Apr 17, 2015
PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between
the primers is amplified
The first PCR cycle:The sequence between the two primers will be
amplified
Four cycles of PCR
Copy number of the sequence between the primers increases exponentially
SEQUENCIAMENTO DE DNA
Profa. Dra. Maria Aparecida Fernandez
Depto de Biologia Celular e Genética
Universidade Estadual de Maringá
Structure of dideoxynucleotide triphosphates
Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist
DNAP requires a template and a primer
The [ddNTP] determines the distribution of chain lengths produced.
The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.
TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA
Alto peso molecular
Baixo peso molecular
Filme de raio X
Auto-radiograma
Leitura manual
Automated DNA Sequencing
Reação de seqüênciamentoReação de seqüênciamento
Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento
Typical output of an automated sequencer
Eletroforese no seqüênciamentoEletroforese no seqüênciamento
Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação
Seqüenciador automáticoSeqüenciador automático
Conjunto
de
16 capilares
Panorama no momento da corrida
Análise preliminar pós corrida
ELETROFEROGRAMAS