1 ONLINE MATERIALS I. Online Methods II. Online Results III. Online Tables Table 1A Clinical features of 15 French probands with congenital AV block and their parents Table 1B Clinical features and ECG profiles of 31 Japanese AV block and SSS cases Table 2 Candidate arrhythmia susceptibility 457 genes for targeted exon sequencing Table 3 ECG parameters of cardiac-specific conditional Gjc1 knockout mice Table 4 Transesophageal pacing study of cardiac-specific conditional Gjc1 knockout mice Table 5 Nucleotide sequences of the oligonucleotide primers IV. Online Figures Figure 1 Lateral cephalometric angular and linear measurement Figure 2 Study protocol of conditional knockout and immunohistological demonstration of Gjc1 depletion in SA node Figure 3 Current ECGs of the affected members of family A and family B Figure 4 Extracardiac abnormalities of family B members Figure 5 Efficacy of gap junction plaque formation and the voltage-dependency of WT- and WT/R75H-Cx45 Figure 6. Histological evaluation of nodal areas of control and Gjc1-CKO mouse V. References
26
Embed
ONLINE MATERIALS I. Online Methods II. Online Results · 2017-06-15 · 1 . ONLINE MATERIALS . I. Online Methods . II. Online Results . III. Online Tables . Table 1A . Clinical features
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
ONLINE MATERIALS
I. Online Methods
II. Online Results
III. Online Tables
Table 1A Clinical features of 15 French probands with congenital AV block and their parents
Table 1B Clinical features and ECG profiles of 31 Japanese AV block and SSS cases
The proband’s father was diagnosed with AV block and atrial standstill. He had exertional palpitations and repetitive
episodes of presyncope at the age of 36 (Figure 1B). ECG and transesophageal pacing demonstrated atrial standstill,
and he received a permanent pacemaker implanted. He also had bilateral camptodactyly and clinodactyly (not shown).
Dental records are not available. He died of a non-cardiac cause during the 7th decade of his life. Genomic DNA and
X-ray imaging are unavailable, and he is an obligate mutation carrier.
Intermolecular binding affinity of Cx45
The R75 residue in Cx45 was assumed to be essential for the inter-monomer interactions based on the crystal structure
analysis(37). We tested if the mutation R75H of Cx45 disrupt the hemi-channel assembly property using co-IP assay.
The binding affinity of R75H-Cx45 was comparable to that of WT-Cx45 (Figure 4A).
Gap junction plaque formation
To investigate the localization of the mutant Cx45 channel molecules, neuroblastoma N2a cells were transfected with
myc-Cx45 plasmids of either WT, R75H, or in combination, and were labelled with the GFP-conjugated anti-myc
antibody. In N2a cells overexpressing WT-Cx45, the GFP signals were mainly localized on the borderline between the
adjoining cells as well as the cells homozygously or heterozygously overexpressing R75H (Figure 4B). Fluorescence-
positive and gap junction plaque-positive cell pairs were counted in 5 different views for each group, and the efficacy
of gap junction plaque formation were statistically analyzed by calculating the ratio of cell pairs with gap junction
plaques to the number of fluorescence-positive cell pairs. The efficacy of gap junction plaque formation was not
significantly different in three groups (WT: 64.3 ± 6.7%, n=171; WT/R75H: 59.4 ± 11.0%, n=165; R75H: 60.4 ± 8.4%,
11
n=150; NS, Online Figure 5), suggesting that the mutant Cx45 does not have defect of membrane trafficking or
localization on the border line between the adjoining cells. Combined with the result of the binding assay by co-IP
(Figure 4A), it is indicated that R75H-Cx45 can assemble each other and be transported to cell surface to form GJ
channels between the adjoining cells as well as WT-Cx45.
Mutant R75H-Cx45 exhibited severely reduced dye transfer
To evaluate the GJ permeability of the mutant Cx45 channels, Lucifer yellow dye transfer was performed in N2a cell
pairs overexpressing Cx45 of either WT, R75H or both. Immediately after rupturing the membrane to make a whole-
cell patch, Lucifer yellow in the pipette solution was rapidly diffused into the manipulated cells (donor cells, Figure 4C).
