Pavel Morozov Pavel Morozov March 3 March 3 Legionella Legionella Functional Functional Genomics Project. Genomics Project.
Dec 19, 2015
Pavel Morozov Pavel Morozov
March 3March 3
LegionellaLegionella Functional Functional Genomics Project.Genomics Project.
Legionella pneumophilaLegionella pneumophila• An intracellular pathogen that can invade and replicate inside human macrophages and causes An intracellular pathogen that can invade and replicate inside human macrophages and causes
potentially fatal human infection Legionaires' disease. potentially fatal human infection Legionaires' disease. • Transmitted through inhaling mist droplets containing the bacteria. Transmitted through inhaling mist droplets containing the bacteria. • Has extraordinary ability to survive in many different ecological niches (axenic cultures, Has extraordinary ability to survive in many different ecological niches (axenic cultures,
biofilms with other organisms and intracellular vacuoles of amoebae, ciliates and human biofilms with other organisms and intracellular vacuoles of amoebae, ciliates and human cells). cells).
• In order to relpicate In order to relpicate LegionellaLegionella should be inside if protozoa (amobae, acanthamoeba) which should be inside if protozoa (amobae, acanthamoeba) which are single-cell eukaryotes, or macrophages of human lungs or monocites.are single-cell eukaryotes, or macrophages of human lungs or monocites.
I
II III
IV
VI V
Adhesion, invasion
Inhibition of
lysosome fusion
Recruitment of ER
Evasion
Modulation of host-cell gene expression
Replication
Complete genome of LEgionella Complete genome of LEgionella pneumophila (strain Phyladelphia 1).pneumophila (strain Phyladelphia 1).
oriC
repl termrepl term
region 3: efflux
region 7: tra/trb region (F-plasmid)
Legionella pneumophila (strain Phyladelphya 1) genome.The highlighted regions were noteworthy due to their possession of different than average G+C content and GC skew in addition to skewed strand preference of ORFs. These computationally determined regions turn out to contain gene clusters that belong to specific categories (e.g., ribosomal protein cluster), or those corresponding to points of genome rearrangements or acquired by horizontal transfer. Some examples are shown in more detail below.
genes in direct chain
genes inreverse chain
C+G content
GC skew
Project goalsProject goals
• Study molecular mechanisms (genetics and Study molecular mechanisms (genetics and regulation) of regulation) of – LegionellaLegionella ability to survive in different ecological ability to survive in different ecological
niches.niches.– LegionellaLegionella infection. infection.
• Extended genome annotation of Extended genome annotation of Legionella Legionella species (species (Phyladelphia, Paris, LensPhyladelphia, Paris, Lens strains). strains).
• Custom whole-genome microarrays.Custom whole-genome microarrays.• Network reconstruction and modeling.Network reconstruction and modeling.
June 2001•1344 clones in triplicate•40% of the genome
October 2003
3,230 clones90% of the genome
September 2005
2,997 70-mer oligos
Whole-genome array
3,005 genes in duplicates
640 reference controls
Microarray Design. Microarray Design. History of History of LegionellaLegionella Microarrays. Microarrays.
The goal was to design 70-mer probes covering all protein- and RNA- coding The goal was to design 70-mer probes covering all protein- and RNA- coding genes and control probes for testing background and array properties.genes and control probes for testing background and array properties.
Requirements common to all probes:Requirements common to all probes:
– should not contain short nucleotide stretches that are too abundant;should not contain short nucleotide stretches that are too abundant;
– should be free from secondary structure elements;should be free from secondary structure elements;
– should have approximately same melting temperatureshould have approximately same melting temperature
Requirements specific to probes specific to genes: Requirements specific to probes specific to genes:
– 70-mers should be unique (occure once) in experimental system 70-mers should be unique (occure once) in experimental system ((Legionella, Human, E.coliLegionella, Human, E.coli););
Requirements specific to array control probes:Requirements specific to array control probes:
– should not not exist in experimental system (should not not exist in experimental system (Legionella, Human, Legionella, Human, E.coliE.coli))
Requirements for Microarray Probes.Requirements for Microarray Probes.
Microarray probe design using unique oligonucleotides of particular Microarray probe design using unique oligonucleotides of particular length.length.
