Top Banner
Oliver Stegle and Karsten Borgwardt: Computational Approaches for Analysing Complex Biological Systems, Page 1 Linear models Oliver Stegle and Karsten Borgwardt Machine Learning and Computational Biology Research Group, Max Planck Institute for Biological Cybernetics and Max Planck Institute for Developmental Biology, Tübingen
63

Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Aug 11, 2018

Download

Documents

vuongquynh
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Oliver Stegle and Karsten Borgwardt: Computational Approaches for Analysing Complex Biological Systems, Page 1

Linear modelsOliver Stegle and Karsten Borgwardt

Machine Learning andComputational Biology Research Group,

Max Planck Institute for Biological Cybernetics andMax Planck Institute for Developmental Biology, Tübingen

Page 2: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Motivation

Curve fitting

Tasks we are interested in:

I Making predictions

I Comparison of alternativemodels

X

Y

?

x*

O. Stegle & K. Borgwardt Linear models Tubingen 1

Page 3: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Motivation

Curve fitting

Tasks we are interested in:

I Making predictions

I Comparison of alternativemodels

X

Y

?

x*

O. Stegle & K. Borgwardt Linear models Tubingen 1

Page 4: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Motivation

Further reading, useful material

I Christopher M. Bishop: Pattern Recognition and Machine learning.I Good background, covers most of the course material and much more!I This lecture is largely inspired by chapter 3 of the book.

O. Stegle & K. Borgwardt Linear models Tubingen 2

Page 5: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Outline

Outline

O. Stegle & K. Borgwardt Linear models Tubingen 3

Page 6: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Outline

Motivation

Linear Regression

Bayesian linear regression

Model comparison and hypothesis testing

Summary

O. Stegle & K. Borgwardt Linear models Tubingen 4

Page 7: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

RegressionNoise model and likelihood

I Given a dataset D = {xn, yn}Nn=1, where xn = {xn,1, . . . , xn,D} is Ddimensional, fit parameters θ of a regressor f with added Gaussiannoise:

yn = f(xn;θ) + εn where p(ε |σ2) = N(ε∣∣ 0, σ2) .

I Equivalent likelihood formulation:

p(y |X) =N∏

n=1

N(yn∣∣ f(xn), σ

2)

O. Stegle & K. Borgwardt Linear models Tubingen 5

Page 8: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

RegressionChoosing a regressor

I Choose f to be linear:

p(y |X) =

N∏n=1

N(yn∣∣wT · xn + c, σ2

)I Consider bias free case, c = 0,

otherwise inlcude an additionalcolumn of ones in each xn.

O. Stegle & K. Borgwardt Linear models Tubingen 6

Page 9: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

RegressionChoosing a regressor

I Choose f to be linear:

p(y |X) =

N∏n=1

N(yn∣∣wT · xn + c, σ2

)I Consider bias free case, c = 0,

otherwise inlcude an additionalcolumn of ones in each xn. Equivalent graphical model

O. Stegle & K. Borgwardt Linear models Tubingen 6

Page 10: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Linear RegressionMaximum likelihood

I Taking the logarithm, we obtain

ln p(y |w,X, σ2) =N∑

n=1

lnN(yn∣∣wTxn, σ

2)

= −N2ln 2πσ2 − 1

2σ2

N∑n=1

(yn −wT · xn)2

︸ ︷︷ ︸Sum of squares

I The likelihood is maximized when the squared error is minimized.

I Least squares and maximum likelihood are equivalent.

O. Stegle & K. Borgwardt Linear models Tubingen 7

Page 11: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Linear RegressionMaximum likelihood

I Taking the logarithm, we obtain

ln p(y |w,X, σ2) =N∑

n=1

lnN(yn∣∣wTxn, σ

2)

= −N2ln 2πσ2 − 1

2σ2

N∑n=1

(yn −wT · xn)2

︸ ︷︷ ︸Sum of squares

I The likelihood is maximized when the squared error is minimized.

I Least squares and maximum likelihood are equivalent.

