Olanzapine, but not aripiprazole, weight-independently elevates serum triglycerides and activates lipogenic gene expression in female rats

Olanzapine, but not aripiprazole,weight-independently elevates serumtriglycerides and activates lipogenic geneexpression in female rats

Silje Skrede1,2, Johan Fernø1,2, Marıa Jesus Vazquez3,4, Sveinung Fjær5, Tina Pavlin6,

Niclas Lunder7, Antonio Vidal-Puig8, Carlos Dieguez3,4, Rolf Kristian Berge9,

Miguel Lopez3,4 and Vidar Martin Steen1,2

1 Dr. Einar Martens’ Research Group for Biological Psychiatry, Department of Clinical Medicine, University of Bergen, Norway2 Center for Medical Genetics and Molecular Medicine, Haukeland University Hospital, Bergen, Norway3 Department of Physiology, School of Medicine, University of Santiago de Compostela-Instituto de Investigacion Sanitaria (IDIS),

Santiago de Compostela, Spain4 CIBER Fisiopatologıa de la Obesidad y Nutricion (CIBERobn), Santiago de Compostela, Spain5 The Norwegian Multiple Sclerosis Competence Centre, Department of Neurology, Haukeland University Hospital, Bergen,

Norway6 Molecular Imaging Center, Department of Biomedicine, University of Bergen, Bergen, Norway7 Department of Psychopharmacology, Diakonhjemmet Hospital, Oslo, Norway8 Institute of Metabolic Science, Metabolic Research Laboratories, University of Cambridge, Addenbrooke’s Hospital, Cambridge, UK9 The Lipid Research Group, Section of Medical Biochemistry, Institute of Medicine, University of Bergen, Norway

Abstract

Metabolic adverse effects such as weight gain and dyslipidaemia represent a major concern in treatment

with several antipsychotic drugs, including olanzapine. It remains unclear whether such metabolic

side-effects fully depend on appetite-stimulating actions, or whether some dysmetabolic features induced

by antipsychotics may arise through direct perturbation of metabolic pathways in relevant peripheral

tissues. Recent clinical and preclinical studies indicate that dyslipidaemia could occur independently of

weight gain. Using a rat model, we showed that subchronic treatment with olanzapine induces weight

gain and increases adipose tissue mass in rats with free access to food. This effect was also observed

for aripiprazole, considered metabolically neutral in the clinical setting. In pair-fed rats with limited

food access, neither olanzapine nor aripiprazole induced weight gain. Interestingly, olanzapine, but

not aripiprazole, induced weight-independent elevation of serum triglycerides, accompanied by up-

regulation of several genes involved in lipid biosynthesis, both in liver and in adipose tissues. Our

findings support the existence of tissue-specific, weight-independent direct effects of olanzapine on lipid

metabolism.

Received 13 December 2010 ; Reviewed 10 February 2011 ; Revised 9 July 2011 ; Accepted 11 July 2011 ;

First published online 19 August 2011

Key words : Antipsychotics, gene expression, rat, SREBP, triglycerides, weight gain.

Introduction

Life expectancy for schizophrenia patients is greatly

reduced compared to that of the general population

(Tiihonen et al. 2009), with increased risk of somatic

conditions such as cardiovascular disease (CVD)

largely accounting for the mortality gap (Colton &

Manderscheid, 2006). Treatment with certain atypical

antipsychotic drugs, most notably clozapine and

olanzapine, has consistently been shown to increase

the risk of obesity, dyslipidaemia, and type 2 diabetes

(Allison et al. 1999; American Diabetes Association,

2004 ; Henderson, 2001), all established CVD risk fac-

tors (Despres et al. 2008). Some newly introduced

atypical antipsychotics, such as aripiprazole, are

Address for correspondence : Professor V. M. Steen, Center for

Medical Genetics and Molecular Medicine, Laboratory Building,

Haukeland University Hospital, 5021 Bergen, Norway.

Tel. : +4755975425 Fax : +4754977878

Email : [email protected]

International Journal of Neuropsychopharmacology (2012), 15, 163–179. f CINP 2011doi:10.1017/S1461145711001271

ARTICLE

THEMATIC SECTIONEating Disorders andObesity

associated with much lower risk of metabolic adverse

effects than olanzapine and clozapine (Leucht et al.

2009; Newcomer et al. 2008; Stip & Tourjman, 2010).

In fact, add-on treatment of aripiprazole in patients

treated with olanzapine reduced body weight and

improved serum lipid profiles (Henderson et al. 2009).

The widespread use of metabolically unfavourable

antipsychotics in clinical practice may be explained

by superior symptom-relieving effects (Essali et al.

2009; Komossa et al. 2010; Lieberman et al. 2005).

Interestingly, the occurrence of weight gain and

hypertriglyceridaemia has been suggested to predict

superior clinical improvement of schizophrenia symp-

toms in some studies (Ascher-Svanum et al. 2005;

Bai et al. 2006; Procyshyn et al. 2007). Insight into

the molecular basis of the complex balance between

therapeutic efficacy and adverse effects may pave the

way for improved drug therapy in schizophrenia.

