of Pitx2 within the atrial chambers
usingNppaCre and deletion of Pitx2 in the ventricular chambers
usingMlc2vCre resulted in viable chamber-specific homozygous
Pitx2-deleted mice. qRT-PCR analyses of Pitx2 expression inthe
atrial chambers and the ventricular chambers revealed thatPitx2b
and Pitx2c transcript levels were reduced approximately60%
(online-only Data Supplement Figure 3), respectively,whereas Pitx2a
expression was undetectable. Thus, these con-ditional Pitx2 mice
represent Pitx2 loss-of-function deficiencymodels within the atrial
and ventricular chambers. Within thepresent study, we have centered
our attention on the atrial-specific Pitx2 mouse mutant.
Adult NppaCrePitx2/ mutant mice display moderateenlargement of
the atrial chambers with myocardial wallthinning, whereas the
ventricular chambers display an overtincrease in size and volume
(Figure 2A through 2C), which isalso characterized by a mild
increase in the interventricularseptum and left ventricular free
wall thickness (Figure 2Dthrough 2G). Increased fibrous tissue
deposition is detectablewithin the ventricular but not the atrial
chambers (Figure 2Hthrough 2M), in line with procollagen qRT-PCR
analyses(Figure 2N through 2O).
To investigate whether such morphological defects werepresent in
atrial-specific Pitx2 conditional mouse mutants during
Table 1. SNP Genotypes in AF Patients
AF Type Sex
TotalIsolated With CM/VM Male Female
rs2200733
AF patients
C/C 14/30 (47%) 13/17 (76%) 17/25 (68%) 10/22 (45%) 27/47
(57%)
C/T 14/30 (47%) 3/17 (18%) 9/25 (36%) 8/22 (17%) 17/47 (36%)
T/T 2/30 (6%) 1/17 (6%) 1/25 (4%) 2/22 (9%) 3/47 (5%)
Control subjects
C/C NA NA 35/44 (79%) 43/56 (77%) 88/100 (88%)
C/T NA NA 9/44 (21%) 13/56 (33%) 22/100 (22%)
T/T NA NA 0/44 (0%) 0/56 (0%) 0/100 (0%)
rs13143308
AF patients
G/G 13/30 (42%) 8/17 (50%) 11/25 (44%) 10/22 (45%) 21/47
(45%)
G/T 13/30 (42%) 6/17 (37%) 10/25 (40%) 9/22 (41%) 19/47
(40%)
T/T 5/30 (16%) 2/17 (13%) 4/25 (16%) 3/22 (13%) 7/47 (15%)
Control subjects
G/G NA NA 42/44 (95%) 48/56 (86%) 90/100 (90%)
G/T NA NA 2/44 (5%) 8/56 (14%) 10/100 (10%)
T/T NA NA 0/44 (0%) 0/56 (0%) 0/100 (0%)
Isolated AF
Paroxysmal Permanent
rs2200733 AF patients C/T or T/T 16/27 (59%) 1/3 (33%)
rs13143308 AF patients G/T or T/T 17/27 (62%) 1/3 (33%)
Age
5170 y 7190 y
rs2200733 AF patients C/T or T/T 11/16 (68%) 5/11 (45%)
rs13143308 AF patients G/T or T/T 13/16 (81%) 4/11 (36%)
CM indicates cardiomyopathy and VM, valvulopathy.
Chinchilla et al Pitx2 Insufficiency Leads to Atrial
Arrhythmogenesis 271
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
embryonic development, control (NppaCrePitx2flox/flox) andmutant
(NppaCrePitx2/) mouse embryos were generated,collected at distinct
developmental stages, and morphologi-cally analyzed. Lack of Pitx2
in the developing atrial myo-cardium partially impaired cardiac
development because asubset (7/22; 30%) of E13.5 NppaCrePitx2/
mouseembryos displayed enlarged and thinner atrial chambers,
asillustrated in Figure 3A through 3H), but no other morpho-genetic
defects were observed. Atrial length but not widthwas significantly
larger in NppaCrePitx2/ as comparedwith NppaCrePitx2flox/flox
embryos at this stage, as reflectedin Figure 3I. Enlarged atrial
chambers, in both the right andleft atria, become more patent at
fetal (5/10 at E15.5; 50%and 12/15 at E17.5; 80%) stages and was
characterized bya thinner myocardial wall as compared with
wild-type age-matched control mice (Figure 3E through 3H). No
ventriculardefects are observed in NppaCrePitx2/ embryos
duringdevelopment and thus ventricular defects are likely to
besecondary to atrial chamber dysfunction.
Because Pitx2 expression in the developing atria is con-fined to
the left atrial chamber, we explored the expressionprofile of
several cardiac markers in the left atrial appendagesof
NppaCrePitx2/ mutant embryos as compared withage-matched control
mice. In line with previous reports,15Bmp10 expression was highly
upregulated in the left atrialchambers. In addition, a significant
increase on Nkx2.5expression was observed. On the contrary, Gata6,
Mef2c, andNppa transcript levels were downregulated, whereas
islet-1and Gata4 displayed no significant differences (Figure
3J).
Atrial-Specific Pitx2-Deficient Mice DisplayElectrophysiological
DefectsTo address potential electrophysiological changes in
themutant mice, we analyzed the ECG recordings and actionpotentials
of adult Pitx2 chamber-specific mutants. ECGrecordings were similar
between nontransgenic control adultmice (data not shown), NppaCre
(Figure 4A), andNppaCrePitx2flox/flox (Figure 4C) adult mice,
displaying inall cases rhythmic ECG recordings. However, 40% (4/10)
ofNppaCrePitx2/ mutants display impaired ECG record-ings
characteristic of an atrioventricular (AV) node block(Figure 4B).
In addition, p waves are missing in most (5/6;85%) of the remaining
adult NppaCrePitx2/ mutantmice (Figure 4D). Morphological
examination of the ventric-ular conduction system in NppaCrePitx2/
mutants dem-onstrates that the sinoatrial node (data not shown) and
theventricular conduction system is properly organized (Figure4J
through 4M), yet the AV node and bundle of His displayreduced
fibrous tissue insulation (Figure 4J through 4K).
In addition, we studied the electrophysiological propertiesof
dissected right and left atrial samples corresponding to
theNppaCrePitx2 background (control and mutants) and
leftventricular samples of control and conditional mutants
cor-responding to the Mlc2vCrePitx2 background. The
character-istics of action potentials were recorded on
multicellularpreparations, and the results are summarized in Table
2. Leftatria from NppaCrePitx2-deficient mice displayed a
signifi-cantly more depolarized resting membrane potential
(RMP)(83.84.2 versus 87.02.7 mV) and a smaller actionpotential
amplitude (109.80.6 versus 114.11.8 mV) thanthose from control
littermate control mice (P0.05). Thedepolarization of the RMP would
suggest that the absence ofPitx2 correlates with a decrease in the
expression and/orfunction of the channels that generate the ionic
currentsinvolved in the control of the resting membrane potential,
forinstance, the inward rectifier current (IK1). Furthermore,
thisdepolarization may inactivate the Na channels responsibleof the
AP upstroke explaining the reduced action potentialamplitude
observed in Pitx2-deficient mice. It is interesting tonote that the
effects observed are chamber-specific becausesignificant
differences were apparent only in the left atria.
Molecular Determinants of theElectrophysiological Measurements
inAtrial-Specific Pitx2-Deficient Mouse MutantsTo further
investigate the molecular substrates underlying thedecreased action
potential amplitude and the depolarizedRMP in the left atria of
NppaCrePitx2/ adult hearts, we
Figure 1. PITX2C qRT-PCR analysis in AF patients. A,
PITX2Cexpression in right atrial biopsies from AF patients and
no-AFpatients. In 4 of 5 comparisons (80%), PITX2C expression
isdecreased approximately 80% to 90% in AF patients as com-pared
with no-AF patients. B, PITX2C expression in left atrialbiopsies
from AF patients and no-AF patients. In 3 of 4 (75%)comparisons,
PITX2C expression is similarly decreased (approx-imately 80% to
90%) in AF patients as compared with no-AFpatients. C, GAPDH
normalization against PPIA, which displayno differences between AF
and no-AF patients in left atria (n4),serving as internal control.
Similar results were obtained for rightatrial (n5) samples. *P0.05,
**P0.01.
272 Circ Cardiovasc Genet June 2011
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
compared the expression of the major determinants of
sodiumcurrent (INa) and the inward rectifier current (IK1) by
qRT-PCR. As shown in Figure 4C and 4D, Scn5a and Scn1bexpression
was severely impaired in the both left and rightatrial chambers,
with milder or no changes in the ventricularchambers of
NppaCrePitx2/ adult hearts. Similarly Kcnj2,
Kcnj12, and Kcnj4 expression was severely reduced in the
leftatrial myocardium but not ventricular chambers (Figure
4Ethrough 4G). Consistent with these findings, Western blotanalysis
showed that Kir2.1 (Kcnj2) and Nav1.5 (Scn5a)channel expression is
decreased in the atrial chambers ofNppaCrePitx2/ mice (Figure
4L).
Figure 2. Morphological remodeling of adult atrial-specific
Pitx2 conditional mutants. Whole-mount ventral views (A) and
isolated leftatria (B and C) corresponding to adult
NppaCrePitx2flox/flox (A and B) and NppaCrePitx2/ (A and C) hearts,
respectively. Observethe increased heart size in NppaCrePitx2/
compared with control NppaCrePitx2flox/flox hearts. Left atria (la)
size is significantlyenlarged in NppaCrePitx2/ (B) compared with
control NppaCrePitx2flox/flox (C) hearts. Dashed lines in C
represent the overlay ofthe left atria dimensions illustrated in B.