Fluorescent intensity of the transferred dye from the donor cells (open symbols) to the adjoining cells (closed symbols)
was time-dependent, and was nearly saturated in 5 min in almost all the cells expressing WT-Cx45 (Figure 4D). In
contrast, dye transfer to the adjoining cells was severely suppressed in the cells expressing homomeric (R75H) or
heteromeric (WT/R75) Cx45. These data show that the mutant Cx45 protein dominant-negatively suppresses permeation
property of WT-Cx45 protein without affecting plaque formation.
Electrophysiological properties of the mutant Cx45 channels
The electrophysiological properties of R75H-Cx45 were determined using conventional dual whole-cell patch-clamp
techniques. The probability of observing electrical coupling in homomeric mutant R75H channel (R75H-Cx45-pIRES2-
EGFP) was 0% (0/8), whereas those of WT (WT-Cx45-pIRES2-EGFP) and WT (WT-Cx45-pIRES2-DsRed) were
respectively 91.7% (11/12) and 100% (5/5). Heteromeric channels (WT/R75H) expressing both WT-Cx45-pIRES2-
DsRed and R75H-Cx45-pIRES2-EGFP showed electrical coupling of 72.7% (8/11). In contrast, macroscopic
conductance (Gj) measured at a transjunctional voltage of +60 mV was significantly suppressed in the heteromeric
channel WT/R75H and homomeric channel R75H than WT (WT: 24.2 ± 7.9 nS, n=5; WT/R75H: 4.9 ± 5.3 nS, n=11;
R75H: 0 nS, n=8; p=1.00x10-7) (Figure 4E). These data show that R75H exhibits the dominant-negative suppression
effects on the electrophysiological properties of WT-Cx45 channel.
Immunohistological evaluation of Gjc1 depletion at the SA node area
Gjc1-CKO mice after tamoxifen administration showed red fluorescence in all organs, while green fluorescence was
observed only in the heart. Furthermore, immunohistological evaluation with cryosections of the hearts in these mice
showed colocalization of HCN4 (red) and Cre recombination (green) in the SA node areas, confirming that tamoxifen
successfully depleted Gjc1 in the heart (Online Figure 2C).
Histological evaluation of nodal areas and time course of nodal functions in Gjc1-CKO mice
Paraffin-embedded sections of SA node and AV node area were histologically examined using Masson Trichrome
staining in Gjc1-CKO and control mice. There was no apparent difference in fibrosis of between Gjc1-CKO and control
mouse (Online Figure 6).
12
We repeated EPS several times for an extended period of time (up to 32 weeks) in some mice, but the SA node
and AV node functions were largely unchanged after tamoxifen injection (data not shown).
13
III. ONLINE TABLES
Table 1A. Clinical features of 15 French probands with congenital AV block and their parents
a. Probands
Family Sex Age at last clinicalexamination (y.o.)
