Page 1
1
Oncolytic herpes virus armed with vasculostatin in combination with bevacizumab
abrogate glioma invasion via the CCN1 and AKT signaling pathways
Running title: Oncolytic herpes virus and bevacizumab combination
Yusuke Tomita 1, Kazuhiko Kurozumi
1, Ji Young Yoo
2, Kentaro Fujii
1, Tomotsugu
Ichikawa 1, Yuji Matsumoto
1, Atsuhito Uneda
1, Yasuhiko Hattori
1, Toshihiko Shimizu
1,
Yoshihiro Otani 2, Tetsuo Oka
1, Balveen Kaur
2, Isao Date
1
1Department of Neurological Surgery, Okayama University Graduate School of
Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan 2Department of Neurosurgery, University of Texas Health Science Center at Houston,
Houston, Texas, USA
Correspondence should be addressed to Kazuhiko Kurozumi:
Department of Neurological Surgery, Okayama University Graduate School of
Medicine, 2-5-1 Shikata-cho, Kita-ku, Okayama 700-0914, Japan
Tel: (+81) 86-235-7336
Fax: (+81) 86-227-0191
E-mail: [email protected]
Total number of figures: 6 figures and 4 supplementary figures
Funding
This study was supported by Japan Society for the Promotion of Science to K.Kurozumi
(No. 26462182; No.17K10865).
Conflict of Interest
All authors certify that they have no affiliations with, or involvement in, any
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 2
2
organization or entity with any financial interest (such as honoraria; educational grants;
participation in speakers' bureaus; membership, employment, consultancies, stock
ownership, or other equity interest; and expert testimony or patent-licensing
arrangements) or non-financial interest (such as personal or professional relationships,
affiliations, knowledge, or beliefs) in the subject matter or materials discussed in this
manuscript.
Abbreviations
HSV, herpes simplex virus; OV, oncolytic virus; HSVQ, attenuated herpes simplex
virus; RAMBO, Rapid Antiangiogenesis Mediated By Oncolytic virus; rQNestin34.5,
oncolytic HSV-1 mutant expressing ICP34.5 under nestin promotor; 34.5ENVE, viral
ICP34.5 Expressed by Nestin promotor and Vstat120 Expressing; VEGF, vascular
endothelial growth factor; BEV, bevacizumab; CM, conditioned medium; CSK,
C-terminal Src kinase; SHC3, SHC (Src homology 2 domain containing) transforming
protein 3; PTK2, protein tyrosine kinase 2; CAV, caveolin 3; SOS1, Son of sevenless
homolog 1 (Drosophila); CCN1, cysteine-rich protein 61; GAPDH, glyceraldehyde
3-phosphate dehydrogenase
Keywords: glioma, invasion, bevacizumab, VEGF, oncolytic herpes virus
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 3
3
Abstract
Anti-vascular endothelial growth factor treatments such as bevacizumab have
demonstrated convincing therapeutic advantage in glioblastoma patients. However,
bevacizumab has also been reported to induce invasiveness of glioma. In this study, we
examined the effects of Rapid Antiangiogenesis Mediated By Oncolytic virus
(RAMBO), an oncolytic herpes simplex virus-1 expressing vasculostatin, on
bevacizumab-induced glioma invasion. The effect of the combination of RAMBO and
bevacizumab in vitro was assessed by cytotoxicity, migration, and invasion assays. For
in vivo experiments, glioma cells were stereotactically inoculated into the brain of mice.
RAMBO was intratumorally injected seven days after tumor inoculation, and
bevacizumab was administered intraperitoneally twice a week. RAMBO significantly
decreased both the migration and invasion of glioma cells treated with bevacizumab. In
mice treated with bevacizumab and RAMBO combination, the survival time was
significantly longer and the depth of tumor invasion was significantly smaller than those
treated with monotherapy of bevacizumab. Interestingly, RAMBO decreased the
expression of cysteine-rich protein 61 and phosphorylation of AKT, which were
increased by bevacizumab. These results suggest that RAMBO suppresses
bevacizumab-induced glioma invasion, which could be a promising approach to glioma
therapy.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 4
4
Introduction
Gliomas represent about 30% of primary brain tumors. Despite numerous efforts to develop new
treatments for malignant gliomas, therapeutic options remain limited and the prognosis is still poor (1,2).
Temozolomide is the only agent validated for its effectiveness on overall survival, and its concomitant use
with radiotherapy is the standard therapy for malignant glioma (3). Many investigators continue to seek
novel therapeutic approaches for glioma including surgery, chemotherapy, radiotherapy, immunotherapy,
and combination therapies.
Antiangiogenic therapy is one of the strategies used to treat glioblastoma. Glioblastoma cells secrete
high levels of vascular endothelial growth factor (VEGF). Bevacizumab binds to all VEGF isoforms,
causing reduced tumor vascularization, reduced vascular permeability, and the inhibition of tumor growth
(4). Bevacizumab, which targets pro-angiogenic VEGF, is a recombinant humanized monoclonal antibody
that was approved as a chemotherapeutic agent for primary and recurrent glioblastoma in Japan. Its
clinical use is increasing, even though its advantages on overall survival were lacking in previous trials
(5,6). Recent studies indicated that anti-VEGF therapy induced glioma invasion via several mechanisms
including the integrin-related pathway (7,8), indicating it is important to test the potential uses of
bevacizumab in combination therapies.
Oncolytic viral (OV) therapy has appeared as a promising treatment modality that utilizes the
tumor-specific properties (9). Oncolytic herpes simplex viruses (HSVs) is designed to replicate and have
cytotoxicity selectively in tumor cells, but not in normal tissues. Oncolytic HSVs include genetically
engineered viruses such as talimogene laherparepvec, and a spontaneously mutated virus without the
insertion of foreign genes, such as HF10 (10). Intralesional talimogene laherparepvec administration
improved durable response rates in a randomized phase III trial (11), for which the accelerated Food and
Drug Administration approved to use oncolytic HSVs for patients with recurrent melanoma. Phase I and
II trials of HF10 in patients with recurrent metastatic breast carcinoma, recurrent head and neck squamous
cell carcinoma, advanced pancreatic carcinoma, refractory and superficial cancers, and melanoma have
been successfully conducted (10). There are several challenges regarding oncolytic HSVs, such as their
rapid clearance by host immune responses, and limited intratumoral spread of the virus. To overcome
these challenges, genetic engineering of OVs or combination therapy with OVs and systemic treatments
such as molecular targeting drugs have been suggested (12-17).
Vasculostatin (Vstat120), the extracellular fragment of brain-specific angiogenesis inhibitor 1 (BAI-1),
is a potent anti-angiogenic and anti-tumorigenic factor (18,19). Vasculostatin contains an
integrin-antagonizing RGD (Arg-Gly-Asp) motif, five thrombospondin type 1 repeats, a GPS
(G-protein-coupled receptor proteolytic site) domain and seven-transmembrane domains (18,20). The
BAI-1 expression is negatively correlated with pathological grading, angiogenesis and brain edema in
gliomas (21). A vasculostatin-armed oncolytic HSV-1, termed Rapid Antiangiogenesis Mediated By
Oncolytic virus (RAMBO) , significantly suppressed intracranial and subcutaneous glioma growth in
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 5
5
mouse glioma models compared with control virus (12,13). Furthermore, Fujii et al. reported the efficacy
of combination therapy with cyclic RGD peptide and RAMBO for malignant glioma (12). We
hypothesized that bevacizumab and RAMBO combination therapy has a synergic effect, because
vasculostatin expressed by RAMBO might antagonize integrin-related pathways induced by
bevacizumab.