Antipsychotic-induced weight gain probably rep-

resents a major risk factor for dyslipidaemia in

patients. However, increased serum triglycerides

and other metabolic derangements have been dem-

onstrated to occur independently of weight gain for

both clozapine and olanzapine (Birkenaes et al. 2008;

Meyer, 2002 ; Procyshyn et al. 2007), suggesting that

molecular mechanisms distinct from those causing

hyperphagia and weight gain may underlie some of

the metabolic disturbances associated with atypical

antipsychotic agents. The nature of these mechanisms

remains to be established. We have previously dem-

onstrated that in cultured cells, several antipsychotic

drugs, among them clozapine and olanzapine, activate

lipogenic gene expression controlled by sterol regu-

latory element-binding protein (SREBP) transcription

factors (Ferno et al. 2005, 2006). These lipid-stimulating

effects, suggested as being relevant for some of the

metabolic disturbances associated with antipsychotic

drug treatment (Ferno et al. 2005; Raeder et al. 2006),

have later been confirmed by others (Lauressergues

et al. 2010; Yang et al. 2007). Two SREBP isoforms exist,

with SREBP1 mainly regulating fatty-acid synthesis,

and SREBP2 controlling genes involved in cholesterol

biosynthesis and transport (Shimano, 2001).

Molecular studies in psychotic patients spur ethical

and practical challenges, and reliable preclinical

models are therefore essential in psychopharmacolo-

gical research (Boyda et al. 2010). In rats, olanzapine

frequently mimics the metabolic disturbances ob-

served in humans, with increased adiposity consist-

ently reported in both female and male rats (Albaugh

et al. 2006; Minet-Ringuet et al. 2006a). However,

olanzapine-induced hyperphagia and weight gain are

extensively documented only in female rodents, with

less robust effects observed in male rats (Cooper et al.

2005, 2007 ; Minet-Ringuet et al. 2006a, b). Olanzapine-

induced effects on serum lipids in rats are equivocal

(Albaugh et al. 2006; Boyda et al. 2010; Kalinichev et al.

2005). With respect to aripiprazole, data on metabolic

disturbances in rats are so far ambiguous (Han et al.

2008; Kalinichev et al. 2005).

In the present study, two subsequent, partially

overlapping experiments were performed. In expt I,

we investigated the effect of olanzapine and

aripiprazole on body-weight gain and serum lipids

in rats. In order to investigate potential weight-

independent dyslipidaemic effects of the obesogenic

drug olanzapine, a group of rats with food restricted

to the level of vehicle-treated rats (pair-fed) was in-

cluded. Expt II was a follow-up study, focusing on

weight-independent effects of both olanzapine and

aripiprazole. We compared the effects of olanzapine

and aripiprazole on a number of lipid parameters

and on lipogenic gene transcription across several

metabolically active tissues.

Materials and methods

Drugs

Olanzapine and aripiprazole were suspended in 4%

carboxymethyl cellulose (CMC). Care was taken to

protect the drugs from light exposure. Plasma levels

of antipsychotic drugs were determined by means of

liquid chromatography/mass spectrometry [see Sup-

plementary materials and methods (available online)

for a detailed description].

Animals and treatment schemes

All experiments were performed in accordance with

the guidelines of the Norwegian Committee for

Experiments on Animals. Rats were kept under stan-

dard conditions with an artificial 12-h light/dark cycle

(lights on 07:00 hours) under constant 48% humidity.

Ad libitum-fed rats were allowed free access to stan-

dard laboratory chow during the experimental period,

while pair-fed rats received an amount of food cor-

responding to that consumed by the control group

during the previous 24 h. Rats were allowed free

access to tap water. This study consists of two sub-

sequent independent biological experiments. In the

inital experiment (expt I), we investigated the effect of

olanzapine and aripiprazole on body-weight gain and

serum lipids in female Sprague–Dawley rats weighing

(mean¡S.D.) 261¡12 g on the first day of treatment

and housed n=3 per cage. We chose to house rats

164 S. Skrede et al.

together in order to reduce stress, which could poten-

tially influence food intake. The following treatment

groups were included (n=9) : vehicle, olanzapine

ad libitum-fed, olanzapine pair-fed, aripiprazole ad

libitum-fed. Each animal, and chow in each cage, was

weighed daily, and average daily food intake for each

animal was calculated. Vehicle or antipsychotic drug

was administered by gavage twice daily (08:00–09:00

and 14:00–15:00 hours), with total daily dosage

of 6 mg/kg olanzapine or aripiprazole split into

two separate administrations (administration volume

2 ml/kg). A second experiment (expt II)was performed

in order to follow-up on the weight-independent

effects in expt I, focusing both on olanzapine and

aripiprazole. In expt II we also aimed to investigate the

effect of antipsychotic drug treatment on white adi-

pose tissue (WAT) mass, using both dissection ofWAT

depots and MRI. Expt II was identical to expt I, with a

few important exceptions : rats (n=10) were housed

individually, and an aripiprazole pair-fed treatment

group was included.

The duration of drug exposure was 13 d, and ani-

mals were sacrificed on day 14. The last drug dose

prior to sacrifice was administered 18–23 h prior to

decapitation. All animals were fasted from 21:00 hours

on the day prior to sacrifice, with dissection starting

at 09:00 hours the following day. Animals were

anaesthetized using isoflurane prior to decapitation.

Trunk blood was collected in pre-cooled tubes, left at

4 xC for 25–30 min and centrifuged at 4 xC for 10 min

(3000 g) to extract serum. Samples from other tissues

were frozen in liquid nitrogen immediately after

dissection. Tissue samples were stored at x80 xC

until analysis, whereas serum samples were kept at

x20 xC.

Ethics statement

The animal experiments described in this article were

approved by Norwegian Committee for Experiments

on Animals (Forsøksdyrutvalget, FDU), and were

performed in accordance with the Norwegian Animal

Welfare Act and international guidelines. Care was

taken to minimize the suffering of animals at all stages

of the experiments.