5’5’ CDS or genomic sequenceCDS or genomic sequence 3’ 3’
14-mer14-mer
oligonucleotidesoligonucleotides
uniqueunique
oligonuclleotidesoligonuclleotides
overrepresented 8-overrepresented 8-mersmers
70-mer microarray probe70-mer microarray probeIn simplified form probe selection can be described like selection of regions with
maximum number of unique oligonucleotides (in this case of length 14 bp) and minimal number of overrepresented shorter oligonucleotides (in this case 8 bp).
In actual study we have to use oligonucleotides of different length and also check for the probe melting temperature.
Using unique oligonucleotide for designing probes automatically removes secondary structure issues.
Chosing length of Chosing length of oligonucleotidesoligonucleotides
DNA or RNA (genomic or mRNA sequence).
n
n+1
n+2
n+3
n+k
ancestors
descendants
10 12 14 16 18 200
0.5
1
1.5
2
2.5
3x 10
7
oligonucleotide lengthn
um
ber
of n
ow
el u
niq
ue o
ligon
ucl
eot
ide
s (x
107 )
Human chromosome X
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5x 10 5
Simulations for length 1m.b.
oligonucleotide length
6 8 10 12 14 16 18 10 12 14 16 18 20
nu
mb
er o
f no
we
l uni
que
olig
onu
cle
otid
es
(x1
05 )
A) B)
Distributions of ancestral and descendant unique oligonucleotides by it’s length. Solid line denote sum of two distributions, dotted line denote distribution of ancestral oligonucleotides and dashed line stands for descendats. A) Results of simulation for genomes of size 1mb. B) Real data for human chromosome X.
Distribution of ancestors and descendant of various length.Distribution of ancestors and descendant of various length.
For each position we can define the length L at which the nucleotide, starting at this position became unique. All oligonucleotides in this position longer than L will be also unique. Also there are two types of unique oligonucleotides: those who contain unique oligonucleotide of smaller length and those who do not, we name them ancestors and descendants. It is enough to keep information about first occurrence of oligonucleotide for each position in order to have complete information about distribution of unique oligonucleotides for particular sequence region.
Sequence region and ancestors for each position (-1 if not known) :Sequence region and ancestors for each position (-1 if not known) :
a t g c a c t a g c t a g c t a g t c g a t g c a c t a g c t a g c t a g t c g ……
12,14,-1,-1,15,10,10,11,10,14,-1,-1,13,15,12,-1,-1,-12,14,-1,-1,15,10,10,11,10,14,-1,-1,13,15,12,-1,-1,-1,12,16…1,12,16…
PP11
PP22
PPii
Design of probes using unique oligonucleotides Design of probes using unique oligonucleotides positional information.positional information.
For each potential probe Pi can be defined vector of number of unique oligonucleotides of various length (both ancestors and descendants): Vi={0,0,0,0,0,0,0,2,3,4,2,3,5,6,7}.
A Golden Standard vector can be defined as G={0,0,0,0,0,0,n1,n1-1,n1-2,n1-3…}.
An Euclidian distance is a relible choise of a measure for the estimation of distance between Vi and G:
D(Vi,G)=√ ∑L (Vi(j)-G(j))²where L set of oligonucleotide length used. A probes with minimal distance to golden standard we choosed.
• Enumerating oligonucleotides Enumerating oligonucleotides – Binary arithmetic : Binary arithmetic :
00 stands for A, 01 for T, 10 for C and 11 00 stands for A, 01 for T, 10 for C and 11 for G.for G.
Binary:01110001 Decimal:142 Binary:01110001 Decimal:142 T G A T T G A T
– Enumeration is Enumeration is completecomplete, , densedense, and , and nonredundantnonredundant..
• Counting oligonucleotidesCounting oligonucleotides– direct countingdirect counting– Complete space of possible Complete space of possible
oligonucleotides grows as 4oligonucleotides grows as 4nn. . – Memory size of current computers Memory size of current computers
allows to handle oligonucleotides up allows to handle oligonucleotides up to 16 on PC, up to 18 on Sun Solaris. to 16 on PC, up to 18 on Sun Solaris. With algorithm enhancements we can With algorithm enhancements we can go up to 24 (but no need).go up to 24 (but no need).The best resolution for human The best resolution for human genome provided by length 18 and genome provided by length 18 and most bacterial genomes 12-14.most bacterial genomes 12-14.