In this study, we evaluated RAMBO and bevacizumab combination treatment of glioma. RAMBO
reduced bevacizumab-induced glioma invasion with vasculostatin expressed by RAMBO-infected glioma
cells. Evaluation of the invasive mechanism revealed the decreased activation of AKT signaling pathways
in cells treated with combined RAMBO and bevacizumab.
Materials and Methods
Cell lines, drugs, and viruses
U87ΔEGFR was initially engineered by the Cavenee laboratory at the Ludwig Institute for Cancer
Research, New York, NY, USA. U251MG was obtained from Dr. Balveen Kaur at Ohio State University,
Columbus, OH, USA. U87MG was obtained from the American Type Culture Collection. Vero cells were
purchased from American Type Culture Collection and used for viral replication. Glioma cells and Vero
cells were prepared and maintained as described previously (14). MGG23 was provided by Dr. Hiroaki
Wakimoto and cultured as previously described (22,23). All cells were cultured at 37°C in an atmosphere
containing 5% CO2. U87ΔEGFR, U251MG, and U87MG were authenticated by Promega (Madison, WI,
USA) via short tandem repeat profiling in December 2016. Mycoplasma was negative in all cells.
Bevacizumab was purchased from Genentech (San Francisco, CA)/Roche (Basel,
Switzerland)/Chugai Pharmaceutical Co (Tokyo, Japan).
The construction and efficacy of HSVQ, a first generation OV deleted for both copies of ICP34.5 and
disrupted for ICP6, and RAMBO, a Vstat120-expressing OV within the context of HSVQ1, have been
previously described (13,14,17,24,25). HSVQ1 was engineered by the Chiocca laboratory, and RAMBO
was originally engineered by the Chiocca and Kaur laboratories.
Cytotoxicity assay
The cytotoxicity of U87ΔEGFR, U251MG, U87MG, and MGG23 glioma cells were analyzed using
the water-soluble tetrazolium (WST)-1 according to the manufacturer’s instructions (Roche Molecular
Biochemicals, Mannheim, Germany). We performed WST-1 quantitative colorimetric assay for cell
survival as previously described (12).
In vitro migration assay
U87ΔEGFR, U251MG, and U87MG glioma cells were infected with RAMBO or HSVQ dissolved in
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 6
6
DMEM with 0.1% FBS at MOI 2, and conditioned medium (CM) was harvested 14 hours later by
centrifugation, as previously reported (12).
The scratch wound assay was performed as previously described (12,26). Glioma cells were exposed
to bevacizumab from 72 hours before assessment. Medium was changed to CM or DMEM with 0.1%
fetal bovine serum, and the indicated concentration of bevacizumab was added. Glioma cells were
assessed by counting migrating cells in the area of the gap every 6 hours to 24 hours (Keyence, Osaka,
Japan).
An in vitro migration assay was performed using a 24-well plate and ThinCert™ (8 μm-pore, 24-well
format, Greiner Bio-One) according to the manufacturer’s instructions, as previously reported (26,27).
In vitro invasion assay
The in vitro invasion assay was performed using a BioCoat Matrigel invasion chamber (24-well
format, Corning Incorporated) according to the manufacturer’s instructions. 5 × 104 cells were seeded in
CM or DMEM with 0.1% FBS in the upper chamber, followed by treatment with bevacizumab or PBS, as
previously described (26,27).
In another in vitro invasion assay, MGG23 cells were seeded in a 96-well ultra-low attachment plate
(Costar, Corning Incorporated, NY, USA) at a density of 1.0 × 103 cells/well in 25 μl of medium,
followed by treatment with viruses and bevacizumab to the indicated wells. After centrifugation to
assemble all the cells to the center, matrigel (25 μg/insert, Becton Dickinson, Franklin Lakes, USA) was
added to each well. Digital photomicrographs of the midplane of spheroids were taken daily with a
BZ-8100 microscope (Keyence, Osaka, Japan). Core and invasive diameter were measured using ImageJ
(http://rsb.info.nih.gov/ij/) and the radius of invasion was calculated, as previously described (28).
Brain Xenografts
All experiments were conducted in accordance with the guidelines of the Okayama University Animal
Research Committee. All procedures and animal protocols were approved by the Committee on the Ethics
of Animal Experimentation at Okayama University, as previously described (27). U87ΔEGFR cells were
injected into athymic mice (CLEA japan Inc., Tokyo, Japan), and MGG23 cells were injected into severe
combined immunodeficiency mice (Charles River Laboratories Japan, Yokohama, Japan), respectively.
Glioma cells (2 × 105 cells) were stereotactically injected into the right frontal lobe, as previously
described (7). Five days after implantation of the glioma cells, mice were treated with bevacizumab at the
indicated concentration or PBS intraperitoneally twice a week. Seven days after inoculation of the glioma
cells, anesthetized mice were stereotactically injected with the indicated plaque forming units of RAMBO
at the same location as the tumor.
In both mouse glioma models, the survival time was assessed with a Kaplan-Meier survival analysis.
U87ΔEGFR harboring mise were sacrificed 18 days after tumor implantation or if they showed signs of
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 7
7
morbidity for pathological analysis, qRT-PCR and western blotting. MGG23 harboring mise were
sacrificed 50 days after tumor implantation for pathological analysis.
Immunohistochemistry
Surgically excised brains from mouse glioma models were fixed with 4% paraformaldehyde,
embedded in paraffin, and 4-μm sections were prepared. Immunohistochemistry analyses were carried out
as previously described (7,25). Anti-human leukocyte antigen monoclonal antibody (1:100 dilution,
Abcam Inc.) was used for the staining, and mouse immunoglobulin was used as a negative control. The
sections were stained with Dako Envision + System-HRP Kit in accordance with the manufacturer’s
protocol (DakoCytomation), and were counterstained with hematoxylin. Immunohistochemistry samples
were observed with a BZ-8100 microscope.
RNA isolation, cDNA synthesis and qRT–PCR
We isolated total RNA from the cell lines or tumor specimens. Syntheses of cDNA and qRT–PCR
procedures were conducted as previously described (26,29). As an internal control, we used
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. The primer sequences used were as
follows: Human C-terminal Src kinase (CSK) primers: forward, gacgtgtggagtttcggaat; reverse,
agctgctctcggagctgtag. Human SHC (Src homology 2 domain containing) transforming protein 3 (SHC3)
primers: forward, agagtgtggaaggctcagga; reverse, gtgctttttcagcgagaacc. Human protein tyrosine kinase 2
(PTK) primers: forward, cttctgcagtttccccagag; reverse, ccaggtggttggctcactat. Human Caveolin 3 (CAV)
primers: forward, tttgccaagaggcagctact; reverse, accctttactggagccacct. Human Son of sevenless homolog
1 (SOS1) primers: forward, ccttgcttgaggttttctgc; reverse, gcagatgctgatgaaccaga. Human cysteine rich
protein 61 (CCN1) primers: forward, cctcgcatcctatacaacccttta; reverse, gattctgacactcttctcccttgt. Human
GAPDH primers: forward, gacctgccgtctagaaaaacc; reverse, gctgtagccaaattcgttgtc.
