PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN SPESIFIK Deoxyribonucleic Acid STADIUM TAKIZOIT DAN BRADIZOIT oleh Ida Ayu Pasti Apsari 08/276691/SKH/62 PROGRAM STUDI SAIN VETERINER FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS GADJAH MADA YOGYAKARTA 2012
33
Embed
PENGEMBANGAN DIAGNOSIS MOLEKULER …repository.ugm.ac.id/digitasi/download.php?file=3027_RD12100011... · Rantai siklus hidup dari T. gondii, bisa terjadi penularan dari hospes definitif
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN
SPESIFIK Deoxyribonucleic Acid STADIUM TAKIZOIT DAN BRADIZOIT
oleh Ida Ayu Pasti Apsari
08/276691/SKH/62
PROGRAM STUDI SAIN VETERINER FAKULTAS KEDOKTERAN HEWAN
UNIVERSITAS GADJAH MADA YOGYAKARTA
2012
ii
PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN
SPESIFIK Deoxyribonucleic Acid STADIUM TAKIZOIT DAN BRADIZOIT
Disertasi untuk memperoleh derajat Doktor dalam Ilmu Kedokteran Hewan pada
Universitas Gadjah Mada
Dipertahankan terhadap sanggahan Dewan Penguji Program Studi Sain Veteriner
Fakultas Kedokteran Hewan Universitas Gadjah Mada Pada tanggal : 18 Juli 2012
oleh Ida Ayu Pasti Apsari 08/276691/SKH/62
Lahir di Denpasar – Bali
84
PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN Deoxyribonucleic Acid SPESIFIK
STADIUM TAKIZOIT DAN BRADIZOIT
RINGKASAN
PENDAHULUAN
Latar Belakang
Toksoplasmosis merupakan penyakit zoonosis yang tersebar di seluruh dunia.
Kasus toksoplasmosis pada hewan dan manusia di Indonesia sangat tinggi. Prevalensi
toksoplasmosis pada manusia 40–85%, sedangkan pada hewan berkisar antara 5–80%
(Subekti et al., 2005). Tingginya kasus toksoplasmosis dan dampak negatif yang
berakibat kerugian ekonomi maupun penurunan produksi, maka diagnosis menjadi hal
yang sangat penting. Diagnosis melalui gejala klinis, toksoplasmosis tidak menciri
(Bastien, 2002), melalui metode immunologis masih memerlukan uji tambahan
(Remington et al., 2004), sedangkan melalui level molekuler, walau memberi hasil yang
spesifik namun, biayanya mahal dan memerlukan peralatan khusus. Metode diagnosis
yang praktis dan akurat oleh karena itu perlu dilakukan pengembangan. Penelitian ini
berupaya mengembangkan diagnosis molekuler toksoplasmosis berdasarkan sekuen
DNA spesifik stadium takizoit dan bradizoit sebagai probe molekuler dengan metode
aplikasi hibridisasi dot blot.
Tujuan Penelitian
Tujuan umum untuk mendapat DNA probe berdasar fragmen DNA spesifik
stadium takizoit dan bradizoit yang dapat memenuhi syarat sebagai probe untuk
mendeteksi toksoplasmosis.
Tujuan khusus yaitu 1. mengamplifikasi dan sekuensing fragmen spesifik DNA
takizoit dengan primer gen sag-1 dan bag-1 T. gondii, 2. menganalisis sekuen spesifik
fragmen DNA stadium takizoit dan bradizoit yang dapat digunakan sebagai kandidat
probe, 3. membuat optimalisasi probe takizoit dan bradizoit dengan metode hibridisasi
85
dot blot untuk mendeteksi komplementernya, 4. menentukan spesifisitas dan sensitivitas
probe takizoit dan bradizoit dalam metode diagnosis aplikasi dot blot untuk mendeteksi
T. gondii.
Manfaat Penelitian
Probe takizoit dan bradizoit diharapkan dapat digunakan untuk mendeteksi
infeksi akut dan infeksi kronis, sehingga secara tidak langsung dapat membantu
meningkatkan keamanan pangan dari hewan ke manusia. Probe molekuler ini juga dapat
digunakan pada proses hibridisasi lain, seperti southern blot, northen blot atau in situ
hybridization, sehingga berguna bagi pengembangan ilmu pengetahuan baik dalam
bidang biologi maupun pada bidang parasitologi.
TINJAUAN PUSTAKA
Toksoplasmosis
Toksoplasmosis disebabkan oleh protozoa Toxoplasma gondii (Tenter et al.,
2000). Toxoplasma gondii adalah parasit intraseluler obligat yang termasuk phyllum
Apicomplexa, class Sporozoea, ordo Eucoccidiida, family Sarcocystidae dan genus
Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). Parasit ini dapat
menginfeksi semua vertebrata termasuk manusia dan berbagai hewan termasuk unggas
serta hewan berdarah panas lainnya (Tenter et al., 2000; Dubey and Jones, 2008).
Stadium infektif T. gondii yaitu, oosista yang hanya terdapat pada feses hospes definitif,
sedangkan stadium takizoit dan bradizoit terdapat dalam bentuk sista jaringan di hospes
perantara (Tenter et al., 2000; Dubey, 2007).
Rantai siklus hidup dari T. gondii, bisa terjadi penularan dari hospes definitif ke
hospes perantara, dari hospes perantara ke hospes definitif dan diantara hospes
perantara. Penularan terus berlanjut dalam waktu yang tidak terbatas, melalui sista
jaringan diantara hospes perantara (walaupun pada keadaan ketidak hadiran hospes
definitif) dan juga penularan dari oosista diantara hospes definitif (bahkan dalam ketidak
hadiran hospes perantara) (Tenter et al., 2000).
Adanya antibodi dalam serum untuk keperluan diagnosis toksoplasmosis,
merupakan manifestasi dari respon hospes terhadap keberadaan T. gondii di dalam
86
tubuhnya. Antibodi IgM terbentuk pada awal infeksi dan dapat dideteksi 5 hari setelah
infeksi. Antibodi ini meningkat cepat selama 2 minggu dan menghilang setelah 2–3
bulan. Antibodi IgG dibentuk kemudian yang bisa bertahan cukup lama sampai 1 tahun.
Adanya IgG merupakan tanda infeksi kronis (Cornain et al., 1990; Lubis et al., 1997).
Takizoit yang menginfeksi hospes cepat berreplikasi dan dengan cepat menyebar
ke seluruh tubuh hospes. T. gondii secara mudah melewati barier darah retina, otak dan
plasenta. Hospes yang mempunyai imunitas, menyebabkan takizoit berubah menjadi
bradizoit. Bradizoit berada di dalam sel, membentuk sista jaringan yang resisten
(Filiceti and Candolfi, 2004).