Four-chambered views of adult NppaCrePitx2flox/flox (D) and
NppaCrePitx2/ (E) hearts areshown. Note that atrial-specific Pitx2
mutants (E) display enlarged atrial and ventricular chambers and
thickening of the interventricularseptum (IVS) (double arrows)
compared with control (D) and right ventricular (rv) lumen is
significantly dilated (asterisk, E). Transversalhistological
sections of adult ventricular NppaCrePitx2floxed/floxed (F) and
NppaCrePitx2/ (G) chambers illustrate a significant IVSthickness
(double arrows). Red sirius staining of atrial (H through K) and
ventricular (L and M) histological sections ofNppaCrePitx2flox/flox
(H, J, and L) and NppaCrePitx2/ (I, K, and M) adult hearts
demonstrate increased fibrosis in the ventricular(arrows, M) but
not the atrial chambers in atrial-specific Pitx2 conditional
mutants. qRT-PCR analyses of Col1a1 (K) and Col3a1 (L) expres-sion
in NppaCrePitx2flox/flox (black bars) and NppaCrePitx2/ (white
bars) adult hearts are shown. *P0.05, **P0.01.
Chinchilla et al Pitx2 Insufficiency Leads to Atrial
Arrhythmogenesis 273
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
Pitx2 Modulates miR-1 Expression, TherebyControlling IK1 but Not
INa ComponentsTo further understand the regulatory role of Pitx2 on
ionchannel expression, we tested whether lack of Pitx2 in theadult
left atrial chambers impairs microRNA expression.miR-1 qRT-PCR
analyses of adult NppaCrePitx2/ leftatrial myocardium demonstrate a
significant increase ofmiR-1 expression (Figure 5A). Thus, these
results support arole for Pitx2 in repressing miR-1 expression,
which in turn,can regulate Kcnj2 expression.16 However, it is
unknownwhether Scn5a and Scn1b can also be modulated by miR-1.
We therefore overexpressed miR-1 in HL-1 atrial cardiomyo-cytes,
which resulted in decreased Gja1 and Kcnj2 transcriptslevels
(Figure 5B), in line with previous reports,16 but did notmodify
Scn5a and/or Scn1b expression (Figure 5B). Tofurther investigate if
Pitx2 directly regulates miR-1 expres-sion and/or Scn5a expression,
we transiently transfectedHL-1 atrial adult cardiomyocytes with
Pitx2c. Overexpres-sion of Pitx2c resulted in decreased miR-1 and
increasedScn5a and Scn1b expression (Figure 5C). Furthermore,
Pitx2silencing decreased Scn5a and Scn1b expression in HL-1cells
(Figure 5D).
Figure 3. Morphological remodeling ofembryonic atrial-specific
Pitx2 condi-tional mutants. Transversal histologicalsections of
E13.5 (A and B) and E17.5(C through H) embryonic hearts
corre-sponding to NppaCrePitx2flox/flox (A, C,E, and G) and
NppaCrePitx2/ (B, D,F, and H) embryos illustrate a
significantatrial chamber enlargement (A throughD) and myocardial
thinning (E throughH). F, Mean dorso-ventral length (doublearrows
in A through D) of the right atrial(ra) and left atrial (la)
appendages in mul-tiple E13.5 transversal sections demon-strate a
statistically significant increasein length in atrial-specific
Pitx2 condi-tional mutants (black bars) comparedwith control (white
bars). F, Expressionlevels of Nkx2.5, Bmp10, Gata6, Mef2c,Nppa,
Islet-1, and Gata4 in E17.5 leftatrial appendages corresponding
toatrial-specific Pitx2 conditional mutants(white bars) compared
with control(black bars). *P0.05, **P0.01,***P0.001.
274 Circ Cardiovasc Genet June 2011
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
Figure 4. Electrophysiological and molecular remodeling of adult
atrial-specific Pitx2 conditional mutants. Shown are
representativeECG recordings (A through D) of adult NppaCre (n5)
(A), NppaCrePitx2flox/flox (n10) (C), and NppaCrePitx2/ (B and D)
hearts,respectively. Observe that in control mice (NppaCre and
NppaCrePitx2flox/flox), conserved R-R intervals are recording, and
in allcases a p wave can be distinguished (arrows, A and C). In 40%
(4/10) of the atrial-specific conditional mutant mice
(NppaCrePitx2/), anAV block ECG pattern can be observed, as
delineated by arrowheads in B and B, whereas in the remaining
atrial-specific conditionalmutant (6/10), in all but one, a p wave
(arrow) was frequently missing (asterisks), as illustrated in D and
D, and irregular R-R intervalswere also recorded (D, double
arrows). E through I correspond to qRT-PCR expression analyses of
Scn5a (E), Scn1b (F), Kcnj2 (J),
Chinchilla et al Pitx2 Insufficiency Leads to Atrial
Arrhythmogenesis 275
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
DiscussionAF is the most common cause of arrhythmogenesis in
thehuman population, yet, the genetic cause of AF
remainselusive.1719 Point mutations in potassium or sodium
channelgenes have been associated with familial AF but account
foronly a small AF fraction.1923 Recent genome-wide associa-tion
studies810 have reported several risk variants on chro-mosome 4q25,
adjacent to PITX2 gene, which are associatedwith AF. Although these
studies do not provide any experi-mental evidence that links
regulation of PITX2 expression/activity to the risk variants, it
has been suggested that PITX2might be the causative link. In the
present study, we demon-strate that 2 SNPs, rs2200733 and
rs13143308, are highlyprevalent in a cohort of Spanish patients
with AF, supportingprevious findings from other populations. In
addition,rs2200733 is more prevalent in patients with isolated AF
ascompared with patients with AF and other cardiac
structuraldefects, providing a potential role for SNP genotyping as
astratification tool as recently suggested.24 The mechanisms
bywhich these SNPs regulate PITX2 function, however,
remainunknown.
At the transcriptional level, we demonstrate for the firsttime
in this study that PITX2C is significantly decreased inhuman
patients with sustained AF, thus providing a molecularlink between
PITX2 loss of function and AF. We have alsogenerated
chamber-specific conditional Pitx2 mouse mutants,which display a
60% reduction of Pitx2 expression in thechamber myocardium, thus
providing an experimental modelof Pitx2 insufficiency. Such
incomplete Pitx2 deletion mightbe attributed to incomplete and/or
patchy Cre recombinationin the atrial chamber myocardium.11
Importantly, Cre recom-bination (NppaCre) is mainly restricted to
the atrial append-age myocardium, with some weak and patchy
expression inthe AV node (V. Christoffels, personal communication)
butexcluding the sinoatrial and pulmonary veins myocardium.11Lack
of Pitx2 expression in the atrial myocardium leads to aprogressive
enlargement of the atrial chambers, which isconsistent with the
increased proliferation rate in the leftcompared with the right
atrium already observed from earlydevelopmental stages.25
Furthermore, Bmp10 is highly up-
regulated in the left atrial chambers,15 supporting a role
ofPitx2 controlling atrial chamber dimensions, because
overex-pression of Bmp10 plays a crucial role regulating
physiolog-ical hypertrophy.26 Thus, these findings support the
hypoth-esis that selective upregulation of Bmp10 in the
atrialmyocardium, mediated by Pitx2, leads to increase cell
pro-liferation and thus larger atrial chambers. Critically,
atrialdilatation has been widely reported as a putative
mechanismtriggering the onset and maintenance of
arrhythmogenicprocesses, including AF, in the adult heart.27
At the functional level, atrial deletion of Pitx2 leads to
ionchannel remodeling events, which have been previouslylinked to
familiar cases of AF,21,28 supporting the notion thatPitx2 acts
upstream of these AF-prone pathways. In context,Wang et al29 have
recently reported that Pitx2 plays importantrole inhibiting
sinoatrial pacemaker activity in the left atrium,thus providing
susceptibility to atrial arrhythmias. Impor-tantly, our
atrial-specific deletion of Pitx2 provides evidenceof ion channel
remodeling within the atrial chamber myocar-dium independent of
altering sinoatrial node function. Spe-cifically, we show that
Pitx2 loss of function leads todownregulation of Scn5a and Scn1b.
Genetic studies haverevealed that point mutations in SCN5A and
SCN1B areassociated with familiar cases of AF,28 and Scn5a
loss-of-function mouse mutants also display increased atrial
suscep-tibility to atrial arrhythmogenesis.30 Surprisingly, lack
ofPitx2 expression in atrial myocardium leads to downregula-tion
Kcnj2, Kcnj4, and Kcnj14 expression, in contrast to
theproarrhythmogenic pattern of expression observed in hu-mans,31
although loss of the resting membrane potential hasbeen also
associated with atrial electric remodeling and AF.32
Atrial chamber-specific Pitx2 conditional mutants alsodisplay
conductive disturbances, such as an AV block.Importantly, P-wave
recording is frequently missing in theNppaCRe-Pitx2flox/flox
(control) and NppaCrePitx2/atrial chamber-specific Pitx2
conditional mutants, demon-strating too an atrial chamber
dysfunction. Curiously, themorphological characteristics and
anatomic location of thesinoatrial node and the ventricular
conduction system ofatrial-chamber specific conditional mutants is
unaltered, yet
Figure 4 (Continued). Kcnj12 (H), and Kcnj4 (I) in right atrium
(RA), left atrium (LA), and ventricular (V) chambers corresponding
toatrial-specific adult Pitx2 conditional hearts (white bars) as
compared with control mice (black bars). Histological sections of
theAV conduction system of adult NppaCrePitx2flox/flox (J and L)
and NppaCrePitx2/ (K and N) hearts are stained with picro-sirius (J
and K) and Mallory trichrome (L and M). Western blot analyses (N)
of Nav1.5 and Kir2.1 expression correspond to
adultNppaCrePitx2flox/flox (wt) and NppaCrePitx2/ (Pitx2/) hearts.