HR (bpm) PR (ms)* QRS(ms)
QTc (ms) QRSwaveform
AVConduction
Age at PMI
1 female 12 47 NA 78 389 Normal 3rd AVB 22 female 22 60 NA 158 494 RBBB 3rd AVB 223 male 0 75 NA 70 498 Normal 3rd AVB 34 female 0 39 NA 125 755 LBBB 3rd AVB 05 male 0 56 NA 122 325 LBBB 3rd AVB 06 female 5 49 NA 60 495 Normal 3rd AVB 57 male 2 60 NA 63 442 Normal 3rd AVB8 female NA NA NA NA NA NA NA 09 male 4 50 NA 55 385 Normal 3rd AVB10 male NA NA NA NA NA NA NA 9
11 male 18 51 237 73 483 Normal 1st andMobitz AVB
12 male 3 100 392 64 415 Normal 1st-3rd AVB13 female 5 50 NA 65 443 Normal 3rd AVB 514 male 2 60 NA 75 397 Normal 3rd AVB 215 male 4 43 NA 70 433 Normal 3rd AVB 4
mother 43 53 170 88 412 Normal Normal Unaffectedfather 46 74 184 94 418 Normal Normal Unaffectedmother 49 75 121 101 404 Normal Normal Unaffectedfather 50 67 173 91 398 Normal Normal Unaffectedmother 36 75 157 95 426 Normal Normal Unaffectedfather 37 60 145 83 389 Normal Normal Unaffectedfather 43 61 160 100 400 Normal Normal Unaffectedmother 43 59 140 80 360 Normal Normal Unaffectedfather 51 85 120 80 405 Normal Normal Unaffectedmother 30 73 150 80 397 Normal Normal Unaffectedmother 37 80 132 90 418 Normal Normal Unaffectedfather 36 90 194 101 473 Normal Normal Unaffectedmother 33 80 97 55 341 Normal Normal Unaffectedfather 37 75 102 79 318 Normal Normal Unaffectedfather 43 65 126 100 445 Normal Normal Unaffectedmother 40 60 123 85 390 Normal Normal Unaffectedfather 45 75 137 93 421 Normal Normal Unaffectedmother 41 78 127 103 446 Normal Normal Unaffectedmother 41 79 160 90 413 Normal Normal Unaffected
father 40 61 140 110 380 IncompleteRBBB
Normal Probablyunaffected
father 46 70 175 99 412 Normal Normal Unaffectedmother 44 100 154 98 403 Normal Normal Unaffectedmother 39 69 122 88 437 Normal Normal Unaffectedfather 42 43 188 88 403 Normal Normal Unaffectedfather 39 48 159 88 353 Normal Normal Unaffectedmother 39 75 140 66 391 Normal Normal Unaffectedmother 38 60 116 69 351 Normal Normal Unaffectedfather 39 80 170 70 388 Normal Normal Unaffectedmother 37 60 130 92 409 Normal Normal Unaffectedfather 43 78 143 104 420 Normal Normal Unaffected
mean 41 ± 5 70 ± 12 145 ± 25 89 ± 12 401 ± 33
15
QTc : Bazett's corrected QT interval. HR, heart rate; NA, data not available; PMI, pacemaker implantation; LBBB, left bundlebranch block; RBBB, right bundle branch block; AVB, atrioventricular block. *; PR duration was rarely recorded due to a largenumber of cases with complete atrioventricular dissociation. Family 12 is the Family A of this work.
b. Parents
1
2
3
4
5
6
7
8
9
10
11
12
13
14
14
Table 1B. Clinical features and ECG profiles of 31 Japanese AV block and SSS cases
Proband Sex diagnosis Age at diagnosis(y.o.)
SSS HR (bpm) AV Conduction QRSwaveform
Age atPMI
family history
1 female SSS 62 + 48 Normal Normal 62 mother (SSS, PMI)
3 male SSS 19 + 54 Normal Normal 19 grandfather, uncles(syncope, PMI)
4 female AVB 6 - 58 3rd AVB LBBB 11 father (arrhythmia)5 male SSS NA + NA NA NA NA NA6 male SSS NA + NA NA NA NA NA7 male SSS NA + NA NA NA NA NA8 female SSS NA + NA NA NA NA NA9 male AVB 42 - NA NA NA NA NA
10 female AVB, AS 7 + 54 3rd AVB Normal 14grandfather, mother,brother (AVB, AS,PMI)
11 female SSS 52 + NA NA NA 52 son, daughter (SSS)
12 female SSS, AFL 49 + 48 Normal Normal 49 father, sister, son(SSS, AFL)
13 male AVB 51 - NA NA NA 51 brother, mother(AVB, PMI)
14 female AVB 52 - NA 3rd AVB NA 52 mother (AVB)
15 male SSS, LVNC, AS 16 + 32 Normal Normal 17 grandfather, great-grandmother (PMI)
16 female SSS NA + NA NA NA NA father (SSS, PMI)17 male SSS NA + NA NA NA NA NA18 female SSS + 54 Normal Normal daughter (SSS)19 male SSS NA + NA NA NA NA NA20 male SSS, Af 50 + NA NA NA 52 mother (SSS, PMI)21 female SSS NA + NA NA NA NA NA22 female SSS NA + NA NA NA NA NA23 female AVB NA + NA NA NA NA NA24 male SSS 54 + 64 NA Normal none25 female SSS 15 + 33 Normal Normal 15 none26 male SSS NA - NA NA NA NA NA27 female AVB 33 - 50 3rd AVB Normal 33 brorther (SSS)28 male AVB 12 - 71 3rd AVB Normal NA29 male SSS, WPW 7 + 67 Normal Normal mother (SSS)
30 male SSS, AS 0 + 49 NA NA mother, brothers(SSS)
SSS: sick sinus syndrome, AS: Atrial standstill, AFL:atrial flutter, Af: atrial fibrillation, LVNC: Left ventricular non-compaction. Family 10 is the Family B ofthis work.