Diagnosis Toksoplasmosis
Diagnosis penyebab toksoplasmosis dapat dilakukan dengan dua cara yaitu
secara klasik dan modern. Diagnosis secara klasik, berdasar gejala klinis, tidak berlaku
untuk toksoplasmosis, karena toksoplasmosis secara klinis tidak menunjukkan gejala
yang spesifik (Bastien, 2002), diagnosis dengan uji biologis, metode ini tidak praktis
karena memerlukan waktu lama, sedangkan diagnosis metode immunologis juga tidak
efektif karena masih memerlukan uji tambahan dan sering memberi hasil negatif palsu
(Remington et al., 2004). Diagnosis secara modern, pada level molekuler, berdasar
deoxyribonucleic acid (DNA) T. gondii, seperti metode Polymerase Chain Reaction
(PCR), (Susanto et al., 2002; Priyowidodo, 2003) yang mengamplifikasi sekuen
spesifik Toxoplasma gondii memberi hasil yang sangat spesifik, namun metode ini
biayanya mahal dan memerlukan peralatan khusus. Diagnosis pada level molekuler yang
mempunyai kendala dalam hal interpretasi hasil, maka metode teknik hibridisasi dengan
DNA probe dapat dikembangkan (Samuelson et al., 1989; Garberi et al., 1994; Akin,
2001; Aidawati et al., 2007; Sarova and Saigoval, 2010).
Gena sag-1 dan bag-1 Toxoplasma gondii
Toxoplasma gondii mempunyai tiga stadium infektif yaitu takizoit, bradizoit dan
sporozoit. Secara struktur ketiganya mirip, tapi mereka beda dalam penotipe dalam
ekspresi protein spesifik. Protein 65 kDa sebagai MAG-1 dipakai sebagai penanda
ekspresi secara khusus selama bradizoit, karena protein ini berlokasi dalam sista jaringan
87
dan secara imunobloting akan terdeteksi oleh ekstrak sista (Holec et al., 2007).
Penelitian sebelumnya juga mendukung bahwa P30 dan P22 merupakan antigen spesifik
takizoit yang reaktif.
Toxoplasma gondii mempunyai gena sag-1 merupakan gena spesifik untuk
stadium takizoit, sedangkan bag-1 merupakan gena spesifik untuk stadium bradizoit
(Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004;
Kazemi et al., 2007a dan Kazemi et al., 2007b). Melalui metode Polymerase Chain
Reaction (PCR) gena spesifik stadium tertentu berhasil diisolasi menggunakan primer
dengan panjang 18-24 nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Landasan Teori
Sista T. gondii (terdapat di jaringan) terkandung di dalamnya sejumlah bradizoit,
dan takizoit terdapat bebas di cairan ekskresi dan sekresi (Tenter et al., 2000; Weiss and
Kim, 2000). Menurut Zhang et al.(1999), Weiss dan Kim (2000) dan Ajioka et al.
(2001) ada gena yang spesifik pada stadium takizoit dan gena spesifik pada stadium
bradizoit. Gena sag-1 merupakan gena spesifik untuk stadium takizoit, sedangkan bag-1
merupakan gena spesifik untuk stadium bradizoit (Weiss and Kim, 2000; Ajioka et al.,
2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi et al., 2007a; Kazemi et al.,
2007b). Sampai saat ini, eksplorasi kedua gena tersebut untuk tujuan diagnosis belum
banyak dilakukan. Menggunakan metode Polymerase Chain Reaction (PCR) gena
spesifik stadium tertentu berhasil diisolasi menggunakan primer dengan panjang 18-24
nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Deoxyribonucleic acid dapat digunakan sebagai probe molekuler untuk diagnosis
penyakit, disamping DNA mempunyai sifat yang komplementer dan adanya sifat
sekuen yang conserve (konstan) dan variabel. Sekuen yang baik untuk calon probe
adalah sekuen yang conserve (Keller and Manak, 1989; Weiss, 1995). Panjang pendek
sekuen dan jumlah copy gene sebagai calon probe juga mempengaruhi kualitas probe.
Sekuen dengan panjang 100 – 300 bp ideal sebagai probe (Leitch et al., 1994), dan
repetitif sekuen gen dengan jumlah 300 copy berhasil digunakan sebagai probe untuk
mendiagnosis toksoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).
Probe yang diperoleh dari gena yang mempunyai jumlah copy gene yang tinggi,
88
hibridisasi lebih cepat daripada yang lebih rendah. Isolasi dan analisis gena sag-1
(Ajioka et al., 2001) dan bag-1 (Bohne et al., 1995) mempunyai single copy, sebagai
calon probe molekuler diharapkan dapat mendeteksi T. gondii.
Hipotesis
1. Primer spesifik gena sag1 dan bag-1 dapat dipergunakan untuk mengamplifikasi
fragmen DNA takizoit T. gondii isolat lokal
2. Sekuen spesifik DNA stadium takizoit dan bradizoit dapat digunakan sebagai
probe molekuler toksoplasmosis
3. Probe takizoit dan bradizoit dapat dipergunakan mendeteksi toksoplasmosis
4. Probe takizoit dan bradizoit memiliki spesifisitas dan sensitivitas yang tinggi
sehingga dapat diaplikasikan untuk mendeteksi T. gondii
METODE PENELITIAN DAN CARA ANALISIS
Deoxyribonucleic Acid (DNA) takizoit diisolasi dari Takizoit Toxoplasma gondii
isolat lokal dengan metode alkali lysis. Sekuen spesifik fragmen gena sag-1 dan bag-1
Toxoplasma gondii, berhasil diamplifikasi dengan metode polymerase chain reaction
(PCR) menggunakan primer sag-1 (forward: 5′-CACCTGTAGGAAGCTG
TAGTCACTG –3′ reverse: 5′- TCACTGTGACCATACAACTCTGTG - 3′) dan bag-1
shedding ligth on Pathogenesis and Chemotheraphy. Expert Review. In Mol. Med. http://www.ermm.cbcu.cam.ac.uk. Departement of Pthology. University of Cambridge. Cambridge: 2 – 19
Akin, H.M. 2001. Penggunaan Pelacak Nonradioaktif (Digoxigenin-DNA Probe) untuk
Mendeteksi Peanut Stripe Virus. J.Hama dan Penyakit Tumbuhan Tropika. 1(2): 75-79.
Ali, N.Z.; Valian, H.K.; Rezaian, M.; Khorramizadeh, M.R.; Kazemi, B.; A.Fazaeli, A.
and Darde, M. 2005. Moleculer Characterization of Toxoplasma gondii from Bird Host. Iranian J.Publ Health. 34(3): 27-30.
