Oxidative stress activates the c-Abl/p73 proapoptotic pathway in Niemann-Pick type C neurons

Neurobiology of Disease 41 (2011) 209ndash218

Contents lists available at ScienceDirect

Neurobiology of Disease

j ourna l homepage wwwe lsev ie rcom locate ynbd i

Oxidative stress activates the c-Ablp73 proapoptotic pathway in Niemann-Pick typeC neurons

Andres Klein a Carola Maldonado a Lina M Vargas b Marcela Gonzalez a Fermiacuten Robledo aKaren Perez de Arce b Francisco J Muntildeoz c Claudio Hetz de Alejandra R Alvarez b Silvana Zanlungo aa Departamento de Gastroenterologiacutea Facultad de Medicina Pontificia Universidad Catoacutelica de Chile Santiago Chileb Departamento de Biologiacutea Celular y Molecular Facultad de Ciencias Bioloacutegicas Pontificia Universidad Catoacutelica de Chile Santiago Chilec Grup de Fisiologia Molecular i Canalopaties Department of Experimental and Health Sciences Universitat Pompeu Fabra Barcelona Spaind Institute of Biomedical Sciences FONDAP Center for Molecular Studies of the Cell University of Chile Santiago Chilee Department of Immunology and Infectious Diseases Harvard School of Public Health Boston MA USA

Corresponding authors AR Alvarez is to be contBioloacutegicas Pontificia Universidad Catoacutelica de ChileSantiago Chile Fax +56 2 6862959 S Zanlungo FaUniversidad Catoacutelica de Chile Marcoleta 367 Casilla 1146397780

E-mail addresses aalvarezbiopuccl (AR Alvarez)(S Zanlungo)

Available online on ScienceDirect (wwwscienced

0969-9961$ ndash see front matter copy 2010 Elsevier Inc Aldoi101016jnbd201009008

a b s t r a c t

a r t i c l e i n f o

Article historyReceived 30 October 2009Revised 11 September 2010Accepted 19 September 2010Available online 29 September 2010

KeywordsNiemann-Pick type Cc-Ablp73Oxidative stressApoptosisNeurodegeneration

Niemann-Pick type C (NPC) is a neurodegenerative disease characterized by the intralysosomal accumulationof cholesterol leading to neuronal apoptosis We have previously reported the activation of the c-Ablp73proapoptotic pathway in the cerebellum of NPC mice however upstream signals underlying the engagementof this pathway remain unknown Here we investigate the possible role of oxidative stress in the activation ofc-Ablp73 using different in vitro and in vivo NPC models Our results indicate a close temporal correlationbetween the appearance of nitrotyrosine (N-Tyr a post-translational tyrosine modification caused byoxidative stress) and the activation of c-Ablp73 in NPC models To test the functional role of oxidative stressin NPC we have treated NPC neurons with the antioxidant NAC and observed a dramatic decrease of c-Ablp73 activation and a reduction in the levels of apoptosis in NPC models In conclusion our data suggest thatoxidative stress is the main upstream stimulus activating the c-Ablp73 pathway and neuronal apoptosis inNPC neurons

acted at Facultad de CienciasAlameda 340 Casilla 114-Dcultad de Medicina Pontificia-D Santiago Chile Fax +56 2

silvanamedpuccl

irectcom)

l rights reserved

copy 2010 Elsevier Inc All rights reserved

Introduction

Niemann-Pick type C (NPC) disease is a fatal pediatric neurode-generative lysosomal storage disorder (Pentchev et al 1995) causedby mutations in the NPC1 or NPC2 genes (Carstea et al 1997Naureckiene et al 2000) NPC cells exhibit aberrant organelletrafficking (Ko et al 2001) and accumulate large amounts of freecholesterol within lysosomes (Liscum et al 1989) Patients affectedwith NPC disease exhibit rapid and progressive neuronal loss mainlyof cerebellar Purkinje neurons (Walkley and Suzuki 2004)

Apoptosis plays a critical role in NPC neuronal cell death Thecortex and cerebellum of NPC mouse and human neurons exhibitclassical signs of apoptosis and are TUNEL (TdT-mediated dUTP nickend labeling)-positive (Wu et al 2005 Alvarez et al 2008)Consistently primary cultured neurons treated with U18666Awhich mimics the NPC phenotype show activation of caspase-3 and

apoptosis (Koh et al 2007) Unlikely the molecular mechanismunderlying the engagement of the apoptosis program in NPC remainsunclear (Alvarez et al 2008)

The p73 transcription factor which is a homologue of p53 is anessential regulator of apoptosis in neurons (Jacobs et al 2004)Phosphorylation by c-Abl kinase is the main upstream mechanismthat regulates p73 protein levels by stabilization (Tsai and Yuan2003) c-Abl activation is induced by several types of proapoptoticstimuli including changes in calcium homeostasis DNA damageendoplasmic reticulum (ER) and oxidative stress (Ito et al 2001Alvarez et al 2004 Zhu and Wang 2004 Wang 2005)

Interestingly the c-Ablp73 pathway is also activated in thehippocampus of Alzheimers patients and murine models (Jing et al2009 Cancino et al 2008) a well-known neurodegenerative diseaseinvolving oxidative stress (Guix et al 2009) Oxidative stress has beenshown in NPC mice brain (Smith et al 2009) and different NPCcellular models (Koh et al 2006 Zampieri et al 2009) however itsfunctional relevance to the disease process has not yet beenestablished In the present study we investigated the possible roleof oxidative stress in the activation of the c-Ablp73 pathway usingcomplementary NPC models including rat hippocampal neuronsexposed to U18666A primary hippocampal neurons derived fromNpc1minusminus mice knockdown Npc1 experiments and histologicalanalysis of NPC mouse cerebellum Our results digest a critical role