Western blot analysis
We prepared cell lysates and proteins using RIPA buffer and phenyl-methylsulfonyl fluoride (Cell
Signaling Technology, Danvers, MA, USA), as previously described (28). Then, we performed western
blotting as previously described (15,27). After blocking, membranes were incubated overnight with
primary antibodies (anti-CYR61, 1:100, Novus Biologicals, Littleton, Co., USA; anti-AKT, 1:1000, Cell
Signaling Technology; anti-p-AKT, 1:1000, Cell Signaling Technology; and anti-GAPDH, 1:1000, Cell
Signaling Technology; anti-BAI1, 1:200, WuXi Biosciences) at 4°C. The secondary antibodies used were
horseradish peroxidase-conjugated anti-mouse IgG and HRP-conjugated anti-rabbit IgG (Cell Signaling
Technology, 1:5000). HRP signals were analyzed by the VersaDoc molecular imaging system (Bio-Rad,
Hercules, CA, USA).
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 8
8
Statistical analysis
The changes in cell death, migration and invasion were analyzed using one-way analysis of variance
(ANOVA) followed by Tukey’s post hoc test. Kaplan-Meier survival curves were compared using the
log-rank test. Data on mRNA expression obtained by quantitative real-time PCR were analyzed by
one-way ANOVA followed by Scheffe’s post hoc test. Data on protein expression obtained by western
blotting were analyzed using ANOVA followed by Tukey’s post hoc test. All statistical analyses were
performed using SPSS statistical software (version 20; SPSS, Inc., Chicago, IL, USA).
Results
Cytotoxic effect of combination therapy with bevacizumab and RAMBO
The cytotoxic effect of combined bevacizumab and RAMBO on glioma cells was investigated by
WST-1 proliferation assay. Glioma cell lines and glioma stem cells were incubated with the indicated
concentrations of bevacizumab or RAMBO at the indicated MOI. Treatment with RAMBO decreased
viable cells compared with saline as a control in a time-dependent manner. After treatment with RAMBO,
U87ΔEGFR cells were aggregated and floated from the dishes, whereas MGG23 cells were dissociated
and adhered to the dishes (Figure 1A). There was a significant decrease in viable cells treated with
RAMBO compared with saline treatment of each cell line at 48 and 72 hours (U87ΔEGFR, p<0.001;
U251MG, p<0.001; U87MG, p<0.001; MGG23, p<0.001). However, bevacizumab had no cytotoxic
effect against glioma cells and did not increase the cytotoxicity of RAMBO against glioma cells (Figure
1B).
Supernatant from RAMBO-infected glioma cells inhibits glioma cell migration in
vitro.
To examine the in vitro effect of vasculostatin on GBM cell migration over time, we performed a
scratch wound assay using bevacizumab and conditioned medium (CM). The supernatant of malignant
glioma cells infected by RAMBO was centrifuged and filtrated to eliminate virus and cell lysates, then it
was used as RAMBO-CM. Infection of each cell line by oncolytic virus was detected by the expression of
GFP implanted into the viral sequence (Supplementary Figure 1A). In the RAMBO-infected glioma cells,
the expression of vasculostatin was detected by western blotting (Supplementary Figure 1B).
Vasculostatin in CM had no cytotoxic effect against glioma cells similar to fresh medium (Supplementary
Figure 1C). The rate of migrating cells was assessed every 6 hours after scratch formation and we
performed Giemsa staining 24 hours after scratch formation (Figure 2A, Supplementary Figure 2A-B).
RAMBO CM significantly reduced the rate of migration of each cell line compared with saline control
(U87ΔEGFR: p<0.001, U251MG: p<0.001, and U87MG: p<0.001). Furthermore, the rate of migrating
cells induced by bevacizumab treatment was reduced by RAMBO CM (U87ΔEGFR: p<0.001, U251MG:
p<0.001, and U87MG: p<0.001) (Figure 2B). We also performed another migration assay using ThinCert
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 9
9
for an enhanced quantitative analysis (Figure 2C). Bevacizumab significantly increased the migration of
each cell line compared with saline control (U87ΔEGFR: p<0.001, U251MG: p<0.001, and U87MG:
p<0.001). Furthermore, the rate of migrating cells induced by bevacizumab treatment was reduced by
RAMBO CM (U87ΔEGFR: p<0.001, U251MG: p<0.001, and U87MG: p=0.010) (Figure 2D).
RAMBO-infected glioma cells inhibit glioma cell invasion in vitro.
To examine the in vitro effect of vasculostatin on GBM cell invasion, we performed a matrigel
invasion assay with a Corning chamber using bevacizumab and CM. The supernatant of malignant glioma
cells infected by RAMBO or HSVQ was centrifuged and filtrated to eliminate virus and cell lysate, then
they were used as RAMBO-CM or HSVQ-CM. The expression of vasculostatin was detected by western
blotting in RAMBO-infected glioma cells but not in HSVQ-infected glioma cells (Supplementary Figure
1B). Giemsa staining was performed 24 hours after seeding glioma cells into the upper chamber, and then
cells invading through the membrane were counted (Figure 3A). RAMBO CM significantly reduced the
number of invading cells of each cell line compared with saline control (U87ΔEGFR: p<0.001, U251MG:
p<0.001, and U87MG: p<0.001). Furthermore, the invading cells induced by bevacizumab treatment were
reduced by RAMBO CM (U87ΔEGFR: p<0.001, U251MG: p<0.001, and U87MG: p<0.001) (Figure
3B).
To examine the in vitro effect of vasculostatin on GBM stem cell invasion, we performed Matrigel
invasion assays (p<0.01) (Figure 3C). After measurement of the core and invasive diameter, the
proportion of invasion was calculated. Bevacizumab significantly increased the proportion of glioma cell
invasion compared with saline controls (p=0.001). Combination therapy with bevacizumab and RAMBO
significantly inhibited bevacizumab-induced glioma cell invasion of MGG23 cells (p=0.001), whereas
combination therapy with bevacizumab and HSVQ did not inhibit bevacizumab-induced glioma cell
invasion of MGG23 (p=0.062) (Figure 3D).
Anti-tumor efficacy of combination therapy with bevacizumab and RAMBO in
xenograft mice.
The antitumor effect of combination with bevacizumab and RAMBO was tested in mice harboring
intracerebral U87ΔEGFR glioma cells. Seven days after tumor cell implantation we injected RAMBO or
HSVQ into the brain tumor at the indicated pfu . Five days after tumor inoculation bevacizumab was
injected into intraperitoneal twice a week (Figure 4A). The survival of mice in each group (7 mice per
group) was compared by Kaplan-Meier analysis.
