-
piggyBac Transposon plus Insulators OvercomeEpigenetic Silencing
to Provide for Stable SignalingPathway Reporter Cell LinesValeri V.
Mossine1,2*, James K. Waters2, Mark Hannink1, Thomas P.
Mawhinney1,2,3
1 Department of Biochemistry, University of Missouri, Columbia,
Missouri, United States of America, 2 Experiment Station Chemical
Labs, University of Missouri,Columbia, Missouri, United States of
America, 3 Department of Child Health, University of Missouri,
Columbia, Missouri, United States of America
Abstract
Genetically modified hematopoietic progenitors represent an
important testing platform for a variety of cell-basedtherapies,
pharmaceuticals, diagnostics and other applications. Stable
expression of a transfected gene of interest inthe cells is often
obstructed by its silencing. DNA transposons offer an attractive
non-viral alternative of transgeneintegration into the host genome,
but their broad applicability to leukocytes and other “transgene
unfriendly” cells hasnot been fully demonstrated. Here we assess
stability of piggyBac transposon-based reporter expression in
murineprostate adenocarcinoma TRAMP-C2, human monocyte THP-1 and
erythroleukemia K562 cell lines, along withmacrophages and
dendritic cells (DCs) that have differentiated from the THP-1
transfects. The most efficient andstable reporter activity was
observed for combinations of the transposon inverted terminal
repeats and one 5’- or twocHS4 core insulators flanking a green
fluorescent protein reporter construct, with no detectable
silencing over 10months of continuous cell culture in absence of
any selective pressure. In monocytic THP-1 cells, the
functionalactivity of luciferase reporters for NF-κB, Nrf2, or
HIF-1α has not decreased over time and was retained
followingdifferentiation into macrophages and DCs, as well. These
results imply pB as a versatile tool for gene integration
inmonocytic cells in general, and as a convenient access route to
DC-based signaling pathway reporters suitable forhigh-throughput
assays, in particular.
Citation: Mossine VV, Waters JK, Hannink M, Mawhinney TP (2013)
piggyBac Transposon plus Insulators Overcome Epigenetic Silencing
to Provide forStable Signaling Pathway Reporter Cell Lines. PLoS
ONE 8(12): e85494. doi:10.1371/journal.pone.0085494
Editor: Jean-Luc EPH Darlix, Institut National de la Santé et de
la Recherche Médicale, FranceReceived August 13, 2013; Accepted
December 4, 2013; Published December 20, 2013Copyright: © 2013
Mossine et al. This is an open-access article distributed under the
terms of the Creative Commons Attribution License, which
permitsunrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited.
Funding: This work was supported, in part, by the University of
Missouri Agriculture Experiment Station Laboratories and by Grant
P50AT006273 from theNational Center for Complementary and
Alternative Medicines (NCCAM), the Office of Dietary Supplements
(ODS), and the National Cancer Institute(NCI). Its contents are
solely the responsibility of the authors and do not necessarily
represent the official views of the NCCAM, ODS, NCI, or the
NationalInstitutes of Health. The funders had no role in study
design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing interests: The authors have declared that no competing
interests exist.* E-mail: [email protected]
Introduction
Signaling pathway reporters are defined as synthetic
DNAsequences incorporating a cis-regulatory transcriptionalresponse
element (TRE) followed by a minimal promoter and areporter gene
[1]. The significance of signaling pathwayreporter technology for
cell biology cannot be overestimated. Adiverse range of
applications in such areas as drug discovery[2,3], toxicology or
environmental surveys [4,5], which employthe reporter transgenic
bacteria, eukaryotic cell lines, oranimals, have been developed in
recent years.
Blood-borne cells, such as dendritic cells (DCs) or
theirmonocyte progenitors, represent an attractive resource
fordeveloping various human cell-based assays [6,7], due to
thestrong responses to immunostimulants and convenience oftheir
isolation and genomic manipulation ex vivo. Dendritic cellsare
professional antigen-presenting cells and are key
regulators of the inflammatory status in response to
themicrobiota, environmental stress and pathogen invasions
[8,9].Mature DCs normally reside in epithelia and thus are
wellsuited for development of reporter-based assays for
potentialskin, lung, or mucosal allergens. One current limitation
is thelack of a robust approach to generation of stable
DC-basedreporters. Ideally, the reporter cells would
representimmortalized lines stably expressing both stimulated
andmarker reporter genes. Mature DCs do not proliferate, butcould
be differentiated in vitro from monocytic precursors [10].However,
previous attempts to use isolated blood monocytesfor securing
stable reporter transgene activity in differentiatedDCs were not
successful [11]. An alternative to isolatedmonocytes, human
monocytic leukemia line THP-1 is one ofthe widely used models for
monocytic progeny of phagocyticcells, such as macrophages [12,13].
In addition, high relevanceof THP-1 monocytes to isolated DCs has
been verified in skin
PLOS ONE | www.plosone.org 1 December 2013 | Volume 8 | Issue 12
| e85494
http://creativecommons.org/licenses/by/4.0/
-
sensitization assays [14] using qPCR analysis of
representativemarker genes. Hence, we asked whether pathway
reporterDCs could be reliably generated from THP-1 stably
expressingrespective reporter genes.
Stable expression of transgenes in human cells has receiveda
significant effort from both academia and pharma, due to awide
variety of potential applications for genetically modifiedcells
[15,16]. Regulation of gene expression in eukaryotesdepends on
multiple cis- and trans-acting factors, includingspatial
organization of chromatin, nucleosomal positioning onregulatory
sequences, and covalent modifications of DNAnucleotides and
histones. Random exogenous polynucleotideintegration into the host
DNA often leads to the transgenesilencing [17]. To achieve
continuous expression of the targettransgene, a number of
approaches have been developed inrecent years [18]. Although the
most popular systems currentlyused for gene integration into
mammalian cells are viralvectors, they per se do not provide
transgene protection fromsilencing, while their cargo size
limitations and safety concernshave prompted an increase in efforts
to develop efficient non-viral gene delivery and protection tools
[19]. The task has beenaddressed by the establishment of
“humanized” transposonsand insulators.
The piggyBac transposon (pB) was initially identified ininsects
over three decades ago, but has been introduced intothe gene
technology field only recently [20]. The pB transposonhas a number
of advantages over traditional transfection andviral gene delivery
approaches. First, the transgene integrationinto the target genome
is not spontaneous, but is mediated byco-transfected pB transposase
(pBase) in a “cut-and-paste”fashion. Second, the insertion sites
tend to localize intranscription-active areas rich in CpG islands.
Finally, the sizeof pB transposon cargo gene (over 200 kb [21])
dramaticallyexceeds the limit of viral particles (5-10 kb).
Insulators are cis-regulatory elements that can blockimproper
gene activation or heterochromatin propagationimposed by remote
enhancers and silencers. One of the beststudied insulators is
chicken hypersensitive site-4 (cHS4)boundary element at the
β-globin locus, which acts byrecruiting histone acetyl transferases
and hindering DNAmethylation of the transgene promoter [22]. In
addition, cHS4may act as an enhancer blocker, although by a
differentmechanism. Insulators thus have been successfully applied
forstabilization of transgenes, such as those delivered by
viralvectors [22,23].