-Tubulin served as internal loading control. O,
Semiquantitativeillustration of Nav1.5 protein expression
normalized to -tubulin expression corresponding to control mice as
compared with atrial-specific Pitx2 mutants. *P0.05, **P0.01.
Table 2. Electrophysiological Measurements in Atrial
Chamber-Specific Pitx2 Insufficient Mice
Preparation Pitx2 Conditional RMP, mV APA, mV Vmax, V/s APD20,
ms APD50, ms APD90, ms
Left atria (n5) NppaCrePitx2flox/flox 87.02.7 114.11.8 174.08.7
7.31.4 23.33.5 72.28.9
NppaCrePitx2/ 83.84.2* 109.80.6* 170.014.8 7.30.8 24.32.6
89.710.0
Right atria (n5) NppaCrePitx2flox/flox 86.42.9 111.71.1 160.08.6
6.81.0 25.62.7 93.07.5
NppaCrePitx2/ 85.41.7 111.52.0 164.013.4 9.12.2 31.75.6
102.38.8
Ventricular papillarymuscle (n5)
Mlc2vCrePitx2flox/flox 85.32.1 116.41.7 190.014.9 8.81.7 37.05.8
145.114.6
Mlc2vCrePitx2/ 86.23.0 114.02.5 186.08.7 14.62.5 40.23.8
124.87.8
APA indicates action potential amplitude; APD, action potential
duration; and Vmax, maximum upstroke velocity.
276 Circ Cardiovasc Genet June 2011
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
there is reduced insulation of the AV node and bundle ofHis.33
Thus, it is plausible that such AV block might becaused by Pitx2
deficiency in the AVN (Cre recombination),leading to sodium channel
impairment, which in turn canunderlie AV block, as previously
proposed in mice andhumans.34 Importantly, AV block is an
independent riskfactor for AF in humans,28,35 and the observation
of AV blockin our mouse mutant model further implicates Pitx2 in
thedevelopment of atrial proarrhythmogenic substrates.
Atrial dilation and ion channel remodeling are highlylinked
events. However, it is unclear whether Pitx2 directlyregulates
these ion channels or whether this might be caused
by remodeling due to atrial chamber dilation. Our resultsprovide
for the first time evidence that lack of Pitx2 results inimpaired
expression of sodium (INa) and potassium (IK1)channel expression in
atrial but not the ventricular chambers,consistent with the altered
electrophysiological propertiesrecorded in the left but not right
adult Pitx2-deficient atrialmyocardium. Moreover, our Pitx2 gain-
and loss-of-functionexperiments in vitro provide direct evidence
that ion channelremodeling triggered by Pitx2 is independent of
atrial cham-ber dilation. In addition, we demonstrate that Pitx2
can alsomodulate IK1 channel expression indirectly, through
regula-tion of miR-1,36 whereas Scn5a regulation appears to be
Figure 5. Pitx2-mediated microRNA molecular pathway. A, qRT-PCR
analyses of microRNA miR-1 expression in adultNppaCrePitx2flox/flox
(control) and NppaCrePitx2/ (Pitx2/) hearts. Observe that miR-1
expression is increased approximately2-fold in atrial-specific
mutant mice as compared with control mice. B, qRT-PCR analyses of
Scn5a, Scn1b, Gja1, Kcnj2, Kcnj12, andKncj4 expression corresponds
to miR-1 overexpression in HL-1 atrial cardiomyocytes.
Overexpression of miR-1 leads to a significantdecrease in the
expression of Gja1, Kcnj2, and Kcnj4, in line with previous
reports,14 whereas Scn5a, Scn1b, and Kcnj12 display nosignificant
differences. C, qRT-PCR analyses of Pitx2c, miR-1, Scn5a, and Scn1b
expression in Pitx2c-transfected HL-1 atrial cardio-myocytes.
Overexpression of Pitx2c leads to downregulation of miR-1 and
enhanced expression of Scn5a and Scn1b. D, qRT-PCRanalyses of
Pitx2b, Pitx2c, Scn5a, and Scn1b expression in Pitx2
siRNA-transfected HL-1 atrial cardiomyocytes. Silencing of
Pitx2cleads to downregulation of Scn5a and Scn1b. *P0.05,
**P0.01.
Chinchilla et al Pitx2 Insufficiency Leads to Atrial
Arrhythmogenesis 277
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
directly exerted by Pitx2. Thus, together these data supportthe
notion that impaired Pitx2 expression leads to reduced ionchannel
expression and function, thereby providing cellularand molecular
substrates for the onset of arrhythmogenicevents. Unfortunately,
the size limits of the murine heartmakes this model unsuitable to
decipher if ion channelremodeling caused by impaired Pitx2
expression is sufficientto induce AF, and resolution of this issue
will have to wait forthe generation of Pitx2 loss of function in
larger animalmodels.
In conclusion, we provide the first direct evidence for
arelationship between impaired Pitx2 function and distinct
cellu-lar, molecular, and electrophysiological pathways (Figure 6)
canprovide increased susceptibility to induce and/or promote
atrialarrhythmogenesis, supporting the notion that Pitx2 acts
hierar-chically upstream of these AF-prone pathways.
AcknowledgmentsWe thank Phil Gage (University of Michigan
Medical School, AnnHarbor, MI), Vincent Christoffels (Heart Failure
Research Center,Academic Medical Centre, Amsterdam, The
Netherlands), and Ken-neth Chien (University of California, San
Diego, CA) for reagents,Antonio Caruz and Francisco J. Esteban for
expert counseling andsupport on statistical analyses of genotype
data, and Robert Kelly forcritical reading of the manuscript. We
also thank the SpanishNational Bank of DNA (BNADN, Salamanca) for
their valuablesupply of AF and control DNA samples (grant
AL-09-0026). Wethank the Department of Surgery, Hospital de Sant
Pau, for providingtissue samples. Technical assistance of Berta
Ballester and collabo-ration of the Cardiac Surgery Team at
Hospital Sant Pau in providingand handling human atrial samples is
greatly appreciated.
Sources of FundingThis work was partially supported by the VI
European UnionIntegrated Project Heart Failure and Cardiac Repair,
LSHM-CT-2005-018630 to Dr Franco; a grant from the Junta de
AndalucaRegional Council to Dr Franco (CTS-1614); a grant from the
Juntade Andaluca Regional Council to Dr Aranega (CTS-03878);
andgrants from the Ministry of Science and Innovation of the
SpanishGovernment to Dr Franco (MICINN BFU2009-11566) and to
DrAranega (MICINN BFU-2008-01217). This work was partiallysupported
by the Spanish national network REDINSCOR (RD006/0003/0000) on
heart failure, coordinated by Dr Cinca, and transla-tional CNIC
grant 2009/08 to Drs Franco, Caballero, and Hove-Madsen. This work
was partially supported by grants from Ministryof Health and
Consume (PI08/665 and HERACLES RD06/009network) of the Spanish
Government to Dr Tamargo; a grant from
the Complutense University of Madrid to Dr Caballero; a
transla-tional CNIC grant (CNIC-13) to Drs Tamargo and Caballero;
and theMinistry of Science and Education (SAF2008-04903) to Dr
Delpon.This work was partially supported by a grant from the
University ofJaen (UJA2009/12/11) to Dr Dominguez.
DisclosuresNone.
References1. Burdine RD, Schier AF. Conserved and divergent
mechanisms in
left-right axis formation. Genes Dev. 2000;14:763776.2.
Schweickert A, Campione M, Steinbeisser H, Blum M. Pitx2
isoforms:
involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate
left-rightasymmetry. Mech Dev. 2000;90:4151.
3. Campione M, Steinbeisser H, Schweickert A, Deissler K, van
Bebber F,Lowe LA, Nowotschin S, Viebahn C, Haffter P, Kuehn MR,
Blum M.The homeobox gene Pitx2: mediator of asymmetric left-right
signaling invertebrate heart and gut looping. Development.
1999;126:12251234.
4. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M,
Katoh-FukuiY, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y,
Kondo S,Yokoyama M. Mouse Pitx2 deficiency leads to anomalies of
the ventralbody wall, heart, extra- and periocular mesoderm and
right pulmonaryisomerism. Development. 1999;126:57495758.
5. Gage PJ, Suh H, Camper SA. Dosage requirement of Pitx2 for
devel-opment of multiple organs. Development.
1999;126:46434651.
6. Lu MF. Pressman C, Dyer R, Johnson RL, Martin JF. Function of
Riegersyndrome gene in left-right asymmetry and craniofacial
development.Nature. 1999;401:276278.
7. Lui C, Liu W, Lu MF, Brown NA, Martin JF. Regulation of
left-rightasymmetry by thresholds of Pitx2c activity. Development.