Alcamo, E. 2001. DNA Analysis and Diagnosis. In DNA Technology. The A we some
V.; Bandera, F.; Fomer, O.and Ginorio, D. 2009. Detection of Toxoplasma gondii in cerebrospinal fluid from AIDS pasient by nested PCR and rapid identification of type I alele at Bi gene by RLFP. Exp.Parasitol. 122(3): 203-207.
99
Amirudin; Hastuti, S. dan Artama, W.T. 1999. Deteksi Antigen Toxoplasma gondii Isolat Lokal dengan cara ELISA Sandwich menggunakan Anti bodi monoklonal. Agrosain 12(3): 187-197.
Angel, S.O; Blanco, J.C.;Maero, E.;Pzsenny, V. and Garberi, J.C. 1991. Repetitive DNA
Sequences of Toxoplasma gondii for Development of Diagnostic Probes. Mem Inst Oswldo Cruz, Rio de Janeiro. 86(4): 483-484.
H. and Garberi, J.C. 1992. Early Diagnosis of Toxoplasmic Encephalitis in AIDS Patient by Dot Blot Hyridization Analysis. J.Clinical Microbiol. 30(12): 3286-3287
Araujo, F.G. 1994. Immunization against Toxoplasma gondii. Parasitol.Todays 10(9):
358-360. Artama, W.T. 2007. Animal Toxoplasmosis in Indonesia : Serologic and Biomolecular
Diagnostic. Prosiding Simposium Nasional Parasitologi dan Penyakit Tropis. 25-26 Agustus 2007. Bali: 1-11
Artama, W.T.; Utami, W.S. and Sarjono. 2009. Recombinant Granule Protein-1 for
biomolecular diagnosis of Toxoplasmosis in Indonesia. Proceeding of Internationl Conference on Animal Health and Human Safety. 6-8 Des.2009. Kualalumpur Malaysia: 298-306.
Artama, W.T. 2009. Biologi Molekuler Toxoplasma dan Aplikasinya pada
Penanggulangan Toxoplasmosis. Pidato Pengukuhan Jabatan Guru Besar dalam bidang Biokimia pada FKH-UGM: 1-25.
Bastien, P. 2002. Diagnosis. Molecular diagnosis of toxoplasmosis. Transactions of The
Royal Society of Trop.Med.and Hyg. 96(1): 205-215. Behnke, M.S.; Radke, J.B.; Smith, A.T.; Sullivan, W.J. and White, M.W. 2008. The
transcription of bradyzoite genes in Toxoplasma gondii is controlled by autonomous promotor elements. Molecular Biology 68(6): 1502-1518.
Chovan, L.; Howard, L.; Brojanac, S.; Sheu, M.; Tyner, J.; Pluot, M. and Pinon, J.M. 1998. Quantitative immunolocalization of a P29 Protein (GRA7) a new antigen of Toxoplasma gondii. J.Histochem.and Cytochem. 46: 1411-1422.
Brown, T. 2000. Hybridization Analysis of DNA Blots. Current Protocol in Molecular
Biology.2.10.1-2.10.16. By John Willey & Sons Inc.
100
Brown, T.A. 2006. The Basic Principles of Gene Cloning and DNA Analysis. In Gene Cloning and DNA Analysis. An Introduction. Fifth Ed. Blackwell Publishing:
1 – 84 Budijanto, S.K. 1995. Antibodi IgA anti P30 sebagai petanda pada toksoplasmosis
kongenital dan akut. Majalah Kedokteran Indonesia, 45(1): 61-65. Burg, J.L.; Grover, C.M.; Poeletty, P. & Boothroyd, J.C. 1989. Direct and Sensitive
Detection of a pathogenic protozoa Toxoplasma gondii by Polymerase chain Reaction. J.Clin.Microbiol. 27: 1787 – 1792
Burgess, G. W. dan Malcolm, K. M. 1995. ELISA untuk mendeteksi antigen. Dalam
Teknologi ELISA Dalam Diagnosis dan Penelitian. Terjemahan oleh W.T.Artama. Gadjah Mada University Press. Cetakan Pertama : 252 – 257.
Carruthers, V.B.; Sherman, G.D. and Sibley, L.D. 2000. The Toxoplasma adhesive
protein MIC2 is proteolytically processed at multiple sites by two parasite derived proteases. J.Biol.Chem. 275: 14346-14353.
Cesbron-Delauw, M.F.; Tomavo, S. and Beauchamp, P. 1994. Similarities between the
primary structure of two distinct major surface protein of Toxoplasma gondii. J.Biol.Chem. 269(62): 17-22.
Chandra, G. 2001. Toxoplasma gondii : Aspek Biologi, Epidemiologi, Diagnosis dan
Toxoplasmosis. Oxford: Oxford University Press: 144-184. Chen, X.G.; Gong, Y.; Li, H.; Lun, Z.R.; Fung, M.C. 2001. High-level expression and
Purification of Immunogenic recombinant SAG1 (P30) of Toxoplasma gondii in Escherichia coli. Protein Expression and Purification 23: 33-37.
Cheng, S; Fockler, C; Barnes, WM; Higuchi, R. 1994. Effective amplification of long
target from cloned insert and human genomic DNA. Proceeding of the National Academy of Sciences. 91 (12): 5695-5699.
Chevalier, J.; Yi, J.; Michel, O. and Tang, X.M. 1997. Biotin and Digoxigenin as Labels
for Ligth and Electron microscopy in situ hybridization probe : Where Do We Stand ?. J.Histochem.and Cytochem. 45: 481-492.
Chiabchalard, R.; Wiengcharoen, J.T. and Sukthana, Y. 2005. Sensitivity and Specificity
of Polymerase Chain Reaction for Detection of Toxoplasma gondii DNA added to laboratory samples. Southest Asian J.Trop.Med.Public Health. 36(2): 408-411
101
Cornain, S.; Suryana, E.J.; Sugiharto; Jacoeb, T.Z.; Rahman, I.A.; Lubis, N.S. dan Gusmiarti, N. 1991. Aspek immunolog dan pendekatan immunoterapi pada infeksi Toxoplasma. Majalah Kedokteran Indonesia. 41(7): 395-401.
Conraths, F.J. and Schares, G. 2006. Validation of Molecular diagnostic techniques in
parasitological laboratory. Vet.Parasitol. 136: 91-98. Clark, W.and Christopher, K. 2001. An Introduction to DNA: Spectrophotometry,
Degradation and Frankengel experiment. University of Alberto. Cristina, M.D.; Porto, P.D.; Buffolano, W.; Beghetto, E.; Spadoni, A.; Gaglietta, S.;
Piccolella, E.; Felici, F. and Gargano, N. 2000. The Toxoplasma gondi bradyzoite antigen BAG1 and MAG1 induce early humoral and cell-mediated immune responses upon human infection. Microbes and Infections. 6: 164-171.