We assessed the efficacy of combination with RAMBO or HSVQ at 1.0 × 105 pfu and bevacizumab at
10 mg/kg. Mice bearing U87ΔEGFR glioma cells treated with saline, bevacizumab at 10 mg/kg, RAMBO
at 1.0 × 105 pfu, HSVQ at 1.0 × 105 pfu and bevacizumab at 10 mg/kg, and RAMBO at 1.0 × 105 pfu and
bevacizumab at 10 mg/kg were compared. Control mice treated with PBS had a median survival of 17
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 10
10
days after tumor cell implantation, and mice treated with RAMBO had a median survival of 28 days after
tumor cell inoculation that was similar to that of PBS-treated mice. Mice treated with bevacizumab had a
median survival of 37 days. Mice treated with HSVQ and bevacizumab combination had a median
survival of 46 days, which did not reach statistical significance compared with bevacizumab monotherapy
(p=0.075). However, mice treated with bevacizumab and RAMBO combination had a median survival of
64 days, which was significantly longer than mice treated with PBS, RAMBO alone, bevacizumab alone,
and bevacizumab and HSVQ combination (Log-rank test: p<0.001, p<0.001, p<0.001, and p=0.001,
respectively) (Figure 4B).
Next, we performed survival analysis using glioma stem cells. We compared immunodeficient mice
bearing MGG23 cells treated with saline, bevacizumab at 10 mg/kg, HSVQ at 1.0 × 105 pfu as
monotherapy, HSVQ at 1.0 × 105 pfu and bevacizumab at 10 mg/kg, and RAMBO at 1.0 × 105 pfu and
bevacizumab at 10 mg/kg. Control mice treated with PBS had a median survival of 62 days, and mice
treated with bevacizumab had a median survival of 61 days. Mice treated with RAMBO as monotherapy
had a median survival of 65 days after tumor cell inoculation, which was significantly longer than mice
treated with PBS (p=0.001). Mice treated with HSVQ and bevacizumab combination had a median
survival of 65 days after glioma cell implantation, which reached statistical significance compared with
bevacizumab monotherapy (p=0.001). Furthermore, mice treated with bevacizumab and RAMBO
combination had a median survival of 70 days, which was significantly longer than mice treated with
bevacizumab monotherapy, RAMBO monotherapy, HSVQ and bevacizumab combination, or untreated
mice (p=0.001, p=0.005, p=0.001, and p=0.001, respectively) (Figure 5A).
Effect of RAMBO on bevacizumab-induced invasion in vivo.
To address the therapeutic effect against glioma invasion, we evaluated combination therapy with
RAMBO at 1.0 × 105 pfu and bevacizumab at 10 mg/kg. RAMBO and bevacizumab were administered
using the same schedule as for the survival analysis (Figure 4A).
Eighteen days after tumor inoculation athymic mice with U87ΔEGFR glioma were sacrificed.
Immunohistochemical staining using anti-human leukocyte antigen was performed, and then glioma
invasion was assessed by the distance between the mass edge of tumor and invasive area (Figure 4C).
After treatment with bevacizumab, the tumor border showed tumor invasion. Anti-VEGF therapy with
bevacizumab significantly increased cell invasion compared with saline controls (p=0.010). However,
combination therapy with bevacizumab and RAMBO significantly decreased the depth of glioma
invasion induced by bevacizumab (p=0.006, Figure 4D).
Next, immunodeficient mice harboring MGG23 glioma stem cells were sacrificed at 50 days after
tumor implantation, and immunohistochemical staining with anti-human leukocyte antigen was
performed. MGG23 cells treated with bevacizumab as monotherapy showed a greater invasion to the
ipsilateral cerebral cortex adjacent to the injection site and to the contralateral corpus callosum compared
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 11
11
with saline controls or the bevacizumab and RAMBO treated group (Figure 5B). We assessed invasion
activity with the number of cells in the ipsilateral or contralateral cerebral cortex, as previously reported
(27). There was a significant increase of glioma cells invading into the cerebral cortex in the MGG23 cell
treated with bevacizumab group compared with saline controls (ipsilateral cortex: p=0.016, contralateral
cortex: p<0.001). However, combination therapy with bevacizumab and RAMBO significantly decreased
the depth of glioma invasion induced by bevacizumab (ipsilateral cortex: p=0.002, contralateral cortex:
p<0.001, Figure 5C). These results indicated that RAMBO reduced invasion with bevacizumab.
Mechanism of combination therapy compared with bevacizumab alone in the
U87ΔEGFR orthotopic mouse model
To investigate the mechanism of the anti-tumor effect of combination therapy with bevacizumab and
RAMBO, we performed quantitative PCR analysis. We chose the integrin-related cell adhesion pathway
and hepatocyte growth factor receptor signaling pathway because we previously reported its relationship
to bevacizumab-induced invasion (7). Relative expression levels of CSK, SHC3, PTK, CAV, SOS1 and
CCN1 in the U87ΔEGFR mouse model with bevacizumab were upregulated 1.84-, 1.35-, 2.35-, 6.98-,
3.95- and 3.34-fold, respectively compared with the control group. In particular, only CCN1 expression
was significantly reduced in tumors treated with bevacizumab and RAMBO as combination therapy
compared with those treated with bevacizumab alone (Figure 6A-6F, p<0.05).
Western blotting was performed to investigate the relationship between CCN1 and the AKT pathway
(Figure 6G). Tumors treated with bevacizumab showed significantly higher CCN1 activation than those
treated with saline (p=0.013) and those treated with bevacizumab and RAMBO as combination therapy
(p=0.001). In addition, tumors treated with bevacizumab showed significantly higher p-AKT at Ser473
than those treated with saline (p=0.024), but bevacizumab and RAMBO as combination therapy
significantly reduced AKT phosphorylation compared with bevacizumab (p<0.001, Figure 6H). Full scans
of the western blotting are shown in Supplementary Figure 3.
These results demonstrated that vasculostatin expressed by RAMBO and ENVE34.5 reduced CCN1
expression and AKT phosphorylation induced by bevacizumab.
Discussion
In 2009 the US Food and Drug Administration conditionally approved bevacizumab for patients with
recurrent glioblastoma. Lately, prospective two phase III trials of newly diagnosed patients, AVAglio and
RTOG 0825, showed that overall survival did not reach statistical significance although these studies
decreased the risk of progression-free survival in patients (5,6). Our data showed that
U87ΔEGFR-bearing mice treated with bevacizumab had significantly longer survival than those treated
with saline. Although U87dEGFR has a poor-invasive phenotype in contrast to clinical glioblastomas, this
cell line has been used in several experimental studies to evaluate glioma invasion. In contrast to
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 12
12
U87ΔEGFR, bevacizumab had no significant anti-tumor effect against MGG23-bearing mice compared
with saline, which was similar to the results of multiple Phase III clinical trials. A study using a mouse
model reported showed that bevacizumab significantly reduced tumor growth (30). Our results showed
that invasive activity increased by bevacizumab seemed to counteract the effectiveness of bevacizumab in
the diffuse invasion glioma model. Moreover, our experiments using two different mouse glioma models
indicated that RAMBO inhibited glioma cell invasion induced by bevacizumab, resulting in a synergistic
effect.
Previous reports indicated that tumor invasiveness was increased by anti-VEGF therapy (7). de Groot
et al. described three patients who, during bevacizumab therapy, developed infiltrative lesions visible by
MRI and reported pair imaging features seen on MRI with histopathologic findings (31). In this report,
we showed that glioma migration and invasion were increased by bevacizumab, similar to previous
reports (7,32). Interestingly, our data also showed that invasive activities of glioma cells were increased
by bevacizumab both in the poor-invasive model using U87ΔEGFR and in the diffuse invasive model
using MGG23, indicating that bevacizumab increased glioma cell invasion regardless of the original
invasive activity.