Behavioural analysis

Possible sedative effects of olanzapine and

aripiprazole were assessed in expt I. The number of

seconds spent on grooming, rearing, sitting/standing

or smaller movements was manually quantified dur-

ing 180 s of recorded film by an experienced animal

technician.

Serum glucose and lipid measurements and

fatty-acid composition analysis

The levels of glucose, triglycerides, phospholipids,

and cholesterol in serum and liver were measured

enzymatically on the Hitachi 917 system (Roche

Diagnostics, Germany) using glucose (Gluco-quant),

triglyceride (GPO-PAP) and cholesterol (CHOD-PAP)

kits (Roche Diagnostics) and a phospholipid kit

(DiaSys Diagnostic Systems, Germany). Serum and

liver lipids were extracted according to the method of

Bligh and Dyer (Bligh & Dyer, 1959), evaporated

under N2 and re-dissolved in isopropanol before

analysis. Serum lipid composition was analysed

by gas–liquid chromatography (see Supplementary

materials and methods for detailed description).

Serum insulin, leptin and adiponectin measurements

Truncal vein blood was collected in precooled

tubes, left on ice for 30 min and centrifuged at

3000 g for 10 min. Serumwas transferred to pre-cooled

Eppendorf tubes immediately after centrifugation

and stored atx20 xC. Serum insulin, leptin and adipo-

nectin levels were assessed as previously described

(Caminos et al. 2005).

Sample preparation, RNA extraction cDNA

synthesis and real-time PCR

Tissue samples (y20 mg of liver tissue or y100 mg of

adipose tissue) were homogenized using a TissueLyser

(Qiagen, USA). RNA extraction and cDNA synthesis

were performed as previously described (Ferno

et al. 2009). Primers (Table 1) were designed using

PrimerExpress (Applied Biosystems, USA) or Primer3

(Rozen& Skaletsky, 2000). The relative gene expression

levels were determined by means of the comparative

DCt method. In liver samples, the expression of target

genes was normalized relative to the endogenous

control ribosomal protein, large, P0 (Rplp0), while

genes run inWATwere normalized against both Rplp0

and b-actin (Actb) ; results are presented as fold changes

normalized against P0.

Immunoblotting

Tissue samples (100 mg liver tissue, 250 mg adipose

tissue) were homogenized in lysis buffer and cen-

trifuged at 12 000 g for 10 min at 4 xC (Lopez et al.

2010). Thirty mg total protein from each sample was

separated on NuPAGE 4–12% Bis-Tris Gels using

SDS buffer and blotted onto InvitrolonTM PVDF

membranes. PVDF membranes were blocked with

5% BSA in TBST prior to incubation with primary

Olanzapine-induced lipogenic activation in rat 165

antibody at 4 xC overnight or at room temperature

(RT) for 1 h, followed by incubation with secondary

antibody at RT for 1 h. The primary antibodies used

were : ACC1: 04-322 (Millipore, USA) ; a-tubulin :

T5168 (Sigma Aldrich, USA); FAS: SC20140 (Santa

Cruz, USA) ; SREBP1 (recognizing both SREBP1a and

x1c isoforms) : SC8984 (Santa Cruz). Signal intensity

measurements were performed using the ImageJ soft-

ware (National Institutes of Health, USA).

Quantification of adipose tissue

In order to investigate whether weight gain correlates

with increased WAT mass, we ran a separate exper-

iment (expt II) using two alternative methods to com-

pare the weights of dissected adipose tissue depots by

the end of the treatment period with semi-quantitative

MRI measurements of the changes in pararenal adi-

pose tissue volumes during treatment. Following 13 d

of drug treatment, animals were sacrificed on day 14

after overnight fasting, with immediate dissection of

mesenteric, retroperitoneal, pararenal, and para-

metrial (periovarian) adipose tissue depots, which

were weighed separately. Animals were subject toMRI

scans on treatment daysx1 (the day prior to initiation

of treatment) and day 13 (the day prior to sacrifice).

MRI images were acquired using a 7-T horizontal

bore magnet (Pharmascan 70/16, Bruker BioSpin,

Germany) operating at 300 MHz, using protocols de-

scribed in detail in the Supplementary materials and

methods section. An estimate of the relative change in

pararenal fat volume was made using a robust

thresholding scheme on the MR images, as described

in Supplementary materials and methods. In short, an

estimated change in adipose tissue volume during

the treatment period was calculated by summing up

voxels containing fat signals in selected slices with

visible kidney tissue, as the kidneys represent reliable

anatomical landmarks, and substracting the number

of fat-containing voxels on the day prior to treatment

initiation from the number of fat-containing voxels on

the day prior to sacrifice.

Table 1. Genes examined in liver, parametrial, subcutaneous and/or brown adipose tissue