210 A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

of oxidative stress in the activation of the c-Ablp73 pathway andapoptosis in NPC

Materials and methods

Animals

SpraguendashDawley rats were obtained from the animal facility of ourBiological Science Faculty BALBc mice carrying a heterozygousmutation in theNPC1 genewere kindly donated by Dr Peter PentchevGenotypes were identified using a PCR-based screening as describedpreviously (Amigo et al 2002) The animal protocols were approvedby the Animal Studies Review Board at our institution

Primary rat and mice hippocampal neurons

Hippocampi from SpraguendashDawley rats and NPC mice at embry-onic day 18 were dissected and primary hippocampal cultures wereprepared as described by Alvarez et al (2004) Hippocampal cellswere seeded in polylysine-coated wells andmaintained in Neurobasalmedium supplemented with B27 (Invitrogen Carlsbad CA USA) plusantibiotics (100 Uml penicillin and 100 mgml streptomycin) for5 days before the cell treatments Glial proliferation was inhibited byadding 2 μM cytosine arabinoside on the third day

U18666A imatinib and N-acetylcysteine (NAC) treatments

Cultured rat hippocampal cellswere treatedwithU18666Aat 1 μgmlfor short periods (less than 24 h) or at 05 μgml for longer treatments(24ndash48 h) plus 10 μM imatinib or 100 μM NAC In some experimentscells were treated with 100 μM H2O2 for 1 h or 90 mM H2O2 for 3 min

Stable Npc1 knockdown in the neuroblastoma (N2a) cell line

We generated stable N2a cell lines with reduced levels of NPC1using methods previously described (Hetz et al 2007) by targetingthe Npc1 mRNA with shRNA using the lentiviral expression vectorpLKO1 and puromycin selection As control an shRNA againstluciferase was employed Constructs were generated by The BroadInstitute (Boston USA) based on different criteria for shRNA design(see httpwwwbroadmitedugenome_biotrcrnaihtml) Wescreened a total of five different constructs for NPC1 and selectedthe most efficient one for further studies Targeting sequencesidentified for mouse Npc1 mRNA is CCCGTCTTACTCAGTTACATA

Immunofluorescence

Cell cultures were fixed in 4 paraformaldehyde for 30 min andcerebellar sections were fixed as described by Alvarez et al (2008)and incubated overnight with the following rabbit polyclonalantibodies anti-p73 (H-79 125) (Santa Cruz Biotech Santa CruzCA USA) anti-c-Abl (K12 1100) (Santa Cruz Biotech) anti-nitrotyrosine (N-Tyr) (NITT12-A 1100) (Alpha Diagnostic SanAntonio TX USA) anti-NPC1 (150) (donated by Dr William GarverUniversity of Arizona Arizona AZ USA) and anti-active caspase-3(1100) (Chemicon International Temecula CA USA) and the mousemonoclonal antibodies anti-TAp73 (IMG-246 1100) (Imgenex SanDiego CA USA) anti-c-Abl (24-11 1100) (Santa Cruz Biotech) anti-tubulin (T5168 11000) (Sigma St Louis MO USA) or anti-N-Tyr(ab7048 1100) (Abcam Cambridge UK) Secondary antibodies anti-mouse or rabbit IgG conjugated with Alexa Fluor-488 or Alexa Fluor-594 were used at a 11000 dilution (Molecular Probes Eugene ORUSA) Cerebellar cell lines and primary cultures fluorescent imageswere captured with a confocal Olympusmicroscope (Olympus TokyoJapan) or with an Olympus BX51 microscope and analyzed with theImage-Pro Express program

Filipin DCF (dichloro-fluorescein) and Hoechst staining

Filipin (Sigma) staining was performed as described by Karten etal (2002) DCF (Molecular Probes) was dissolved in Neurobasalmedium plus B27 without antioxidants Cells were incubated for30 min with 30 μM DCF and then washed 3 times with PBS and fixedwith 4 paraformaldehyde and 4 sucrose in PBS pH 75 for 30 minHoechst staining (Sigma) was performed as described by Alvarez et al(2004)

DCF and N-Tyr quantification

Fluorescence was quantified by using the IMAGE J program(National Institutes of Health Bethesda MD USA) to processfluorescence images captured with an Olympus BX51 microscopeFor each experiment fields were exposed for the same amount of timeand cells were photographed Cells were marked by manuallydrawing a region of interest within the cell body and the meanfluorescence was determined for each cell after subtracting thebackground fluorescence determined in a region of the samephotographed field that was devoid of cells The fluorescence in thecontrol group was set at 100

Western blot analysis

Proteins were prepared as described previously (Cancino et al2008) Cerebellar protein samples (50 μg) or rat hippocampal proteinsamples (25 μg) were resolved by SDSndashPAGE The immunoblot wasdone using anti-p73 (H-79 11000) (Santa Cruz Biotech) anti-c-Abl(K-12 11000) (Santa Cruz Biotech) anti-N-Tyr (NITT12-A 11000)(Alpha Diagnostic San Antonio TX USA) and anti-tubulin (T516815000) (Sigma) antibodies and secondary antibodies conjugatedwith horseradish peroxidase (13000) (Upstate Biotechnology LakePlacid NY USA)

Real-time PCR analysis

Total RNA was extracted pretreated with DNAse (Invitrogen) andthen reverse transcribed to cDNA using random primers (Invitrogen)Real-time PCR was then performed (model AB7500 Applied Biosys-tems Foster City CA USA) The PCR conditions and the gene-specificprimer sequences are provided in the Supplementary Materialsection Expression in mice tissue was normalized using the 18Sgene Data from the PCR reactions were analyzed using themathematical model described by Pfaffl (2001)