Olig Space without Space with length coding coding
4 256 32
5 1,024 128
6 4,096 512
7 16,384 2,048
8 65,536 8,192
9 262,144 32,768
10 1,048,576 131,072
11 4,194,304 524,288
12 16,777,216 2,097,152
13 67,108,864 8,388,608
14 268,435,456 33,554,432
15 1,073,741,824 134,217,728
16 4,294,967,296 536,870,912
17 17,179,869,184 2,147,483,648
18 68,719,476,736 8,589,934,592
19 274,877,906,944 34,359,738,368
20 1,099,511,627,776 137,438,953,472
- computable on desktop- computable on workstation with big memory- computable on workstation with big memory with enhanced algorithm- hardly computable
Finding unique oligonucleotides.Finding unique oligonucleotides.
Storing data in Rich FASTA format
Program realization and data Program realization and data formats.formats.
Results of the search for unique oligonucleotides are stored in “rich” Fasta format. Essentially it is linear record of positional information like regular Fasta file, but with coded additional information.
0 1 0 0 1 1 0 0
Symbol Length of first Overrepresented flag unique oligonucleotides in this position
List of fasta files(genomes etc.)
Marked for unique oligonucleotides fasta file
u_find.exeu_findm.exe
for minimal oligonucleotidelength
u_find.exeu_findm.exe
for all desired oligonucleotidelengthu_code.exe
Microarray probes
u_design.exe
Goal: sequence which have no homology to any genome Goal: sequence which have no homology to any genome ( no blast hits over threshold)( no blast hits over threshold)
• Selecting nonexistent oligonucleotidesSelecting nonexistent oligonucleotides• Overlapping and merging oligonucleotidesOverlapping and merging oligonucleotides• Choosing probes from merged sequencesChoosing probes from merged sequences
AATGCTAGCTAAATGCTAGCTA ATGCTAGCTACATGCTAGCTAC CTAGCTACGGACTAGCTACGGA AGCTACGGAATAGCTACGGAAT AATGCTAGCTACGGAAT . . . . . .AATGCTAGCTACGGAAT . . . . . .
ATGCTAGCTACGGAATGCTAGCTACGGA
Nonexisting oligonuclleotides
Nonexisting sequence.
Probe selection (temperature, secondary
structure)
Design of control probes using non-existing Design of control probes using non-existing oligonucleotides information.oligonucleotides information.
12 –mers; 39855 nonexistant out of 16777216 (0.24%); 640 12 –mers; 39855 nonexistant out of 16777216 (0.24%); 640 probes selectedprobes selected
• Finding of unique and nonexistent oligonucleotides have linear computational Finding of unique and nonexistent oligonucleotides have linear computational time on the size of genomes used.time on the size of genomes used.
• Once the unique and system is represented in “rich” fasta format, design of Once the unique and system is represented in “rich” fasta format, design of new probes became extremely fast and can be repeated as much as needed in new probes became extremely fast and can be repeated as much as needed in order to create probes for new set of CDS or genomic region.order to create probes for new set of CDS or genomic region.
• Probes, selected by using unique oligonucleotides automatically reduce the Probes, selected by using unique oligonucleotides automatically reduce the presence of hairpins on RNA secondary structure. presence of hairpins on RNA secondary structure.
• Method can be applied to experimental systems with multiple non-related Method can be applied to experimental systems with multiple non-related genomes (genomes can be as far from each other as eu- and prokaryotes).genomes (genomes can be as far from each other as eu- and prokaryotes).
• Method is efficient for control probe selection.Method is efficient for control probe selection.
• Problem: Method did not provide robust estimation of sequence homology Problem: Method did not provide robust estimation of sequence homology between probe and the rest of genomes, at the same time selected probes have between probe and the rest of genomes, at the same time selected probes have the lowest homology to the rest of genome possible.the lowest homology to the rest of genome possible.