Gene Forward primer Reverse primer

Abca1 AGACCTGCTCAGCGGGATG CAGGGCGATGCAAACAAAG

Acc1 CAACGCCTTCACACCACCTT TCATCAAAGATCCTGACGAAATCTT

Adiponectin GATACCGGGCCGTGATGG CCCTTCCGCTCCTGTCATTC

Atgl (Pnpla2) TGAGGGCCAAGAGGAAATTG GCTCCACCTGCTCAGACAGTC

b-actin TACAGCTTCACCACCACAGC CTTCTCCAGGGAGGAAGAGG

Dgat1 AATCTGTGGTGCCGCCAG TCCCTGCAGACACAGCTTTG

Dgat2 GAACCGCAAAGGCTTTGTAAA ACCCAGATCAGCTCCATGGC

Fabp4 ATGTGTCATGAAAGGCGTGA AAACCACCAAATCCCATCAA

Fasn CCATCATCCCCTTGATGAAGA GTTGATGTCGATGCCTGTGAG

Glut4 CGCCCCACAGAAAGTGATT CCTACCCAGCCAAGTTGCAT

Gpat (Gpam) AATGCTGCGGAAAAACTACG TTGCTGGTAACAGTGCTTGC

Hmgcr1 TGGCCAGGATGCAGCAC GGCATGGTACAGCTGATGTATAAGTC

Hmgcs1 CAGCTCTTGGGATGGACGA GGCGTTTCCTGAGGCATATATAG

Insig2b CACGTTCAGACAGGATGTGG AGCCGAGAAATGAAATGAGG

LDLr ACCGCCATGAGGTACGTAAG GCCACCACATTCTTCAGGTT

Leptin CGGTTCCTGTGGCTTTGG GGATACCGACTGCGTGTGTG

LIPE (Hsl) GAGACGGGCCTCAGTGTGAC GAATCGGCCACCCGTAAAG

Pepck GTGATGGGGGTGTTTACTGG TTCCTCATCCTGTGGTCTCC

P0 (Rplp0) CATTGAAATCCTGAGCGATGT AGATGTTCAACATGTTCAGCAG

Pparg CCACAAAAAGAGTAGAAATAAATGTCAGTAC CAAACCTGATGGCATTGTGAGA

Ppargc1a TCTGCAACTGCAGGCCTAACTTC GCTTTGGCGAAGCCTTGA

Soat1 GGAATATCAAACAGGAGCCCTTT CACACCTGGCAAGATGGAGTT

Srebf1 GCGCGGACGACGGAG GATGAGCTGAAGCATGTCT

Srebf2 GCCGCAACCAGCTTTCAA CCTGCTGCACCTGTGGTGTA

Ucp1 AGTTCGGTACCCACATCAGG TGTCGAACTCACCATCTTGG

Forward and reverse primers applied in real-time PCR reactions.

166 S. Skrede et al.

Statistical analysis

Data are expressed as mean¡S.E.M. Food intake was

analysed by repeated-measures two-way ANOVAs,

with treatment as between-subject variable and time

as within-subject variable in both experiments. Body

weight changes were analysed using the same

method. In expt I, four treatment groups were in-

cluded (control, olanzapine ad libitum-fed, olanzapine

pair-fed, aripiprazole ad libitum-fed), whereas expt II

contained five treatment groups, as an aripiprazole

pair-fed group was added. One-way ANOVA fol-

lowed by Tukey’s post-hoc test or Student’s t test was

used to analyse statistical significance for each time-

point. Pearson’s bivariate correlation analysis was

used in order to examine correlations between various

metabolic parameters as described below. For all other

comparisons, we used two-sided Student’s t test.

p values <0.05 were considered statistically sig-

nificant. All tests were conducted with PASW

Statistics version 18 (PASW Statistics ; SPSS Inc., USA)

software.

Results

Serum levels of antipsychotics correspond

with a short half-life

The average serum concentration of olanzapine

(mean¡S.D.) at the time of sacrifice (18–23 h after

last dose) was very low both in the olanzapine ad

libitum-fed group (average+S.D.) (0.27¡0.10 nM) and

in the olanzapine pair-fed group (0.80¡0.57 nM).

Serum aripiprazole levels were also negligible (0.23¡

0.17 nM).

Olanzapine and aripiprazole induce hyperphagia

and body-weight gain

Initially (expt I), we investigated how 13 d treatment

with olanzapine or aripirazole affected daily food

intake (Fig. 1a), cumulative food intake (Fig. 1b) and

weight gain (Fig. 1c) in female rats. In order to inves-

tigate any potential hyperphagia-independent effects

of the well established obesogenic drug olanzapine,

we included an olanzapine pair-fed group, with

food intake identical to the level consumed by vehicle-

treated rats. Repeated-measures two-way ANOVA

was performed for average daily food intake (from

n=3 rats per cage) with treatment and time as factors.

A statistically significant main effect on food intake

for treatment was evident [F(2, 6)=21.91, p<0.01].

A Tukey’s HSD post-hoc test revealed that both

olanzapine and aripiprazole induced significantly

different food intake from vehicle-treated controls.

Similarly, cumulative body-weight gain was analysed

using a repeated-measures two-way ANOVA with

time and treatment as factors. Significant main effects

[F(3, 32)=12.01, p<0.001] and significant treatmentrtime interaction effects [F(48, 133)=2.37, p<0.001]

were observed. Statistically significant differences be-

tween the drugs for each time-point was determined

by one-way ANOVA analysis followed by Tukey’s

post-hoc test, as indicated in Fig. 1c. In expt II, we

focused on weight-independent effects of both olan-

zapine and aripiprazole. With respect to food intake

(measured for each rat individually), a significant

main effect was observed for treatment [F(2, 27)=16.31, p<0.001] and a trend towards significance was

observed for the timertreatment interaction effect

[F(24, 32)=1.645, p=0.1] (Supplementary Fig. S1a).

In line with elevated food intake, cumulative body-

weight gain was increased, with a significant main

effect of treatment [F(4, 45)=20.03, p<0.001] and sig-

nificant treatmentrtime interaction effect [F(36, 62)=3.59, p<0.001]. In expt II, weight gain in the

aripiprazole ad libitum-fed group was more pro-

nounced than in expt I (Supplementary Fig. S1b),

whereas no weight gain was observed in the aripi-

prazole pair-fed group. Of note, one-way ANOVA

followed by Tukey’s post-hoc test revealed significantly

reduced body weight in the olanzapine pair-fed group

relative to the control (pf0.05) and aripiprazole pair-

fed (pf0.01) groups.