Statistical analysis

Mean and standard error values with the corresponding numberof experiments are indicated in the figure legends Probabilityvalues for Students t-tests of the data were obtained using theSigmaPlot 2004 version 90 program (Systat Software Inc ChicagoIL USA)

Results

U18666A treatment triggers oxidative stress and cholesterolaccumulation

To investigate the possible association of NPC-related neurode-generation with c-Ablp73 activation and oxidative stress we firsttreated rat primary hippocampal neurons with U18666A a well-known NPC phenotype inducer (Liscum and Faust 1989 Sparrow etal 1999 Koh et al 2006) that triggers significant cholesterolaccumulation after 24ndash48 h of treatment Interestingly we observedfast intracellular accumulation of cholesterol using filipin staining (a

211A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

marker of free cholesterol) Indeed we detected cholesterol buildupas early as 1 h after U18666A treatment (1 μgml) which wassustained over time (Fig 1A) Stronger filipin staining was observed24ndash48 h after U18666A treatment (data not shown)

Fig 1 U18666A triggers oxidative stress (A) Control (Ct) and U18666A (U18)-treated (1 μgwas detected by filipin staining Scale bar 50 μm (B) Rat hippocampal neurons were treatedand then fixed The positive control corresponds to 90 mM H2O2 for 3 min The images are rneurons treated with U18 for 1 2 and 4 h using the IMAGE J program Results are expresstreated with U18 (1 μgml) for 1 2 and 4 h and then fixed and immunostained using anQuantification of intensity of N-Tyr from U18-treated neurons for 1 2 and 4 h using the IMApb0001 vs control

Next we examined oxidative stress levels in U18666A-treatedneurons We evaluated oxidative stress using 2 approaches DCFfluorescent staining and nitrotyrosine (N-Tyr) immunolabeling DCFemits fluorescence when it comes in contact with reactive oxygen

ml for 1 2 or 4 h) rat hippocampal neurons were fixed and cholesterol accumulationwith U18 (1 μgml) for 1 2 and 4 h Cultures were labeled with DCF for 30 min at 37 degCepresentative of each treatment Scale bar 50 μm Quantification of intensity of DCF fored as meanplusmnSEM pb005 pb0001 vs control (C) Rat hippocampal neurons wereti-N-Tyr The positive control corresponds to 100 μM H2O2 for 1 h Scale bar 50 μmGE J program Results are meanplusmnSEM values of 3ndash4 independent experimentspb005

212 A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

species (ROS) and N-Tyr is generated following oxidative stress-induced post-translational modification of tyrosine A rapid increaseon DCF fluorescence was observed after treatment of rat hippocampalneurons with U18666A (Fig 1B) After 1 h of treatment the DCFfluorescence intensity in U18666A cells increased by 40 Theproduction of ROS increased over time reaching an increase of 296in DCF fluorescence intensity after 4 h of treatment (Fig 1B)Similarly N-Tyr staining also presented a progressive increase aftertreatment with U18666A (Fig 1C) and we observed a significantincrease in this oxidative stress marker after 1 h of treatment (60) Afurther 323 increase in N-Tyr staining was observed after 4 h oftreatment Taken together these results indicate that U18666Atreatment induces a fast accumulation of cholesterol and oxidativestress markers in neurons

Oxidative stress-mediated activation of the c-Ablp73 pathway inU18666A-treated neurons

We then studied the possible connection between oxidative stressand the engagement of c-Ablp73 proapoptotic signals by U18666Atreatment of hippocampal neurons U18666A (1 μgml for 1 h)dramatically increased c-Abl and p73 immunostaining relative tountreated control neurons (Fig 2A) Interestingly cells treated withU18666A and the c-Abl inhibitor imatinib (10 μM) presented lowerincreases in c-Abl and p73 expression (Fig 2A) To test the possiblerole of oxidative stress in c-Abl and p73 activation by U18666A weanalyzed the impact of the antioxidant NAC (100 μM) on the pathwayAs shown in Fig 2A a strong inhibition of c-Abl and p73 expressionwas induced by NAC

To furtherdefine the contributionof oxidative stress top73activationby U18666A treatment we performed kinetic experiments to monitorthe impact of imatinib (10 μM) or NAC (100 μM) in the pathway Weobserved a progressive increase of p73 over time after U18666Atreatment which was drastically prevented by the co-administrationof imatinib or NAC (Fig 2B) NAC treatment did not affectfilipin stainingof U18666A treated neurons (data not shown) suggesting that oxidativestress is downstream cholesterol accumulation

To functionally assess the impact of c-Ablp73 signaling andoxidative stress in U18666A-induced apoptosis we monitored thenumber of apoptotic nuclei in our experimental system (Fig 2C)Remarkably a strong protection against U18666A treatment wasobserved with imatinib which reduced the percentage of apoptoticnuclei by 54 Similarly NAC treatment reduced the number ofU18666A-induced apoptotic nuclei by 69 while treatment withU18666A plus imatinib and NAC resulted in the greatest reduction ofapoptotic nuclei (77) (Fig 2C) Taken together these results suggestthat the activation of c-Ablp73 by oxidative stress after U18666Atreatment is an important mediator of its neurotoxicity

Oxidative stress and c-Ablp73 activation in NPC1-deficient primaryneurons

To complement our studies in the pharmacological model of NPCwe decided to monitor oxidative stress markers and c-Abl and p73levels in two different genetic models of NPC (i) Npc1minusminus miceprimary hippocampal neurons and (ii) stable knockdown of Npc1 inN2a cells (N2a-NPC cells) We cultured wild-type (WT) and NPC1-deficient mouse hippocampal neurons The NPC neurons showedincreased markers of oxidative stress reflected in higher levels of DCFfluorescence and N-Tyr immunostaining compared to WT neurons(Fig 3A B) In addition NPC cultured neurons clearly presented anincreased accumulation of cholesterol as detected by filipin stainingand increased levels of c-Abl and p73 proapoptotic proteins (Fig 3CD) To test the possible impact of oxidative stress in the upregulationof p73 we treated WT and control cells with NAC and imatinib aspositive control and then assessed the levels of p73 protein levels