Curry, E.; Pratt, S.L.; Kelley, D.E.; Lapin, D.R. and Gibbons, J.R. 2008. Use of a
combined Duplex PCR/Dot blot assay sor more sensitive genetic characterization. Biochemistry Insights: 35-39.
Tenter, A.M.; Volmer, R. and Zahner, H. 2004. Cross Sectional study in pig breeding farm In Hesse, germany: Prevalence of antibodies to Toxoplasma gondii , Sarcocystis spp.,Neospora caninum in sows and analysis of risk factor. Vet.Parasitol. 126: 271-286.
Darcy, F and Santoro, P. 1994. Toxoplasmosis. Dalam Kierszen-baum, F (Ed). Parasitic
Infection and the immune system. Academic Press, London: 163-201. Darde, M.L. 2004. Genetic analysis of diversity in Toxoplasma gondii. Ann.Ist.Super
Sanita. 40 (1): 57-63. Daryani, A; Hosseini, A.Z.; Sharif, M.; Dalimi, A.; Dehghan, M.H. and Ziaei, H. 2006.
Protective role of antigens from pritoneal exudates of infected mice against toxoplasmosis. Iran J.Immunol. 3(2): 78-85.
Alejos, O.; Gatius, F.L.; Lavin, S. and Almeria, S. 2011. Presence of Toxoplasma gondii and Neospora caninum DNA in the brain of wild bird. Vet.Parasitol. 23: 21831525.
Desmonts, G. and Remington, J.S. 1980. Direct Agglutination test for Diagnosis of Toxoplasma Infection : Method for Increasing sensitivity and Specificity. J. Clinical Microbiol. 11: 562-568.
102
Drennan, J.L.; Westra, A.A.G.; Slack, S.A.; Delserone, I.M. and Collmer, A. 1993. Comparison of a DNA Hybridization Probe and ELISA for the Detection of Clavibacter michiganensis subsp. sepedonicus in Fild-Grown Potatoes. Plant Dis. 77(12): 1243-1247.
Dubey, J.P.; Desmont, G.; McDonald, C.; and Walls, K.W. 1985.Serologic evaluation of
Cattle inoculated with Toxoplasma gondii comparison of sabin-Fieldman dye test and other aglutination test. Am.J.Vet.Res. 46: 1085-1088
Dubey, J.P. 1986. : Riview of Toxoplasmosis in Pig. Vet.Parasitol: 19: 181-223. _________ 1988. Long term persistence of Toxoplasma gondii in tissue of pigs
inoculated with T.gondii ocyst and effect of freezing on viability of tissue cyst pork. Am.J.Vet.Res. 49(6): 910-913.
Dubey, J.P. and Beattle C.P. 1988. Toxoplasmosis of animal and man. Boca Raton,
Sencitivity and Specificity of various serologic test for detection of Toxoplasma gondii infection in naturally infected sows. Am.J.Vet.Res. 56: 1033-1036.
Dubey, J.P. 1996. Pathogenicity and Infectivity of Toxoplasma gondii oocyst for Rats.
J.Parasitol. 83(6): 95-956. _________ 1997. Distribution of tissue cyst in organ of rats fed Toxoplasma gondii
oocysts. J.Parasitol. 83(4): 755-757. _________ 1998. Refinement of Pepsin digestion method for isolation of Toxoplasma
gondii from infected tissue. Vet.Parasitol. 74: 75-77. Dubey, J.P.; Linsay, D.S. and Speer, A. 1998. Structure of Toxoplasma gondii
tachyzoites, bradizoites and spoozoites and biology and development of tissue cysts. Clin.Microbiol.Rev. 11(2): 267-299.
Kwok,O.C.H. Shen, S.K. and Lehman, T. 2003a. Isolation and Moleculer Characterization of Toxoplasma gondii from Chickens and Ducks from Egypt. Vet.Parasitol. 114: 89-95
L.B.; Sreekumar, C.; Viana, M.C.B. and Lehman, T. 2003b. Characterization of Toxoplasma gondii isolate from free range chickens from Parana, Brazil. Vet. Parasitol. 117: 229-234.
103
Dubey, J.P.; Venturini, M.C.; Venturini, L.; Piscopo, M.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Viana, M.C. and Lehmann, T. 2003c. Isolation and Genotyping ofToxoplasma gondii from Free Ranging Chickens from Argentina. J.Parasitol. 89(5): 1063-1064.
Dubey, J.P.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Lehmann, T.; Davis, M.F. and
Morishita, T.Y. 2003d. Toxoplasma gondii Isolates from Free Ranging Chickens from the United States. J.Parasitol. 89(5): 1060-1062.
Dubey, J.P.; Morales, E.S. and Lehman, T. 2004. Isolation and Genotyping of
Toxoplasma gondii from Free-Ranging Chickens from Mexico. J.Parasitol. 90(2): 411-412
Dubey, J.P.; Paula, L. and Lehmann, T. 2005. Characterization of Toxoplasma gondii Isolates in free-ranging chickens from argentina. J.Parasitol. 91(6): 1335-1339.
O.C.H. and Shen, S.K. 2006. Biologic and Characterization of Toxoplasma gondii isolates in free-ranging chickens from Costa Rica, Central America. Vet. Parasitol. 139: 29-36
Dubey, J.P. 2007. The history and life cycle of Toxoplasma gondii. In : Toxoplasma
gondii the model apicomplexa. Perspectives and methods. Weiss, L.M. and Kim, K (eds). Elsevier Ltd, Amsterdam.
Dubey, J.P. and Jones, J.L. 2008. Toxoplasma gondii Infection in Human and Animals
in United State. Int.J.Parasitol. 38: 1257-1278 El-Massry, A.; Mahdy, O.A.; El-Ghaysh, A. and Dubey, J.P. 2003. Prevalence of
Toxoplasma gondii Antibodies in Sera of Turkey, Chicken and Duck from Egypt. J.Parasitol. 86(3): 627-628.
Evans, R. 1992. Life Cycle an animal infection. In Ho-Yen, DO and Joss, AWL (eds).
Human Toxoplasmosis. Oxford Univ.Press, Oxford, GB.: 26-55. Faria, E.B.; Gennari, M.S.; Pena, H.F.J.; Athayde, R.A.C.; Silva, M.L.C.R. and
Azevado, S.S. 2007. Prevalence of anti-Toxoplasma gondii and anti Neospora caninum antibodies in Goats Slaughtered in The Public Slaughterhouse of Patos city, Paraiba State, Northeast region of Brazil. Vet.Parasitol. 149: 126-129
Feyer, R; Gamble, HR; Lichtenfels, JR and Bier, JW (1992). Food borne and water
bone Parasites. In Compendium of Methods for microbiological examination of food (ed Speck, ML). Washington DC. USA Am.Pub.Health Ass.: 789-809
Frenkel, J.K. 1990. Transmision of Toxoplasmosis and The Role of Immunity in Limiting Transmission and Illness. J.Am.Vet.Med.Assoc. 196: 233-240.