• Method provides valuable statstics about oligonucleotide usage in particular Method provides valuable statstics about oligonucleotide usage in particular genomes and genome sets.genomes and genome sets.
Properties of proposed probe design method.Properties of proposed probe design method.
Legionella Legionella in Microbial in Microbial Communities.Communities.
• Biofilms are not just a bunch of microbes, they are a special environment, Biofilms are not just a bunch of microbes, they are a special environment, protected from harsh outside by a special polysaccharide layer, which is protected from harsh outside by a special polysaccharide layer, which is produced by other microbes in the community.produced by other microbes in the community.
• Microbial community in biofilms have shared metabolic and regulatory Microbial community in biofilms have shared metabolic and regulatory networks.networks.
• Biofilms provide excellent environment for horizontal gene transfer.Biofilms provide excellent environment for horizontal gene transfer.• Since biofilms prevent antibiotics and other biocide from getting to the Since biofilms prevent antibiotics and other biocide from getting to the pathogens biofilms are significant reservoir of health-hazardous pathogens biofilms are significant reservoir of health-hazardous pathogens. pathogens.
• LegionellaLegionella can survive in biofilms, but cannot form it by itself, only as can survive in biofilms, but cannot form it by itself, only as part of the microbial community. part of the microbial community.
• Evolutionary studies (Traces of ancient events?).Evolutionary studies (Traces of ancient events?).Hsieh et.al., Minimal model for genome evolution and growth. Hsieh et.al., Minimal model for genome evolution and growth.
Phys Rev Lett. 2003 Jan 10;90(1):018101. Phys Rev Lett. 2003 Jan 10;90(1):018101. Jordan et.al., A universal trend of amino acid gain and loss in protein evolution.Jordan et.al., A universal trend of amino acid gain and loss in protein evolution.
Nature. 2005 Feb 10;433(7026):633-8. Epub 2005 Jan 19.Nature. 2005 Feb 10;433(7026):633-8. Epub 2005 Jan 19.
• Use in organism and sequence identification – Use in organism and sequence identification – metagenomics.metagenomics.
Metagenomics: "the application of modern genomics Metagenomics: "the application of modern genomics techniques to the study of communities of microbial techniques to the study of communities of microbial organisms directly in their natural environments, bypassing organisms directly in their natural environments, bypassing the need for isolation and lab cultivation of individual the need for isolation and lab cultivation of individual species.“ (Chen and Pachter, University of California, species.“ (Chen and Pachter, University of California, Berkeley)Berkeley)
Bailey & Ulrich, Molecular profiling approaches for identifying novel biomarkers.Bailey & Ulrich, Molecular profiling approaches for identifying novel biomarkers.Expert Opin Drug Saf. 2004 Mar;3(2):137-51. Review.Expert Opin Drug Saf. 2004 Mar;3(2):137-51. Review.
Palmer et.al., Rapid quantitative profiling of complex microbial populations.Palmer et.al., Rapid quantitative profiling of complex microbial populations.Nucleic Acids Res. 2006 Jan 10;34(1):e5. Nucleic Acids Res. 2006 Jan 10;34(1):e5.
Similar applications and potential use of Similar applications and potential use of proposed method.proposed method.
Clickable Interactive Interface
BrowserJAVA
HTML
Server Side
Client Side
requestdata transfersupervision
Local Databases
Local Methods
Update Engine
SQL Engine
Memory Engine
ADAPTERS LAYER: Converting and performing requests, formatting output. UNIX web server, Perl scripts, JAVA, C.
Remote Databases
Remote Methods
•Setting up the server sideSetting up the server side•Setting up mySQL server and servicesSetting up mySQL server and services•Tools for importing and parsing Tools for importing and parsing external databasesexternal databases
– scripts to process flat files (perl, scripts to process flat files (perl, mySQL): mySQL):
•extracting related information extracting related information •fomatting into SQL database fomatting into SQL database •Formatting into static HTMLFormatting into static HTML
– scripts to pars remote databases scripts to pars remote databases (perl, java, mySQL):(perl, java, mySQL):
•extracting related information extracting related information •fomatting into SQL database fomatting into SQL database •Formatting into static HTMLFormatting into static HTML
– update engine (under construction)update engine (under construction)•WEB page development (HTML, WEB page development (HTML, JavaScript, CSS)JavaScript, CSS)
–Testing with Explorer, Fire Fox, Opera, Testing with Explorer, Fire Fox, Opera, Safari.Safari.