Western blot analysis revealed a significant decrease on p73 levelsafter both treatments in NPC neurons (Fig 3E)

We confirmed these results using an alternative model of NPC1deficiency We knocked down NPC1 in N2a cells using stabletransduction of cells with lentivirus expressing shRNA against Npc1mRNA (N2a-NPC) as we recently described (Klein et al in press) A~80 reduction in Npc1 mRNA levels was observed as monitored byquantitative PCR (data not shown) As expected N2a-NPC cellsshowed cholesterol accumulation which correlated with decreasedlevels of NPC1 and increased levels of c-Abl and p73 as monitored byimmunofluorescence (Fig 4A) As control we treated N2a-NPC cellswith NAC for 1 to 2 h and observed lower levels of DCF staining and N-Tyr labeling (Fig 4CndashD) In addition imatinib treatment did not affectthe appearance of oxidative stress markers in N2a-NPC (Fig 4CndashD)confirming the hypothesis that c-Ablp73 activation is downstream ofoxidative stress in NPC neurons

Elevated levels of oxidative stress markers in the cerebellum ofsymptomatic NPC mice

Based on the results presented in our three cellular models of NPCwe decided to monitor the levels of oxidative stress markers in thebrain of NPC mice (Fig 5A) First we determined the relative mRNAexpression levels of some classic oxidative stress response genes byquantitative PCR including the antioxidant transcription factor Nrf2 adetoxification gene heme oxygenase-1 (HO-1) an antioxidant geneglutathione reductase 1 (Gr-1) and Atf4 a stress response transcrip-tion factor The NPC cerebellum of 8-week-old mice expressedincreased levels of Nrf2 and Atf4 (more than 2-fold of the WT and ofHO-1 (more than 4-fold of the WT) We detected no changes in Gr-1mRNA levels (Fig 5A) In order to assess the possible accumulation ofoxidative stress markers in the NPC mouse cerebellum we measuredthe N-Tyr levels of the 8-week-old WT and NPC mouse cerebellum byWestern blot We detected an increased pattern of nitrotyrosinilatedproteins in the NPC tissue when compared with WT control mice(Fig 5B)

c-Abl p73 and active caspase-3 colocalize with N-Tyr in the NPC mousecerebellum

In order to test the possible association between c-Abl p73 andoxidative stress in vivo in NPC we analyzed the levels of c-Abl p73and phospho-p73 in WT and NPC mouse cerebellum by Western blot(Fig 6A B) We detected a 227 increase in c-Abl protein and asignificant increase in phospho-p73 as we have previously described(Alvarez et al 2008) We also analyzed the cerebellar distributions ofN-Tyr c-Abl and p73 using immunofluorescence in 8-week-old WTand NPC mice (Fig 6C) We observed an accumulation of N-Tyr-positive cells in NPC animals compared with WT healthy controlanimals (Fig 6C) Of note most N-Tyr-positive cells were foundmainly at the Purkinje and granular layers

Then we evaluated the expression pattern of these markers by co-localization experimentsWe found a clear co-expression of N-Tyr andc-Abl or p73 in the same cells in vivo (Fig 6C) Moreover we detecteda co-localization of N-Tyr and activated caspase-3 in the NPC mousecerebellum (Fig 6C) Taken together with our studies in the threecellular models of NPC these results suggest that oxidative stress mayactivate the pro-apoptotic c-Ablp73 pathway in the NPC mousecerebellum

Discussion

NPC is characterized by the intralysosomal accumulation ofcholesterol but the possible association between this event andneuronal apoptosis is unknownWe have reported previously that thelevels of c-Abl and p73 are elevated in the NPC mouse cerebellum co-

Fig 2 U18666A induced-c-Abl p73 protein expression and neuronal death are prevented by imatinib and NAC treatment (A) Control (Ct) and U18-treated (1 μgml for 1 h) rathippocampal neurons in the absence or presence of imatinib (Imat) (10 μM) or NAC (100 μM)were fixed and immunostained using anti-c-Abl anti-p73 and anti-tubulin antibodiesScale bar 50 μm (B) Immunoblot analysis of p73 Rat hippocampal neuron extracts (25 μg proteinlane) were treated with U18 (1 μgml) for 30 min 2 h or 4 h in the absence orpresence of Imat (10 μM) or NAC (100 μM) and measured by Western blot with an anti-p73 antibody Graph shows quantifications of p73 levels normalized by tubulin expression(C) Apoptosis quantification Ct and U18-treated (05 μgml for 24 h) rat hippocampal neurons in the absence or presence of Imat (10 μM) andor NAC (100 μM) were fixed and thenuclei were stained using Hoechst stain (005 μgml) Apoptotic (condensate) nuclei were quantified (arrows) and the results are presented as percentages (meanplusmnSEM) of 4independent experiments pb005 pb0005 vs control Representative images of some experimental conditions are shown

213A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

Fig 3 Npc1minusminus hippocampal neurons show increased levels of c-Abl p73 and N-Tyr (A) Eight-day in vitro wild-type (WT) and Npc1minusminus (NPC) hippocampal neurons were loadedwith DCF and then fixed Quantification of intensity of DCF from WT and NPC neurons was performed using the IMAGE J program Results are meanplusmnSEM (n=4) pb005(BndashD)Eight-day in vitro WT and NPC hippocampal neurons were fixed and stained using filipin and anti tubulin and (B) anti-N-Tyr antibodies (C) anti-c-Abl and (D) anti-p73Arrows indicate the same cells in the left and right panels Scale bar 50 μm (E) Immunoblot analysis of p73 25 μg of protein extracts from8-day in vitroWTandNPC hippocampal neuronswere subjected to 10 SDSndashPAGE and Western blotting with anti-p73 and anti-tubulin antibodies Graph shows quantifications of p73 levels normalized by tubulin expression