In this study, we have assessed whether pB transposonmediated
transfer of insulated reporter gene series into THP-1cells could
provide for stably altered monocytic cell linescapable of further
cell differentiation into tissue-specificmacrophages or DCs with
the reporter activities preserved. Tothe best of our knowledge,
this approach enabled, for the firsttime, a facile generation of
DC-based signaling pathwayreporters suitable for high-throughput
assays.
Results
The overall efficiency of stable transgene expressiondepends on
the gene delivery, integration into the host
genome, and epigenetic regulation of its promoters due to
thepositional and silencing/ enhancing effects.
Monocyte-derivedcells are well equipped for recognition and
clearance of foreignDNA [24], and are resistant to stable
transfections [15].Although there are a number of reports claiming
successfultransient transfection of reporter DNA into THP-1 and
othermonocytes, the vectors most often described in the
literature,such as pmaxGFP [25], are relatively small, and the
reports donot normally elaborate on efficiency of the vector
incorporationinto the host genome. In our hands, THP-1 resisted
most oftested transfection protocols, with the exception
ofnucleofection when performed specifically with pmaxGFP. Thegreen
fluorescent protein (GFP) expression in the nucleofectedcells,
however, was not observable after 1-2 weeks, due to thesilencing or
cell death. In addition, monocytes are notoriouslysensitive to
manipulations, and our attempts to enrichtransfected monocytes by
flow cytometry or cloning were metwith a mixed success owing to
very low cell survival rates. We,therefore, decided to turn to
different cell lines which woulddisplay a significant level of
transgene silencing, but would betolerant to conventional
transfection reagents and DNA vectors,as well as enrichment
protocols.
Flanking a GFP gene with insulators and pB ITRsovercomes the
transgene silencing in TRAMP-C2 andK562 cells
Transgenic mouse prostate adenocarcinoma (TRAMP) is apopular
model for prostate cancer studies, both in vitro and invivo
[26,27]. Reports on stably transfected TRAMP cell linesare scarce,
while the cell line’s propensity to efficiently
enforcedownregulation on many genes through
chromatinhypermethylation is well documented [28,29]. When
wetransfected the TRAMP-C2 line with a standard pEGFP-C1reporter
plasmid and then attempted to enrich stablytransfected cells by
either G418-mediated selection or flowcytometric sorting, only
about 3-5% of the selected cellsremained fluorescent (Figure S1A).
A similar effect wasobserved when a GFP reporter transgene was
stablyintegrated into the chromatin of TRAMP-C2 cells using
alentiviral vector (Figure S1B). The cells displayed aheterogeneous
pattern of GFP expression in growing colonies,as well (Figure S2).
In a striking contrast, when TRAMP-C2cells were transfected with a
transposon-based GFP-encodingvector (pB513B-1) along with a
piggyBac transposase (pBase)plasmid and sorted by flow cytometry,
the GFP-positive cellshave uniformly retained GFP expression and
puromycinresistance (Figure S1C).
pB513B-1 contains both pB transposon inverted terminalrepeat
(ITR) recognition sites and two core HS4 insulatorsflanking the GFP
reporter/ puromycin resistance sequence(Figure 1H). To determine
the individual roles of pB and HS4 inthe stabilization of reporter
activity in TRAMP-C2 cells, asystematic analysis was performed. The
CMV/MCS wasexcised from the transposon and the remaining elements
werereassembled in a barebone pSMART plasmid (constructs Athrough H
in Figure 1). TRAMP-C2 were transfected withplasmids carrying A
through H (pSA through pSH), along withthe pBase plasmid. All
transfects were enriched by
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 2 December 2013 | Volume 8 | Issue 12
| e85494
-
fluorescence-activated cell sorting (FACS) in 5 to 6
biweeklysort rounds, until 100% fluorescent, and then left to
proliferatefor 4 months without any further selection. The flow
cytometryanalysis is presented in Figure 2 and clearly shows
twopatterns. At the beginning of the 4-month period (the
upperhistograms in the pairs), the fluorescence intensity was
thelowest (median 50-fold over autofluorescence in the
non-transfects) in cells transfected with pSA, which lacks
bothtransposon and insulator sequences. Cells transfected withpSB
through pSE, that is, possessing either pB or at least onecHS4
insulator, formed a group with an intermediatefluorescence
intensity (median 84 to 107-fold). The strongestmedian fluorescence
(214 to 366-fold) was displayed by cellstransfected with vectors
pSF through pSH, containing both pBand at least one cHS4. At the
end of the 4-month run (the lowerhistograms in the pairs, Figure
2), there was a significantnumber of non-fluorescent cells in
TRAMP-C2 transfected withpSA through pSC. In the cells transfected
with vectorscontaining both insulators (pSD), transposon only
(pSE), ortransposon plus one insulator (pSF and pSG), we observed
ashift in the cell populations towards 2 to 3-fold decrease
inmedian GFP expression, but no cells with a complete loss ofthe
reporter. In contrast, there was only about 20% decrease inmedian
GFP expression in cells that have the construct H, withboth
insulators flanking the GFP reporter gene, that wereinserted into
the chromatin by pB transposition.
Human erythroleukemia K562 line is another well-established
example of transgene silencing. It has beenreported to efficiently
reduce expression of stably transfectedGFP, presumably due to both
epigenetic silencing and excisionof the transgene from the
integration sites in the host genome[30]. When K562 cells were
transfected with pSA, pSD, or pSHand then FACS-selected for the
uniformity of fluorescence, theresulting stable transfects
displayed a GFP expression intensityand stability pattern, in the
order pSH>pSD>pSA (Figure S3),which is similar to the one
observed in TRAMP-C2 cellstransfected with the respective
vectors.
Expression of TRE-luciferase-GFP reporter constructsis stable in
monocytic THP-1
Encouraged by the successful stabilization of GFP
transgeneexpression in TRAMP-C2 and K562 cells, we then assessedthe
ability of the transposon vector pSH to provide for stableGFP
expression in THP-1 cells. We have succeeded with thetask by
employing a non-toxic transfection reagent, GeneIn, asa suitable
vehicle for pSH and pB transposase plasmids co-delivery into the
monocytic cells (Table S1). Having achievedstable transfection of
transposon-based GFP-only vectors intoTHP-1, we next asked whether
significantly larger pBtransposons, carrying additional luciferase
reporters, could beintroduced into THP-1 genome as well.
The sequences that are encoding for multiple TREs specificfor
NF-κB, HIF-1α, and Nrf2 and are followed by a minimal
Figure 1. Schematic representation of GFP reporter constructs.
The constructs A through H were inserted into pSMART,resulting in
pSA through pSH plasmids, respectively.doi:
10.1371/journal.pone.0085494.g001
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 3 December 2013 | Volume 8 | Issue 12
| e85494
-
CMV promoter for the firefly luciferase gene have beeninserted
into the construct H, thus affording reporter vectors forNF-κB,
hypoxia-induced, and antioxidant/electrophile signalingpathways,
respectively (Figures 3A and S4). These productsare abbreviated
accordingly as pTR01F, pTR03F, and pTR05F,while respective stable
cell transfect names are denoted by theextensions R01F, R03F, or
R05F.