2. Plasmid cloning and mutagenesisName sequence (5' to 3')GJC1-EcoR1-F GCATACGAATTCCGCCACCATGAGTTGGAGCTTCCGJC1-R-Flag-Xho1 TTTCTCGAGCTACTTGTCGTCATCGTCTTTGTAGTCAATCCAGACGGAGGTCTTCCCGJC1-Xho1-R TAAGCCCTCGAGGACCCAAATCCAGACGGAGGTCGJC1-Xho1-F CCACTCGAGTCACCATGAGTTGGAGCTTCGJC1-EcoR1-R AAGAATTCGAATCCAGACGGAGGTCTTCCGJC1-R75H-QCM-F CCTCTCTCCCATGTACACTTCTGGGTGTTCGJC1-R75H-QCM-R GAACACCCAGAAGTGTACATGGGAGAGAGG
3. Genotyping of mT/mG mice Name sequence (5' to 3')GFPF1 CGGCCACAAGTTCAGCGTGTCGFPR1 GTCCATGCCGAGAGTGATCCCDadF1 CCGGTATCCGAAGTCCCCGTGTTCDadR1 CAGTTTCAACTCCTGTTAGGCATTAGAA
18
IV. ONLINE FIGURES
Figure 1. Lateral cephalometric angular and linear measurement. Facial axis angle is defined as an angle between the basion-nasion plane (BA-NAP) and the facial axis (FX). Facial depth angle is an angle between the Frankfort horizontal plane (FHP) and the facial plane (FP). Mandibular plane angle is an angle between FHP and the Mandibular plane (MdP). MfL and MdL stand for midfacial length (Condylion-A point) and mandibular length (Condylion-Gnathion), respectively.
Online Fig. 1
19
Figure 2. Study protocol of conditional knockout and immunohistological demonstration of Gjc1 depletion in SA node (A) Experimental protocol of in vivo assays of Gjc1-CKO mice. ECG parameters, transesophageal pacing study (EPS) were performed before and after tamoxifen administration (four times, weekly) in each mouse. (B) Gjc1-CKO crossed with mT/mG mice were genotyped by multiplex PCR. The 634 bp and 413 bp bands correspond to mT/mG and control Dad1 genes, respectively. (C) Efficiency of Cre-loxP recombinase activity to knockout Gjc1 gene in SA node after tamoxifen administration. GFP fluorescence (green signal) indicating successful Cre-LoxP recombination was colocalized with immunofluorescent Hcn4 (red signal) at the SA node area. RAA: right atrial appendage, CT: crista terminalis, SAN: sinoatrial node, IAS: interatrial septum. White scale bars: 200 μm
20
21
Figure 3. Current ECGs of the affected members of family A and family B. Current ECGs of (A) family A proband (II:1), (B) family B proband (II:2), (C) family B daughter (III:1), and (D) family B son (III:2). ECGs of (B) and (C) were taken in the presence of pacing during the generator exchange. All four individuals show junctional rhythm without ventricular conduction disturbance, despite exhibiting progressive conduction abnormalities in the AV node and atrium.