O. Stegle & K. Borgwardt Linear models Tubingen 7

Page 12: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Linear RegressionMaximum likelihood

I Taking the logarithm, we obtain

ln p(y |w,X, σ2) =N∑

n=1

lnN(yn∣∣wTxn, σ

2)

= −N2ln 2πσ2 − 1

2σ2

N∑n=1

(yn −wT · xn)2

︸ ︷︷ ︸Sum of squares

I The likelihood is maximized when the squared error is minimized.

I Least squares and maximum likelihood are equivalent.

O. Stegle & K. Borgwardt Linear models Tubingen 7

Page 13: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Linear Regression and Least Squares

y

x

f (xn , w )

yn

xn

(C.M. Bishop, Pattern Recognition and Machine Learning)

E(w) =1

2

N∑n=1

(yn −wTxn)2

O. Stegle & K. Borgwardt Linear models Tubingen 8

Page 14: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Linear Regression and Least Squares

I Derivative w.r.t a single weight entry wi

d

dwiln p(y |w, σ2) =

d

dwi

[− 1

2σ2

N∑n=1

(yn −w · xn)2

]

=1

σ2

N∑n=1

(yn −w · xn)xi

I Set gradient w.r.t to w to zero

∇w ln p(y |w, σ2) =1

σ2

N∑n=1

(yn −w · xn)xTn = 0

=⇒ wML = (XTX)−1XT︸ ︷︷ ︸Pseudo inverse

y

I Here, the matrix X is defined as X =

x1,1 . . . x1, D. . . . . . . . .xN,1 . . . xN,D

O. Stegle & K. Borgwardt Linear models Tubingen 9

Page 15: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve Fitting

I Use the polynomials up to degree K to construct new features from x

f(x,w) = w0 + w1x+ w2x2 + · · ·+ wKx

K

= wTφ(x),

where we defined φ(x) = (1, x, x2, . . . , xK).

I Similarly, φ can be any feature mapping.

I Possible to show: the feature map φ can be expressed in terms ofkernels (kernel trick).

O. Stegle & K. Borgwardt Linear models Tubingen 10

Page 16: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve Fitting

I Use the polynomials up to degree K to construct new features from x

f(x,w) = w0 + w1x+ w2x2 + · · ·+ wKx

K

= wTφ(x),

where we defined φ(x) = (1, x, x2, . . . , xK).

I Similarly, φ can be any feature mapping.

I Possible to show: the feature map φ can be expressed in terms ofkernels (kernel trick).

O. Stegle & K. Borgwardt Linear models Tubingen 10

Page 17: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve FittingOverfitting

I The degree of the polynomial is crucial to avoid under- andoverfitting.

x

t

M = 0

0 1

−1

0

1

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 11

Page 18: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve FittingOverfitting

I The degree of the polynomial is crucial to avoid under- andoverfitting.

x

t

M = 1

0 1

−1

0

1

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 11

Page 19: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve FittingOverfitting

I The degree of the polynomial is crucial to avoid under- andoverfitting.

x

t

M = 3

0 1

−1

0

1

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 11

Page 20: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Polynomial Curve FittingOverfitting

I The degree of the polynomial is crucial to avoid under- andoverfitting.

x

t

M = 9

0 1

−1

0

1

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 11

Page 21: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least Squares

I Solutions to avoid overfitting:I Intelligently choose KI Regularize the regression weights w

I Construct a smoothed error function

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

O. Stegle & K. Borgwardt Linear models Tubingen 12

Page 22: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least Squares

I Solutions to avoid overfitting:I Intelligently choose KI Regularize the regression weights w

I Construct a smoothed error function

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

O. Stegle & K. Borgwardt Linear models Tubingen 12

Page 23: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresMore general regularizers

I A more general regularization approach:

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

O. Stegle & K. Borgwardt Linear models Tubingen 13

Page 24: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresMore general regularizers

I A more general regularization approach:

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

q = 0 .5 q = 1 q = 2 q = 4

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 13

Page 25: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresMore general regularizers

I A more general regularization approach:

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

q = 0 .5 q = 1 q = 2 q = 4

QuadraticLasso

sparse

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 13

Page 26: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Loss functions and other methods

I Even more general: vary the loss function

E(w) =1

2

N∑n=1

L(yn −wTφ(xn))︸ ︷︷ ︸Loss

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

I Many state-of-the-art machine learning methods can be expressedwithin this framework.