Thus, the lines THP.R01F, THP.R03F, and THP.R05F weregenerated
following co-transfection of THP-1 with therespective reporter
transposon and pB transposase plasmids,followed by puromycin-driven
selection. All puromycin-resistantcells were expressing GFP and did
not require any furtherselection. To verify the reporter transgene
stability, we havecultured THP.R01F continuously for 10 months,
without any
Figure 2. piggyBac transposon-based, insulated reporters are
stably expressed in TRAMP-C2 line. Vectors pSA throughpSH were
co-transfected with the Super pB transposase plasmid into TRAMP-C2
cells. The transfects went through several roundsof FAC sorting,
until the maximum fluorescence have been achieved (the upper
histogram in each pair). The sorted cells were thenlet to
proliferate without any selection and were subcultured twice a
week. The lower histogram in each pair represents FACSanalyses of
the cells at the end of the 4-month term. Immediately before the
analyses, the FACS instrument settings were calibratedagainst
Sphero Rainbow Beads. Median fluorescence intensities in the
transfected cells are normalized for the non-transfectedcontrol
TRAMP-C2 autofluorescence.doi:
10.1371/journal.pone.0085494.g002
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 4 December 2013 | Volume 8 | Issue 12
| e85494
-
selection pressure. The FACS analysis showed no decrease inGFP
expression and NF-κB reporter activity in this “old” culture,when
compared to the original batch of THP.R01F freshlythawed from
cryopreservation (Figure 3B). As illustrated inFigure 3C, when both
batches were treated with an NF-κBactivator, lipopolysaccharide
(LPS) from E.coli, there was nodecrease in luciferase expression in
the “old” THP.R01Fculture, as well. Similar reporter stability was
observed inTHP.R03F and THP.R05F lines.
Differentiation of the monocyte reporters into maturemacrophages
and dendritic cells retains the reporteractivities
To determine whether THP.R0nF (n = 1, 3, or 5) haveretained the
potential of immature phagocytic progenitors, weperformed
differentiation of the monocyte transfects intomature macrophages
or DCs. When THP.R0nF were treatedwith phorbol 12-myristate
13-acetate (PMA) for 2 daysfollowing a standard differentiation
protocol, all cells becametightly adherent, with characteristic
macrophage morphology(Figure 4B). However, exposure of the
monocytic transfects toDC differentiating factors GM-CSF and IL-4,
followed by TNF-α/ ionomycin treatment as described by Berges et
al. [31],produced DCs (Figure 4C), also within only 2 days.
Importantly,these treatments afforded for 100% adherent cells with
nosigns of cytotoxicity, provided PMA or TNF-α/ ionomycin mediawere
removed after the differentiation was complete. Alldifferentiated
macrophages and DCs displayed strong GFPexpression, comparable with
their monocytic progenitors(Figure 4D).
Next, inducible reporter luciferase activity for each
signalingpathway reporter was compared between the monocytes
andrespective differentiated macrophages and DCs. Aiming
atdevelopment of practical high-throughput assays, thecomparative
studies were carried out in a 96-well plate format.According to a
protocol which we followed, THP.R0nF wereseeded into the inner
wells of 96-well plates, at 2×104 cells/well, and some were treated
with the differentiating agents for 2days in serum-free media. The
differentiation media werereplaced with an assay medium to adapt
for next 16-24 h.Following the adaptation period, specific pathway
stimulatingagents were added to the monocyte, macrophage and
DCreporters for desired periods of time. Then treated anduntreated
cells were lysed, and fluorescence of GFP in thelysates was
measured in a capacity of an internal cell numbersurrogate, in
order to evaluate the cell proliferation/death rateand to normalize
the following luminescence data. Finally, theluciferin substrate
was added to the lysates, and theluminescence in wells was
measured. The assay data arecompiled in Figure 5.
As follows from Figure 5A inset, the relative basal
NF-κBactivity, determined as luminescence normalized to
thefluorescence readings in the unstimulated wells, was thehighest
in THP.R01F monocytes and the lowest in the DCs(DTHP.R01F), a
10-fold difference. When stimulated with abacterial LPS, the
luciferase activity increased in all cells in adose-dependent
manner, reaching 25-fold induction in DCsand 15-fold increase in
monocytes and macrophages for thehighest tested LPS dose.
The relative basal activity of the hypoxia-inducible pathwaywas
again the highest in the monocytic THP.R03F, reaching
Figure 3. Stable transfection of monocytic THP-1 with pB-based,
insulated NF-κB reporter vector pTR01F. (A) Schematicrepresentation
of the pathway reporter (See also Figure S4) transposon, insulated
as in construct H (Fig 1A). (B) FACS analysis ofGFP expression in
THP-1 (non-fluorescent control, red diagram), the transfect
THP.R01F freshly thawed from a cryopreservation(green), and
THP.R01F that was cultured continuously for 10 months without any
selection (blue). (C) Relative activity of NF-κBreporter in ‘fresh’
and ‘old’ THP.R01F batches in response to LPS treatment.doi:
10.1371/journal.pone.0085494.g003
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 5 December 2013 | Volume 8 | Issue 12
| e85494
-
13-fold difference with the minimally active
macrophages(MTHP.R03F, Figure 5B inset). Upon stimulation with
hypoxiamimics CoCl2 and o-phenanthroline, however, the
strongestresponse was detected in the macrophages, 24-fold
increase,and DCs (16-fold), also in a dose-dependent manner
(Figure5B). Interestingly, the NF-κB activator LPS has inhibited
thebasal HIF-1α activity in all cells.
The unstimulated THP.R05F monocytes showed
antioxidant/electrophile pathway activity that was similar to the
DCs’, whilethe MTHP.R05F macrophages demonstrated nearly
twofoldhigher level of the basal activity (Figure 5C inset). All
cellsresponded strongly to specific inducers of the
Nrf2-mediatedantioxidant/electrophile response element (ARE/EpRE)
activity,reaching 60 to 70-fold induction at the maximum. All
threestandard ARE/EpRE stimulators, a Michael addition
acceptortriterpenoid CDDO-Me, heavy metal cadmium, and redoxactive
tert-butyl hydroquinone (t-BHQ), showed cytotoxicity atelevated
doses. The cytotoxicity was cell type specific. Thus,the monocytes
were most affected by t-BHQ cytotoxicity butwere insensitive to
CDDO-Me; the macrophages were inhibitedby CDDO-Me only, while DCs
viability was affected by both thetriterpenoid and cadmium (Figure
5C).
We have also prepared stable pathway reporter lines basedon
TRAMP-C2 (abbreviated as TC2) and K562. These weretested in
presence of the NF-κB, HIF-1α, or Nrf2 activators, andthe results
are depicted in Figures S5-S8. All tested reporterlines displayed
strong responses to the specific stimulatingagents, whereby the
activation magnitudes were cell-specific.Thus, K562.R01F was
indifferent to LPS treatment, ascompared to its strong responses to
TNFα and IL-1β.TC2.R05F were much less sensitive to inducers of
ARE/EpREas compared to the THP-based Nrf2 reporter cell lines,
whileHIF-1α-activating potential of a powerful hypoxia mimic,
o-phenanthroline, was only marginal in THP.R03F.