2001;128:20392048.
8. Gudbjartsson DF, Arnar DO, Helgadottir A, Gretarsdottir S,
Holm H,Sigurdsson A, Jonasdottir A, Baker A, Thorleifsson G,
Kristjansson K,Palsson A, Blondal T, Sulem P, Backman VM, Hardarson
GA, PalsdottirE, Helgason A, Sigurjonsdottir R, Sverrisson JT,
Kostulas K, Ng MC,Baum L, So WY, Wong KS, Chan JC, Furie KL,
Greenberg SM, Sale M,Kelly P, MacRae CA, Smith EE, Rosand J,
Hillert J, Ma RC, EllinorPT, Thorgeirsson G, Gulcher JR, Kong A,
Thorsteinsdottir U, StefanssonK. Variants conferring risk of atrial
fibrillation on chromosome 4q25.Nature. 2007;448:353357.
9. Kaab S, Darbar D, van Noord C, Dupuis J, Pfeufer A,
Newton-Cheh C,Schnabel R, Makino S, Sinner MF, Kannankeril PJ,
Beckmann BM,Choudry S, Donahue BS, Heeringa J, Perz S, Lunetta KL,
Larson MG,Levy D, MacRae CA, Ruskin JN, Wacker A, Schomig A,
WichmannHE, Steinbeck G, Meitinger T, Uitterlinden AG, Witteman JC,
RodenDM, Benjamin EJ, Ellinor PT. Large scale replication and
meta-analysisof variants on chromosome 4q25 associated with atrial
fibrillation. EurHeart J. 2009;30:813819.
10. Ellinor PT, Lunetta KL, Glazer NL, Pfeufer A, Alonso A,
Chung MK,Sinner MF, de Bakker PI, Mueller M, Lubitz SA, Fox E,
Darbar D, SmithNL, Smith JD, Schnabel RB, Soliman EZ, Rice KM, Van
Wagoner DR,Beckmann BM, van Noord C, Wang K, Ehret GB, Rotter JI,
Hazen SL,Steinbeck G, Smith AV, Launer LJ, Harris TB, Makino S,
Nelis M, MilanDJ, Perz S, Esko T, Kottgen A, Moebus S, Newton-Cheh
C, Li M,Mohlenkamp S, Wang TJ, Kao WH, Vasan RS, Nothen MM,
MacRaeCA, Stricker BH, Hofman A, Uitterlinden AG, Levy D,
Boerwinkle E,Metspalu A, Topol EJ, Chakravarti A, Gudnason V, Psaty
BM, RodenDM, Meitinger T, Wichmann HE, Witteman JC, Barnard J,
Arking DE,Benjamin EJ, Heckbert SR, Kaab S. Common variants in
KCNN3 areassociated with lone atrial fibrillation. Nat Genet.
2010;42:240244.
11. de Lange FJ, Moorman AF, Christoffels VM. Atrial
cardiomyocyte-specific expression of Cre recombinase driven by an
Nppa gene fragment.Genesis. 2003;37:14.
12. Chen J, Kubalak SW, Chien KR. Ventricular muscle-restricted
targetingof the RXRalpha gene reveals a non-cell-autonomous
requirement incardiac chamber morphogenesis. Development.
1998;125:19431949.
13. Vaquero M, Caballero R, Gomez R, Nunez L, Tamargo J, Delpon
E.Effects of atorvastatin and simvastatin on atrial plateau
currents. J MolCell Cardiol. 2007;42:931945.
14. Barana A, Amoros I, Caballero R, Gomez R, Osuna L, Lillo
MP,Blazquez C, Guzman M, Delpon E, Tamargo J. Endocannabinoids
andcannabinoid analogues block cardiac hKv1.5 channels in a
cannabinoidreceptor-independent manner. Cardiovasc Res.
2010;85:5667.
Figure 6. Pitx2-mediated signaling pathways in the developingand
adult heart. Schematic representation of the
Pitx2-mediatedsignaling pathways is revealed by the morphological,
electro-physiological, and molecular analysis of atrial
chamber-specificPitx2 conditional mutants.
278 Circ Cardiovasc Genet June 2011
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
15. Tessari A, Pietrobon M, Notte A, Cifelli G, Gage PJ,
Schneider MD,Lembo G, Campione M. Myocardial Pitx2 differentially
regulates the leftatrial identity and ventricular asymmetric
remodeling programs. Circ Res.2008;102:813822.
16. Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, Zhang Y, Xu C, Bai
Y, WangH, Chen G, Wang Z. The muscle-specific microRNA miR-1
regulatescardiac arrhythmogenic potential by targeting GJA1 and
KCNJ2. NatMed. 2007;13:486491.
17. Postma AV, Dekker LR, Soufan AT, Moorman AF. Developmental
andgenetic aspects of atrial fibrillation. Trends Cardiovasc Med.
2009;19:123130.
18. Campuzano O, Brugada R. Genetics of familial atrial
fibrillation.Europace. 2009;11:12671271.
19. Damani SB, Topol EJ. Molecular genetics of atrial
fibrillation. GenomeMed. 2009;1:5456.
20. Chen YH, Xu SJ, Bendahhou S, Wang XL, Wang Y, Xu WY, Jin
HW,Sun H, Su XY, Zhuang QN, Yang YQ, Li YB, Liu Y, Xu HJ, Li XF,
MaN, Mou CP, Chen Z, Barhanin J, Huang W. KCNQ1
gain-of-functionmutation in familial atrial fibrillation. Science.
2003;299:251254.
21. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou
Q, YangY, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong
X, Pan Z,Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen
Y. AKir2.1 gain-of-function mutation underlies familial atrial
fibrillation.Biochem Biophys Res Commun. 2005;332:10121019.
22. Olson TM, Alekseev AE, Liu XK, Park S, Zingman LV,
BienengraeberM, Sattiraju S, Ballew JD, Jahangir A, Terzic A. Kv1.5
channelopathydue to KCNA5 loss-of-function mutation causes human
atrial fibrillation.Hum Mol Genet. 2006;15:21852191.
23. Ellinor PT, Nam EG, Shea MA, Milan DJ, Ruskin JN, MacRae
CA.Cardiac sodium channel mutation in atrial fibrillation. Heart
Rhythm.2007;5:99105.
24. Husser D, Adams V, Piorkowski C, Hindricks G, Bollmann A.
Chro-mosome 4q25 variants and atrial fibrillation recurrence after
catheterablation. J Am Coll Cardiol. 2010;55:747753.
25. Lozano-Velasco E, Chinchilla A, Martnez-Fernandez S,
Hernandez-Torres F, Navarro F, Lyons GE, Franco D, Aranega AE.
Pitx2c modulatescardiac-specifictranscription factors networks in
differentiating cardio-myocytes from murine embryonic stem cells.
Cells Tissues Organs.March 9, 2011. [Epub ahead of print].
26. Chen H, Yong W, Ren S, Shen W, He Y, Cox KA, Zhu W, Li
W,Soonpaa M, Payne RM, Franco D, Field LJ, Rosen V, Wang Y, Shou
W.Overexpression of bone morphogenetic protein 10 in
myocardiumdisrupts cardiac postnatal hypertrophic growth. J Biol
Chem. 2006;281:2748127491.
27. Camm AJ, Luscher TM, Serruys PW. ESC Textbook of
CardiovascularMedicine. 2nd edition. Oxford University Press,
Oxford; 2009.
28. Tfelt-Hansen J, Winkel BG, Grunnet M, Jespersen T. Inherited
cardiacdiseases caused by mutations in the Nav1.5 sodium channel. J
CardiovascElectrophysiol. 2010;21:107115.
29. Wang J, Klysik E, Sood S, Johnson RL, Wehrens XHT, Martin
JF. Pitx2prevents susceptibility to atrial arrhythmias by
inhibiting left-sidedpacemaker specification. PNAS.
2010;107:97539758.
30. Dautova Y, Zhang Y, Sabir I, Grace AA, Huang CL. Atrial
arrhythmo-genesis in wild-type and Scn5a/delta murine hearts
modelling LQT3syndrome. Pflugers Arch. 2009;458:443457.
31. Kharche S, Garratt CJ, Boyett MR, Inada S, Holden AV, Hancox
JC,Zhang H. Atrial proarrhythmia due to increased inward rectifier
current(I(K1)) arising from KCNJ2 mutation-a simulation study. Prog
BiophysMol Biol. 2008;98:186197.
32. Mary-Rabine L, Albert A, Pham TD, Hordof A, Fenoglio JJ Jr,
Malm JR,Rosen MR. The relationship of human atrial cellular
electrophysiology toclinical function and ultrastructure. Circ Res.
1983;52:188199.
33. Suarez-Penaranda JM, Munoz JL, Rodrguez-Calvo MS, Ortz-Rey
JA,Concheiro L. The pathology of the heart conduction system in
congenitalheart block. J Clin Forensic Med. 2006;13:341343.
34. Ge J, Sun A, Paajanen V, Wang S, Su C, Yang Z, Li Y, Wang S,
Jia J,Wang K, Zou Y, Gao L, Wang K, Fan Z. Molecular and clinical
char-acterization of a novel SCN5A mutation associated with
atrioventricularblock and dilated cardiomyopathy. Circ Arrhythm
Electrophysiol. 2008;1:8392.