RAMBO is composed of cDNA encoding for human vasculostatin (Vstat120) within the backbone of
HSVQ (13). Vasculostatin was reported to enhance the anti-tumor effect of oncolytic HSV-1 (13,33).
Vasculostatin is an extracellular fragment of brain angiogenesis inhibitor 1, whose expression is reduced
in several malignancies (20,24,34-36). The re-expression of vasculostatin had an anti-angiogenic effect,
which enhanced antitumor therapeutic efficacy (9,37). Vasculostatin was expressed only from
RAMBO-infected glioma cells, which indicated that the effect of vasculostatin was only seen in cells or
mice treated with RAMBO. Interestingly, combination therapy with RAMBO and bevacizumab but not
HSVQ reduced bevacizumab-induced migration and invasion, and prolonged the survival time of
glioma-bearing mice compared with combination therapy with HSVQ and bevacizumab. These results
indicated that vasculostatin increases anti-tumor effects by reducing glioma migration and invasion.
The integrin-related cell adhesion pathways were reported to be involved in the mechanism of glioma
invasion. DeLay et al. revealed a hyperinvasive phenotype, a resistance pattern of glioblastoma, after
bevacizumab therapy and which was upregulated with integrin α5 and fibronectin 1 (38). Jahangiri et al.
showed that c-Met and β1 integrin were upregulated in bevacizumab-resistant glioblastomas (32). We
previously reported that bevacizumab treatment led to increased cell invasion via an integrin signaling
pathway (7).
Oncolytic HSV-1 therapy increases integrin-activating CCN1 protein in the tumor extracellular matrix.
Kurozumi et al. reported that the oncolytic HSV-1 infection of tumors induced angiogenesis and
upregulated CCN1 (9). Haseley et al. reported that CCN1 limited the efficacy of oncolytic viral therapy
via an integrin signaling pathway that mediated activation of a type-I antiviral interferon response (39).
RAMBO contains vasculostatin in its construct and has five thrombospondin type 1 domains within its N
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 13
13
terminal sequence and an integrin antagonizing RGD motif (13,17,19,40,41). Here, we report that CCN1
expression was upregulated by bevacizumab, and that its upregulation was suppressed by RAMBO.
Previous reports showed that HSV-1 without vasculostatin increased CCN1 expression in glioma cells (9).
Our results showed that HSV-1 expressing vasculostatin decreased CCN1 expression, indicating that the
expression of vasculostatin by oncolytic HSV reduced CCN1 induction by HSV-1 itself and by
bevacizumab.
The relationship between CCN1 and the AKT pathway was evaluated previously. In tumor cells, high
CCN1 expression was related to high Akt phosphorylation (42). Several reports indicated that targeting
CCN1 expression might mediate AKT phosphorylation and tumor cell migration(43,44). From our data,
combination therapy with bevacizumab and RAMBO significantly decreased the phosphorylation of AKT.
Paw et al. previously reported a relationship between the PI3K/AKT pathway and MMP9 expression,
which induced glioma cell invasion (45). Therefore, glioma cell invasion via the CCN1/Akt pathway was
reduced by vasculostatin expressing oncolytic virus but induced by bevacizumab.
The efficacy of combination viral therapy and chemotherapy has been reported previously. Cyclic
RGD peptide had a synergistic effect with viral therapy including adenovirus and HSV-1 (12,16). Ikeda et
al. showed that cyclophosphamide substantially increased herpes viral survival and propagation, leading
to neoplastic regression (46). Regarding anti-VEGF therapy, several reports described enhanced viral
distribution in tumors (30,47). In our study, the mechanism of the synergistic effect observed with
bevacizumab and RAMBO involved the bevacizumab-enhanced distribution of RAMBO in the tumors,
and RAMBO-induced reduction of glioma cell invasion promoted by bevacizumab.
CCN1 interacts with integrins, such as αvβ3, α6β1, αvβ5, and αIIβ3, leading to a wide range of
biological activities, including cell adhesion, migration, and invasion (48). In addition, exogenous CCN1
in the glioma ECM orchestrated a cellular antiviral response that reduced viral replication and limited the
efficacy of the oncolytic virus (39). In this paper, we showed the synergistic effect of combined
bevacizumab and RAMBO combination against glioma cells. This synergetic effect might not be
clinically relevant because we only used cell lines without heterogeneity, although our survival analysis
indicated bevacizumab and RAMBO combination therapy was effective even against a diffuse invading
model using glioma stem cells. In the future, we plan to evaluate the effectiveness of bevacizumab or
RAMBO combinations using several types of glioma stem cells or primary cultures from glioblastoma
patients, that will be more relevant to clinical trials.
Bevacizumab monotherapy or combination treatment with radiation and/or temozolomide is well
tolerated and exhibits modest antitumor activity (6,49). Although bevacizumab has not been shown to
extend overall survival, it may have additional benefits in the setting of immunotherapy (50). Recently,
Currier et al. reported that the combined effect of oncolytic HSV virotherapy and anti-VEGF antibodies
was in part due to the modulation of a host inflammatory reaction to virus (51). In addition, Oka et al.
reported that CD8- and CD11c-positive cells infiltrated tumors treated with adenovirus vector (15). We
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 14
14
intend to evaluate the other combination therapies of bevacizumab and other oncolytic viruses, molecular
targeted therapy, and immunotherapy.
Our results indicate that combination therapy with bevacizumab and RAMBO had additional
therapeutic effects compared with monotherapy using bevacizumab or oncolytic virus. RAMBO-infected
glioma cells significantly reduced glioma migration and invasion induced by bevacizumab both in vitro
and in vivo. Combination therapy with bevacizumab and RAMBO significantly increased the anti-tumor
effect in a mouse glioma model. CCN1 expression was modulated by RAMBO to activate or inhibit AKT
phosphorylation, which promotes cell migration and invasion.
Conclusion
Our results indicated that vasculostatin-expressing OV therapy enhanced chemotherapy with
bevacizumab for malignant glioma by suppressing bevacizumab-induced glioma invasion via the AKT
signaling pathway. This may be a potential combination therapy for clinical use in patients with malignant
glioma.
Acknowledgments
We thank M. Arao and Y. Ukai for their technical assistance. We thank Nancy
Schatken, BS, MT (ASCP), from Edanz Group (www.edanzediting.com/ac) for editing
a draft of this manuscript.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 15
15
References
1. Penas-Prado M, Gilbert MR. Molecularly targeted therapies for malignant
gliomas: advances and challenges. Expert Rev Anticancer Ther
2007;7(5):641-61 doi 10.1586/14737140.7.5.641.
2. Sim HW, Morgan ER, Mason WP. Contemporary management of high-grade
gliomas. CNS Oncol 2017 doi 10.2217/cns-2017-0026.
3. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al.
Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N
Engl J Med 2005;352(10):987-96 doi 10.1056/NEJMoa043330.
4. Vredenburgh JJ, Desjardins A, Herndon JE, 2nd, Dowell JM, Reardon DA,
Quinn JA, et al. Phase II trial of bevacizumab and irinotecan in recurrent
malignant glioma. Clin Cancer Res 2007;13(4):1253-9 doi
10.1158/1078-0432.ccr-06-2309.