Discussion
In this study, we employed piggyBac transposon-mediatedgene
transfer to successfully introduce functional signalingpathway
reporters into a monocytic line THP-1 and themonocyte-derived
macrophages and dendritic cells. Althoughtransposons have
previously been used for gene delivery intohematopoietic stem cells
and lymphocytes, this work deals withmonocyte-derived cells and
thus widens the scope of potential
Figure 4. Differentiation of THP.R01F monocytes does not
interrupt with the GFP reporter activity. Monocytic THP.R01F
(A)were transformed into macrophages (B) upon treatment with 100
ng/mL PMA for 3 days. Alternatively, treatment of the monocyteswith
100 ng/mL GM-CSF and 200 ng/mL IL-4 for 16 hours, followed by 20
ng/mL TNFα and 200 ng/mL ionomycin, produced maturedendritic cells
(C) within next two days. 96-Well assay plates were seeded with
2×104 THP.R0nF cells (n = 1, 3, or 5 for NF-κB,HIF-1α, or Nrf2
reporters, respectively) per well, six wells per cell line. The
cells were differentiated as above, lysed, and relativefluorescence
of the lysates was measured (D). The bars and error bars are
fluorescence means ± SD, n = 6; statistical analysis:one-way ANOVA,
with pairwise multiple comparisons by Holm-Sidak test. Statistical
significance *: compared to white bar; **:compared to dark grey
bar; in all cases, P
-
Figure 5. Differentiation of monocytic THP.R0nF pathway
reporters into macrophages or dendritic cells retains thereporter
activity. (A) Monocytes THP.R01F were differentiated into
macrophages (MTHP.R01F) and DCs (DTHP.R01F) and thentreated, in
triplicates, for 4 hours with LPS only or in presence of NF-κB
activation inhibitor PDTC. (B) THP.R03F, MTHP.R03F, andDTHP.R03F
cells were treated, in triplicates, for 16 hours with LPS or
hypoxia mimics CoCl2 and o-phenanthroline. (C) The ARE/EpRE
activity in THP.R05F, MTHP.R05F, and DTHP.R05F cells treated, in
triplicates, for 16 hours with inducers of Nrf2. The X’sindicate
treatments too toxic to cells and percentages of cell fluorescence
loss due to apoptosis/death. Fluorescence of lysates of alltreated
cells was used as a cell enumeration surrogate. The luciferase
activity induction folds for each cell type were normalized tothe
respective controls. The relative basal TF activities in the
untreated controls were normalized to the lowest value and are
shownin the insets. The bars and error bars are normalized
luminescence means ± SD, n = 3. Statistical analysis in the insets:
one-wayANOVA, with pairwise multiple comparisons by Holm-Sidak
test. Statistical significance #: compared to white bar; ##:
compared tolight grey bar; in all cases, P
-
applications for the transposon technology in immunologyrelated
areas. For example, stabilization of hypoxia-inducibletherapeutic
gene expression in tumor-infiltrating macrophagescould potentially
aid in development of cell-based antitumortherapies [15,32].
Another particular application for transposon-based, insulated
TF-reporters is generation of reporter DCs forhigh-throughput
assays that could become an important in vitroalternative for
environmental allergen assays, such as thosethat currently use
animals for skin or mucosa sensitization[7,33].
In addition to pB employed in this work, there are two
othertransposon systems currently being actively developed
aspotential candidates for therapeutic gene administration intothe
human genome: Sleeping Beauty, and Tol2. A fewpublications offer
comparisons of the three transposons head-to-head [34,35], but the
field is very dynamic and new, morepowerful, transposase
modifications are being rapidlydeveloped [36,37], thus quickly
outdating any comparativestudies. Although our results obtained
with pB may be wellachievable with the other “humanized”
transposons,establishing the relative transposon efficiency was not
criticallysignificant for the purpose of this work. More
importantly, wehave opted in favor of a transposon system over
virus-basedvectors following a failure of the lentivirus-mediated
genetransduction to provide for stable expression of a GFP
reporterin TRAMP-C2 (Figure S1B). In addition, viral particles have
arelatively low size cap on cargo DNA load, which is about 5 kbfor
the currently most popular adeno-associated virus (AAV),for
example. Transposons can operate with much larger DNAloads [21],
which suited our goal of developing double reporterconstructs with
the size of 6 kb, such as in pTR01F, and up.
Since incorporation of a transgene into a host genome doesnot
guarantee stable expression of the transgene per se, eventhough pB
insertions are biased towards actively transcribedloci [38], we
have tested an additional means of epigeneticstabilization for the
reporter expression in TRAMP-C2 cells.The barrier insulators, such
as the most commonly used HS4core sequence derived from the chicken
β-globin gene cluster,are able to resist heterochromatin spread and
subsequentsilencing of an adjoining DNA region [22]. Indeed,
acombination of two flanking HS4 core insulators in the
non-transposable construct D provided for better stability of
GFPexpression in TRAMP-C2, with loss of about one half of
highlyfluorescent population after 4 months, as compared to
thelacking cHS4 transposon pSE-transfected cells, which showeda
complete shift to decreased GFP expression within the sameperiod of
time (Figure 2). A combination of two HS4 insulatorsand pB in
pSH-transfected cells, on the other hand, providedfor a maximum in
both the stability and efficiency of GFPexpression, after the
continuous 4-month culturing.
In addition to tracking a transgene expression,
constitutiveproduction of GFP in the signaling pathway reporter
cells canbe useful for development of high-throughput assays,
sinceGFP fluorescence can be used as an internal surrogate
forrelative cell enumeration [39] done simultaneously withmeasuring
luciferase activity in cell lysates, thus enablingprotocols for 96-
or even 384-well plate formats. The copepodGFP employed in our
reporter constructs is well suited for such
assays, since it is “destabilized” and, unlike the EGFP
family,does not over-accumulate intracellularly and does not
affectimportant signaling pathways such as NF-κB [40]. Hence,
acombination of a signaling pathway reporter construct, such
asTRE-mCMV-luc, and a cell tracking reporter, such as cGFP,under
protection of insulators and transposon, should providefor
simplification and an extended utility of cell-based
screeningprotocols.
Indeed, the initial testing of the TF-reporting activities in
thereporter THP-derived cells proved the assay is easy to
set,relatively rapid and reproducible. The reporter cells
respondedstrongly and dose-dependently to specific inducers of
NF-κB,HIF-1α, or Nrf2 transcription factor activity. The
assay,therefore, allows for simultaneous assessment of
signalingpathway activity in monocytic cells and
monocyte-derivedmacrophages and DCs. Moreover, the availability of
stableTHP-based signaling pathway reporters may allow fordeveloping
assays employing other tissue specific phagocytes,such as microglia
or osteoclasts, since these cell types can bereadily prepared from
monocytic precursors in vitro [41,42].The equally successful
generation and testing of stablesignaling pathway reporters based
on TRAMP-C2 and K562cell lines indicates a broad, if not universal,
applicability of thetransposon plus insulators approach when
overcomingepigenetic transgene silencing is required.
Materials and Methods
Cell differentiation agents human GM-CSF and IL-4 werefrom
Shenandoah Biotech; PMA, ionomycin,lipopolysaccharide (E. coli
026-B6), cadmium acetate, cobaltchloride, nickel chloride,
oltipraz, tert-butylhydroquinone, o-phenanthroline were from
Sigma-Aldrich, human IL-1β andmurine TNFα were purchased from
PeproTech, while CDDO-Me was a gift from TransTech Pharma.