214 A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

localizing with apoptosis markers (Alvarez et al 2008) Thispathological process can be induced in cell cultures by the treatmentwith U18666A which inhibits cholesterol trafficking and triggersapoptosis (Cheung et al 2004 Koh et al 2007) Here we show that

U18666A treatment rapidly triggers cholesterol accumulation andactivates the c-Ablp73 proapoptotic pathway Interestingly cellsexposed to U18666A for short periods of time as we have used hereinduced alterations in NPC1-bearing vesicles dynamics (Ko et al

Fig 4 NPC1 downregulation increases the levels of c-Abl and p73 and imatinib treatment does not affect oxidative stress levels N2a cells were transduced with lentiviral vectorsexpressing shRNA against Npc1 (N2a-NPC) or luciferase mRNA (N2a-WT) (A) NPC1 c-Abl p73 and cholesterol accumulations were determined by immunofluorescence and filipinstaining respectively (B) DCF and N-Tyr levels were determined in N2a-WT and N2a-NPC with no treatment or treated with NAC (100 μM) for 05 1 or 2 h or with imatinib (Imat)(10 μM) for 2 h (C and D) Quantification of DCF and N-Tyr fluorescence Scale bar 50 μm

215A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

2001) This observation suggests that trafficking dysfunction ofcholesterol containing vesicles could participate in oxidative stressgeneration in NPC cells

Microarray and proteomic studies of primary cortical neuronstreated with U18666A have revealed changes in genes that controlsignal transduction induction of stress responses and loss of energyproduction which may all lead to apoptotic cell death (Koh et al2007) Furthermore previous studies have shown that chronicexposure to U18666A is associated with oxidative stress in culturedmurine cortical neurons (Koh et al 2006) similar to that reported in

NPC fibroblasts (Zampieri et al 2009) In addition microarrayanalyses of human NPC fibroblasts revealed a gene expression profileindicative of oxidative stress (Reddy et al 2006) In the present workusing three different NPC cellular models we show that cholesterolaccumulation correlates with activation of the c-Ablp73 pro-apoptotic pathway possibly due to engagement of an oxidative stressresponse

The question that remains unsolved is whether cholesterol accu-mulation directly induces oxidative stress or if cholesterol accumulationand oxidative stress are two independent pathways in NPC cells Our

Fig 5 The NPC mouse cerebellum expresses high levels of oxidative stress markers(A) ThemRNA levels of Nrf2 HO-1 Gr-1 and Atf4 in 8-week-oldWT and NPCmice wereanalyzed by real-time PCR Each gene product was normalized using 18S geneexpression Data are mRNA levels (meanplusmnSEM values) in both WT and NPC miceThere were five mice in each group pb005 NPC vs WTmice (B) Immunoblot analysisof nitrotyrosined proteins Cerebellum extracts (50 μg proteinlane) from 7-week-oldWT and NPC mice were resolved by 10 SDSndashPAGE and Western blot with anti-N-Tyrand anti-tubulin

216 A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

current results suggest that the first scenario is more probably Furtherstudies are required to elucidate themolecularmechanisms connectinglysosomal cholesterol accumulation and oxidative stress

A decrease in the antioxidant defense could also contribute to NPCoxidative stress and pathogenesis Interestingly apoptotic-activated c-Ablnegatively regulates the levels of the antioxidant enzyme catalase (Cao etal 2003ab) Catalase is one of the most important antioxidant enzymesthat participate in the regulation of intracellular H2O2 and its levels aredecreased in the liver andbrain ofNPCmice (Schedin et al 1997) Furtherstudies are required to evaluate if c-Abl-mediated catalase downregula-tion is contributing to oxidative stress in NPC neurons

Vitamin E antioxidant defense could also be impaired inNPC diseaseInterestingly Purkinje cells seemtobeparticularly sensitive tovitaminEalterations Mutations in the α-tocopherol transport protein (α-ttp)gene are responsible for the neurologic syndrome of spino-cerebellarataxia called Ataxia with Vitamin E Deficiency or AVED Thisneurodegenerative condition is characterized by progressive ataxiadysarthria sensory loss and severe damage of Purkinje cells (Larnaout etal 1997 Serra et al 2006) Althoughα-TTP is not detectable in normalbrain its expression is upregulated in cerebellar Purkinje cells inpatients having vitamin E deficiency states or diseases associated withoxidative stress (Copp et al 1999) In addition vitamin E supplemen-tation has been demonstrated to protect against age-related deficits inPurkinje cell-β adrenergic receptor function and ethanol-inducedPurkinje cell loss in rats (Gould et al 1998 Heaton et al 2000)

Oxidative stress acts directly by inducing the oxidation ofbiomolecules or indirectly by the action of peroxynitrite a highlyreactive radical produced by the reaction of superoxide anion andnitric oxide (NO) Peroxynitrite binds a nitro group to tyrosinesinducing protein nitrotyrosination which negates the physiologicalfunction of the proteins (Guix et al 2005) Interestingly it was

reported that NO levels are elevated in neural stem cells fromNpc1minusminus

mice (Kim et al 2008) In addition increase in cellular cholesteroloxidation products has been described in Npc1minusminus mouse tissuesplasma and macrophages (Tint et al 1998 Zhang et al 2008)Moreover microarray analyses of human NPC fibroblasts haverevealed an increase in NO synthase mRNA expression (Reddy et al2006) and in N-Tyr staining in fibroblasts (Mani et al 2006) Recentlydiminished antioxidant capacity has been described in serum fromNPC patients (Fu et al 2010) suggesting that oxidative stress could berelevant in human NPC pathology