Olanzapine, but not aripiprazole, induces weight-

independent elevation in serum triglyceride levels

Interestingly, olanzapine significantly elevated fasting

serum triglyceride levels both in ad libitum-fed rats

that gained weight (mean¡S.E.M., relative to vehicle,

129¡10%, pf0.05) and in pair-fed rats that did not

(126¡7%, pf0.05), while no such changes were in-

duced by aripiprazole, despite the increased weight

gain (Fig. 2a). Other serum lipids were unaffected by

olanzapine exposure, whereas aripiprazole slightly

reduced serum cholesterol and phospholipid levels

relative to controls (Fig. 2a and Table 2). Similarly, in

expt II olanzapine induced significantly elevated

serum triglyceride levels in the ad libitum-fed group

(166¡9%, pf0.001) and a trend towards increased

serum triglyceride levels (126¡12%, p=0.09) in pair-

fed rats, despite marked weight loss in this treatment

group. In contrast, no significant change in serum tri-

glycerides was evident following aripiprazole treat-

ment, neither in ad libitum-fed (114¡13%, p=0.37) nor

in pair-fed (101¡8%, p=0.91) rats (Supplementary

Fig. S2). The relationship between body-weight gain

Olanzapine-induced lipogenic activation in rat 167

and serum lipids was explored using Pearson’s corre-

lation coefficient. In expt I, when analysing the whole

group (n=36), serum triglycerides displayed a sig-

nificant, but weak correlation [r(36)=0.42, p=0.012]

with body-weight gain. However, since weight gain

and lipids were differentially affected by the different

treatments, correlation analyses were also performed

separately for each treatment group. No significant

correlation was observed between body-weight gain

and any of the lipid parameters in the separate treat-

ment groups, suggesting that the effect of treatment

was more pronounced than the effect of weight gain.

Similarly, no significant correlation between body-

weight gain and serum lipids was found in any of the

treatment groups in expt II (data not shown). Next, we

measured fatty-acid composition in total serum lipids

in expt I. Indeed, in line with the observed transcrip-

tional up-regulation of the D9 fatty-acid desaturase

stearoyl-CoA desaturase 1 (SCD1), as described below,

levels of C18:1D9 (oleic acid) were significantly in-

creased by olanzapine both in ad libitum-fed rats

(121¡6%, pf0.01) and in pair-fed rats (125¡6%,

Fig. 1. (a) Average daily food intake (n=3 cages) in rats treated with vehicle or antipsychotic agents for 13 consecutive days.

(b) Average cumulative food intake in ad libitum-fed rats treated with vehicle or antipsychotic agents for 13 consecutive days.

(c) Cumulative weight gain in rats (n=9) treated with vehicle or antipsychotic agents for 13 consecutive days. Absolute total

weight gain (mean¡S.E.M.) was as follows : vehicle 11¡6 g, olanzapine ad libitum (Olanz AL) 34¡5 g, olanzapine pair-fed

(Olanz PF) 14¡3 g, aripiprazole 20¡2 g. Calculated using (d) lipid species in liver tissue from rats (n=9) after exposure to

vehicle or antipsychotic drugs. Absolute values in the vehicle group, given in mg/g liver tissue, were as follows : cholesterol

6.75¡0.15 ; triglycerides 12.9¡0.59 ; phospholipids 24.14¡0.43. * pf0.05 vs. vehicle, ** pf0.01 vs. vehicle, *** pf0.001

vs. vehicle, # pf0.05 vs. aripiprazole.

168 S. Skrede et al.

pf0.01), whereas aripiprazole had no effect (Fig. 2b).

Based on the olanzapine-induced changes in serum

lipids, we examined the effect of drug treatment on

hepatic lipids. Except for a slight reduction in hepatic

cholesterol in olanzapine-exposed pair-fed animals,

hepatic lipids were not significantly changed in any of

the treatment groups compared to control (Fig. 1d).

No significant correlation was found between body-

weight gain and hepatic lipids, neither for all animals

analysed together nor for the separate treatment

groups.

Olanzapine and aripiprazole induce few alterations

in serum glucose and metabolically relevant

hormones

We observed no effect on fasting serum glucose levels,

neither by olanzapine nor by aripiprazole (Table 2).

Serum insulin levels were unaltered in olanzapine-

treated rats, while a statistically significant reduction

(81¡6%, pf0.05) was induced by aripiprazole

(Table 2). Serum levels of leptin were unaltered,

whereas serum adiponectin was moderately increased

in the olanzapine pair-fed group (Table 1).

Olanzapine increases lipogenic and adipogenic

gene expression in parametrial WAT

Based on our previous findings of olanzapine-induced

SREBP activation in cultured cells, we examined the

expression of numerous lipid homeostasis genes in

metabolically active peripheral tissues in expt I, in-

cluding parametrial (visceral) WAT, subcutaneous

WAT, liver, and brown adipose tissue (BAT). In para-

metrial WAT of ad libitum-fed rats, we found that

olanzapine induced up-regulation of SREBP-controlled

Fig. 2. (a) Triglycerides, free fatty acids, phospholipids and total cholesterol in serum after exposure of rats (n=9) to vehicle

or antipsychotic drugs for 13 consecutive days. Absolute values in the vehicle group (mmol/l) were as follows: triglycerides

0.59¡0.04 ; free fatty acids 0.26¡0.02, phospholipids 1.91¡0.13, cholesterol 1.98¡0.06. * pf0.05 vs. vehicle. (b) Fatty-acid

subspecies in serum, measured by gas chromatography, analysed using Student’s t test (n=9). Absolute values in

the vehicle group, given in wt%, were as follows : C16 :0, 14.5¡0.28%; C16 :1D9, 0.12¡0.008%; C18 :0, 15.9¡0.2%; C18 :1D9,

6.7¡0.28%. * pf0.05 vs. vehicle, ** pf0.01 vs. vehicle. Olanz AL, Olanzapine ad libitum-fed ; Olanz PF, olanzapine pair-fed.