Cell cultureTRAMP-C2, K562, and THP-1 cell lines have been
purchased from the American Type Culture Collection. Theoriginal
TRAMP-C2 and K562 cells, as well as the TRAMP-C2and K562-based
reporter transfects, have been routinelycultured in RPMI-1640
medium (Sigma) supplemented with 5%fetal bovine serum (Gibco) and
1% (v/v) penicillin/streptomycincocktail (CellGro). The cells were
subcultured 1:10 uponreaching near confluency or when detached.
THP-1 and allrelated transfects were cultured in the
RPMI-1640supplemented with 10% heat-inactivated FBS
(HyClone),additional 2 g/L glucose, 1 mM sodium pyruvate, 10
mMHEPES (both from Sigma), and 1% penicillin/streptomycin. Thecell
density was maintained between 1×105 and 1×106 cell/ mL.The
standard culturing conditions for all cells were 37°C, 5%CO2, and
100% humidity.
Plasmid constructsSuper piggyBac transposase expression vector
and
pB513B-1 transposon vector were purchased from SystemBiosciences
(Mountain View, CA).
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 8 December 2013 | Volume 8 | Issue 12
| e85494
-
pSB: Plasmid pB513B-1 was digested with SwaI/EcoRVrestriction
enzymes, and the smaller fragment was inserted intopSmart_HCKan
(Lucigen, Middleton, WI) using the CloneSmartreaction.
pSF: The pB ITRs were obtained by PCR of pB513B-1 withthe
following primer sets. For
3’ITR:TCGTTAAATCGGATCGAACACGCAGCTAGATTAAC
andTTGCGGCCGCGGATCCGATCTCGATATACAGACCGATAA.For 5’ITR
:CAATACTGACCATTTAAATCGCTATTTAGAAAGAGAGAGand
GGTCAGGTATGATTTACAGCTATGACCATGATTAC.Then pSB was digested with
BamHI/ SwaI and both piecesisolated. These four fragments were
assembled into pSF in aone-step In-Fusion reaction according to the
manufacturer’s(Clontech) protocol.
pSA and pSE: The 5’HS4 insulator was excised from pSBand pSF
with BstXI/ XbaI, and the gap was In-Fusion-patchedwith a PCR
product of pB513B-1 and the following
primers:TTTTTTAGGGCCCATGTAATACGGTTATCCACAGA
andTTGAGCGATATCTAGACTGGTATCTTTATAGTCCTGTC.
pSC, pSD, pSG, and pSH: The 3’HS4 insulator was obtainedby PCR
of pB513B-1 with the following
primers:ATCGGATCCGCGGCCGGTCTGTATATCGAGGTTTA
andCAGATCCTTGCGGCCGCCATAATACTAGTAGGCCTTGG. Itwas brought into the
In-Fusion reaction with NotI digests ofpSA, pSB, pSE, and pSF,
respectively.
pTR01F: The NF-κB pathway reporter sequence (Figure S4)has been
amplified from pGL4.32 (Clontech) using the
primers:TGGCAGTACATCTACGTAAACTAGCAAAATAGGCTGTCand
CCGCGGATCCGATTTAGAAGGTAGCTAACCAAGTT.Next, P513B-1 was digested with
SnaBI/ SwaI. The larger DNAfragment was then brought into the
In-Fusion reaction with thereporter PCR product.
pTR03F: Two inserts containing 15-bp overhang sequencesfor the
In-Fusion reaction and total 8 hypoxia responseelements (Figures S4
and S9) were synthesized and annealed.The inserts and a product of
pTR01F digestion with NheI/ BglIIwere assembled into pTR03F in one
step following the In-Fusion protocol.
pTR05F: In a similar manner, two inserts containing the 15-bp
overhang sequences and total 8 antioxidant/electrophileresponse
elements (Figures S4 and S9) were synthesized andannealed. The
inserts and the above pTR01F digest wereassembled into pTR05F in
one step using the In-Fusionreaction.
All constructs were confirmed by DNA sequence analysis.
TransfectionsTRAMP-C2 and K562 were seeded into wells of a
96-well
plate, at 1×104 cells per well in antibiotic-free
RPMI-1640supplemented with 5% FBS and left to adhere for 6 hours.
Thecells were then treated with 100 ng of reporter
plasmidconstructs complexed with TransIT Prostate reagent (Mirus)
at1:2 (μg/ μL) ratio, without the Boost reagent. See Table S1
fortransfection efficiencies with this and other
transfectionreagents. In most cases, 33 ng Super pB transposase
vectorwas co-transfected along with pB transposon plasmids. After16
h, the regular media were added and the cells were left to
proliferate for next 48 h. The transfected cells were
thentreated with a selecting antibiotic (100 μg/ mL G418 or 5 μg/mL
puromycin) for another week, and the surviving cells wereexpanded
for cryopreservation and flow cytometryexperiments.
Suspensions of 2×105 THP-1 cells in 300 μL
RPMI-1640,supplemented with 5% heat-inactivated FBS, were
co-treatedwith 66 ng Super pB transposase plasmid and 200 ng of
pBtransposon reporter vectors complexed with GeneInTransfection
reagent set (Global Stem) at 1:8 (μg/ μL) ratio.After 16 h, the
regular media were added and the cells wereleft to proliferate for
next 48 h. Typical percentage offluorescent cells at this point
was, depending on the vectorsize, from 0.5 to 5%; see Table S1 for
transfection efficiencieswith this and other transfection reagents.
The transfected cellswere then treated with 5 μg/ mL puromycin for
another week,and the surviving cells were expanded and frozen
away.
Tranductions of TRAMP-C2 with Lenti GFP Control (Qiagen),at
1×105 TU per well containing 1×104 cells, were carried outaccording
to the manufacturer’s protocol.
THP-1 DifferentiationInto macrophages. Suspensions of the
original THP-1 or
the reporter lines in the differentiation serum-free
mediumCellGro Complete (Mediatech/ Corning) have been seeded
at2×104 cells/well in 96-well plates. The cells were then
treatedwith 10 ng PMA/well for 3 days, when all cells
becameadherent and assumed the macrophage morphology.
Thetransformed cells were washed and kept in the RPMI-1640 (5%FBS,
pen/strep) for a day, before any assays.
Into dendritic cells. The cells were seeded as above,
usingserum-free OptiMEM I (Gibco/ Life Technologies) as
adifferentiation medium and then treated with 10 ng GM-CSFand 20 ng
IL-4 per well for 16 hours, followed by 2 ng TNFαand 20 ng
ionomycin per well [31]. After 2 days, when most ofadherent cells
acquired DC appearance, the differentiated cellshave been washed
and kept in RPMI-1640 (5% FBS, pen/strep) containing reduced
amounts of GM-CSF and IL-4 (2 and4 ng per well, respectively),
before any assays.