22
Figure 4. Extracardiac abnormalities of the family B members. (A)-(C); proband (III:1), and (D)-(F); brother of the proband (III:2). (A)(D) Front and lateral views and cephalograms of the patient. Cephalometric analysis showed significant brachyfacal pattern (see Table 1). (B) (E) Clinodactyly on the 5th fingers and camptodactyly on 3rd through 5th fingers of hand. X-ray showed shorter middle phalanx and radial curvature of the 5th fingers of hands (arrows). (C)(F) Intra-oral view and pantomography of the patient. Bilateral small maxillary lateral incisors (microdontia, asterisks), and defect of bilateral mandibular central incisors and right mandibular lateral incisor (arrows) were observed in III:1. Remnant of mandibular deciduous central incisor, and defect of bilateral mandibular central incisors (agenesis, arrows) were observed in III:2. No microdontia was observed. All phonographs are reproduced with the written permission of the patient or the guardian.
23
Online Fig. 5
Figure 5. Efficacy of gap junction plaque formation and the voltage-dependency of WT- and WT/R75H-Cx45. (A) Fluorescence-positive and gap junction plaque-positive cell pairs were counted in 5 different views for each group. The efficacy of gap junction plaque formation, the ratio of cell pairs with gap junction plaques to the number of fluorescence-positive cell pairs, was not significantly different among WT, heteromeric channel (WT/R75), and homomeric mutant channel (R75H). (WT: 64.3 ± 6.7%, n=171; WT/R75H: 59.4 ± 11.0%, n=165; R75H: 60.4 ± 8.4%, n=150; NS.) (B) Steady-state Gj/Vj relationships of gap junction conductance were determined by plotting normalized steady-state conductance with respect to peak conductance (Gjss/Gjpeak) versus Vj during the long voltage pulses. The normalized junctional conductance (Gj) values were fitted with Boltzmann equation: Gj= (Gjmax-Gjmin)/(1+exp(A(Vj-V0))) + Gjmin where Gj is macroscopic junctional conductance, Gjmax is theoretical maximum conductance, V0 is voltage at which voltage-sensitive conductance is reduced by 50%; A is the slope factor. Parameters of gap junction properties were comparable between WT/R75H heteromeric channels (n=3) and WT (n=1); Parameters of WT/R75H and WT on negative side were; V0: -34.1 mV, -36.5 mV; Gjmin: 0.11, 0.07; A: 0.11 mV-1, 0.18 mV-1, respectively. Parameters of WT/R75H and WT on positive side were; V0: +34.0 mV, +33.8 mV; Gjmin : 0.07, 0.04; A: 0.11 mV-1, 0.10 mV-1, respectively.
24
Figure 6. Histological evaluation of nodal areas of control and Gjc1-CKO mouse Masson-Trichrome staining showing fibrotic changes (blue) in the SA node (A, C) and AV node (B, D) areas in a Gjc1-CKO mouse (22-week-old; A, B) and a control mouse (24-week-old; C, D). Boxed area in each inset is magnified as A-D. No obvious differences of fibrosis levels at the nodal areas between Gjc1-CKO and control.
more than 33,300 non-Finnish European individuals). ftp://ftp.broadinstitute.org/pub/ExAC_release. 4. FREX database (573 exomes from French unrelated individuals). www.france-
http://gnomad.broadinstitute.org. 6. Lindenbaum P, Scouarnec SL, Portero V, Redon R. Knime4Bio: a set of custom nodes for the
interpretation of next-generation sequencing data with KNIME. Bioinformatics 2011;27:3200-3201. 7. SIFT. http://sift.jcvi.org/www/SIFT_enst_submit.html. 8. PolyPhen-2. http://genetics.bwh.harvard.edu/pph2/. 9. Human Genetic Variation Database (HGVD; Japanese 1,200 exomes) http://www.genome.med.kyoto-
u.ac.jp/SnpDB/. 10. Integrative Japanese Genome Database (ToMMo-2KJPN; whole-genome sequence database of 2,049
healthy Japanese). https://ijgvd.megabank.tohoku.ac.jp/. 11. Ash MM, Nelson SL. Introduction to dental anatomy. 8th ed. Philadelphia: Saunders, 2003. 12. Fujita T, Kirino, T., Yamashita, Y. Upper lateral incisor (second incisors). 22nd ed. Tokyo: Kanahara,
2012. 13. Duminache M, Gabison K, Atrtchine A, Chabre C. Trois analyses céphalométriques usuelles. EMC-
Odontologie/Orthopédie Dentofaciale 2013;8:1-14. 14. Ursi WJ, Trotman CA, McNamara JA, Jr., Behrents RG. Sexual dimorphism in normal craniofacial
growth. Angle Orthod 1993;63:47-56. 15. Lux CJ, Conradt C, Burden D, Komposch G. Transverse development of the craniofacial skeleton and
dentition between 7 and 15 years of age--a longitudinal postero-anterior cephalometric study. Eur J Orthod 2004;26:31-42.