Our results show that U18666A treatment or ablation of NPC1expression in neurons induces the appearance of N-Tyr The timecourse of N-Tyr induction by U18666A correlates with the inductionof ROSmeasured by DCF Furthermore N2a cells with downregulationof NPC1 hippocampal primary cultures from Npc1minusminus mice and theNPCmouse cerebellum exhibit large increases in N-Tyr staining Theseresults are in agreement with previous reports of N-Tyr being presentin many neurodegenerative diseases where oxidative stress plays akey role including multiple sclerosis (Bagasra et al 1995) andAlzheimers disease (Miranda et al 2000)

We have described an essential role of c-Abl in NPC pathogenesis invivo In fact imatinib treatment reduces apoptosis in the cerebellum ofNPC mice associated with improved neurological symptoms andincreased survival in NPC mice (Alvarez et al 2008) Considering thatoxidative stress is a potent activator of the c-Ablp73 pathway (Alvarezet al 2004) we addressed the possible role of oxidative stress in theactivation of c-Ablp73 pathway in our NPC models NAC treatmentsdecreased the activation of oxidative stress markers and c-Ablp73 inthree models of NPC In addition inhibition of c-Abl with imatinib didnot affect oxidative stress levels suggesting that c-Ablp73 activation inNPC is downstream of oxidative stress

c-Abl activation is induced by several types of proapoptoticstimuli including endoplasmic reticulum (ER) and oxidative stress(Ito et al 2001 Alvarez et al 2004) However our recent resultsdiscard ER stress and the Unfolded Protein Response (UPR) as relevantinductors of apoptosis and c-Abl in NPC neurons (Klein et al in press)

In agreement with our current study previous reports succeededin improving the neurological symptoms of NPC mice using anantioxidant strategy For example Bascuntildean-Castillo et al (2004)showed that treatment with tamoxifen and vitamin E exerts asignificant beneficial effect on rota-rod performance in NPC miceHowever a recent study with vitamin C failed to obtain a significantbenefit for NPCmice (Smith et al 2009) which could be related to thelack of neuroprotective properties of vitamin C in neurodegenerativediseases where oxidative stress plays a key role and where vitamin Eserves as a neuroprotectant (Quintanilla et al 2005) Early treatmentwith the neurosteroid allopregnanolone also improved the neurolog-ical symptoms and survival in NPC mice by correcting neurosteroido-genic abnormalities (Griffin et al 2004) Interestingly it wasdemonstrated that allopregnanolone works as a potent antioxidantin in vitro NPC models (Zampieri et al 2009) Treating NPC mice invivo with curcumin a potent activator of the antioxidant Nrf2pathway (Balogun et al 2003) also improves the neurologicalsymptoms and survival of NPC mice (Lloyd-Evans et al 2008) Allthese studies indicate a relevant role of oxidative stress in NPC-relatedneurodegeneration

In summary our data suggest that the apoptotic process that leadsto the characteristic neurodegeneration of NPC involves the activationof the c-Ablp73 pathway and upstream induction of oxidative stressOur data support the possibility of developing NPC treatments withinhibitors of the c-Ablp73 pathway andor antioxidants

Acknowledgments

This study was supported by grants from the Ara ParseghianMedical Research Foundation Fondo Nacional de Desarrollo Cientiacutefico

Fig 6 c-Abl p73 and active caspase-3 colocalize with N-Tyr in the NPC mouse cerebellum Cerebellum extracts (50 μg proteinlane) from 7-week-old WT and NPC mice weresubjected to 10 SDSndashPAGE and Western blotting with anti-c-Abl and anti-tubulin (A) or anti-p73 anti-phospho-p73 and anti-tubulin antibodies (B) Quantifications of theimmunoblot are included pb005 (C) Eight-week-old WT and NPC mouse brains were fixed and analyzed by immunofluorescence using anti c-Abl anti-N-Tyr anti-p73 and anti-active caspase-3 antibodies Merges including an amplification of the Purkinje cell layer are shown Purkinje cells positive for both antibodies are indicated by arrows Scale bar100 μm (M molecular layer P Purkinje cell layer G granular layer)

217A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

218 A Klein et al Neurobiology of Disease 41 (2011) 209ndash218

y Tecnoloacutegico (FONDECYT) and Spanish Ministerio de Sanidad [grantnumbers 1080221 to ARA 1100176 to CH and 1070622 to SZ andFIS-PRO1208 to FJM] and CONICYT fellowships to AK and LMVWealso thank FONDAP15010006 andNucleoMilenio P07-048-F (CH)The authors thank the Humbolt Foundation for the donation of theApplied Biosystems AB7500 real-time PCR machine to the Departa-mento de Gastroenterologiacutea Facultad de Medicina Pontificia Uni-versidad Catoacutelica de Chile

References

Alvarez AR Sandoval PC Leal NR Castro PU Kosik KS 2004 Activation of theneuronal c-Abl tyrosine kinase by amyloid-beta-peptide and reactive oxygenspecies Neurobiol Dis 17 326ndash336

Alvarez AR Klein A Castro J Cancino GI Amigo J Mosqueira M Vargas LMYeacutevenes LF Bronfman FC Zanlungo S 2008 Imatinib therapy blocks cerebellarapoptosis and improves neurological symptoms in amouse model of Niemann-Picktype C disease FASEB J 22 3617ndash3627