Reporter activity assayIn a typical experiment, naïve or
differentiated THP reporters
seeded in 96-well plates were treated with sensitizers in 100
μLof serum-free CellGro Complete medium (Corning) for specifictimes
in the standard cell culturing conditions (37°C, 5% CO2,100%
humidity). TRAMP-C2 and K562-derived reporters wereseeded at 1×104
or 2×104 cells/well, respectively, in theculturing medium two days
prior treatments. The assaymedium was the complete RPMI-1640 less
Phenol Redindicator. After the treatments, the reporter cells were
washedand lysed in 60 μL of the Luciferase reporter lysing
buffer(Promega). The lysates fluorescence was measured at
the482(9)/512(17) nm wavelength(width) setup, followed byaddition
of the luciferase substrate (Promega) and kineticluminescence
measurements in the wells, with 2-minuteintervals, for 30 minutes
total. All the measurements were doneusing a Synergy MX (BioTek)
plate reader. The GFPfluorescence values were used for both
evaluation of relative
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 9 December 2013 | Volume 8 | Issue 12
| e85494
-
cell proliferation and normalization of the reporter
luciferaseactivities in respective wells.
Flow CytometryAll experiments were done using a Beckman Coulter
MoFlo
XDP instrument. Normally, the instrument was calibrated withthe
Sphero Rainbow Beads (BD Biosciences). Analysis of theFACS data was
performed with help of Summit 5.2 softwarepackage.
Statistical AnalysisStatistical tests and plots were done using
SigmaPlot
software, version 11.0.
Supporting Information
Figure S1. Conventional transfections or viraltransduction fail
to provide stable expression of GFP inTRAMP-C2 cells. TRAMP-C2 were
A) transfected with acontrol pEGFP-C1 plasmid, B) transduced with
CignalLentiGFP, or C) co-transfected with PB513B-1 and pBase.
Thecells then went through several rounds of fluorescenceactivated
cell sorting in two-week intervals, by selecting 5% ofthe brightest
(R4 cut on the histograms) cells for furtherproliferation. The
respective fluorescence histograms arepositioned in the columns and
the sort rounds – in rows, fromtop to bottom. The cytometer
settings were not uniformlycalibrated on different days in this
experiment. Thefluorescence profiles of transfected/transduced
TRAMP-C2cells are shown in solid blue, while auto-fluorescence
profilesof non-transfected cells are overlayed as contour
lines.(EPS)
Figure S2. A representative view of the fluorescence“mosaic”
distribution in FAC-sorted (6 rounds) DU145 cellstransfected with a
control GFP plasmid.(EPS)
Figure S3. pB-based, insulated reporters are stablyexpressed in
K562 line. K562 cells were co-transfected withpB transposase and
pSA, pSD, or pSH reporter plasmids. Thetransfects went through
several rounds of FAC sorting, until themaximum fluorescence has
been achieved (the upperhistogram in each pair). The sorted cells
were then let toproliferate without any selection and were
subcultured twice aweek. The lower histogram in each pair
represents FACSanalysis of the cells at the end of the 3-month
term. The FACSinstrument settings were uniformly calibrated against
SpheroRainbow Beads. Median fluorescence intensities werenormalized
for the non-transfected control K562 cellautofluorescence.(EPS)
Figure S4. Schematic representation of the pathwayreporter
constructs , which are flanked by pB and cHS4sequences as in H
(Figure 1). The transcription responseelement, minimal CMV
promoter, and firefly luciferase
encoding sequences were inserted into p513B-1, resulting
inpTR01F, pTR03F, and pTR05F plasmids. Sequences of TREsfor HIF-1α
and Nrf2 are given with essential nucleotidescapitalized. TREs for
NF-κB were cloned from pGL4.32.(EPS)
Figure S5. NF-κB reporter activity in TC2.R01F. The cellswere
treated with proinflammatory agents, in triplicates, for 6hours,
then lysed. A. Fluorescence in the lysates wasnormalized against
the control. B. Luciferase activities in thelysates were normalized
against the respective fluorescencevalues and then against the
control. The bars and error barsare normalized fluorescence or
luminescence means ± SD, n =3; statistical analysis: pairwise
comparisons by an unpaired t-test. Statistical significance *: the
lowest dose treatmentcompared to control; in all cases, P
-
(EPS)
Table S1. Efficiencies (%) of transient transfections of thecell
lines after 48 hours.(DOCX)
Acknowledgements
The authors thank Daniel Jackson (University of Missouri)
fortechnical assistance with flow cytometry experiments.
Author Contributions
Conceived and designed the experiments: VVM JKW TPM.Performed
the experiments: VVM JKW. Analyzed the data:VVM MH TPM. Contributed
reagents/materials/analysis tools:MH. Wrote the manuscript:
VVM.
References
1. Naylor LH (1999) Reporter gene technology: the future looks
bright.Biochem Pharmacol 58: 749-757.
doi:10.1016/S0006-2952(99)00096-9. PubMed: 10449183.
2. Michelini E, Cevenini L, Mezzanotte L, Coppa A, Roda A (2010)
Cell-based assays: fuelling drug discovery. Anal Bioanal Chem
398:227-238. doi:10.1007/s00216-010-3933-z. PubMed: 20623273.
3. Maggi A, Ciana P (2005) Innovation: Reporter mice and drug
discoveryand development. Nat Rev Drug Discovery 4: 249-255.
doi:10.1038/nrd1661.
4. Yagi K (2007) Applications of whole-cell bacterial sensors
inbiotechnology and environmental science. Appl Microbiol
Biotechnol73: 1251-1258. doi:10.1007/s00253-006-0718-6. PubMed:
17111136.
5. Emter R, Ellis G, Natsch A (2010) Performance of a novel
keratinocyte-based reporter cell line to screen skin sensitizers in
vitro. Toxicol ApplPharmacol 245: 281-290.
doi:10.1016/j.taap.2010.03.009. PubMed:20307559.
6. Vandebriel RJ, Hoefnagel MHN (2012) Dendritic cell-based in
vitroassays for vaccine immunogenicity. Hum Vaccines - Journal
ofImmunother 8: 1323-1325. doi:10.4161/hv.21350. PubMed:
22951585.
7. Kimber I, Dearman RJ, Basketter DA (2013) Dendritic cells and
theassessment in vitro of skin sensitizing potential. Cutan Ocul
Toxicol 32:54-59. doi:10.3109/15569527.2012.692135. PubMed:
22668204.
8. Hansel TT, Johnston SL, Openshaw PJ (2013) Microbes and
mucosalimmune responses in asthma. Lancet 381: 861-873.
doi:10.1016/S0140-6736(12)62202-8. PubMed: 23428115.
9. Kau AL, Ahern PP, Griffin NW, Goodman AL, Gordon JI (2011)
Humannutrition, the gut microbiome and the immune system. Nature
474:327-336. doi:10.1038/nature10213. PubMed: 21677749.
10. Conti L, Gessani S (2008) GM-CSF in the generation of
dendritic cellsfrom human blood monocyte precursors: recent
advances.Immunobiology 213: 859-870.
doi:10.1016/j.imbio.2008.07.017.PubMed: 18926300.
11. Lindemann C, Schilz AJ, Emons B, Baum C, Löw R et al. (2002)
Down-regulation of retroviral transgene expression during
differentiation ofprogenitor-derived dendritic cells. Exp Hematol
30: 150-157. doi:10.1016/S0301-472X(01)00778-0. PubMed:
11823050.
12. Auwerx J (1991) The human leukemia cell line, THP-1: a
multifacettedmodel for the study of monocyte-macrophage
differentiation.Experientia 47: 22-31. doi:10.1007/BF02041244.
PubMed: 1999239.