35. Miura M, Yamagishi H, Morikawa Y, Matsuoka R. Congenital
long QTsyndrome and 2:1 atrioventricular block with a mutation of
the SCN5Agene. Pediatr Cardiol. 2003;24:7072.
36. Girmatsion Z, Biliczki P, Bonauer A, Wimmer-Greinecker G,
Scherer M,Moritz A, Bukowska A, Goette A, Nattel S, Hohnloser SH,
Ehrlich JR.Changes in microRNA-1 expression and IK1 up-regulation
in humanatrial fibrillation. Heart Rhythm. 2009;6:18021809.
CLINICAL PERSPECTIVEAtrial fibrillation (AF) is the most
frequent cardiac arrhythmia, leading to a high risk of mortality
and morbidity. Thoughits prevalence is high, genetics of AF has
remained rather elusive, with sporadic reports on point mutations
in a wide varietyof ion channelencoding genes. Recently,
genome-wide association studies have unraveled genetic variants
(associatedwith AF risk) that are located close to the homeobox
transcription factor PITX2 in a large proportion of AF patients.
Inthe present investigation, we corroborated these findings in a
small cohort of AF patients. We also provided evidence thatPITX2 is
downregulated in AF patients and experimentally demonstrated that
Pitx2 insufficiency results in cellular andmolecular changes
leading to atrial electrical and cellular remodeling linked to
atrial arrythmogenesis. Thus, these findingsprovide insights into
signaling pathways that are implicated in the pathogenesis of
AF.
Chinchilla et al Pitx2 Insufficiency Leads to Atrial
Arrhythmogenesis 279
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from
-
SUPPLEMENTALMATERIAL
-
Supplementary Materials & Methods
Human tissue and DNA samples
Atrial myocardial tissue samples were obtained from patients
undergoing cardiac surgery. Specimens were obtained from the
right
or left atria just prior to atrial cannulation for
cardiopulmonary bypass.
After excision, samples were rapidly frozen in liquid nitrogen
and
stored at -80C until analyzed. The atrial samples were
classified as
patients with atrial fibrillation (AF) and without (No AF) a
recorded
history of AF. Although the atrial tissue samples consisted of
tissue
that would normally be discarded during surgery, permission to
be
used in this study was obtained from each patient. The study
was
approved by the Ethical Committee of the Hospital de la Santa
Creu i
Sant Pau (Barcelona) and the investigation conforms with the
principles outlined in the Declaration of Helsinki.
Genomic DNA samples from 47 patients diagnosed of having
atrial
fibrillation and 100 healthy donors with no cardiac structural
and/or
functional diseases were obtained from the Spanish National
DNA
Bank (BNADN, Salamanca). This study was approved by the
Ethical
Committees of the Spanish National DNA Bank (BNADN,
Salamanca)
and of the University of Jan and the investigation conforms with
the
principles outlined in the Declaration of Helsinki.
Transgenic mouse lines and breeding strategy
The Pitx2floxed, NppaCre and Mlc2vCre transgenic mouse line
have
been previously described (5, 11, 12). Generation of conditional
atrial
(NppaCre) and ventricular (Mlc2vCre) mutant mice was performed
by
intercrossing hemizygous Cre deletor mice with homozygous
Pitx2floxed mice. Double heterozygous were selected by PCR
and
subsequently crossed with homozygous Pitx2floxed mice,
respectively, yielding to controls (Cre-) (i.e.
Mlc2vCre-Pitx2flox/flox and
NppaCre-Pitx2flox/flox, respectively), heterozygous Cre+/floxed
(i.e.
Mlc2vCre+Pitx2fl/- and NppaCre+Pitx2fl/-, respectively) and
homozygous Cre+/floxed (i.e. Mlc2vCre+Pitx2-/- and
NppaCre+Pitx2-/-,
-
respectively). Since homozygous mice were viable to adulthood
in
both conditional deletions, mice have been bred into a pure
C57Bl/6J
genetic background, and offspring from mouse lines matting
were
routinely screened for the presence of the Pitx2 floxed allele
and the
Cre sequence as previously reported (15). This investigation
conform
the Guide for the Care and Use of Laboratory Animals published
by
the US National Institutes of Health.
Mouse genotyping
DNA for PCR screening was extracted from adult ear and/or
tail
samples and from the yolk sac in embryos. Screening of Cre
and
Pitx2 floxed alleles was routinely done using used specific
primers as
detailed in Supplementary Table 1. Cycling conditions for Cre
were as
follows; 5 min at 95C, 35 cycles of 30s at 95C, 30s at 60C and
90s
at 72C, and for Pitx2 as follows; 5 min at 95C. 40 cycles of 30s
at
95C, 30s at 60C and 90s at 72C, followed by a final extension
step
of 10 min at 72C, respectively. PCR products were separated
in
standard agarose electrophoresis and classified according to
the
expected band size.
Anatomical and histological analyses
Mice were sacrificed by cervical dislocation, after ECG
recordings
(see below). Adult hearts were carefully dissected and briefly
rinse in
Ringers solution and photographed. Samples processed for
histochemistry and immunohistochemistry were fixed overnight
in
freshly made sterile 4% paraformaldehyde. Samples processed
for
RNA isolation were immediately snap-frozen in liquid nitrogen
and
stored at -80C until used. Staged wild-type control and
chamber-
specific Pitx2 conditional embryos (E13.5, E15.5 and E17.5)
were
carefully dissected from uterus of time-controlled pregnant
females,
briefly rinse in sterile PBS and processed accordingly, Adult
and
embryonic samples processed for histochemistry and
immunohistochemitry were dehydrated through graded ethanol
steps
and embedded in paraplast. Sections were cut at 10 m and
-
processed for hematoxylin and eosin, Mallorys thrichrome
and/or
picrosirius staining.
mRNA Isolation and Reverse Transcription
Embryonic hearts (E17.5) were dissected from pregnant
tissue-
specific conditional mutants. Neonatal (3 weeks) and adult
Mlc2vCrePitx2 and Nppa-CrePitx2 conditional mutants were
also
obtained. For NppaCrePitx2 (NppaCre-Pitx2flox/flox and
NppaCre+Pitx2-
/-, respectively) mouse mutants we carefully separately
dissected the
left atrial chambers, the right atrial chambers and the
ventricular
chambers, and stored in liquid nitrogen. For MlcvCrePitx2
(Mlc2vCre-
Pitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively), only the
ventricular
chambers were dissected and stored in liquid nitrogen.
RNA extraction was performed using six E17.5 pooled left,
right
atrial or ventricular samples of embryonic NppaCrePitx2
conditional
mutants, respectively, corresponding on each case to either
control
(NppaCre-Pitx2flox/flox) or homozygous (NppaCrePitx2-/-)
mutants. For
Mlc2vCrePitx2 three pooled ventricular myocardium samples of
Mlc2vCre+Pitx2-/- and their corresponding controls
(Mlc2vCre-Pitx2 flox/flox) were used. RNA extraction of adult
hearts was performed using
three pooled left atrial samples NppaCre Pitx2 conditional
mutants
(NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/-, respectively) and
a single
ventricular myocardium sample of Mlc2vCrePitx2 conditional
mutants
(Mlc2vCre-Pitx2flox/flox and Mlc2vCre+Pitx2-/-, respectively).
Total RNA
was isolated using Trizol (Roche) according to manufactures
guidelines and DNase treated using RNase-Free DNase (Roche)
for
1h at 30C. In all cases, at least three distinct pooled samples
were
used to perform the corresponding qRT-PCR experiments.
First strand cDNA was synthesized at 50C for 1h using 1 g of
RNA, oligo-dT primers and Superscript III Reverse
Transcriptase
(Invitrogen) according to manufactures guidelines Negative
controls
to assess genomic contamination were performed for each
sample,
without reverse transcriptase, which resulted in all cases in
no
detectable amplification product.
-
qRT-PCR (mRNA)
RT-PCR was performed in Mx3005Tm QPCR System with a MxPro
QPCR Software 3.00 (Stratagene) and SYBR Green detection
system. Reactions were performed in 96-well plates with
optical
sealing tape (Cultek) in 20 L total volume containing SYBR
Green
Mix (Finnzymes) and the corresponding cDNA. Two internal
controls,
mouse actin and GAPDH, were used in parallel for each run.
Amplification conditions were as follows: denaturisation step of
95C
for 10 min, followed by 40 cycles of 95C for 30s, 60C for 30s,
72C
for 30s; with final elongation step of 72C for 10 min. All
primers were
designed to span exon-exon boundaries using online Primer3
software Primer3input (primer3 www. cgi v 0.2) as provided in
Table 1. No amplifications were observed in PCR control reactions
containing only water as the template. Each PCR reaction was
performed at least three times to obtain representative
averages. The
Livak method was used to analyze the relative quantification
RT-PCR
data (37) and normalized in all cases taking as 100% the
wild-type
(control) value, as previously described (38).
qRT-PCR (microRNA)
miR-1 microRNA qRT-PCR was performed using Exiqon LNA
microRNA qRT-PCR primers and detection kit according to
manufacturers guidelines. All reactions were always run in
triplicates
using 5S as normalizing control, as recommended by the
manufacturer. SyBR Green was used as quantification system on
a
Stratagene Q-Max 2005P qRT-PCR thermocycler. Relative
measurements were calculated as described by Livak &
Schmittgen
(37) and control measurements were normalized to represent
100%,
as previously described (38).
