Top Banner
harmacogenomics and Personalized Medici Michael D. Kane, PhD sociate Professor, University Faculty Scholar, Graduate Education Ch Department of Computer and Information Technology College of Technology & Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park Purdue University West Lafayette, Indiana 47907 bioinformatics.tech.purdue.edu Industry Positions: er: Genomic Guidance, LLC (Personalized Medicine, Information Management) er: Broadband Antenna Tracking Systems, Inc (Wireless Communications Technol ndustry Positions: er & President: Nucleico, LLC (Gene Expression Profiling, Microarrays) D: Genomic Solutions, Inc (Biotechnology Instrumentation and Software, Micro cientist: Pfizer Pharmaceuticals (Molecular Technologies Group) ic Advisor and Co-Inventor: Sensigen Diagnostics (Clinical HPV Detection)
14

Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Dec 19, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Pharmacogenomics and Personalized MedicineMichael D. Kane, PhD

Associate Professor, University Faculty Scholar, Graduate Education ChairDepartment of Computer and Information Technology

College of Technology&

Lead Genomic Scientist, Bindley Bioscience Center at Discovery ParkPurdue University

West Lafayette, Indiana 47907

bioinformatics.tech.purdue.edu

Current Industry Positions:Co-Founder: Genomic Guidance, LLC (Personalized Medicine, Information Management)Co-Founder: Broadband Antenna Tracking Systems, Inc (Wireless Communications Technology)

Former Industry Positions:Co-Founder & President: Nucleico, LLC (Gene Expression Profiling, Microarrays)VP of R&D: Genomic Solutions, Inc (Biotechnology Instrumentation and Software, Microarrays)Senior Scientist: Pfizer Pharmaceuticals (Molecular Technologies Group)Scientific Advisor and Co-Inventor: Sensigen Diagnostics (Clinical HPV Detection)