13. Qin Z (2012) The use of THP-1 cells as a model for mimicking
thefunction and regulation of monocytes and macrophages in
thevasculature. Atherosclerosis 221: 2-11.
doi:10.1016/j.atherosclerosis.2011.09.003. PubMed: 21978918.
14. Ade N, Leon F, Pallardy M, Peiffer J-L, Kerdine-Romer S et
al. (2009)HMOX1 and NQO1 genes are upregulated in response to
contactsensitizers in dendritic cells and THP-1 cell line: role of
the Keap1/Nrf2pathway. Toxicol Sci 107: 451-460. PubMed:
19033392.
15. Burke B, Sumner S, Maitland N, Lewis CE (2002) Macrophages
ingene therapy: cellular delivery vehicles and in vivo targets. J
LeukocBiol 72: 417-428. PubMed: 12223508.
16. Li Z, Michael IP, Zhou D, Nagy A, Rini JM (2013) Simple
piggyBactransposon-based mammalian cell expression system for
inducibleprotein production. Proc Natl Acad Sci U S A 110:
5004-5009. doi:10.1073/pnas.1218620110. PubMed: 23476064.
17. Maston GA, Evans SK, Green MR (2006) Transcriptional
regulatoryelements in the human genome. Annu Rev Genomics Hum Genet
7:29-59. doi:10.1146/annurev.genom.7.080505.115623.
PubMed:16719718.
18. Recillas-Targa F (2006) Multiple strategies for gene
transfer,expression, knockdown, and chromatin influence in
mammalian cell
lines and transgenic animals. Mol Biotechnol 34: 337-354.
doi:10.1385/MB:34:3:337. PubMed: 17284781.
19. Atkinson H, Chalmers R (2010) Delivering the goods: viral
and non-viralgene therapy systems and the inherent limits on cargo
DNA andinternal sequences. Genetica 138: 485-498.
doi:10.1007/s10709-009-9434-3. PubMed: 20084428.
20. Di Matteo M, Mátrai J, Belay E, Firdissa T, VandenDriessche
T et al.(2012) PiggyBac toolbox. Methods Mol Biol 859: 241-254.
doi:10.1007/978-1-61779-603-6_14. PubMed: 22367876.
21. Li R, Zhuang Y, Han M, Xu T, Wu X (2013) piggyBac as a
high-capacity transgenesis and gene-therapy vector in human cells
andmice. Dis Models. Journal of Mech 6: 828-833.
22. Emery DW (2011) The use of chromatin insulators to improve
theexpression and safety of integrating gene transfer vectors. Hum
GeneTher 22: 761-774. doi:10.1089/hum.2010.233. PubMed:
21247248.
23. Ramezani A, Hawley RG (2010) Strategies to insulate
lentiviral vector-expressed transgenes. Methods Mol Biol 614:
77-100. doi:10.1007/978-1-60761-533-0_5. PubMed: 20225037.
24. Holm CK, Paludan SR, Fitzgerald KA (2013) DNA recognition
inimmunity and disease. Curr Opin Immunol 25: 13-18.
doi:10.1016/j.coi.2012.12.006. PubMed: 23313533.
25. Schnoor M, Buers I, Sietmann A, Brodde MF, Hofnagel O et al.
(2009)Efficient non-viral transfection of THP-1 cells. J Immunol
Methods 344:109-115. doi:10.1016/j.jim.2009.03.014. PubMed:
19345690.
26. Foster BA, Gingrich JR, Kwon ED, Madias C, Greenberg NM
(1997)Characterization of prostatic epithelial cell lines derived
from transgenicadenocarcinoma of the mouse prostate (TRAMP) model.
Cancer Res57: 3325-3330. PubMed: 9269988.
27. Jeet V, Ow K, Doherty E, Curley B, Russell PJ et al. (2008)
Broadeningof transgenic adenocarcinoma of the mouse prostate
(TRAMP) modelto represent late stage androgen depletion independent
cancer.Prostate 68: 548-562. doi:10.1002/pros.20714. PubMed:
18247402.
28. McCabe MT, Low JA, Daignault S, Imperiale MJ, Wojno KJ et
al.(2006) Inhibition of DNA methyltransferase activity
preventstumorigenesis in a mouse model of prostate cancer. Cancer
Res 66:385-392. doi:10.1158/0008-5472.CAN-05-2020. PubMed:
16397253.
29. Camoriano M, Morey Kinney SR, Moser MT, Foster BA, Mohler JL
etal. (2008) Phenotype-specific CpG island methylation events in
amurine model of prostate cancer. Cancer Res 68: 4173-4182.
doi:10.1158/0008-5472.CAN-07-6715. PubMed: 18519676.
30. Migliaccio AR, Bengra C, Ling J, Pi W, Li C et al. (2000)
Stable andunstable transgene integration sites in the human genome:
extinction ofthe Green Fluorescent Protein transgene in K562 cells.
Gene 256:197-214. doi:10.1016/S0378-1119(00)00353-X. PubMed:
11054549.
31. Berges C, Naujokat C, Tinapp S, Wieczorek H, Höh A et al.
(2005) Acell line model for the differentiation of human dendritic
cells. BiochemBiophys Res Commun 333: 896-907.
doi:10.1016/j.bbrc.2005.05.171.PubMed: 15963458.
32. Owen MR, Stamper IJ, Muthana M, Richardson GW, Dobson J et
al.(2011) Mathematical modeling predicts synergistic antitumor
effects ofcombining a macrophage-based, hypoxia-targeted gene
therapy withchemotherapy. Cancer Res 71: 2826-2837.
doi:10.1158/1538-7445.AM2011-2826. PubMed: 21363914.
33. Corsini E, Aeby P, Python F, Nelissen I, Kjaer T et al.
(2011) The useof myeloid cell lines for the identification of
allergens. In: EL RoggenH-U WeltzienH Hermans. Prog Novel Test
Strategies In Vitro AssessAllergens. Trivandrum, India: Transworld
Research Network. pp.103-116.
34. Meir Y-JJ, Wu SC-Y (2011) Transposon-based vector systems
for genetherapy clinical trials: challenges and considerations.
Chang Gung MedJ 34: 565-579. PubMed: 22196059.