5. Chinot OL, Wick W, Mason W, Henriksson R, Saran F, Nishikawa R, et al.
Bevacizumab plus radiotherapy-temozolomide for newly diagnosed
glioblastoma. N Engl J Med 2014;370(8):709-22 doi 10.1056/NEJMoa1308345.
6. Gilbert MR, Dignam JJ, Armstrong TS, Wefel JS, Blumenthal DT, Vogelbaum
MA, et al. A randomized trial of bevacizumab for newly diagnosed glioblastoma.
N Engl J Med 2014;370(8):699-708 doi 10.1056/NEJMoa1308573.
7. Ishida J, Onishi M, Kurozumi K, Ichikawa T, Fujii K, Shimazu Y, et al. Integrin
inhibitor suppresses bevacizumab-induced glioma invasion. Transl Oncol
2014;7(2):292-302.e1 doi 10.1016/j.tranon.2014.02.016.
8. Piao Y, Liang J, Holmes L, Zurita AJ, Henry V, Heymach JV, et al.
Glioblastoma resistance to anti-VEGF therapy is associated with myeloid cell
infiltration, stem cell accumulation, and a mesenchymal phenotype. Neuro
Oncol 2012;14(11):1379-92 doi 10.1093/neuonc/nos158.
9. Kurozumi K, Hardcastle J, Thakur R, Shroll J, Nowicki M, Otsuki A, et al.
Oncolytic HSV-1 infection of tumors induces angiogenesis and upregulates
CYR61. Mol Ther 2008;16(8):1382-91 doi 10.1038/mt.2008.112.
10. Eissa IR, Naoe Y, Bustos-Villalobos I, Ichinose T, Tanaka M, Zhiwen W, et al.
Genomic Signature of the Natural Oncolytic Herpes Simplex Virus HF10 and Its
Therapeutic Role in Preclinical and Clinical Trials. Front Oncol 2017;7:149 doi
10.3389/fonc.2017.00149.
11. Andtbacka RH, Kaufman HL, Collichio F, Amatruda T, Senzer N, Chesney J, et
al. Talimogene Laherparepvec Improves Durable Response Rate in Patients
With Advanced Melanoma. J Clin Oncol 2015;33(25):2780-8 doi
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 16
16
10.1200/jco.2014.58.3377.
12. Fujii K, Kurozumi K, Ichikawa T, Onishi M, Shimazu Y, Ishida J, et al. The
integrin inhibitor cilengitide enhances the anti-glioma efficacy of
vasculostatin-expressing oncolytic virus. Cancer Gene Ther 2013;20(8):437-44
doi 10.1038/cgt.2013.38.
13. Hardcastle J, Kurozumi K, Dmitrieva N, Sayers MP, Ahmad S, Waterman P, et
al. Enhanced antitumor efficacy of vasculostatin (Vstat120) expressing oncolytic
HSV-1. Mol Ther 2010;18(2):285-94 doi 10.1038/mt.2009.232.
14. Kambara H, Okano H, Chiocca EA, Saeki Y. An oncolytic HSV-1 mutant
expressing ICP34.5 under control of a nestin promoter increases survival of
animals even when symptomatic from a brain tumor. Cancer Res
2005;65(7):2832-9 doi 10.1158/0008-5472.can-04-3227.
15. Oka T, Kurozumi K, Shimazu Y, Ichikawa T, Ishida J, Otani Y, et al. A super
gene expression system enhances the anti-glioma effects of adenovirus-mediated
REIC/Dkk-3 gene therapy. Sci Rep 2016;6:33319 doi 10.1038/srep33319.
16. Shimazu Y, Kurozumi K, Ichikawa T, Fujii K, Onishi M, Ishida J, et al. Integrin
antagonist augments the therapeutic effect of adenovirus-mediated REIC/Dkk-3
gene therapy for malignant glioma. Gene Ther 2015;22(2):146-54 doi
10.1038/gt.2014.100.
17. Yoo JY, Haseley A, Bratasz A, Chiocca EA, Zhang J, Powell K, et al. Antitumor
efficacy of 34.5ENVE: a transcriptionally retargeted and "Vstat120"-expressing
oncolytic virus. Mol Ther 2012;20(2):287-97 doi 10.1038/mt.2011.208.
18. Kaur B, Brat DJ, Devi NS, Van Meir EG. Vasculostatin, a proteolytic fragment
of brain angiogenesis inhibitor 1, is an antiangiogenic and antitumorigenic factor.
Oncogene 2005;24(22):3632-42 doi 10.1038/sj.onc.1208317.
19. Kaur B, Cork SM, Sandberg EM, Devi NS, Zhang Z, Klenotic PA, et al.
Vasculostatin inhibits intracranial glioma growth and negatively regulates in
vivo angiogenesis through a CD36-dependent mechanism. Cancer Res
2009;69(3):1212-20 doi 10.1158/0008-5472.can-08-1166.
20. Nishimori H, Shiratsuchi T, Urano T, Kimura Y, Kiyono K, Tatsumi K, et al. A
novel brain-specific p53-target gene, BAI1, containing thrombospondin type 1
repeats inhibits experimental angiogenesis. Oncogene 1997;15(18):2145-50.
21. Wang W, Da R, Wang M, Wang T, Qi L, Jiang H, et al. Expression of
brain-specific angiogenesis inhibitor 1 is inversely correlated with pathological
grade, angiogenesis and peritumoral brain edema in human astrocytomas. Oncol
Lett 2013;5(5):1513-8 doi 10.3892/ol.2013.1250.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 17
17
22. Wakimoto H, Kesari S, Farrell CJ, Curry WT, Jr., Zaupa C, Aghi M, et al.
Human glioblastoma-derived cancer stem cells: establishment of invasive
glioma models and treatment with oncolytic herpes simplex virus vectors.
Cancer Res 2009;69(8):3472-81 doi 10.1158/0008-5472.Can-08-3886.
23. Wakimoto H, Mohapatra G, Kanai R, Curry WT, Jr., Yip S, Nitta M, et al.
Maintenance of primary tumor phenotype and genotype in glioblastoma stem
cells. Neuro Oncol 2012;14(2):132-44 doi 10.1093/neuonc/nor195.
24. Kaur B, Brat DJ, Calkins CC, Van Meir EG. Brain angiogenesis inhibitor 1 is
differentially expressed in normal brain and glioblastoma independently of p53
expression. Am J Pathol 2003;162(1):19-27 doi
10.1016/s0002-9440(10)63794-7.
25. Terada K, Wakimoto H, Tyminski E, Chiocca EA, Saeki Y. Development of a
rapid method to generate multiple oncolytic HSV vectors and their in vivo
evaluation using syngeneic mouse tumor models. Gene Ther 2006;13(8):705-14
doi 10.1038/sj.gt.3302717.
26. Shimizu T, Ishida J, Kurozumi K, Ichikawa T, Otani Y, Oka T, et al.
delta-Catenin Promotes Bevacizumab-Induced Glioma Invasion. Mol Cancer
Ther 2019;18(4):812-22 doi 10.1158/1535-7163.MCT-18-0138.
27. Otani Y, Ichikawa T, Kurozumi K, Inoue S, Ishida J, Oka T, et al. Fibroblast
growth factor 13 regulates glioma cell invasion and is important for
bevacizumab-induced glioma invasion. Oncogene 2017 doi
10.1038/onc.2017.373.