I Linear Regression: squared loss, squared regularizer.I Support Vector Machine: hinge loss, squared regularizer.I Lasso: squared loss, L1 regularizer.

I Inference: minimize the cost function E(w), yielding a point estimatefor w.

O. Stegle & K. Borgwardt Linear models Tubingen 14

Page 27: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Loss functions and other methods

I Even more general: vary the loss function

E(w) =1

2

N∑n=1

L(yn −wTφ(xn))︸ ︷︷ ︸Loss

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

I Many state-of-the-art machine learning methods can be expressedwithin this framework.

I Linear Regression: squared loss, squared regularizer.I Support Vector Machine: hinge loss, squared regularizer.I Lasso: squared loss, L1 regularizer.

I Inference: minimize the cost function E(w), yielding a point estimatefor w.

O. Stegle & K. Borgwardt Linear models Tubingen 14

Page 28: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Loss functions and other methods

I Even more general: vary the loss function

E(w) =1

2

N∑n=1

L(yn −wTφ(xn))︸ ︷︷ ︸Loss

2

D∑d=1

|wd|q︸ ︷︷ ︸Regularizer

I Many state-of-the-art machine learning methods can be expressedwithin this framework.

I Linear Regression: squared loss, squared regularizer.I Support Vector Machine: hinge loss, squared regularizer.I Lasso: squared loss, L1 regularizer.

I Inference: minimize the cost function E(w), yielding a point estimatefor w.

O. Stegle & K. Borgwardt Linear models Tubingen 14

Page 29: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresProbabilistic equivalent

I So far: minimization of error functions.I Back to probabilities?

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

I Similarly: most other choices of regularizers and loss functions can bemapped to an equivalent probabilistic representation.

O. Stegle & K. Borgwardt Linear models Tubingen 15

Page 30: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresProbabilistic equivalent

I So far: minimization of error functions.I Back to probabilities?

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

=− ln p(y |w,Φ(X), σ2) − ln p(w)

I Similarly: most other choices of regularizers and loss functions can bemapped to an equivalent probabilistic representation.

O. Stegle & K. Borgwardt Linear models Tubingen 15

Page 31: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresProbabilistic equivalent

I So far: minimization of error functions.I Back to probabilities?

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

=− ln p(y |w,Φ(X), σ2) − ln p(w)

=−N∑

n=1

lnN(yn∣∣wTφ(xn), σ

2)

− lnN(

w

∣∣∣∣0, 1λI

)I Similarly: most other choices of regularizers and loss functions can be

mapped to an equivalent probabilistic representation.

O. Stegle & K. Borgwardt Linear models Tubingen 15

Page 32: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Linear Regression

Regularized Least SquaresProbabilistic equivalent

I So far: minimization of error functions.I Back to probabilities?

E(w) =1

2

N∑n=1

(yn −wTφ(xn)

)2︸ ︷︷ ︸

Squared error

2wTw︸ ︷︷ ︸

Regularizer

=− ln p(y |w,Φ(X), σ2) − ln p(w)

=−N∑

n=1

lnN(yn∣∣wTφ(xn), σ

2)

− lnN(

w

∣∣∣∣0, 1λI

)I Similarly: most other choices of regularizers and loss functions can be

mapped to an equivalent probabilistic representation.