Page 2: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

>gi|1924939|emb|X98411.1|HSMYOSIE Homo sapiens partial mRNA for myosin-IF CAGGAGAAGCTGACCAGCCGCAAGATGGACAGCCGCTGGGGCGGGCGCAGCGAGTCCATCAATGTGACCC TCAACGTGGAGCAGGCAGCCTACACCCGTGATGCCCTGGCCAAGGGGCTCTATGCCCGCCTCTTCGACTT CCTCGTGGAGGCCATCAACCGTGCTATGCAGAAACCCCAGGAAGAGTACAGCATCGGTGTGCTGGACATT TACGGCTTCGAGATCTTCCAGAAAAATGGCTTCGAGCAGTTTTGCATCAACTTCGTCAATGAGAAGCTGC AGCAAATCTTTATCGAACTTACCCTGAAGGCCGAGCAGGAGGAGTATGTGCAGGAAGGCATCCGCTGGAC TCCAATCCAGTACTTCAACAACAAGGTCGTCTGTGACCTCATCGAAAACAAGCTGAGCCCCCCAGGCATC ATGAGCGTCTTGGACGACGTGTGCGCCACCATGCACGCCACGGGCGGGGGAGCAGACCAGACACTGCTGC AGAAGCTGCAGGCGGCTGTGGGGACCCACGAGCATTTCAACAGCTGGAGCGCCGGCTTCGTCATCCACCA CTACGCTGGCAAGGTCTCCTACGACGTCAGCGGCTTCTGCGAGAGGAACCGAGACGTTCTCTTCTCCGAC CTCATAGAGCTGATGCAGTCCAGTGACCAGGCCTTCCTCCGGATGCTCTTCCCCGAGAAGCTGGATGGAG ACAAGAAGGGGCGCCCCAGCACCGCCGGCTCCAAGATCAAGAAACAAGCCAACGACCTGGTGGCCACACT GATGAGGTGCACACCCCACTACATCCGCTGCATCAAACCCAACGAGACCAAGCACGCCCGAGACTGGGAG GAGAACAGAGTCCAGCACCAGGTGGAATACCTGGGCCTGAAGGAAAACATCAGGGTGCGCAGAGCCGGCT TCGCCTACCGCCGCCAGTTCGCCAAATTCCTGCAGAGGTATGCCATTCTGACCCCCGAGACGTGGCCGCG GTGGCGTGGGGACGAACGCCAGGGCGTCCAGCACCTGCTTCGGGCGGTCAACATGGAGCCCGACCAGTAC CAGATGGGGAGCACCAAGGTCTTTGTCAAGAACCCAGAGTCGCTTTTCCTCCTGGAGGAGGTGCGAGAGC GAAAGTTCGATGGCTTTGCCCGAACCATCCAGAAGGCCTGGCGGCGCCACGTGGCTGTCCGGAAGTACGA GGAGATGCGGGAGGAAGCTTCCAACATCCTGCTGAACAAGAAGGAGCGGAGGCGCAACAGCATCAATCGG AACTTCGTCGGGGACTACCTGGGGCTGGAGGAGCGGCCCGAGCTGCGTCAGTTCCTGGGCAAGAAGGAGC GGGTGGACTTCGCCGATTCGGTCACCAAGTACGACCGCCGCTTCAAGCCCATCAAGCGGGACTTGATCCT GACGCCCAAGTGTGTGTATGTGATTGGGCGAGAGAAGATGAAGAAGGGACCTGAGAAAGGTCCAGTGTGT GAAATCTTGAAGAAGAAATTGGACATCCAGGCTCTGCGGGGGGTCTCCCTCAGCACGCGACAGGACGACT TCTTCATCCTCCAAGAGGATGCCGCCGACAGCTTCCTGGAGAGCGTCTTCAAGACCGAGTTTGTCAGCCT TCTGTGCAAGCGCTTCGAGGAGGCGACGCGGAGGCCCCTGCCCCTCACCTTCAGCGACACACTACAGTTT CGGGTGAAGAAGGAGGGCTGGGGCGGTGGCGGCACCCGCAGCGTCACCTTCTCCCGCGGCTTCGGCGACT TGGCAGTGCTCAAGGTTGGCGGTCGGACCCTCACGGTCAGCGTGGGCGATGGGCTGCCCAAGAACTCCAA GCCTACCGGAAAGGGATTGGCCAAGGGTAAACCTCGGAGGTCGTCCCAAGCCCCTACCCGGGCGGCCCCT GGCGCCCCCCAAGGCATGGATCGAAATGGGGCCCCCCTCTGCCCACAGGGGG

From Genetics to Data Management Systems…

Bioinformatics & Genomics

Page 3: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

GenBank DataYear Base Pairs Sequences

1982 680,338 606

1983 2,274,029 2,427

1984 3,368,765 4,175

1985 5,204,420 5,700

1986 9,615,371 9,978

1987 15,514,776 14,584

1988 23,800,000 20,579

1989 34,762,585 28,791

1990 49,179,285 39,533

1991 71,947,426 55,627

1992 101,008,486 78,608

1993 157,152,442 143,492

1994 217,102,462 215,273

1995 384,939,485 555,694

1996 651,972,984 1,021,211

1997 1,160,300,687 1,765,847

1998 2,008,761,784 2,837,897

1999 3,841,163,011 4,864,570

2000 11,101,066,288 10,106,023

2001 15,849,921,438 14,976,310

2002 28,507,990,166 22,318,883

2003 36,553,368,485 30,968,418

2004 44,575,745,176 40,604,319

2005 56,037,734,462 52,016,762

2006 69,019,290,705 64,893,747

2007 83,874,179,730 80,388,382

2008 99,116,431,942 98,868,465

Page 4: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Bioinformatics & Genomics

Biomolecular Trends:

Yeast Genome Human Genome Onion Genome Lily Genome1.2 x 107 BP 3.3 x 109 BP 15 x 109 BP 90 x 109 BP(1/275x Human) (1x) (5x Human) (27x Human)

Page 5: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Single Nucleotide Polymorphisms (SNPs) are simple changes (or differences) in the DNA sequence that appear to have little or no impact on human health. They represent 90% of all human genetic variations.

Genetically similar to a mutation, but distinct in that a SNP is not causal to a clinical disease or disorder (or at least not yet causally linked, and not really applicable to ages >40 yrs old).