28. Young N, Pearl DK, Van Brocklyn JR. Sphingosine-1-phosphate regulates
glioblastoma cell invasiveness through the urokinase plasminogen activator
system and CCN1/Cyr61. Mol Cancer Res 2009;7(1):23-32 doi
10.1158/1541-7786.Mcr-08-0061.
29. Kurozumi K, Hardcastle J, Thakur R, Yang M, Christoforidis G, Fulci G, et al.
Effect of tumor microenvironment modulation on the efficacy of oncolytic virus
therapy. J Natl Cancer Inst 2007;99(23):1768-81 doi 10.1093/jnci/djm229.
30. Tan G, Kasuya H, Sahin TT, Yamamura K, Wu Z, Koide Y, et al. Combination
therapy of oncolytic herpes simplex virus HF10 and bevacizumab against
experimental model of human breast carcinoma xenograft. Int J Cancer
2015;136(7):1718-30 doi 10.1002/ijc.29163.
31. de Groot JF, Fuller G, Kumar AJ, Piao Y, Eterovic K, Ji Y, et al. Tumor invasion
after treatment of glioblastoma with bevacizumab: radiographic and pathologic
correlation in humans and mice. Neuro Oncol 2010;12(3):233-42 doi
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 18
18
10.1093/neuonc/nop027.
32. Jahangiri A, Nguyen A, Chandra A, Sidorov MK, Yagnik G, Rick J, et al.
Cross-activating c-Met/beta1 integrin complex drives metastasis and invasive
resistance in cancer. Proc Natl Acad Sci U S A 2017;114(41):E8685-e94 doi
10.1073/pnas.1701821114.
33. Kang X, Xiao X, Harata M, Bai Y, Nakazaki Y, Soda Y, et al. Antiangiogenic
activity of BAI1 in vivo: implications for gene therapy of human glioblastomas.
Cancer Gene Ther 2006;13(4):385-92 doi 10.1038/sj.cgt.7700898.
34. Fukushima Y, Oshika Y, Tsuchida T, Tokunaga T, Hatanaka H, Kijima H, et al.
Brain-specific angiogenesis inhibitor 1 expression is inversely correlated with
vascularity and distant metastasis of colorectal cancer. Int J Oncol
1998;13(5):967-70.
35. Hatanaka H, Oshika Y, Abe Y, Yoshida Y, Hashimoto T, Handa A, et al.
Vascularization is decreased in pulmonary adenocarcinoma expressing
brain-specific angiogenesis inhibitor 1 (BAI1). Int J Mol Med 2000;5(2):181-3.
36. Lee JH, Koh JT, Shin BA, Ahn KY, Roh JH, Kim YJ, et al. Comparative study
of angiostatic and anti-invasive gene expressions as prognostic factors in gastric
cancer. Int J Oncol 2001;18(2):355-61.
37. Aghi M, Rabkin SD, Martuza RL. Angiogenic response caused by oncolytic
herpes simplex virus-induced reduced thrombospondin expression can be
prevented by specific viral mutations or by administering a
thrombospondin-derived peptide. Cancer Res 2007;67(2):440-4 doi
10.1158/0008-5472.can-06-3145.
38. DeLay M, Jahangiri A, Carbonell WS, Hu YL, Tsao S, Tom MW, et al.
Microarray analysis verifies two distinct phenotypes of glioblastomas resistant
to antiangiogenic therapy. Clin Cancer Res 2012;18(10):2930-42 doi
10.1158/1078-0432.ccr-11-2390.
39. Haseley A, Boone S, Wojton J, Yu L, Yoo JY, Yu J, et al. Extracellular matrix
protein CCN1 limits oncolytic efficacy in glioma. Cancer Res
2012;72(6):1353-62 doi 10.1158/0008-5472.can-11-2526.
40. Klenotic PA, Huang P, Palomo J, Kaur B, Van Meir EG, Vogelbaum MA, et al.
Histidine-rich glycoprotein modulates the anti-angiogenic effects of
vasculostatin. Am J Pathol 2010;176(4):2039-50 doi
10.2353/ajpath.2010.090782.
41. Koh JT, Kook H, Kee HJ, Seo YW, Jeong BC, Lee JH, et al. Extracellular
fragment of brain-specific angiogenesis inhibitor 1 suppresses endothelial cell
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 19
19
proliferation by blocking alphavbeta5 integrin. Exp Cell Res
2004;294(1):172-84 doi 10.1016/j.yexcr.2003.11.008.
42. Otani Y, Ishida J, Kurozumi K, Oka T, Shimizu T, Tomita Y, et al.
PIK3R1Met326Ile germline mutation correlates with cysteine-rich protein 61
expression and poor prognosis in glioblastoma. Sci Rep 2017;7(1):7391 doi
10.1038/s41598-017-07745-0.
43. Goodwin CR, Lal B, Zhou X, Ho S, Xia S, Taeger A, et al. Cyr61 mediates
hepatocyte growth factor-dependent tumor cell growth, migration, and Akt
activation. Cancer Res 2010;70(7):2932-41 doi
10.1158/0008-5472.Can-09-3570.
44. Han S, Bui NT, Ho MT, Kim YM, Cho M, Shin DB. Dexamethasone Inhibits
TGF-beta1-Induced Cell Migration by Regulating the ERK and AKT Pathways
in Human Colon Cancer Cells Via CYR61. Cancer Res Treat
2016;48(3):1141-53 doi 10.4143/crt.2015.209.
45. Paw I, Carpenter RC, Watabe K, Debinski W, Lo HW. Mechanisms regulating
glioma invasion. Cancer Lett 2015;362(1):1-7 doi 10.1016/j.canlet.2015.03.015.
46. Ikeda K, Ichikawa T, Wakimoto H, Silver JS, Deisboeck TS, Finkelstein D, et al.
Oncolytic virus therapy of multiple tumors in the brain requires suppression of
innate and elicited antiviral responses. Nat Med 1999;5(8):881-7 doi
10.1038/11320.
47. Libertini S, Iacuzzo I, Perruolo G, Scala S, Ierano C, Franco R, et al.
Bevacizumab increases viral distribution in human anaplastic thyroid carcinoma
xenografts and enhances the effects of E1A-defective adenovirus dl922-947.
Clin Cancer Res 2008;14(20):6505-14 doi 10.1158/1078-0432.Ccr-08-0200.
48. Walsh CT, Radeff-Huang J, Matteo R, Hsiao A, Subramaniam S, Stupack D, et
al. Thrombin receptor and RhoA mediate cell proliferation through integrins and
cysteine-rich protein 61. Faseb j 2008;22(11):4011-21 doi 10.1096/fj.08-113266.
49. Chinot OL, de La Motte Rouge T, Moore N, Zeaiter A, Das A, Phillips H, et al.
AVAglio: Phase 3 trial of bevacizumab plus temozolomide and radiotherapy in
newly diagnosed glioblastoma multiforme. Adv Ther 2011;28(4):334-40 doi
10.1007/s12325-011-0007-3.
50. Filley AC, Henriquez M, Dey M. Recurrent glioma clinical trial,
CheckMate-143: the game is not over yet. Oncotarget 2017;8(53):91779-94 doi
10.18632/oncotarget.21586.