O. Stegle & K. Borgwardt Linear models Tubingen 15

Page 33: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Outline

Motivation

Linear Regression

Bayesian linear regression

Model comparison and hypothesis testing

Summary

O. Stegle & K. Borgwardt Linear models Tubingen 16

Page 34: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regression

I Likelihood as before

p(y |X,w, σ2) =N∏

n=1

N(yn∣∣wT · φ(xn), σ

2)

I Define a conjugate prior over w

p(w) = N (w |m0,S0)

O. Stegle & K. Borgwardt Linear models Tubingen 17

Page 35: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regression

I Likelihood as before

p(y |X,w, σ2) =N∏

n=1

N(yn∣∣wT · φ(xn), σ

2)

I Define a conjugate prior over w

p(w) = N (w |m0,S0)

O. Stegle & K. Borgwardt Linear models Tubingen 17

Page 36: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regression

I Posterior probability of w

p(w |y,X, σ2) ∝N∏

n=1

N(yn∣∣wT · φ(xn), σ

2)· N (w |m0,S0)

= N(y∣∣w ·Φ(X), σ2I

)· N (w |m0,S0)

= N (w |µw,Σw)

I where

µw = Σw

(S−10 m0 +

1

σ2Φ(X)Ty

)Σw =

[S−10 +

1

σ2Φ(X)TΦ(X)

]−1

O. Stegle & K. Borgwardt Linear models Tubingen 18

Page 37: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regressionPrior choice

I A common choice is a prior that corresponds to regularized regression

p(w) = N(

w

∣∣∣∣0, 1λI

).

I In this case

µw = Σw

(S−10 m0 +

1

σ2Φ(X)Ty

)Σw =

[S−10 +

1

σ2Φ(X)TΦ(X)

]−1

O. Stegle & K. Borgwardt Linear models Tubingen 19

Page 38: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regressionPrior choice

I A common choice is a prior that corresponds to regularized regression

p(w) = N(

w

∣∣∣∣0, 1λI

).

I In this case

µw = Σw

(1

σ2Φ(X)Ty

)Σw =

[λI +

1

σ2Φ(X)TΦ(X)

]−1

O. Stegle & K. Borgwardt Linear models Tubingen 19

Page 39: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regressionExample

0 Data points

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 20

Page 40: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regressionExample

1 Data point

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 20

Page 41: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Bayesian linear regressionExample

20 Data points

(C.M. Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 20

Page 42: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Making predictions

I Prediction for fixed weight w at input x? trivial:

p(y? |x?, w, σ2) = N(y?∣∣∣ wTφ(x?), σ2

)I Integrate over w to take the posterior uncertainty into account

p(y? |x?,D) =∫wp(y? |x?,w, σ2)p(w |X,y, σ2)

=

∫wN(y?∣∣wTφ(x?), σ2

)N (w |µw,Σw)

= N(y?∣∣µT

wφ(x?), σ2 + φ(x?)TΣwφ(x

?))

I Key:I prediction is again GaussianI Predictive variance is increase due to the posterior uncertainty in w.

O. Stegle & K. Borgwardt Linear models Tubingen 21

Page 43: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Making predictions

I Prediction for fixed weight w at input x? trivial:

p(y? |x?, w, σ2) = N(y?∣∣∣ wTφ(x?), σ2

)I Integrate over w to take the posterior uncertainty into account

p(y? |x?,D) =∫wp(y? |x?,w, σ2)p(w |X,y, σ2)

=

∫wN(y?∣∣wTφ(x?), σ2

)N (w |µw,Σw)

= N(y?∣∣µT

wφ(x?), σ2 + φ(x?)TΣwφ(x

?))

I Key:I prediction is again GaussianI Predictive variance is increase due to the posterior uncertainty in w.

O. Stegle & K. Borgwardt Linear models Tubingen 21

Page 44: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Bayesian linear regression

Making predictions

I Prediction for fixed weight w at input x? trivial:

p(y? |x?, w, σ2) = N(y?∣∣∣ wTφ(x?), σ2

)I Integrate over w to take the posterior uncertainty into account

p(y? |x?,D) =∫wp(y? |x?,w, σ2)p(w |X,y, σ2)

=

∫wN(y?∣∣wTφ(x?), σ2

)N (w |µw,Σw)

= N(y?∣∣µT

wφ(x?), σ2 + φ(x?)TΣwφ(x

?))