Amigo L Mendoza H Castro J Quintildeones V Miquel JF Zanlungo S 2002Relevance of Niemann-Pick type C1 protein expression in controlling plasmacholesterol and biliary lipid secretion in mice Hepatology 36 819ndash828

Bagasra O Michaels FH Zheng YM Bobroski LE Spitsin SV Fu ZF Tawadros RKoprowski H 1995 Activation of the inducible form of nitric oxide synthase in thebrains of patients with multiple sclerosis Proc Natl Acad Sci USA 92 12041ndash12045

Balogun E Hoque M Gong P Killeen E Green CJ Foresti R Alam J Motterlini R2003 Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 andthe antioxidant-responsive element Biochem J 371 887ndash895

Bascuntildean-Castillo EC Erickson RP Howison CM Hunter RJ Heidenreich RHHicks C Trouard TP Gillies RJ 2004 Tamoxifen and vitamin E treatments delaysymptoms in the mouse model of Niemann-Pick C J Appl Genet 45 461ndash467

Cancino GI Toledo EM Leal NR Hernandez DE Yeacutevenes LF Inestrosa NC AlvarezAR 2008 Imatinib prevents apoptosis tau phosphorylation and behaviouralimpairments induced by Alzheimers beta-amyloid deposits Brain 131 2425ndash2442

Cao C Leng Y Kufe D 2003a Catalase activity is regulated by c-Abl and Arg in theoxidative stress response J Biol Chem 278 29667ndash29675

Cao C Leng Y Liu X Yi Y Li P Kufe D 2003b Catalase is regulated byubiquitination and proteosomal degradation Role of the c-Abl and Arg tyrosinekinases Biochemistry 42 10348ndash10353

Carstea ED Morris JA Coleman KG Loftus SK Zhang D Cummings C Gu JRosenfeld MA Pavan WJ Krizman DB Nagle J Polymeropoulos MH SturleySL Ioannou YA Higgins ME Comly M Cooney A Brown A Kaneski CRBlanchette-Mackie EJ Dwyer NK Neufeld EB Chang T Liscum L Strauss JFOhno K Zeigler M Carmi R Sokol J Markie D ONeil RR Diggelen OPElleder M Patterson MC Brady RO Vanier MT Pentchev PG Tagle DA1997 Niemann-Pick C1 disease gene homology to mediators to cholesterolhomeostasis Science 277 228ndash231

Cheung NS Koh CH Bay BH Qi RZ Choy MS Li QT Wong KP Whiteman M2004 Chronic exposure to U18666A induces apoptosis in cultured murine corticalneurons Biochem Biophys Res Commun 315 408ndash417

Copp RP Wisniewski T Hentati F Larnaout A Ben HM Kayden HJ 1999Localization of alpha-tocopherol transfer protein in the brains of patients withataxia with vitamin E deficiency and other oxidative stress related neurodegen-erative disorders Brain Res 822 80ndash87

Fu R Yanjanin NM Bianconi S Pavan WJ Porter FD 2010 Oxidative stress inNiemann-Pick disease type C Mol Genet Metab 101 214ndash218

Gould TJ Chadman K Bickford PC 1998 Antioxidant protection of cerebellar beta-adrenergic receptor function in aged F344 rats Neurosci Lett 250 165ndash168

Griffin LD Gong W Verot L Mellon SH 2004 Niemann-Pick type C diseaseinvolves disrupted neurosteroidogenesis and responds to allopregnanolone NatMed 10 704ndash711

Guix FX Uribesalgo I Coma M Muntildeoz FJ 2005 The physiology and pathophys-iology of nitric oxide in the brain Prog Neurobiol 76 126ndash152

Guix FX Ill-Raga G Bravo R Nakaya T de Fabritiis G Coma M Miscione GPVillagrave-Freixa J Suzuki T Fernagravendez-Busquets X Valverde MA de Strooper BMuntildeoz FJ 2009 Amyloid-dependent triosephosphate isomerase nitrotyrosina-tion induces glycation and tau fibrillation Brain 132 1335ndash1345

Heaton MB Mitchell JJ Paiva M 2000 Amelioration of ethanol-inducedneurotoxicity in the neonatal rat central nervous system by antioxidant therapyAlcohol Clin Exp Res 24 512ndash518

Hetz C Thielen P Fisher J Pasinelli P Brown RH Korsmeyer S Glimcher L 2007The proapoptotic BCL-2 family member BIM mediates motoneuron loss in a modelof amyotrophic lateral sclerosis Cell Death Differ 7 1386ndash1399

Ito Y Pandey P Mishra N Kumar S Narula N Kharbanda S Saxena S Kufe D2001 Targeting of the c-Abl tyrosine kinase to mitochondria in endoplasmicreticulum stress-induced apoptosis Mol Cell Biol 21 6233ndash6242

Jacobs WB Walsh GS Miller FD 2004 Neuronal survival and p73p63p53 afamily affair Neuroscientist 10 443ndash455

Jing Z Caltagarone J Bowser R 2009 Altered subcellular distribution of c-Abl inAlzheimers disease J Alzhemiers Dis 17 409ndash422

Karten B Vance DE Campenot RB Vance JE 2002 Cholesterol accumulates in cellbodies but is decreased in distal axons of Niemann-Pick C1-deficient neurons JNeurochem 83 1154ndash1163

Kim SJ Lim MS Kang SK Lee YS Kang KS 2008 Impaired functions of neuralstem cells by abnormal nitric oxide-mediated signaling in an in vitro model ofNiemann-Pick type C disease Cell Res 18 686ndash694

Klein A Mosqueira M Martinez G Robledo F Gonzaacutelez M Caballero B Cancino GIAlvarez AR Hetz C Zanlungo S in press Lack of activation of the Unfolded ProteinResponse (UPR) in mouse and cellular models of Niemann-Pick type C diseaseNeurodeg Dis doi101159000316540