104
Filliseti, D. and Candolfi, E. 2004. Immune response to Toxoplasma gondii. Ann.Ist. Super Sania. 40(1): 71-80.
Cringoli, G. 2007. Toxoplasma gondii in sheep from the Champania region (Italy). Vet.Parasitol. 149: 271-274
Furuya, H; Yamada, T; Ikezoe, K; Ohyagi, Y; Fukumaki, Y; Fujii, N. 2006. An
improved method for Southern DNA and Northern RNA blotting using a Mupid-2 Mini-Gel electrophoresis unit. J.Biochem.Biophys.Methods. 68(2): 139-143
Garberi, J.C.; Angel, S.O.; Paulin, P.; Pszenny, V. And Romano, L. 1994. Use of a
monoclonal antibody and a DNA probe for diagnosing acute toxoplasmosis in ambiguous cases. J.Clin.Pathol. 47: 853-854
Ge, N.L.; Kocan, M.; Murphy, G.L. and Blouin, E.F. 1995. Detection of Anaplasma
marginale DNA in Bovine erythrocyte by slot-blot and In Situ hybridization with a PCR-mediated digoxigenin-labeled DNA Probe. J.Vet.Diagn.Invest. 7: 465-472.
Goel, R.; Kumar, P.; Sinha, R.and Ambwani, S. 2004. Dot blot assay using reverse-
probe genomic hybridization of repetitive DNA for environmental monitering of flourescent Pseudomonads. Indian J.Biotech. 3: 82-85.
Goodwin, MA; Dubey, JP and Hatkin, J. 1994. Toxoplasma gondi peripheral neuritis in
chickens. J.Vet.Diagn.Invest. 6: 682-385. Hanafiah, M.; Nurcahyo, W.; Kamarudin, M. dan Karmil, F. 2009. Produksi dan Isolasi
Protein Membran Stadium Bradizoit Toxoplasma gondii : Suatu usaha untuk mendapatkan material diagnostik dalam mendiagnosa toksoplasmosis. Jur.Vet. 10(3): 156-164.
Hartati, S; Widada, S.J.; Sumartono dan Kusumawati, A. 2003. Cloning of gene
encoding SAG1 of lokal isolate Toxoplasma gondii in Escherichia coli DH5α. J. Sain Vet. XX(2): 51-56.
mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with other strains. J.Vet.Sci. 7(3): 263-270.
Hartono, T. (1990). Identifikasi kista Toxoplasma gondii pada kambing/domba di RPH
Surabaya dan Malang. Cermin Dunia Kedokteran 61: 31-33.
105
Hayde, M. and Polack, A. 2000. A Clinical picture neonatal sign and symptoms. In: Ambroise Thomas P; Peterson E editor. Congenital Toxoplasmosis: scientific background, Clinical Management and Control. Paris. Springer verlag. France: 153-164.
Held, P. 2001. The Importance of the 240 nm Absorbance Measurement. Biotek
Instruments, Inc. Winooski, VT, USA. www.Biotek.com.: 1-3 Hendrix, C.M. 1998. Diagnostic Veterinary Parasitology. 2ndEd. Masby: 7-8.
Hermawan, P. 1988. Survey Serologis terhadap Toksoplamosis pada Ayam Buras di
Kabupaten Lamongan dengan Uji Haemaglutinasi tak Langsung. Skripsi. FKH-UNAIR. Surabaya: 1-53.
Herzer, S and Englert, D.F. 2001. Nucleic Acid Hybridization. Molecular Biology
Problem Solver: A Laboratory Guide. Willey-Liss, Inc. Hitt, J.A. and Filice, G.A. 1992. Detection of Toxoplasma gondii parasitemia by gene
amplification, cell culture and mouse inoculation. J.Clin.Microbiol. 30(12): 3181-3184.
Hohlfield, P.; Daffos, F.; Costa, J.M.; Thulliez, P.; Forestier, F. and Vidaud, M. 1994.
Prenatal diagnosis of congenital Toxoplasmosis with Polymerase Chain Reaction test on amniotic fluid. The New England J.Med. 331 (11): 695-699.
Holec, L.; Hiszczynska-Sawicka, E.; Gasior, A.; Brillowski-Dabrowski, A. and Kur, J.
2007. Clinical and Vaccine. Immunol.14(3): 220-225. Holliman, R.E. 2003. Toxoplasmosis. In: A manson,s tropical diseases. 21th ed. Cook,
G.C. and Zumia(eds). Saunders Elsevier Science, London: 211-240 Ho-Yen, D.O.; Joss, A.W.; Balfour, A.H.; Smyth, E.T.; Baird, D. and Chatterton, J.M.
1992. Use of the polymerase chain reaction to detect Toxoplasma gondii in human blood samples. J.Clin.Path. 45: 910-913.
Howe, D..K and Sibley, L.D. 1995. Toxoplasma gondii comprises three clonal lineages
corelation of parasites genotype with human diseases. J.Infect.Dis.172: 1561-1566.
Howe, D.K.; Mercier, C.; Messina, M. and Sibley, L.D. 1997. Expression of
Toxoplasma gondii in the closely related apicomplexan parasites Neospora caninum. Moleculer and Biochem.Parasitol. 86: 29-36.
Studies for Detection of Brucella spp. in Milk Samples. Global Veterinaria. 8(1): 54-61
106
Indra, C. 2003. Epidemiologi Toxoplasma gondii. USU Digital Library: 1-13 Indri, S. 1999. Hibridisasi Asam Nukleat. Dalam Biologi Molekuler Kedokteran. Ed
Suhartono Taat Putra. Airlangga University Press.: 168-172. Iskandar, T. 1998. Pengisolasian Toxoplasma gondii dari Otot Diafragma Seekor Domba
yang Mengandung Titer Antibodi Tinggi dan Tanah Tinja dari Seekor Kucing. Jurnal Ilmu Ternak dan Veteriner. 3(2): 111-116.
Jackson, M.H and Hutchinson, W.M. 1989. The prevalence and source of Toxoplasma
infection in the environtment. Adv.Parasitol. 28: 55-104. Jacobs, I; Remington, JS. And Milton, MI. 1960. A Survey of meat samples from swine,
cattle and sheep for the presence of encysted Toxoplasma. J.Parasitol. 46: 23-26 Jensen, L.; Heegaard, P.M.H. and Lind, P. 1998. A study of virulence parameters for
Toxoplasma gondii infections in mice. Parasitol.Res.84: 382-387. Jin, Si ; Chang, Z.Y.; Ming, Xu; Min, C.L.; Wei, He; Sheng, L.Y. and Hong, G.X. 2005.