Olanzapine-induced lipogenic activation in rat 169

fatty-acid biosynthetic genes, including acetyl-CoA

carboxylase 1 (Acc1), fatty-acid synthase (Fasn) and

stearoyl-CoA desaturase (Scd1) (Table 3). A moderate,

non-significant trend towards transcriptional up-

regulationwas also observed for aripiprazole (Table 3).

Of note, the average fold change of the three genes was

positively correlated with cumulative weight gain,

both for aripiprazole [r(9)=0.90, p=0.001] and olan-

zapine [r(9)=0.87, p=0.003]. Nevertheless, a marked,

significant up-regulation of Acc1, Fasn and Scd1 was

also present in the olanzapine pair-fed treatment

group (Table 3). As could be expected from the lack of

body-weight gain in this group, no significant corre-

lation was found between transcriptional activation

and body-weight gain [r(9)=0.50, p=0.17]. The

olanzapine-induced transcriptional activation of Acc1

was confirmed at the protein level, with statistically

significant elevation of ACC1 in both ad libitum-fed

and pair-fed rats (Fig. 3a). Notably, despite the

marked effect on SREBP target genes in parametrial

WAT, olanzapine affected neither expression levels

of the Srebp1c gene itself, nor SREBP1 protein levels

in this adipose tissue (Table 3, Fig. 3a). Several genes

essential in triglyceride synthesis, e.g. Dgat1 (di-

acylglycerol O-acyltransferase 1) and Dgat2, not con-

sidered SREBP targets, followed the pattern above,

with up-regulation in one or both olanzapine treat-

ment groups, but not in the aripiprazole group

(Table 3). In expt II, olanzapine also induced signifi-

cant transcriptional induction of key lipogenic en-

zymes (Acc1, Fas, Scd1) in parametrial WAT, evident

both in ad libitum-fed and in pair-fed rats. Several of

these genes were also up-regulated by aripiprazole in

ad libitum-fed rats, possibly due to the excessive

weight gain, as no changes were observed in the

aripiprazole pair-fed group (Supplementary Table S1).

Furthermore, we examined several genes involved

in cholesterol metabolism, mainly controlled by the

SREBP2 transcription factor. Cholesterol biosynthesis

genes such as sterol regulatory element-binding pro-

tein 2 (Srebp2), 3-hydroxy-3-methylglutaryl-CoA re-

ductase (Hmgcr) and 3-hydroxy-3-methylglutaryl-CoA

synthase 1 (Hmgcs1) were up-regulated in parametrial

WAT by olanzapine, with most pronounced effects in

ad libitum-fed rats (Table 3). Interestingly, these effects

were also seen for aripiprazole, with significant up-

regulation of Srebp2 and Hmgcs1, as well as the chol-

esterol esterification gene sterol O-acyltransferase 1

(Table 3). Due to the close links between dyslipid-

aemia and insulin resistance, we examined the tran-

scription of the insulin-responsive glucose transporter

4 (Glut4), which was markedly up-regulated both by

olanzapine and aripiprazole (Table 3).

Subcutaneous adipose tissue : WAT depot-specific

effects of antipsychotics on lipid-related

gene expression

Olanzapine also up-regulated lipogenic genes in sub-

cutaneous WAT, although the increase was less pro-

nounced than in parametrial WAT, both at the

transcriptional and protein levels (Table 3, Fig. 3b).

Notably, in contrast to the effects observed in para-

metrial WAT, olanzapine markedly up-regulated

Srebp1c transcription in subcutaneous WAT both in ad

libitum-fed and pair-fed rats (Table 3). This was

Table 2. Serum glucose, insulin, cholesterol, lipid and adipokine levels in expt I

Vehicle Olanzapine ad libitum Olanzapine pair-fed Aripiprazole

Glucose 8.66¡0.34 8.76¡0.14 9.12¡0.16 9.12¡0.26

Insulin 0.37¡0.02 0.36¡0.02 0.33¡0.03 0.3¡0.02

Leptin 1.62¡0.15 2.1¡0.29 1.86¡0.23 1.36¡0.14

Adiponectin 6.41¡0.31 7.25¡0.37 7.43¡0.31** 7.31¡0.32

Triglycerides 0.59¡0.04 0.76¡0.06* 0.74¡0.04* 0.62¡0.07

Free fatty acids 0.26¡0.02 0.25¡0.03 0.3¡0.02 0.26¡0.01

Phospholipids 1.91¡0.13 1.92¡0.08 1.78¡0.06 1.62¡0.07

Total cholesterol 1.98¡0.06 2.03¡0.09 1.85¡0.08 1.73¡0.09*

HDL cholesterol 1.82¡0.06 1.82¡0.07 1.67¡0.07 1.55¡0.08**

LDL cholesterol 0.21¡0.02 0.18¡0.02 0.16¡0.02 0.15¡0.02*

Free cholesterol 0.56¡0.03 0.55¡0.03 0.51¡0.03 0.43¡0.03**

HDL, High density lipoprotein ; LDL, low density lipoprotein.