I Key:I prediction is again GaussianI Predictive variance is increase due to the posterior uncertainty in w.

O. Stegle & K. Borgwardt Linear models Tubingen 21

Page 45: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Outline

Motivation

Linear Regression

Bayesian linear regression

Model comparison and hypothesis testing

Summary

O. Stegle & K. Borgwardt Linear models Tubingen 22

Page 46: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Model comparisonMotivation

I What degree of polynomialsdescribes the data best?

I Is the linear model at allappropriate?

I Association testing.

O. Stegle & K. Borgwardt Linear models Tubingen 23

Page 47: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Model comparisonMotivation

I What degree of polynomialsdescribes the data best?

I Is the linear model at allappropriate?

I Association testing.

?

Phenome

GenomeATGACCTGAAACTGGGGGACTGACGTGGAACGGTATGACCTGCAACTGGGGGACTGACGTGCAACGGTATGACCTGCAACTGGGGGACTGACGTGCAACGGTATGACCTGAAACTGGGGGATTGACGTGGAACGGTATGACCTGCAACTGGGGGATTGACGTGCAACGGTATGACCTGCAACTGGGGGATTGACGTGCAACGGT

individu

als

phenotypes

SNPs

yyyyyy1

O. Stegle & K. Borgwardt Linear models Tubingen 23

Page 48: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparison

I How do we choose among alternative models?

I Assume we want to choose among models H0, . . . ,HM for adataset D.

I Posterior probability for a particular model i

p(Hi | D) ∝ p(D |Hi)︸ ︷︷ ︸Evidence

p(Hi)︸ ︷︷ ︸Prior

O. Stegle & K. Borgwardt Linear models Tubingen 24

Page 49: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparison

I How do we choose among alternative models?

I Assume we want to choose among models H0, . . . ,HM for adataset D.

I Posterior probability for a particular model i

p(Hi | D) ∝ p(D |Hi)︸ ︷︷ ︸Evidence

p(Hi)︸ ︷︷ ︸Prior

O. Stegle & K. Borgwardt Linear models Tubingen 24

Page 50: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparisonHow to calculate the evidence

I The evidence is not the model likelihood!

p(D |Hi) =

∫θp(D |θ)p(θ) for model parameters θ.

I Remember:

p(θ |Hi,D) =p(D |Hi,θ)p(θ)

p(D |Hi)

O. Stegle & K. Borgwardt Linear models Tubingen 25

Page 51: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparisonHow to calculate the evidence

I The evidence is not the model likelihood!

p(D |Hi) =

∫θp(D |θ)p(θ) for model parameters θ.

I Remember:

p(θ |Hi,D) =p(D |Hi,θ)p(θ)

p(D |Hi)

posterior =likelihood · prior

Evidence

O. Stegle & K. Borgwardt Linear models Tubingen 25

Page 52: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparisonOcam’s razor

I The evidence integral penalizesoverly complex models.

I A model with few parametersand lower maximum likelihood(H1) may win over a model witha peaked likelihood that requiresmany more parameters (H2).

wMAP w

LikelihoodH2

H1

(C.M.

Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 26

Page 53: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Bayesian model comparisonOcam’s razor

I The evidence integral penalizesoverly complex models.

I A model with few parametersand lower maximum likelihood(H1) may win over a model witha peaked likelihood that requiresmany more parameters (H2).

wMAP w

LikelihoodH2

H1

(C.M.

Bishop, Pattern Recognition and Machine Learning)

O. Stegle & K. Borgwardt Linear models Tubingen 26

Page 54: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWA

I Consider an association study.I H0: p(y |H0,X,θ) = N

(y∣∣0, σ2I

)(no association)

θ = {σ2}I H1: p(y |H1,X,θ) = N

(y∣∣wT ·X, σ2I

)(linear association)

θ = {σ2,w}I Choosing conjugate priors for σ2 and w, the required integrals are

tractable in closed form.