51. Currier MA, Eshun FK, Sholl A, Chernoguz A, Crawford K, Divanovic S, et al.
VEGF blockade enables oncolytic cancer virotherapy in part by modulating
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 20
20
intratumoral myeloid cells. Mol Ther 2013;21(5):1014-23 doi
10.1038/mt.2013.39.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 21
21
Figure 1. Cytotoxicity effect of RAMBO, bevacizumab, and their combination on
glioma cell lines.
U87ΔEGFR, U251MG, U87MG, and MGG23 glioma cells were treated with saline or
bevacizumab at a concentration of 10 μg/ml and infected with saline or RAMBO at a
MOI of 0.1. (A) Representative images of U87ΔEGFR and MGG23 glioma cells
undergoing cytotoxicity by RAMBO. (B) Cell viability was examined by WST-1
proliferation assay every 24 hours after infection. Data shown are the proportion of
viable cells relative to those treated with saline as a control. Values are the mean ± SEM
from five independent experiments. Statistical significance was calculated by analysis
of variance with one-way ANOVA with Tukey’s post hoc test. * p<0.001 compared
between the indicated groups. CvR, control versus RAMBO; CvBR, control versus
bevacizumab and RAMBO; BvR, bevacizumab versus RAMBO; BvBR, bevacizumab
versus bevacizumab and RAMBO.
Figure 2. Inhibition of glioma cell migration.
Glioma cell lines were incubated with conditioned medium (CM) derived from glioma
cells treated with RAMBO. Additionally, they were treated with the indicated
concentration of bevacizumab. Giemsa staining was performed 24 hours after treatment.
(A) Representative images from the scratch wound assay. (B) Glioma cells migrating
into the scratch area were assayed. Data shown are the proportions of migrating cells
against whole cells in the field relative to those treated with saline as a control. (C)
Representative images from the two-chamber migration assay. (D) Migrating cells were
counted 24 hours after treatment. Data shown are the migrating cells relative to those
treated with saline as a control.
Values are the mean ± SEM from five independent experiments. Statistical significance
was calculated by analysis of one-way ANOVA with Tukey’s post hoc test. *p<0.05,
**p<0.01 and ***p<0.001 compared between the indicated groups.
Figure 3. Inhibition of glioma cell invasion.
(A) Representative images from the two-chamber invasion assay. Glioma cell lines were
incubated with conditioned medium (CM) derived from glioma cells treated with
RAMBO or HSVQ. Additionally, they were treated with the indicated concentration of
bevacizumab. (B) Invading cells were counted 24 hours after treatment. Data shown are
the invading cells relative to those treated with saline as a control. (C) Representative
images of matrigel invasion assay. Spheroids of MGG23 cells were implanted into a
96-well plate, followed by treatment with viruses and bevacizumab. Then matrigel was
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 22
22
added to each well. (D) The invading cells observed outside the core spheroid were
assayed. Data shown are the proportions of invading distance against core diameter
relative to those treated with saline as a control.
Values are the mean ± SEM from five independent experiments. Statistical significance
was calculated by analysis of one-way ANOVA with Tukey’s post hoc test. *p<0.05,
**p<0.01 and ***p<0.001 compared between the indicated groups.
Figure 4. Kaplan–Meier survival curves and histological analysis of mice implanted
with intracranial U87ΔEGFR glioma cells.
(A) Glioma cell-bearing animals were administered saline or bevacizumab
intraperitonially on the indicated days and intratumoral saline or viruses on day 7. (B)
Athymic nude mice bearing intracranial U87ΔEGFR gliomas were treated with 1.0 ×
105 pfu HSVQ or RAMBO, and bevacizumab was administered intraperitoneally at 10
mg/kg. Statistical significance was calculated by the log-rank test. (C)
Immunohistochemical staining of the tumors with anti-human leukocyte antigen
monoclonal antibody. The untreated tumor shows the expansion of the tumor with
well-defined borders. After treatment with bevacizumab, the tumor border became
irregular with tumor invasion. (D) The invasiveness was assessed by the distance
between the tumor mass edge and invasive lesion. Values are the mean ± SEM from five
independent experiments. Statistical significance was calculated by analysis of one-way
ANOVA with Tukey’s post hoc test. *p=0.010, and **p<0.006 compared between the
indicated groups.
Figure 5. Kaplan–Meier survival curves and histological analysis of mice implanted
with intracranial MGG23 glioma cells.
(A) Immunodeficient mice bearing intracranial MGG23 gliomas were treated with 1.0
× 105 pfu HSVQ or RAMBO, and bevacizumab was administered intraperitoneally at
10 mg/kg. Statistical significance was calculated by the log-rank test. (B)
Immunohistochemical staining of the tumors with anti-human leukocyte antigen
monoclonal antibody. MGG23 cells invaded to the ipsilateral cerebral cortex adjacent
to the injection site and to the contralateral corpus callosum. Bevacizumab treatment
increased invasion compared with saline or bevacizumab and RAMBO combination.
(C) Values are the mean ± SEM from five independent experiments. Statistical
significance was calculated by analysis of one-way ANOVA with Tukey’s post hoc
test. *p<0.05, **p<0.01 and ***p<0.001 compared between the indicated groups.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 23
23
Figure 6. Combination therapy with bevacizumab and RAMBO downregulated the
AKT pathway compared with bevacizumab monotherapy.
Relative expression levels of CSK (A), SHC3 (B), PTK (C), CAV (D), SOS1 (E) and
CCN1 (F) in the U87ΔEGFR mouse orthotopic model treated with bevacizumab. Only
CCN1 expression was significantly reduced in the tumors treated with bevacizumab and
RAMBO combination therapy compared with those treated with bevacizumab alone.
Data shown are the mean ± SEM. Statistical significance was calculated by one-way
analysis of variance followed by Scheffe’s post hoc test, two-sided. *p<0.05 compared
between the indicated groups. (G) Immunoblot analysis of the levels of CCN1, p-AKT
and AKT total protein in glioma cells. (H) Quantification of data from panel (A). Values
are the mean ± SEM from five independent experiments. Statistical significance was
calculated by analysis of one-way ANOVA with Tukey’s post hoc test. *p<0.05,
**p<0.01 and ***p<0.001 compared between the indicated groups.
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 24
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 25
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 26
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 27
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 28
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 29
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799
Page 30
Published OnlineFirst May 15, 2019.Mol Cancer Ther Yusuke Tomita, Kazuhiko Kurozumi, Ji Young Yoo, et al. the CCN1 and AKT signaling pathwayscombination with bevacizumab abrogate glioma invasion via Oncolytic herpes virus armed with vasculostatin in
Updated version
10.1158/1535-7163.MCT-18-0799doi:
Access the most recent version of this article at:
Material
Supplementary
http://mct.aacrjournals.org/content/suppl/2019/05/15/1535-7163.MCT-18-0799.DC1
Access the most recent supplemental material at:
Manuscript
Authorbeen edited. Author manuscripts have been peer reviewed and accepted for publication but have not yet
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
[email protected] at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://mct.aacrjournals.org/content/early/2019/05/15/1535-7163.MCT-18-0799To request permission to re-use all or part of this article, use this link
on January 27, 2021. © 2019 American Association for Cancer Research. mct.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 15, 2019; DOI: 10.1158/1535-7163.MCT-18-0799