Fast Dipstick Dye Immunoassay for Detection of Immunoglobulin G (IgG) and IgM Antibodies of Human Toxoplasmosis. Clin.Diagn.Lab.Immunol. 12(1) : 198-201.
Jittapalapong, S.; Nimsupan, B.; Pinyopanuwat, N.; Chimnoi, W.; Kabeya, H. and
Maruyama, S. 2006. Seroprevalence of Toxoplasma gondii antibodies in stray cats and dogs in the Bankok metropolitan area. Thailand Vet.Parasitol. 10: 3833-3837.
Johnson, A.M.; Robert, H. and Tenter, A.M. 1992. Evaluation of recombinant antigen
ELISA for the diagnosis of acute toxoplasmosis and comparison with traditional Antigen ELISAs. J.Med.Microbiol. 37: 404-409.
Joiner, I.A. and Roos, D.S. 2002. Secretory traffic in the Eukaryotic parasite
Toxoplasma gondii : Less is more. J.Cell Biol. 157(4): 557-563 Jones, D.D.; Okbravi, N.; Adamson, P; Tasker, S and Ligbtman, S. 2000. Comparison of
PCR detection methods for B1, P30 and 18S rDNA genes of Toxoplasma gondii in equeous humor. Int.Opthamol.Vis.Sci. 41(3): 634-644
Jungersen, G.; Bille-Hansen, V.; Jensen, L. and Lind, P. 2001. Tranplacental
transmission of Toxoplasma gondii in minipig infected with strain of different virulence. J.Parasitol. 87(1): 108-113.
Kazemi, B.; Bandepour, M.; Maghen, L. and Solgi, G.H. 2007a. Gene Cloning of 30
Kazemi, B.; Maghen, L.; Bandehpour, M.; Shahabi, S. and Haghighi, A. 2007b. Gene Cloning of 43 kDa surface protein of Toxoplasma gondii tachyzoite and bradyzoite (SAG3). Gene Ther.Mol.Biol. 11: 113-116.
Karkata, K. dan Suwardewa, T.G.A.. 2006. Infeksi TORCH pada ibu hamil di RSUP
Sanglah Denpasar. Cermin Dunia Kedokteran. 151: 5-7. Kasper,L.H. and Boothroyd, J.C. 1993. Toxoplasma gondii and Toxoplasmosis. In
Immunology and Moleculr Biology of Parasitic Infections. Ed by Kenneth S Warren. Blackwell Scientific Publications. Oxford. London Edinburgh, Melbourne Paris Berlin Vienna: 269-301
Keller, G.H. and Manak, M.M. 1989. DNA Probe. Macmillan Publisher ltd.: 1-16. Khan, A.; Taylor, S.; Su, C.; Mackey, A.J.; Boyle, J.; Cole, R.; Glover, D.; Tang, K.;
Paulsen, I.T.; Berriman, M.; Boothroyd, J.C.; Pfefferkorn, E.R. Dubey, J.P.; Ajioka, J.W.; Roos, D.S.; Wootton, J.C. and Sibley, L.D. 2005. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acid Res. 33(9): 2980-2992.
Koskiniemi, M.; Lappaiainen, M.; Hedman, K. 1989. Toxoplasmosis needs evaluation
on : Overview and proposals. Am.J.Dis.Chid. 143: 724-728. Kresno, S.B. 1996. Imunologi. Diagnosis dan Prosedur Laboratorium. Ed ketiga.
Penerbit Fakultas Kedokteran UI-Jakarta: 1-336. Kruchen, B. and Rueger, B. 2003. The Dig System – Nonradioactive and Highly
Sensitive Detection of Nucleic Acids. Biochemica. 3: 13-15. Kusumawati, A.; Nafratilova, S. and Hartati, S. 2011. Digoxigenin(DIG) Labeled Probe
Candidate of Surface antigen1 (SAG1) for Toxoplasma gondii Detection. Ind.J. Biotech. 16(1): 17-23.
H.R and Dubey, J.P. 2003. Transmission dynamics of Toxolasma gondii on a pig farm. Infect.Genet.Evol. 3: 135-141.
Leitch, A.R.; Schwarzacher, T.; Jackson, D and Leitch, I.J. 1994. 1sted. In situ
hybridization. A practical guide, BOS Sciencetific Publisher Limited: 4-5: 33-39 Levine, N.D. 1994. Buku Pelajaran Parasitologi Veteriner. Edisi Indonesia. Gadjah
Mada University Press.: 1-531
108
__________ 1995. Protozoologi Veteriner. Edisi Indonesia. Gadjah Mada University Press.: 1-585
Liesenfeld, O.; Montoya, J.G.; Tathinemi, N.J.; Davis, M.; Brown, Jr. B.W.; Cobb, K.L.;
Parssonet, J. and Remington, J.S. 2001. Confirmatory serologic testing for acute toxoplasmosis and rate of induced abortions among women reported to have positive Toxoplasma immunoglobulin M antibody titer. Am.J.Obstet.Gynecol. 184: 140-145.
L. and Darnell, J. 2006. Moleculer Cell Biology. 5th Ed. Media conected.: 40-408.
Lubis, N.K.; Gandahusada, S. dan Surjana, E.J. 1997. Peran antibodi IgA dan IgE pada
diagnosis toksoplasmosis. Majalah Kedokteran Indonesia, 4(11): 563-567. Luft, B.J.; Haffler, M.D. and Korzun, A.H. 1993. Toxoplasmic encephalitis in patients
with the aquaired immunodeficiency syndrome. New England J.Med. 329: 995-1000.
Luft, BJ. and Remington, JS. 1988. AIDS commentary. Toxoplasmosis encephalitis.
J.Infect.Dis. 157(1): 1-6 Lyons, R.E.; McLeod, R. and Robert, C.W. 2002. Toxoplasma gondii Tachyzite-
bradyzoite interconversion. Trends in Parasitol. 18(5): 198-201. Maganathan, P; Singh, S; Ling, LY; Singh, J; Subrayan, V and Nisapatorn, V. 2010.
Detection of Toxoplasma gondii DNA by PCR following microwave treatment of serum and whole blood. Southeast Asian J.Trop.Med.Public Health. 41(2): 265-273.
Maroef, S. 1990. Toxoplasmosis di Indonesia. Cermin Dunia Kedokteran, 61: 34- 39. Martin, J.; Kwok, O.C.H. and Dubey, J.P. 2011. Seroprevalence of Neospora caninum in
free-range chickens (Gallus domesticus) from Americas. Vet.Parasitol. 27: 21676546.