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 11 December 2013 | Volume 8 | Issue
12 | e85494
http://dx.doi.org/10.1016/S0006-2952(99)00096-9http://dx.doi.org/10.1016/S0006-2952(99)00096-9http://www.ncbi.nlm.nih.gov/pubmed/10449183http://dx.doi.org/10.1007/s00216-010-3933-zhttp://www.ncbi.nlm.nih.gov/pubmed/20623273http://dx.doi.org/10.1038/nrd1661http://dx.doi.org/10.1038/nrd1661http://dx.doi.org/10.1007/s00253-006-0718-6http://www.ncbi.nlm.nih.gov/pubmed/17111136http://dx.doi.org/10.1016/j.taap.2010.03.009http://www.ncbi.nlm.nih.gov/pubmed/20307559http://dx.doi.org/10.4161/hv.21350http://www.ncbi.nlm.nih.gov/pubmed/22951585http://dx.doi.org/10.3109/15569527.2012.692135http://www.ncbi.nlm.nih.gov/pubmed/22668204http://dx.doi.org/10.1016/S0140-6736(12)62202-8http://dx.doi.org/10.1016/S0140-6736(12)62202-8http://www.ncbi.nlm.nih.gov/pubmed/23428115http://dx.doi.org/10.1038/nature10213http://www.ncbi.nlm.nih.gov/pubmed/21677749http://dx.doi.org/10.1016/j.imbio.2008.07.017http://www.ncbi.nlm.nih.gov/pubmed/18926300http://dx.doi.org/10.1016/S0301-472X(01)00778-0http://www.ncbi.nlm.nih.gov/pubmed/11823050http://dx.doi.org/10.1007/BF02041244http://www.ncbi.nlm.nih.gov/pubmed/1999239http://dx.doi.org/10.1016/j.atherosclerosis.2011.09.003http://dx.doi.org/10.1016/j.atherosclerosis.2011.09.003http://www.ncbi.nlm.nih.gov/pubmed/21978918http://www.ncbi.nlm.nih.gov/pubmed/19033392http://www.ncbi.nlm.nih.gov/pubmed/12223508http://dx.doi.org/10.1073/pnas.1218620110http://www.ncbi.nlm.nih.gov/pubmed/23476064http://dx.doi.org/10.1146/annurev.genom.7.080505.115623http://www.ncbi.nlm.nih.gov/pubmed/16719718http://dx.doi.org/10.1385/MB:34:3:337http://www.ncbi.nlm.nih.gov/pubmed/17284781http://dx.doi.org/10.1007/s10709-009-9434-3http://dx.doi.org/10.1007/s10709-009-9434-3http://www.ncbi.nlm.nih.gov/pubmed/20084428http://dx.doi.org/10.1007/978-1-61779-603-6_14http://www.ncbi.nlm.nih.gov/pubmed/22367876http://dx.doi.org/10.1089/hum.2010.233http://www.ncbi.nlm.nih.gov/pubmed/21247248http://dx.doi.org/10.1007/978-1-60761-533-0_5http://www.ncbi.nlm.nih.gov/pubmed/20225037http://dx.doi.org/10.1016/j.coi.2012.12.006http://dx.doi.org/10.1016/j.coi.2012.12.006http://www.ncbi.nlm.nih.gov/pubmed/23313533http://dx.doi.org/10.1016/j.jim.2009.03.014http://www.ncbi.nlm.nih.gov/pubmed/19345690http://www.ncbi.nlm.nih.gov/pubmed/9269988http://dx.doi.org/10.1002/pros.20714http://www.ncbi.nlm.nih.gov/pubmed/18247402http://dx.doi.org/10.1158/0008-5472.CAN-05-2020http://www.ncbi.nlm.nih.gov/pubmed/16397253http://dx.doi.org/10.1158/0008-5472.CAN-07-6715http://www.ncbi.nlm.nih.gov/pubmed/18519676http://dx.doi.org/10.1016/S0378-1119(00)00353-Xhttp://www.ncbi.nlm.nih.gov/pubmed/11054549http://dx.doi.org/10.1016/j.bbrc.2005.05.171http://www.ncbi.nlm.nih.gov/pubmed/15963458http://dx.doi.org/10.1158/1538-7445.AM2011-2826http://www.ncbi.nlm.nih.gov/pubmed/21363914http://www.ncbi.nlm.nih.gov/pubmed/22196059
-
35. Grabundzija I, Irgang M, Mátés L, Belay E, Matrai J et al.
(2010)Comparative analysis of transposable element vector systems
inhuman cells. Mol Ther 18: 1200-1209.
doi:10.1038/mt.2010.47.PubMed: 20372108.
36. Li X, Burnight Erin R, Cooney Ashley L, Malani N, Brady T et
al. (2013)piggyBac transposase tools for genome engineering. Proc
Natl AcadSci U S A 110: E2279-E2287. doi:10.1073/pnas.1305987110.
PubMed:23723351.
37. Voigt K, Gogol-Döring A, Miskey C, Chen W, Cathomen T et al.
(2012)Retargeting Sleeping Beauty transposon insertions by
engineered zincfinger DNA-binding domains. Mol Ther 20: 1852-1862.
doi:10.1038/mt.2012.126. PubMed: 22776959.
38. Liang Q, Kong J, Stalker J, Bradley A (2009)
Chromosomalmobilization and reintegration of Sleeping Beauty and
PiggyBac
transposons. Genesis 47: 404-408. doi:10.1002/dvg.20508.
PubMed:19391106.
39. Bradburne C, Robertson K, Thach D (2009) Assessment of
methodsand analysis of outcomes for comprehensive optimization
ofnucleofection. Genet Vaccines Ther 7: 6.
doi:10.1186/1479-0556-7-6.PubMed: 19432988.
40. Baens M, Noels H, Broeckx V, Hagens S, Fevery S et al.
(2006) Thedark side of EGFP: defective polyubiquitination. PLOS ONE
1: e54. doi:10.1371/journal.pone.0000054. PubMed: 17183684.
41. Leone C, Le Pavec G, Même W, Porcheray F, Samah B et al.
(2006)Characterization of human monocyte-derived microglia-like
cells. Glia54: 183-192. doi:10.1002/glia.20372. PubMed:
16807899.
42. Takahashi N, Udagawa N, Kobayashi Y, Suda T (2007)
Generation ofosteoclasts in vitro, and assay of osteoclast
activity. Methods Mol Med135: 285-301.
doi:10.1007/978-1-59745-401-8_18. PubMed:17951666.
Stable Transposon Based Pathway Reporters
PLOS ONE | www.plosone.org 12 December 2013 | Volume 8 | Issue
12 | e85494
http://dx.doi.org/10.1038/mt.2010.47http://www.ncbi.nlm.nih.gov/pubmed/20372108http://dx.doi.org/10.1073/pnas.1305987110http://www.ncbi.nlm.nih.gov/pubmed/23723351http://dx.doi.org/10.1038/mt.2012.126http://dx.doi.org/10.1038/mt.2012.126http://www.ncbi.nlm.nih.gov/pubmed/22776959http://dx.doi.org/10.1002/dvg.20508http://www.ncbi.nlm.nih.gov/pubmed/19391106http://dx.doi.org/10.1186/1479-0556-7-6http://www.ncbi.nlm.nih.gov/pubmed/19432988http://dx.doi.org/10.1371/journal.pone.0000054http://www.ncbi.nlm.nih.gov/pubmed/17183684http://dx.doi.org/10.1002/glia.20372http://www.ncbi.nlm.nih.gov/pubmed/16807899http://dx.doi.org/10.1007/978-1-59745-401-8_18http://www.ncbi.nlm.nih.gov/pubmed/17951666
piggyBac Transposon plus Insulators Overcome Epigenetic
Silencing to Provide for Stable Signaling Pathway Reporter Cell
LinesIntroductionResultsFlanking a GFP gene with insulators and pB
ITRs overcomes the transgene silencing in TRAMP-C2 and K562
cellsExpression of TRE-luciferase-GFP reporter constructs is stable
in monocytic THP-1Differentiation of the monocyte reporters into
mature macrophages and dendritic cells retains the reporter
activities
DiscussionMaterials and MethodsCell culturePlasmid
constructsTransfectionsTHP-1 DifferentiationReporter activity
assayFlow CytometryStatistical Analysis
Supporting InformationAcknowledgementsAuthor
ContributionsReferences