Solved technical problems:
ongoing
solved
Sources of Information
Results of computationsPublicly available data
PFAM PDB PRODOM PROSITE
TRANSFAC SMART
GeneNet MetaCyc
Sequence/Genome
Functional Domains
Literature
MEDLINE
Function and annotation
NCBI EMBL TIGR Individual genomes
PathwaysCategoriesGO
Proprietary data
Current list of integrated Current list of integrated databases databases
Parsed for Parsed for Legionella-Legionella-related related information, organized and stored information, organized and stored locally:locally:– NCBINCBI– EMBLEMBL– UniProtUniProt– InterProInterPro– PIRSF (PIR superfamily/family)PIRSF (PIR superfamily/family)– PfamPfam– PRINTSPRINTS– PRODOMPRODOM– PROSITEPROSITE– HSSPHSSP– MedLine/PubMed MedLine/PubMed – MetaCycMetaCyc– NMPDR/FIGNMPDR/FIG– KEGGKEGG
WEB site schemeWEB site scheme
Interactive data retrieval into interactive tables
Interactive genome map
Interactive toolsBLAST, HMM,
REMOTE_SEARCH (SMART, PROSITE etc.)
Static interactive tables
Static interactive gene descriptionsWEB
server and
scripts
Search History
Precompiled
Dynamic (by user requests)
Semi Dynamic
SQLdatabas
e
Integrated
Tools
LegionellaLegionella GenomeGenome Browser. Browser.
Interactive.Interactive.
You can:You can:
•Choose scale Choose scale and regionand region
•Links to tables Links to tables and annotation and annotation datadata
•Choose Choose annotation annotation tracks to display tracks to display and track and track parametersparameters
•Choose various Choose various color schemescolor schemes
•Add custom Add custom annotation annotation trackstracks
Interactive tablesInteractive tables
Row operations: Select/Unselect, Show/Hide
rows
Columns (fields) operations: Show/hide
column
Sorting columns
Snapshots of the NMPDR annotation pages
icmPicmRRegion comparisons in other genomes by sequence homology:
L.pn Phil1
Coxiella burnetii
Visualization of the gene expression in Visualization of the gene expression in NMPDR systemNMPDR system pathway
reactions
Legionella gene info
expression ratios
4. Develop models (gene networks and reporter genes) that describe relevant patterns of gene expression:
(gene networks = expressed genes + their regulators)
Study gene expression:1. during intracellular growth and under various
environmental stresses2. axenically- and protozoan-grown Legionella3. in Legionella-containing biofilms
~3000 genes
ORF Finders BLAST
KEGG Pathways
Plus MissingMembers
Confirm absenceof these genes:
1. Use lower stringency search2. BLAST expected genes to Legionella genome sequence3. Search for probable motif combinations
GeneOntologyMetaCyc
560 assignments
LegCyc:181
pathways
678 assignments
72%
Expressed genes: Original Gene Function Expressed genes: Original Gene Function AssignmentsAssignments
Search for transcription factor binding Search for transcription factor binding sitessites
Clusters of co-expressed genes
Predicted operons
Experimental confirmation of the predicted promoters. Transcription start sites.
Use of confirmed motifs to identify additional co-regulated genes.
+
lvhlvrA
1 2 3 4 5 6 7 8
• Promoter manipulations
• Co-expressed gene sets
• Regulatory networks
TF site prediction (in silico).
Microbiology DepartmentProf. Shuman• Gene knockout • Phenotypic analysis
Columbia Genome CenterJing Ju lab, S. Kalachikov, S. PompuGene expression microarrays• Clusters of coexpressed genes• Regulatory genes knockout results (expression)
Molecular biology methodsGene expression microarrays• RT-PCR• Transcriptional factors• promotor verification
Computational AnalysisMorozov Pavel, Morozova Irina•operon structures•putative promotors and transcriptional regulation sites•detailed gene annotation•regulatory network reconstruction