17. Flatt AE. The troubles with pinkies. Proc (Bayl Univ Med Cent) 2005;18:341-4. 18. Temtamy SA, Aglan MS. Brachydactyly. Orphanet J Rare Dis 2008;3:15. 19. Welch JP, Temtamy SA. Hereditary contractures of the fingers (camptodactyly). J Med Genet
1966;3:104-13. 20. Hamilton KL, Netscher DT. Multidigit camptodactyly of the hands and feet: A case study. Hand (N Y)
2013;8:324-9. 21. Chong AK. Common congenital hand conditions. Singapore Med J 2010;51:965-71. 22. Piazza V, Beltramello M, Menniti M et al. Functional analysis of R75Q mutation in the gene coding for
Connexin 26 identified in a family with nonsyndromic hearing loss. Clin Genet 2005;68:161-6. 23. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat
Methods 2012;9:671-5. 24. Seki A, Coombs W, Taffet SM, Delmar M. Loss of electrical communication, but not plaque formation,
after mutations in the cytoplasmic loop of connexin43. Heart Rhythm 2004;1:227-33. 25. Makita N, Seki A, Sumitomo N et al. A connexin40 mutation associated with a malignant variant of
progressive familial heart block type I. Circ Arrhythm Electrophysiol 2012;5:163-72. 26. Nishii K, Seki A, Kumai M et al. Connexin45 contributes to global cardiovascular development by
establishing myocardial impulse propagation. Mech Dev 2016;140:41-52. 27. Sohal DS, Nghiem M, Crackower MA et al. Temporally regulated and tissue-specific gene
manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res 2001;89:20-5.
28. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. A global double-fluorescent Cre reporter mouse. Genesis 2007;45:593-605.
29. Nishii K, Tsuzuki T, Kumai M et al. Abnormalities of developmental cell death in Dad1-deficient mice. Genes Cells 1999;4:243-52.
30. Hagendorff A, Schumacher B, Kirchhoff S, Luderitz B, Willecke K. Conduction disturbances and increased atrial vulnerability in Connexin40-deficient mice analyzed by transesophageal stimulation. Circulation 1999;99:1508-15.
31. Appleton GO, Li Y, Taffet GE et al. Determinants of cardiac electrophysiological properties in mice. J Interv Card Electrophysiol 2004;11:5-14.
32. Narula OS, Shantha N, Vasquez M, Towne WD, Linhart JW. A new method for measurement of sinoatrial conduction time. Circulation 1978;58:706-14.
33. Lavergne J. Dimensions mésio-distales et vestibulo-linguales des dents humaines permanentes. Bulletins et Mémoires de la Société d'anthropologie de Paris, XIII° Série, 1974:351-355.
34. de Groot NM, Schalij MJ, Zeppenfeld K, Blom NA, Van der Velde ET, Van der Wall EE. Voltage and activation mapping: how the recording technique affects the outcome of catheter ablation procedures in patients with congenital heart disease. Circulation 2003;108:2099-106.
35. Nakagawa H, Shah N, Matsudaira K et al. Characterization of reentrant circuit in macroreentrant right atrial tachycardia after surgical repair of congenital heart disease: isolated channels between scars allow "focal" ablation. Circulation 2001;103:699-709.
36. Bell J. Brachydactyly and symphalangism. London: Cambridge University Press, 1951. 37. Maeda S, Nakagawa S, Suga M et al. Structure of the connexin 26 gap junction channel at 3.5 A