Glucose and lipid values (n=9) are given in mmol/l. Insulin values are given in ng/ml. Data are given as mean¡S.E.M.

* pf0.05 vs. vehicle ; ** pf0.01 vs. vehicle ; *** pf0.001 vs. vehicle.

170 S. Skrede et al.

Table 3. Relevant genes regulated in parametrial adipose tissue, subcutaneous adipose tissue and liver

Olanz ad lib-fed

Parametrial WAT

Olanz ad lib-fed

Subcutaneous WAT

Olanz ad lib-fed

Liver

Olanz pair-fed Aripiprazole Olanz pair-fed Aripiprazole Olanz pair-fed Aripiprazole

Fatty acid/TG

biosynthesis

Srebf1 1.1¡0.07 0.95¡0.05 0.91¡0.09 3.57¡0.72** 3.15¡0.44*** 1.16¡0.19 0.75¡0.13 1.06¡0.06 0.81¡0.14

Acc1 2.91¡0.66* 3.09¡0.36*** 1.51¡0.27 1.41¡0.16 2.06¡0.24** 0.84¡0.11 0.89¡0.08 1.55¡0.15** 0.47¡0.12***

Fasn 3.15¡0.77* 3.27¡0.34*** 1.35¡0.26 1.12¡0.15 1.91¡0.32* 0.81¡0.07 0.93¡0.14 0.69¡0.11* 0.63¡0.1*

Scd1 2.36¡0.79** 2.89¡0.43** 1.19¡0.31 1.1¡0.34 1.18¡0.17 0.42¡0.11* 2.04¡0.58 2.81¡0.72 0.66¡0.16

Dgat1 1.71¡0.12** 1.38¡0.11 1.44¡0.13 0.72¡0.10 0.75¡0.08 0.51¡0.08* 0.90¡0.13 0.85¡0.11 1.11¡0.17

Dgat2 2.63¡0.33*** 2.58¡0.28*** 1.32¡0.07 1.03¡0.19 0.75¡0.15 0.89¡0.33 1.04¡0.15 1.21¡0.07 1.35¡0.21

Gpam 1.65¡0.14*** 1.89¡0.21*** 1.1¡0.08 1.16¡0.13 1.49¡0.15 0.82¡0.15 1.16¡0.1 1.08¡0.14 1.22¡0.24

Adipogenesis Fabp4 1.43¡0.05*** 1.03¡0.05 1.20¡0.14 0.53¡0.08* 0.62¡0.12 0.54¡0.11 – – –

Pparg 1.37¡0.09 1.14¡0.08 1.18¡0.12 0.36¡0.06* 0.48¡0.07 0.43¡0.13 – – –

Fatty acid

oxidation

Acox1 1.25¡0.14 0.89¡0.13 1.13¡0.11 1.11¡0.09 1.44¡0.23 0.95¡0.17 0.98¡.12 1.16¡0.08 0.82¡0.06

Cpt1a 1.18¡0.06 1.1¡0.09 1.19¡0.08 1.31¡.011 1.59¡0.33 1.52¡0.17* 0.68¡0.09* 1.07¡0.08 0.87¡0.09

Ppara 1.54¡0.06** 1.16¡0.06 1.37¡0.06 2.17¡0.31* 1.81¡0.44 1.56¡0.30 0.81¡0.1 1.33¡0.18 1.05¡0.09

Cholesterol

metabolism

Srebf2 2.14¡0.2*** 1.88¡0.18** 1.52¡0.13* 1.21¡0.14 1.1¡0.09 0.99¡0.12 0.87¡0.1 0.98¡0.05 0.82¡0.06

Hmgcs1 3.35¡0.28*** 1.18¡0.29 1.98¡0.18** 0.75¡0.07* 0.81¡0.09 0.77¡0.08 1.12¡0.18 1.65¡0.25* 0.80¡0.11

Hmgcr 1.63¡0.07*** 1.26¡0.06* 1.20¡0.13 0.87¡0.1 1.0¡0.14 1.13¡0.1 0.61¡0.07** 0.81¡0.07 0.61¡0.1*

Soat1 1.58¡0.15** 1.46¡0.11** 1.45¡0.19* 1.16¡0.13 1.31¡0.19 1.04¡0.1 0.61¡0.06*** 0.56¡0.06*** 0.58¡0.06**

Ldlr 1.09¡0.13 2.05¡0.26** 0.75¡0.1 0.77¡0.08* 0.78¡0.12 0.56¡0.06*** 1.04¡0.11 2.21¡0.14** 1.20¡0.23

Abca1 2.43¡0.54* 2.71¡0.29*** 1.97¡0.67 1.71¡0.15** 1.57¡0.17* 1.67¡0.3 0.82¡0.03* 1.06¡0.06 1.0¡012

Srebp regulation Insig1 2.23¡0.24*** 1.41¡0.15* 1.54¡0.31 0.79¡0.13 0.68¡0.07* 0.73¡0.15 0.7¡0.12 0.66¡0.04** 0.74¡0.07*

Insg2b 2.68¡0.32*** 1.51¡0.15* 1.63¡0.25 0.87¡0.06 1.27¡0.15 1.03¡0.15 1.17¡0.15 1.13¡0.12 1.22¡0.19

Glucose

metabolism

Glut4 1.84¡0.17*** 1.64¡0.17** 2.26¡0.09*** 0.43¡0.08** 0.53¡0.08* 0.47¡0.17* – – –

Pepck 2.02¡0.14*** 0.97¡0.1 1.44¡1.15 0.47¡0.08* 0.31¡0.12* 0.37¡0.09 0.97¡0.14 0.82¡0.15 1.28¡0.17