Electrophysiological measurements
Transmembrane action potentials were recorded in isolated left
and
right atria of male NppaCre-Pitx2flox/flox and NppaCre+Pitx2-/-
mice
-
(n=5, per group), and in thin papillary muscles from male
Mlcv2Cre-
Pitx2flox/flox and Mlc2vCre+Pitx2-/- mice through glass
microelectrodes
filled with 3 M KCl (tip resistance, 8-15 M) using procedures
described previously (13,14). Multicellular preparations were
perfused
with a modified Tyrodes solution of the following composition:
NaCl
125, KCl 5.4, CaCl2 1.8, MgCl2 1.05, NaHCO3 24, NaH2PO4 0.42
and
glucose 11. The solution was bubbled with 95% O2 and 5% CO2
(pH=7.4) and maintained at a temperature of 35C. The
microelectrode was connected via Ag-AgCl wire to high-input
impedance, capacity-neutralizing amplifiers (model 701; WPI,
New
Haven, CT, USA). Driving stimuli were rectangular pulses (1-2 ms
in
duration) delivered from a multipurpose programmable stimulator
(CS-
220; Cibertec SA, Madrid, Spain). Action potentials were stored
in a
computer by use of Acknowledge software. The following
parameters
of the transmembrane action potential were measured: resting
membrane potential (RMP), amplitude (APA) and action
potential
duration (ADP) measured at the 20% (APD20), 50% (APD50), and
90%
(APD90) level of repolarization. The preparations were driven at
3 Hz
and a period of 1 h was allowed for equilibration, during which
a
stable impalement was obtained.
ECG recordings
Mice were anesthetized with 2mg/Kg Ketamine (PARKE-DAVIS,
S.L.)
intraperitoneally. Electrocardiogram (ECG) recordings were
registered
and analyzed using a digital acquisition and analysis system
(Power
Lab/4SP; www.adinstrument.com). Dual Bio Amplifier was
connected
to the ECG Lead Switch Box to enable recording of standard
lead
configurations. For routine screening, surface ECG (lead II)
were
recorded from needle electrodes that were inserted
subcutaneously in
the limbs and tape secured. The signal is acquired for about
10
minutes using Chart 4.2.3 software. When recordings were
finished,
the limb electrodes are removed and mice were allowed to
recover
and returned to their cage. The signal averaged ECG waveform
and
-
the 1st derivate were analyzed using SAECG (signal-averaged
electrocardiogram) extension for Chart 4 software (AD
Instruments).
Cell culture and microRNA-1 transfection assays
HL-1 mouse immortalized atrial myocardial (39) cells were used
to
assay microRNA-1 gain-of-function experiments. HL-1 cells
(6*105
cells per dish) were culture under appropriate cell culture
condition
(39) and plated 30mm culture dishes. Pre-miR-1 were
transfected
with lipofectamine 2000 (Invitrogen) into HL-1 cells at 5
mmol
according to manufacturers guidelines, respectively.
Negative
controls included non transfected cells as well as FAM-labeled
pre-
miR negative control transfected cells, which also allow
evaluation of
the transfection efficiency. In all cases, transfection
efficiencies were
greater than 50%, as revealed by observation of FAM-labeled
pre-
miR transfection. After 4 hours transfection, HL-1 cells were
culture in
appropriate cell culture media as reported by Claycomb et al.
1998.
Cells were collected 24h (pre-miR treatment) after
transfection.
Negative control and transfected cells were collected and
processed
for RNA isolation using Trizol-base standard protocols. RNA
quality
and integrity was evaluated using a Nanodrop spectrophotometer
and
cDNAs were retro-transcribed accordingly. qRT-PCR measurement
of
several mRNA transcripts was evaluated as described above.
Control
measurements levels were normalization represent 100%, as
previously described (38).
Cell culture, Pitx2c overexpression and siRNA transfection
assays
HL-1 cells (6*105 cells per well) were transfected with
CMV-Pitx2c
construct at two distinct plasmid concentrations (2 and 4
g/well) using lipofectamine 2000 (Invitrogen), according to
manufacturers
guidelines. Cells were harvested for 48 hours and processed for
RNA
isolation as previously described. Transfection efficiency
was
evaluated by assessment of CMV-EGFP transfected cells, which
resulted in all cases in more that 60% transfected cells. In
addition, in
-
all cases, Pitx2c quantitation was evaluated by qRT-PCR,
which
resulted in 5 to 8-fold increase.
HL-1 cells (6*105 cells per well) were transfected with
siRNA-Pitx2
(Sigma), at different concentrations, 25nM and 50nM, using
the
Lipofectamine RNAiMAX Transfection Reagent (Invitrogen)
following
the suppliers protocol. 105 cells per well were seeded and
transfected
in serum free conditions for 5 hr, after that cells were
collected at 24h.
siRNA efficiency was measured as percentage of Pitx2
expression
levels as compared to non-transfected controls. In all cases,
silencing
of Pitx2 was higher than 70-80%.
Immunofluorescence staining and confocal analysis
Embryonic hearts (E16.5) were extracted from
chamber-specific
conditional and control pregnant females, respectively. Adult
hearts
from chamber-specific Pitx2 conditional and controls were
also
collected. For immunofluorescent experiments, embryos and
isolated
adult hearts were fixed overnight in 4% paraformaldehyde in
PBS,
dehydrated in increasing ethanol steps and embedded in
paraplast.
Tissues samples were sectioned at 10 m and mounted in 3-
aminopropyl-triethoxy-silane (AAS) coated slides.
Tissue slides were deparaffinised at 65C during 30 min,
hydrated through decreasing graded ethanol steps, and briefly
rinsed
in bidest water. Unspecific bindings were blocked for 30 min
in
TBSA_BSAT (10 mM Tris, 0,9% NaCl, 2% bovine serum albumin,
0,1% Triton X-100, 0,02% sodium azide) at room temperature.
Subsequently tissue sections were incubated overnight with
the
corresponding primary antibody (1:100) diluted in TBSA-BSAT.
The
antibodies used were: rabbit anti desmin (D8281; Sigma),
anti-hcn4
(APC-052, Alomone) and anti-Nav1.5 (ASC-005, Alomone). The
excess of primary antibody was removed by a brief rinse in
TBSA-
BSAT. Thereafter, the sections were incubated in darkness with
the
corresponding anti-rabbit Cy2-conjugated (Jackson Lab, USA) or
anti-
mouse TRITC-conjugated (DAKO) secondary antibodies (1:100)
respectively, during 5 hours. Sections were washed in
TBSA-BSAT,
-
rinsed in PBS and incubated in DRAQ-5TM (Red Fluorescent
Cell-
Permeable DNA probe, from Biostatus Limited, UK) diluted
(1:1000)
in PBS for 10 min. The excess of DRAQ-5TM was removed by a
wash
in PBS, briefly rinsed in water, dehydrated and mounted in DPX.
The
specificity of the primary antibody was assessed by lack of
primary
antibody incubation which resulted in all cases in no detectable
signal.
The samples were conserved in total darkness until analysed.
Images
were obtained using a Leica Laser Scanning Confocal
Microscope
and further edited using Adobe Photoshop software (version
7.0).
Western blotting
Adult hearts from either wild type (NppaCre-Pitx2flox/flox) or
homozygous
(NppaCre+Pitx2-/-) mutants, were collected, processed
accordingly and
stored in liquid nitrogen. Total protein extraction of was done
using single
hearts. These samples were lysated in a small volume of 1 ml
RIPA buffer
(50mM Tris pH 8,2, 1mM EDTA, 0,1% p/v Triton X-100, 1mM
PMSF,
cocktail protease) using sonication. Protein quantitation was
performed
using standard Commassie Protein Assay (Pierce). 10mg of total
protein
was loaded in homogeneous 12,5% SDS-PAGE gels. Gels were
blotted
onto nitrocellulose and probed against Kir2.1 (ab-80969-500,
Abcam) or
Nav1.5 (ASC-005, Alomone) while -tubuline was used as internal
loading control (T-5168, Sigma). Primary antibody incubation was
performed at
1:200, 1:100 and 1:14000, respectively. Corresponding secondary
anti-
rabbit or anti-mouse antibodies (1:10000 dilution) were used to
reveal
Kir2.1, Nav1.5 and -tubuline, respectively. Signal detection was
performed using ECL Plus (GE).
Statistical analyses
qRT-PCR data statistical analyses were performed using unpaired
Student
t- test. p values
-
1; p-values were obtained directly using the hypergeometric
distribution.