Across the human genome we average approximately 1 SNP for every 300 base pairs of DNA (over one million known SNPs that occur at a frequency of 1% or higher in the world population).

Important Consideration: Inheritance

The appearance of deleterious mutations during evolution tend to NOT be inherited for obvious reasons, at least those that affect growth, reproduction and viability.

…and our modern existence is the result of millions of years of tolerated (and occasionally beneficial) changes in our genome, which is most often evident in what we can and cannot eat or consume (think: evolutionary pressure & natural selection)

Monomethyl Hydrazine (in “False” Morel Mushrooms) Tylenol: Acetaminophen (Cats?)(many examples of “toxins” in nature, many of themare presumably synthesized to prevent consumptionor predation of the host plant or organism)

Introduction to PharmacoGenomics

Modern drug discovery & development falls outside the tolerances & toxicity that have resulted from evolution, because most of these compounds have NEVER been seen in nature.

Page 6: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

More than 770,000 patients die or sustain serious injury every year in the U.S. from Adverse Drug Reactions (ADRs).

ADRs are therefore the 4th leading cause of death in the United States and are one of the leading, preventable public health issues today.

ADRs cost each hospital approximately $5.6 million per year.

In terms of total health care dollars, ADRs cost the U.S. health care system between $1.5 and $5.4 billion per year.

SNPs have been purposed to account for 24% of all ADRs.

Adverse Drug Reactions

Page 7: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

The Pharmacogenomics of WarfarinWhen you ingest a drug, the drug is absorbed into the circulatory system and is distributed throughout the body.

The drug is then available to carry out its intended ‘mechanism of action’ (MOA). In the case of WARFARIN, it inhibits Vitamin K Epoxide Reductase Complex 1 (VKORC1), and reduces blood clotting. It is the largest selling anticoagulant in the world, and the leading case in support of Personalized Medicine”.

Subsequently, the body has the ability to eliminate the drug from the body through “drug metabolism”, which is primarily carried out in the liver. WARFARIN is metabolized primarily by the oxidative liver enzyme CYP2C9, which basically adds an oxygen group to the WARFARIN structure thereby inactivating its MOA and increasing its likelihood of elimination from the body via the kidneys (urine).

For this reason, drug tests that utilize urine a sample source often look for the “metabolite” of the drug in the urine, rather than the ingested drug.

IMPORTANT: If you are prescribed WARFARIN, you have a condition that generates potentially life-threatening blood clots. If you are dosed with too much WARFARIN you could die from complications due to internal bleeding, yet if you are dosed with too little WARFARIN you may be in danger of serious consequences due to circulating embolism.

Page 8: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Go to www.genescription.com

Genescription is a free, online training program in Personalized Medicine for instructors and healthcare professionals.(developed through a grant from Microsoft External Research)

Page 9: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.Personalized Medicine 5(4): 387-397 (2008)

Examples of Clinically-Relevant SNPs

Page 10: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Evidence suggests that Healthcare will be a primary influence on the US economy for the next 50 years.

The “Workforce 2015: Strategy Trumps Shortage” describes how hospitals face the overlapping challenges of attracting and retaining replacements for retiring workers, expanding its workforce to care for an aging population, the greater demand for information technology professionals while coping with significant changes in healthcare delivery.

The “Global Healthcare Information Technology (2009 - 2014)” report states that the current healthcare information technology market is estimated to be $53.8 billion.

Where do YOU see professional, commercial, and entrepreneurial opportunities in this emerging area of healthcare?

Page 11: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.Personalized Medicine 5(4): 387-397 (2008)

Clinical Genotyping Workflow in Healthcare

Page 12: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.Personalized Medicine 5(4): 387-397 (2008)

Clinical Genotyping Workflow in Healthcare

Page 13: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

Considerations for Clinical Genotyping Data Management and User Interface Design and Content in Healthcare

From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.Personalized Medicine 5(4): 387-397 (2008)

Page 14: Pharmacogenomics and Personalized Medicine Michael D. Kane, PhD Associate Professor, University Faculty Scholar, Graduate Education Chair Department of.

QUESTIONS?