McLeod, R.; Mack, D. and Brown, C. 1991. Toxoplasma gondii-New advance in
Cellular and Moleculer Biology. Exp.Parasitol. 72: 109-121.
McPherson, M.J.; Quirke, P.; Taylor, G.R.1992. PCR. A practical Approach. IRL Press Milton, M.; McAllister, Stephen, F.; Parmiey; Weiss, L.M.; Weich, V.J. and McGuire,
A.M. 1996. An Immunohistochemical Method for detecting Bradyzoite antigen (BAG5) in Toxoplasma gondii-Infected tissue cross-reacts with a Neospora caninum bradyzoite antigen. J.Parasitol. 82(2): 354-355.
109
Montoya, J.G. and Liesenfeld, O. 2004. Toxoplasmosis. The Lancet. 363: 1965-1967. Mori, J.; Field, A.M.; Clewley, J.P. and Cohen, B.J. 1989. Dot Blot Hybridization Assay
of B19 Virus DNA i Clinical Specimens. J.Clin.Microbiol. 27(3): 459-464. Mudenda, H.B.; Willliam, U.; James, M.C.L.; Charles, M.; Nayuta, I.; Evans, M.;
Ladslav, M.; Hiroshi, I. And Emiko, I. 2011. Feasibility of using dot blot hybridization to detect Salmonella InvA, SpiC and SipC directly from clinical specimens. African J.Microbiol.Res. 5(6): 582-585.
Mufasirin 1999. Kloning dan Ekpresi cDNA yang menyandi Protein Membran Takizoit
Toxoplasma gondii Isolat Bogor. Tesis. Universitas Gadjah Mada, Yogyakara: 1-69
Mufasirin; Suprihati, E. dan Suwanti, L.T. 2003. Studi Toksoplasmosis pada Telur
Ayam yang dijual sebagai campuran jamu di kota Surabaya dan Kabupaten Sidoarjo menggunakan uji Dot Blot. J.Penelitian Medika Eksakta. 4(2): 113-119.
Muller, N.; Zimmerman, V.; Hetrich, B. and Gottstein, B. (1996).Diagnosis of Neospora
caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassy. J.Clin.Microbiol. 34: 2850-2652.
Nardone, R.M. 1999. Overview of In Situ Hybridization. In Imunocytochemical
Methods and Protocols. Second eds. Edited by Lorette C Javois. Humana Press. Totowa, New Jersey: 357-363.
Owen, M.R.; Clarkson, M.J. and Trees, A.J. 1998a. Diagnosis of Toxoplasma abortion
in ewes by polymerase chain reaction. Vet.Record. 142: 445-448. __________ 1998b. Acute phase Toxoplasma abortion in sheep. Vet.Record. 142: 480-
482. Palmer, H.M.; Atkinson, H.J. and Perry, R.N. 1991. The Use of DNA probe to identify
Ditylenchus dipsaci. Revue Nematol. 14(4): 625-628. Patricia, M.; Craver, J. and Knoll, L.J. 2007. Increased efficiency of homologous
recombination in Toxoplasma gondii dense granule protein 3 demontrates that GRA3 is not necessary in cell culture does contribute to virulence. Mol.and Biochem.Parasitol. 153: 149-157.
Pesic, Z. and Hiruki, C. 1988. Comparison of ELISA and dot-hybridization for of Alfalfa
mosaic virus in alfalfa pollen. Can.J.Plant Pathol. 10: 116-122. Polak, M.W.P.; Wojciech, R. and Zmudzinski, J.F. 2005. Implementation of Dot Blot in
Rapid Diagnosis of BSE. Bull.Vet.Inst.Pulawy. 49: 263-266.
110
Powell, L.C.; Brewer, M. and Lappin, M.R. 2001. Detection of Toxoplasma gondii in the milk of experientally infected lactating cats. Vet.Parasitol. 102: 29-33.
Pratama, D.A.O.A. 2009. Analisis Toxoplasma gondii repeat region 529 bp (NCBI Acc
No AF146527) sebagai kandidat probe untuk diagnosis molekuler toksoplasmosis. Tesis Program Studi Bioteknologi. Pascasarjana – UGM. Yogyakarta.
Priadi, A. 2003. Prinsip Dasar Enzyme Linked Immunosorbant Assay (ELISA).
Dalam Whorkshop Pengembangan Diagnostik Fasciolosis dengan ELISA untuk Mendeteksi Cathepsin L(CatL). BPV. Bogor. 17-19 Februari 2003.
Primrose, S.B. 1995. Principles of genome analysis. A guide to mapping and sequencing DNA from different organism. Blackwell Science. Oxford.
Priyana, A. 2000. Antibodi Anti Toxoplasma pada Ayam Kampung (Gallus domestius)
di Jakarta. Majalah Kedokteran Indonesia. 50(11): 504-507. Priyowidodo. 2003. Kajian Metoda Diagnosis Toksoplasmosis secara Polymerase Chain
Reaction (PCR) dan Pemeriksaan Histologis. Tesis. Universitas Gadjah Mada, Yogyakarta.: 1-51
Raizman, R.E. and Neva, F.A. 1975. Detection of circulating antigen in acute
experimental Infection with Toxoplasma gondii. J.Infect.Dis. 122, 44-48.
Reischl, U., S. Bretagne, D. Kruger, P. Ernault, J.M. Costa. 2003. Comparison of Two DNA Targets for the Diagnosis of Toxoplasmosis by Real-time PCR using Fluorescence Resonance Energy Transfer Hybridization Probes. BMC. Infect.Dis. 3(1): 1-9.
Remington, J.S. and Destmon, G. 1990. In Remington, JS; Kleid GO (eds). Infection
Diseases of the fetus and Newborn infant 4th.ed.Philadelphia WB. Saunders Comp.: 89-195.
Remington, J.S.; McLeod, R.; Destmont, G. 1995. In: Remington JS : Kleid JO
(eds)Infection Diseases of the fetus and Newborn infant. 2 ed . Philadelphia WB Saunder Comp.: 140-257.
111
Remington, J.S.; Tulliez, P. and Montoya, J.G. 2004. Recent development for diagnosis of toxoplasmosis. J.Microbiol. 42(3): 941-945.
Roche, P.J. 2006. Preparationof Template DNA and Labeling Techniques. From
Methods in Molecular Biology, vol 326 : In Situ Hybridization Protocols : Third Edition. Edited by : I.A.Darby and T.D.Hewitson. Humana Press Inc, Totowa, NJ.: 9 – 16
Roche, 2009. DIG High Prime DNA Labeling and Detection Starter Kit I. WWW.roche-
applied-science.com. Rueue, K., 1998. mRNA Quantitation Techniques: Considerations for Experimental
Design and Application. J.Nutrition. 128(11): 2038-2044. Salehzada, T. and Taha, M.N. 1992. Licence de Biochemie. Travaux Practique de
Biochemie. Biochemie des Proteine. Biochemie Moleculaire. Universitie Montpellier II. U.F.R-S. F.A.: 10-22.