Allele frequencies were estimated from genotype frequencies by
gene
counting. The study was analyzed as a case/ control study
comparing the
allele frequency of both SNPs in the atrial fibrillation (47)
and control (100)
groups. The odds ratio (OR) [95% CI] for both SNPs associated
with
genotype was estimated from logistic regression analysis
adjusted for AF
type (isolated vs associated) and atrial fibrillation/control. A
p-value
-
A ENEP (right atrium)
200
250
* *
**100
150
200
**0
50
1 2 3 4 5 6 7 8 9 10 11 12NoAF AF NoAF AF NoAF AF NoAF AF NoAF
AF NoAF AF
** **
B ENEP (left atrium)
200
250 ***
100
150
200 *
*
0
50
1 2 3 4 5 6 7 8 9 10 11 12NoAF AF NoAF AF NoAF AF NoAF AF NoAF
AF NoAF AF
** ** ***
Chinchilla et al., Supplementary Figure 2
-
A rs2200733 (CT)
C/C C/T T/T
B rs13143308 (GT)
G/G G/T T/T
Chinchilla et al., Supplementary Figure 1
-
A BNppaCrePitx2 Mlc2vCrePitx2
A B
100
120
* *du
n
i
t
s
80
* **
r
m
a
l
i
z
e
d
40
60
n
o
20
01 2 3 4 5Pitx2b Pitx2c Pitx2b Pitx2c
Chinchilla et al., Supplementary Figure 3
-
Supplementary Table 1 Mouse qRT-PCR Oligonucleotide sequence Cre
Forward ATCTTCCAGGCGCACCATTGCCCCTGT Cre Reverse
TGACGGTGGGAGAATGTTAATCCATATTGG Pitx2 Forward
TCGTGTCTTAAAAGGATGTGTTTCTTC Pitx2 Reverse TTCTGGAGGGTTTTCTTGTTCTAG
Gapdh Forward TCCTGGTATGACAATGAATACGGC Gapdh Reverse
TCTTGCTCAGTGTCCTTGCTGG Gusb Forward ACGCATCAGAAGCCGATTAT Gusb
Reverse ACTCTCAGCGGTGACTGGTT Nkx2.5 Forward AGGTACCGCTGTTGCTTGAA
Nkx2.5 Reverse CAAGTGCTCTCCTGCTTTCC Pitx2b Forward
GATAACCGGGAATGGAGACC Pitx2b Reverse GTCTTTCTGGGGCAGAGTTG Pitx2c
Forward GCCCACATCCTCATTCTTTC Pitx2c Reverse CCTCACCCTTCTGTCACCAT
Nppa Forward TCT CAG AGG TGG GTT GAC CT Nppa Reverse CCT GTG TAC
AGT GCG GTG TC Bmp10 Forward TCAAGACGCTGAACTTGTCG Bmp10 Reverse
GTTCAGCCATGACGACCTCT Kcnj2 Forward GGTGTCAGCGCAAACAGTTGC Kcnj2
Reverse AGAGATGGATGCTTCCGAGA Kcnj12 Forward GACAGAAACAGCATCCACCA
Kcnj12 Reverse GTGTATGCACCTTGCCATTG Kcnj4 Forward
AGACCCTCCTCGGACCTTAC Kcnj4 Reverse AGACGTTACACTGGCCGTTC Gja1
Forward ACAGCGAAAGACTGTT Gja1 Reverse TTTGACTTCACCAAGG Scn1b
Forward TGC TCA TTG TGG TGT TGA CC Scn1b Reverse CCT GGA CGC CTG
TAC AGT TT Scn5a Forward GGA GTA CGC CGA CAA GAT GT Scn5a Reverse
ATC TCG GCA AAG CCT AAG GT Mhl7 Forward TGCTTTATTCCCACCT Mhl7
Reverse AGTCCCAGGTAAGCTG Mef2c Forward GGGGTGAGTGCATAAGAGGAG Mef2c
Reverse AGAAGAAACACGGGGACTATGGG Mlc2a Forward
AAGCCATCCTGAGTGCCTTCCG Mlc2a Reverse GGTGTCAGCGCAAACAGTTGC Mlc2v
Forward CCT CTC TGC TTG TGT GGT CA Mlc2v Reverse AAA GAG GCT CCA
GGT CCA AT Col1a1 Forward CACCTGGTCCACAAGGTTTC Col1a1 Reverse
ACCATCCAAACCACTGAAGC Col3a1 Forward AATGGCTCACACAAAG Col3a1 Reverse
CACCTGAAGGCGTGTT
-
Gata4 Forward GCAGCAGCAGTGAAGAGATG Gata4 Reverse
GCGATGTCTGAGTGACAGGA Gata6 Forward CTACACAAGCGACCACCTCA Gata6
Reverse CCAGAGCACACCAAGAATCC islet-1 Forward TCCCATCCCTAAGCAC
islet-1 Reverse ACCAATTGTCCACCAT siRNA Pitx2 sense GUC CAU ACA AUC
UCC GAU AdTdT siRNA Pitx2 antisense UAU CGG AGA UUG UAU GCA CdTdT
Human SNP genotyping Oligonucleotide sequence rs2200733 Forward
ACTAGCAAGCCCTCCAGGTT rs2200733 Reverse GCAAACCACTGCCCTAAGAG
rs13143308 Forward TGGGGGATGGACCAGTATAA rs13143308 Reverse
TTGCCAGAAGAGCTTCAGTATG Human qRT-PCR Oligonucleotide sequence
PITX2A Forward GGCGTGTGTGCAATTAGAGA PITX2A Reverse
GGTCCACACAGCGATTTCTT PITX2B Forward TCGAGTTCACGGACTCTCCT PITX2B
Reverse GAGCTGCTGGCTGGTAAAGT PITX2C Forward CTTTCCGTCTCCGGACTTTT
PITX2C Reverse CGCGACGCTCTACTAGTCCT GAPDH Forward
AGCCACATCGCTCAGACAC GAPDH Reverse AACCATGTAGTTGAGGTCAATGAA PPIA
Forward TCGAGTTGTCCACAGTCAGC PPIA Reverse TTCATCTGCACTGCCAAGAC ENEP
Forward TTTCTCCTGCTCCAGCTTGT ENEP Reverse AGAAACCTTGGCCGAATTG
-
Supplementary Table 2 Sex Age Diabetes Systole
BP Dyastole
BP HTA FA type Isolated/CM rs2200733 rs13143308
1 Male 72 NO 100 65 NO Paroxysmal CM T/T G/G 2 Male 64 NO 160
100 NO Paroxysmal Isolated C/T T/G 3 Female 58 NO 146 80 YES
Paroxysmal Isolated C/C T/T 4 Female 75 NO 128 78 NO Paroxysmal
Isolated C/T T/G 5 Female 64 NO 147 74 YES Paroxysmal Isolated C/T
T/G 6 Male 81 NO 128 95 YES Paroxysmal CM C/C T/G 7 Male 75 NO 155
65 YES Paroxysmal Isolated C/C T/T 8 Female 73 YES 162 95 YES
Paroxysmal Isolated T/T G/G 9 Female 70 NO 90 58 YES Paroxysmal
Isolated C/C G/T
10 Female 60 YES 160 88 YES Paroxysmal Isolated C/T G/T 11
Female 72 NO 130 80 YES Paroxysmal Isolated C/C G/G 12 Male 46 NO
138 96 NO Paroxysmal Isolated C/C G/G 13 Male 58 NO 130 84 NO
Paroxysmal Isolated C/T G/T 14 Male 68 YES 135 66 YES Paroxysmal CM
C/C G/G 15 Male 74 NO 129 80 YES Permanent Valvulopathy C/T G/T 16
Female 65 YES 110 77 NO Permanent Isolated C/C T/T 17 Male 73 NO
136 102 YES Permanent CM C/C G/T 18 Female 78 YES 125 72 YES
Paroxysmal Isolated C/C G/G 19 Male 52 NO 132 75 YES Paroxysmal
Isolated C/C G/T 20 Female 58 NO 123 80 NO Paroxysmal Isolated C/T
G/G 21 Female 81 NO 144 93 YES Paroxysmal Isolated C/T G/T 22 Male
59 YES 131 79 YES Paroxysmal Isolated C/T G/T 23 Male 65 NO 130 80
NO Paroxysmal Isolated C/T G/T 24 Male 78 NO 134 74 YES Paroxysmal
CM C/C G/G 25 Male 60 NO 98 62 NO Paroxysmal Isolated C/C G/G 26
Male 65 NO 152 89 YES Paroxysmal Isolated C/T G/T 27 Female 78 YES
167 97 YES Paroxysmal CM C/C G/G 28 Female 74 NO 140 70 YES
Paroxysmal CM C/T G/T 29 Male 85 NO 131 79 NO Permanent CM C/C G/G
30 Male 77 NO 110 85 YES Permanent CM C/C G/G 31 Male 75 YES 127 68
YES Permanent Isolated C/T G/G 32 Male 57 NO 98 71 YES Paroxysmal
CM C/C T/T 33 Male 76 NO 118 69 YES Permanent CM C/C G/G 34 Male 57
NO 136 81 YES Paroxysmal Isolated C/T T/T 35 Female 86 NO 181 86
YES Permanent CM C/C G/T 36 Female 59 YES 136 78 YES Paroxysmal
Isolated C/T G/G 37 Female 86 NO 120 70 YES Paroxysmal Isolated C/C
G/G 38 Female 77 NO 123 100 YES Paroxysmal CM C/C T/T 39 Male 38 NO
119 82 YES Paroxysmal Isolated C/C T/T 40 Female 90 NO 153 81 NO
Paroxysmal Isolated T/T G/G 41 Male 63 NO 137 89 YES Paroxysmal
Isolated C/T G/T 42 Male 43 NO 119 88 YES Paroxysmal Isolated C/C
G/G 43 Female 83 YES 115 62 YES Permanent CM C/T G/G 44 Female 77
NO 118 97 NO Paroxysmal Isolated C/C G/T 45 Female 78 NO 147 86 YES
Paroxysmal Isolated C/C G/G 46 Male 77 NO 116 61 NO Permanent CM
C/C G/T 47 Male 81 NO 139 67 NO Permanent CM C/C G/G
-
Supplementary Table 3 Sex Age rs2200733 rs13143308 Sex Age
rs2200733 rs13143308
1 Male 61 C/C G/G 61 Male 52 C/T G/G 2 Male 53 C/C G/G 62 Female
53 C/C G/G 3 Male 59 C/C G/G 63 Male 51 C/C G/G 4 Female 49 C/C G/T
64 Male 54 C/T G/G 5 Male 53 C/C G/G 65 Male 52 C/T G/G 6 Female 55
C/C G/G 66 Female 56 C/T G/G 7 Male 59 C/T G/G 67 Male 54 C/C G/G 8
Female 69 C/T G/T 68 Female 44 C/T G/G 9 Male 57 C/C G/T 69 Male 58
C/C G/G
10 Male 53 C/C G/G 70 Male 53 C/T G/G 11 Male 45 C/T G/T 71
Female 52 C/C G/G 12 Female 61 C/C G/T 72 Male 48 C/C G/G 13 Female