O. Stegle & K. Borgwardt Linear models Tubingen 27

Page 55: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWA

I Consider an association study.I H0: p(y |H0,X,θ) = N

(y∣∣0, σ2I

)(no association)

θ = {σ2}I H1: p(y |H1,X,θ) = N

(y∣∣wT ·X, σ2I

)(linear association)

θ = {σ2,w}I Choosing conjugate priors for σ2 and w, the required integrals are

tractable in closed form.

O. Stegle & K. Borgwardt Linear models Tubingen 27

Page 56: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWA

I Consider an association study.I H0: p(y |H0,X,θ) = N

(y∣∣0, σ2I

)(no association)

θ = {σ2}I H1: p(y |H1,X,θ) = N

(y∣∣wT ·X, σ2I

)(linear association)

θ = {σ2,w}I Choosing conjugate priors for σ2 and w, the required integrals are

tractable in closed form.

O. Stegle & K. Borgwardt Linear models Tubingen 27

Page 57: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWAScoring models

I The ratio of the evidences, the Bayes factor is a common scoringmetric to compare two models:

BF = lnp(D |H1)

p(D |H0).

O. Stegle & K. Borgwardt Linear models Tubingen 28

Page 58: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWAScoring models

I The ratio of the evidences, the Bayes factor is a common scoringmetric to compare two models:

BF = lnp(D |H1)

p(D |H0).

0

1.3354 1.3356 1.3358 1.336 1.3362 1.3364 1.3366 1.3368 1.337 1.3372 1.3374x 108

0

5

10

15

LOD

/BF

Position in chr. 7

SLC35B4

0.01% FPR 0.01%

FPR

SLC35B4

O. Stegle & K. Borgwardt Linear models Tubingen 28

Page 59: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWAPosterior probability of an association

I Bayes factors are useful, however we would like a probabilistic answerhow certain an association really is.

I Posterior probability of H1

p(H1 | D) =p(D |H1)p(H1)

p(D)

=p(D |H1)p(H1)

p(D |H1)p(H1) + p(D |H0)p(H0)

I p(H1 | D) + p(H0 | D) = 1, prior probability of observing a realassociation.

O. Stegle & K. Borgwardt Linear models Tubingen 29

Page 60: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWAPosterior probability of an association

I Bayes factors are useful, however we would like a probabilistic answerhow certain an association really is.

I Posterior probability of H1

p(H1 | D) =p(D |H1)p(H1)

p(D)

=p(D |H1)p(H1)

p(D |H1)p(H1) + p(D |H0)p(H0)

I p(H1 | D) + p(H0 | D) = 1, prior probability of observing a realassociation.

O. Stegle & K. Borgwardt Linear models Tubingen 29

Page 61: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Model comparison and hypothesis testing

Application to GWAPosterior probability of an association

I Bayes factors are useful, however we would like a probabilistic answerhow certain an association really is.

I Posterior probability of H1

p(H1 | D) =p(D |H1)p(H1)

p(D)

=p(D |H1)p(H1)

p(D |H1)p(H1) + p(D |H0)p(H0)

I p(H1 | D) + p(H0 | D) = 1, prior probability of observing a realassociation.

O. Stegle & K. Borgwardt Linear models Tubingen 29

Page 62: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Summary

Outline

Motivation

Linear Regression

Bayesian linear regression

Model comparison and hypothesis testing

Summary

O. Stegle & K. Borgwardt Linear models Tubingen 30

Page 63: Oliver Stegle and Karsten Borgwardt - ETH Zürich · Oliver Stegle and Karsten Borgwardt Machine Learning and ... Pattern Recognition and Machine learning. ... I This lecture is largely

Summary

Summary

I Curve fitting and linear regression.

I Maximum likelihood and least squares regression are identical.

I Construction of features using a mapping φ.

I Regularized least squares.

I Bayesian linear regression.

I Model comparison and ocam’s razor.

O. Stegle & K. Borgwardt Linear models Tubingen 31