Salis, AD. 2009. Application in Clinical Microbiology. Real time PCR: Current
Technology and Application. Caister Academic Press. ISSN 978-1-90445539-4 Sambrook, J. and Russell, D.W. 2001. The Basic Polymerase Chain Reaction. In
Molecular cloning. A Laboratory manual. Third Ed. Cold Spring Harbor Laboratory Press, NewYork. Vol 2: 8.18 – 8.24
Samuelson, J.; Soto, R.A.; Reed, S.; Biage, F. and Wirth, D. 1989. DNA Hybridization
Probe for Clinical Diagnosis of Entamoeba histolitica. J.Clin.Microbiol. 27(4): 671-676.
Sandi, E.A. and Brenes, O.V. 2005. Serological Prevalence of Toxoplasma gondii in
Free-range Chickens from Costa Rica. Trop.Ann.Health Prod. 37: 369-372. Sarjono; Nurcahyo, W dan Hanafiah, M. (2004). Studi Produksi takizoit Toxoplasma
gondii dari pembiakan in vivo pada mencit (Mus musculus).Media Kedokteran Hewan. 20(2): 53-56
Sarovar, B. and Saigopal, D.V.R. 2010. Development of Probe-base blotting technique
for the detection of Tobacco streak virus. Acta Virologica. 54: 221-234. Sarva, U. and Holliman R.E. 1989. Diagnosis of Ovine Toxoplasmosis: an alternative to
Toxoplasma as a model genetic system. In Molecular Biology of Parasitic Protozoa. Edited by Deborah F. Smith and Marilyn Parson. IRL Press.: 55 – 74.
112
Son, E.S. and Nam, H.W. 2001. Detection and Characterization of Excretory/Secretory Protein from Toxoplasma gondii by Monoklonal Antibodies. Korean J. Parasitol. 39(1): 49-56.
Soulsby, E.J.L. 1982. Protozoa. In Helminth, Arthropods and Protozoa of domesticated
M.C.B. and Lehman, T.; Dubey, J.P. 2003. Genotyping of Toxoplasma gondii isolates from Chickens from India. Vet.Parasitol.118: 186-194.
Steuber, V.S.; Niu, A.; Reetz, J.; Roth, A. and Janitschke, K. 1995. Der Nachweis von
Toxoplasma gondii in abortgeweben vom schaf mittels der polymerase-ketterreaktion. Dsch.Tierarztl.wschr. 102: 91-93.
Subekti, D.T.; Artama, W.T. dan Iskandar, T. 2005. Perkembangan kasus dan Teknologi
diagnosis Toksoplasmosis. Lokakarya Nasional Penyakit Zoonosis. Bogor Sudjadi. 2008. Bioteknologi Kesehatan. Cetakan pertama. Penerbit Kanisius: 21-279 Sumartono; Nurcahyo, W. dan PriyoWidodo, D. 2005. Pengembangan Probe Molekuler
untuk Optimalisasi diagnosis Koksidiosis. J.Sain Vet. 23(2): 60-66. Sumartono; Artama, W.T., Asmara, W. dan Tabbu, C.R. 2007. Analisis kandidat probe
molekuler untuk diagnosis toksoplasmosis berdasarkan fragmen sekuen repetitif genom takizoit. Media Kedokteran Hewan 23(1): 7-12.
Suratma, A. 2008. Sensitifitas dan Spesifisitas uji ELISA menggunakan antigen Protein
30 kDa untuk mendeteksi kista Toxoplasma gondii dalam jaringan Babi. Disertasi-Program Pascasarjana-UNUD.
Suryadi (2006). Bahan Genetik. Dalam Genetika Kedokteran. Fakultas Kedokteran.
UGM: 7-20. Susanto, L.; Supali, T. dan Gandahusada, S. 2002. Penentuan konsentrasi minimal Gen
B1 dan Gen P30 Toxoplasma gondii yang masih terdeteksi dengan reaksi Rantai Polimerase. Makara Kesehatan 6(2): 64-70.
Susanto, L.; Gandahusada, S. dan Muljono, R. 1999. Invasi Toxolasma gondii ke dalam
sel hospes serta deferensiasinya dari takizoit ke bradizoit. Majalah Kedokteran Indonesia. 49 (6): 208-211.
Suwanti, LT.; Suprihati, E.; Mufasirin. (2006). Prevalensi Toxoplasmosis pada Ayam di
beberapa Pasar di kota Surabaya. Media Kedokteran Hewan. 22(1): 32-35.
113
Taylor, G.R. 1991. Polymerase Chain Reaction. Basic principles and automation. In PCR a practical approach. Ed by M.J.Mepherson, P.Quirhe and GR.Taylor. Oxford University Press.: 1-13
Tenter, A.M.; Vietmeyer, C. and Johnson, A.M. 1992. Development of ELISAs based
on Recombinant antigen for the detection of Toxoplasma gondii-spesific in sheep and Cats . Vet.Parasitol. 43: 187-194
Tenter, A.M.; Seineke, P.; Simon, K. ; Heckerozh, A.R.; Damriyasa, I.M.; Bauer, C. and
Zahner, H. 1999. Aktuelle Studien zur Epidemiologie von Toxoplasma infectionen. Proc.German Vet.Med.Soc.1999: 247-264.
Human toxoplasmosis by using the recombinant truncated surface antigen 1 of Toxoplasma gondii. Diag. Microbiol.and Infect.Dis. 64(3): 261-266
114
Yang, H.; Wanner, I.B.; Roper, S.D. and Chaudhari, N. 1999. An Optimized Method for In Situ Hybridization with signal amplification hat allows the detection of Rare mRNAs. J.Histochem.and Cytochem. 47: 431-446.
Yasodara, P.; Ramalakshmi, B.A.; Sarma, M.K.J. 2001. A New Approach to
Defferentiate Recent VS Chronic Toxoplasma Infection : Avidity ELISA in Toxoplasma serology. Indian J.Med.Microbiol. 19(3): 145-148
Yuwono, T. 2006. Teori dan Aplikasi Polymerase Chain Reaction. Edisi pertama.
Penerbit Andi Yogyakarta: 1-237 Yuwono, T. 2008. Biologi Molekuler. Edisi pertama. Penerbit Erlangga: 1-258 Zhang, Y.W.; Kim, K.; Ma, Y.F.; Wittner, M; Tanowitz, H.B. and Weiss, L.M. 1999.
Disruption of Toxoplasma gondii bradyzoite-specific gene bag-1 decreases in vivo cyst formation. Mol.Microbiol. 31(2): 691-701.