49 C/C G/T 73 Male 58 C/C G/G 14 Female 47 C/C G/T 74 Female 44 C/C
G/G 15 Male 63 C/C G/T 75 Male 51 C/C G/G 16 Female 55 C/T G/T 76
Female 54 C/C G/G 17 Male 64 C/T G/G 77 Female 55 C/C G/G 18 Female
56 C/T G/G 78 Male 53 C/C G/G 19 Female 43 C/C G/G 79 Male 63 C/C
G/G 20 Female 43 C/C G/G 80 Female 51 C/C G/G 21 Female 56 C/T G/T
81 Female 48 C/C G/G 22 Female 46 C/C G/G 82 Female 43 C/C G/G 23
Male 50 C/C G/G 83 Male 56 C/C G/G 24 Female 51 C/C G/G 84 Male 52
C/C G/G 25 Female 49 C/C G/G 85 Male 52 C/C G/G 26 Male 65 C/C G/G
86 Female 45 C/C G/G 27 Female 50 C/C G/G 87 Female 54 C/C G/G 28
Female 57 C/C G/G 88 Male 58 C/C G/G 29 Female 43 C/C G/G 89 Female
62 C/C G/G 30 Female 45 C/C G/G 90 Female 45 C/C G/G 31 Female 45
C/T G/G 91 Male 58 C/C G/G 32 Female 56 C/T G/G 92 Male 51 C/C G/G
33 Female 52 C/C G/G 93 Male 64 C/C G/G 34 Female 47 C/C G/G 94
Female 58 C/C G/G 35 Male 65 C/T G/G 95 Male 49 C/C G/G 36 Male 45
C/T G/G 96 Female 44 C/C G/G 37 Female 57 C/C G/G 97 Male 53 C/C
G/G 38 Male 45 C/C G/G 98 Male 64 C/C G/G 39 Male 56 C/C G/G 99
Male 55 C/C G/G 40 Female 57 C/C G/G 100 Female 53 C/C G/G 41
Female 62 C/C G/G 42 Female 57 C/T G/G 43 Female 44 C/T G/G 44 Male
60 C/T G/G 45 Female 52 C/C G/G 46 Male 66 C/C G/G 47 Female 45 C/T
G/G 48 Male 52 C/C G/G 49 Female 56 C/C G/G 50 Female 50 C/C G/G 51
Female 44 C/C G/G 52 Female 59 C/C G/G 53 Female 51 C/C G/G 54 Male
57 C/C G/G 55 Male 51 C/C G/G 56 Female 45 C/C G/G 57 Female 49 C/C
G/G 58 Male 53 C/C G/G 59 Female 54 C/C G/G 60 Female 44 C/T
G/G
-
Supplementary Table 4
Sex Age Diabetes Hypertension FA/ No AF Surgery Biopsies1 Male
51 NO YES sinus rythmn Valve replacement LA 2 Male 58 NO YES sinus
rythmn Heart transplatation LA 3 Female 79 YES YES sinus rythmn
Valve replacement LA 4 Female 78 NO NO sinus rythmn Valve
replacement LA 5 Female 61 NO NO permanent AF Valve replacement LA
6 Male 75 NO YES permanent AF Valve replacement LA 7 Female 74 YES
YES permanent AF Bypass LA 8 Male 75 YES NO permanent AF Valve
replacement LA 9 Male 15 NO NO sinus rythmn Valve replacement
RA
10 Male 67 NO NO sinus rythmn Valve replacement RA 11 Male 18 NO
NO sinus rythmn Valve replacement RA 12 Male 54 NO NO sinus rythmn
Valve replacement RA 13 Female 74 NO NO sinus rythmn Valve
replacement RA 14 Female 67 NO YES permanent AF Valve replacement
RA 15 Male 71 NO YES permanent AF Valve replacement RA 16 Male 58
YES NO paroxysmal AF Valve replacement RA 17 Female 58 NO NO
permanent AF Valve replacement RA 18 Female 65 NO NO permanent AF
Valve replacement RA
-
Supplementary Table 5
delta CT (PITX2C/PPIA) right atrium mean SD NoAF #1 RA 10,84
1,27 AF #1 RA 14,72 2,43 NoAF #2 RA 8,74 0,54 AF #2 RA 14,26 0,89
NoAF #3 RA 6,4 1,61 AF #3 RA 13,35 1,48 NoAF #4 RA 10,83 1,49 AF #4
RA 15,52 1,49 NoAF #5 RA 20,45 1,12 AF #45 RA 12,75 0,65 left
atrium mean SD NoAF #1 LA 6,73 0,81 AF #1 LA 9,25 0,44 NoAF #2 LA
8,51 1,13 AF #2 LA 16,35 0,49 NoAF #3 LA 7,28 0,27 AF #3 LA 20,83
0,01 NoAF #4 LA 17,58 0,92 AF #4 LA 7,92 0,86
-
Supplementary Figure 1 Chromatograms of SNPs (rs2200733 and
rs13143308) sequencing.
Supplementary Figure 2 qRT-PCR analyses of ENPEP in right
(panel A) and left (panel B) atrial samples of NoAF and AF
patients.
Observe that expression of ENPEP displays in approximately 50%
of
cases a significant decrease of expression in AF patients as
compared to NoAF, whereas in the remaining 50% displays no
significant changes or increased expression in AF patients
as
compared to AF. Thus, ENPEP expression in right and left
atrial
samples seems to be independent of AF.
Supplementary Figure 3 qRT-PCR analyses of Pitx2b and Pitx2c
expression in atria (NppaCrePitx2) and ventricular
(Mlc2vCrePitx2)
chamber-specific conditional Pitx2 mouse mutants corresponding
to
E16.5 atrial and ventricular chambers, respectively.
Relative
expression of Pitx2b and Pitx2c, in age-matched control
negative
littermates (black bars), as compared to conditional mutants
(white
bars). Control levels are normalized to 100%. Observe that
Pitx2b and
Pitx2c are decreased between 60 to 80% in both atrial and
ventricular
chamber-specific Pitx2 conditional mutants.
Supplementary Table 1. Oligonucleotide sequences used for
qRT-
PCR expression analyses, SNPs (rs2200733 and rs13143308)
genotyping and Pitx2 siRNA silencing.
Supplementary Table 2. Clinical data and rs2200733 and
rs13143308 genotype corresponding to the AF cohort of
patients
Supplementary Table 3. Clinical data and rs2200733 and
rs13143308 genotype corresponding to the control cohort of
patients.
-
Supplementary Table 4. Clinical data corresponding to the AF
and
No AF cohorts used for PITX qRT-PCR analyses in the atrial
biopsies.
Supplementary Table 5. Mean values of the delta Ct value
between
PITX2C levels and PPIA levels in NoAF and AF right and left
atrial
qRT-PCR analyses. SD, standard deviation.
-
Diego FrancoCaballero, Eva Delpn, Juan Tamargo, Juan Cinca, Leif
Hove-Madsen, Amelia E. Aranega and
Ana Chinchilla, Houria Daimi, Estefana Lozano-Velasco, Jorge N.
Dominguez, RicardoArrhythmogenesis
Insufficiency Leads to Atrial Electrical and Structural
Remodeling Linked toPITX2
Print ISSN: 1942-325X. Online ISSN: 1942-3268 Copyright 2011
American Heart Association, Inc. All rights reserved.
Dallas, TX 75231is published by the American Heart Association,
7272 Greenville Avenue,Circulation: Cardiovascular Genetics
doi: 10.1161/CIRCGENETICS.110.9581162011;4:269-279; originally
published online April 21, 2011;Circ Cardiovasc Genet.
http://circgenetics.ahajournals.org/content/4/3/269World Wide
Web at:
The online version of this article, along with updated
information and services, is located on the
http://circgenetics.ahajournals.org/content/suppl/2011/04/21/CIRCGENETICS.110.958116.DC1.htmlData
Supplement (unedited) at:
http://circgenetics.ahajournals.org//subscriptions/is online at:
Circulation: Cardiovascular Genetics Information about subscribing
to Subscriptions:
http://www.lww.com/reprints Information about reprints can be
found online at: Reprints:
document. Permissions and Rights Question and Answer information
about this process is available in therequested is located, click
Request Permissions in the middle column of the Web page under
Services. FurtherCenter, not the Editorial Office. Once the online
version of the published article for which permission is being
can be obtained via RightsLink, a service of the Copyright
ClearanceCirculation: Cardiovascular Geneticsin Requests for
permissions to reproduce figures, tables, or portions of articles
originally publishedPermissions:
by guest on April 2,
2015http://circgenetics.ahajournals.org/Downloaded from