Ko DC Gordon MD Jin JY Scott MP 2001 Dynamic movements of organellescontaining Niemann-Pick C1 protein NPC1 involvement in late endocytic eventsMol Biol Cell 12 601ndash614

Koh CH Whiteman M Li QX Halliwell B Jenner AM Wong BS Laughton KMWenk M Masters CL Beart PM Bernard O Cheung NS 2006 Chronicexposure to U18666A is associated with oxidative stress in culturedmurine corticalneurons J Neurochem 98 1278ndash1289

Koh CH Peng ZF Ou K Melendez A Manikandan J Qi RZ Cheung NS 2007Neuronal apoptosis mediated by inhibition of intracellular cholesterol transportmicroarray and proteomics analyses in cultured murine cortical neurons J CellPhysiol 211 63ndash87

Liscum L Faust JR 1989 The intracellular transport of low density lipoprotein-derivedcholesterol is inhibited in Chinese hamster ovary cells cultured with 3-beta-[2-(diethylamino)ethoxy]androst-5-en-17-one J Biol Chem 264 11796ndash11806

Liscum L Ruggiero RM Faust JR 1989 The intracellular transport of low densitylipoprotein-derived cholesterol is defective in Niemann-Pick type C fibroblasts JCell Biol 108 1625ndash1636

Lloyd-Evans E Morgan AJ He X Smith DA Elliot-Smith E Sillence DJ Churchill GCSchuchman EH Galione A Platt FM 2008 Niemann-Pick disease type C1 is asphingosine storage disease that causes deregulation of lysosomal calcium NatMed 141247ndash1255

Mani K Cheng F Fransson LA 2006 Constitutive and vitamin C-induced NO-catalyzed release of heparan sulfate from recycling glypican-1 in late endosomesGlycobiology 16 1251ndash1261

Miranda S Opazo C Larrondo LF Muntildeoz FJ Ruiz F Leighton F Inestrosa NC2000 The role of oxidative stress in the toxicity induced by amyloid beta-peptide inAlzheimers disease Prog Neurobiol 62 633ndash648

Naureckiene S Sleat Delackland H Fensom A Vanier MT Wattiaux R Jadot MLobel P 2000 Identification of HE1 as the second gene of Niemann-Pick C diseaseScience 290 2298ndash2301

Pentchev PG VanierMT Suzuki K PattersonMC 1995 In Scriver CR Beaudet AL SlyWS Valle D (Eds) Niemann Pick typeC a cellular cholesterol lipidosis TheMetabolicandMolecular Bases of InheritedDisease vol 2Mc-GrawHill NewYork pp 2625ndash2639

Pfaffl MW 2001 A new mathematical model for relative quantification in real-timeRT-PCR Nucleic Acids Res 29 e45

Quintanilla RA Muntildeoz FJ Metcalfe MJ Hitschfeld M Olivares G Godoy JAInestrosa NC 2005 J Biol Chem 280 11615ndash11625

Reddy JV Ganley IG Pfeffer SR 2006 Clues to neuro-degeneration in Niemann-Pick type C disease from global gene expression profiling PLoS ONE 1 e19

Schedin S Sindelar PJ Pentchev P Brunk U Dallner G 1997 Peroxisomalimpairment in Niemann-Pick type C disease J Biol Chem 272 6245ndash6251

Serra SA Raga G Coma M Guix FX Muntildeoz FJ 2006 The role of vitamine E onintracellular signaling pathways in brain In Braunstein Matthew H (Ed)Molecular basis for the treatment of neurodegenerative diseases Nova SciencePublishers Inc pp 2ndash26

Smith D Wallom KL Williams IM Jeyakumar M Platt FM 2009 Beneficial effectsof anti-inflammatory therapy in a mouse model of Niemann-Pick disease type C1Neurobiol Dis 36 242ndash251

Sparrow SM Carter JM Ridgway ND Cook HW Byers DM 1999 U18666Ainhibits intracellular cholesterol transport and neurotransmitter release in humanneuroblastoma cells Neurochem Res 24 69ndash77

Tint GS Pentchev P Xu G Batta AK Shefer S Salen G Honda A 1998Cholesterol and oxygenated cholesterol concentrations are markedly elevated inperipheral tissue but not in brain from mice with the Niemann-Pick type Cphenotype J Inherit Metab Dis 21 853ndash863

Tsai KK Yuan ZM 2003 c-Abl stabilizes p73 by a phosphorylation-augmentedinteraction Cancer Res 63 3418ndash3424

Walkley SU Suzuki K 2004 Consequences of NPC1 and NPC2 loss in neuronsBiochim Biophys Acta 1685 48ndash62

Wang JY 2005 Review nucleo-cytoplasmic communication in apoptotic response togenotoxic and inflammatory stress Cell Res 15 43ndash48

Wu YP Mizukami H Matsuda J Saito Y Proia RL Suzuki K 2005 Apoptosisaccompanied by up-regulation of TNF-alpha death pathway genes in the brain ofNiemann-Pick type C disease Mol Genet Metab 84 9ndash17

Zampieri S Mellon SH Butters TD Nevyjel M Covey DF Bembi B Dardis A2009 Oxidative stress in NPC1 deficient cells protective effect of allopregnanoloneJ Cell Mol Med 13 3786ndash3796

Zhang JR Coleman T Langmade SJ Scherrer DE Lane L Lanier MH Feng CSands MS Schaffer JE Semenkovich CF Ory DS 2008 Niemann-Pick C1protects against atherosclerosis in mice via regulation of macrophage intracellularcholesterol trafficking J Clin Invest 118 2281ndash2290

Zhu J Wang JY 2004 Death by Abl a matter of location Curr Top Dev Biol 59165ndash192