Lipases Hsl 1.27¡0.07 0.98¡0.06 0.92¡0.09 0.60¡0.07* 0.60¡0.1* 0.55¡0.18* – – –

Atgl 1.27¡0.08 1.27¡0.07 1.34¡0.12 0.50¡0.08* 0.55¡0.07* 0.40¡0.1* – – –

Lpl (Lipd) 2.06¡0.32** 1.36¡0.08** 1.29¡0.2 0.53¡0.09* 0.78¡0.11 0.42¡0.12* 0.6¡0.04* 0.49¡0.06* 0.57¡0.09*

Mgll 1.69¡0.17** 1.19¡0.04 1.18¡0.21 0.77¡0.1 0.73¡0.1 0.62¡0.17 – – –

Adipokines Leptin 1.51¡0.20 1.37¡0.26 1.08¡0.24 0.30¡0.07* 0.37¡0.11* 0.38¡0.19* – – –

Adiponectin 1.55¡0.10*** 1.38¡0.06 1.20¡0.13 0.42¡0.07*** 0.46¡0.09** 0.48¡0.14** – – –

TG, Triglyceride ; Olanz, olanzapine ; WAT, white adipose tissue.

Data (n=9) are given as fold change relative to vehicle, and presented as mean¡S.E.M. (–) indicates gene expression was not measured. Data shown are normalized to P0 (Arbp), with

comparable results when normalized to b-actin (parametrial WAT and subcutaneous WAT; data not shown).

* pf0.05 vs. vehicle, ** pf0.01 vs. vehicle, *** pf0.001 vs. vehicle, analysed by means of Student’s t test.

Olan

zapine-in

duced

lipogenicactivation

inrat

171

confirmed at the protein level, although reaching

statistical significance only in the pair-fed group

(Fig. 3b). For aripiprazole, the effect on fatty-acid bio-

synthesis genes in subcutaneous WAT was marginal,

with down-regulation of Scd1 as the only significant

finding (Table 3). Directly opposite to what we ob-

served in the parametrial WAT, olanzapine induced

down-regulation of Pparg, encoding the nuclear re-

ceptor transcription factor PPARc, considered the

master regulator of adipogenesis (Rosen et al. 2002).

Of note, transcription of the Pparg gene and several of

its target genes was down-regulated by both olanza-

pine and aripiprazole. Diverging effects in parametrial

and subcutaneous adipose depots were also observed

Fig. 3. Lipogenesis-related immunoblots from (a) parametrial (visceral) white adipose tissue (WAT), (b) subcutaneous WAT

and (c) liver. Calculations are based on results from six rats for each treatment group, run in duplicate. The ratio between

protein of interest and endogenous control (e.g. ACC1/TUBULIN) was calculated from duplicate gels to minimize the

influence of technical across-gel variation. Representative immunoblot images demonstrating the calculated difference were

selected. Each lane (ACC1, SREBP1, FASN, TUBULIN) represents results from the same rat. * pf0.05 vs. vehicle. ** pf0.01

vs. vehicle.

172 S. Skrede et al.

for Glut4, as well as for genes encoding lipases

and adipokines, which were down-regulated in sub-

cutaneous WAT both by olanzapine and aripiprazole

(Table 3).

Antipsychotic drugs induce minor effects on hepatic

lipid-related gene expression

In the liver, normally representing the primary site of

lipogenesis, the effects of olanzapine on the expression

of fatty-acid and cholesterol metabolism genes were

subtle (Table 3). Still, Western blots demonstrated

that ACC1 and FASN protein levels were significantly

elevated by olanzapine both in ad libitum-fed and

in pair-fed rats, with a similar trend for the SREBP1

protein (Fig. 3c). Aripiprazole, on the other hand, sig-

nificantly reduced FASN and SREBP1 protein levels

(Fig. 3c, Table 3).

The effect of antipsychotic drugs on thermogenic

markers in BAT

In our study we found that antipsychotic-induced

weight gain was related to increased food intake.

However, reduced energy expenditure in BAT has

also been suggested to be involved in antipsychotic-

induced weight gain, and we therefore examined

the expression levels of thermogenic markers in BAT.

We found that olanzapine markedly decreased the

expression of genes encoding the thermogenic

markers uncoupling protein 1 (Ucp1) and peroxisome

proliferator-activated receptor gamma, co-activator 1

alpha (Ppargc1a) in BAT, evident both in ad libitum-fed

and in pair-fed rats (Fig. 4a). Aripiprazole did not

significantly alter the expression of Ucp1, whereas

reduced expression levels of Pparg1a were observed

(0.41¡0.09, pf0.05) (Fig. 4a). Sedation, a recognized

adverse effect of antipsychotic agents, could also de-

crease energy output. However, evaluating four dif-

ferent measures of locomotor activity, no statistically

significant changes were found relative to vehicle-

exposed rats (Fig. 4b).

Weight gain is related to increased adipose

tissue mass

In order to investigate whether antipsychotic-induced

weight gain is constituted by increased adipose tissue

mass and whether the lipogenic effects of olanzapine

could increase adipose mass independently of weight

gain, a separate experiment (expt II) was set up,

in which both a non-invasive MRI technique and

weighing of fat after dissection were employed (Fig. 5,

Table 4). Correlation analysis yielded a positive

correlation [r(50)=0.51, p=0.0001] between cumulat-

ive weight gain and total dissected WAT mass (four

anatomical depots, Table 4) when data for all animals

were analysed together. The same was observed in the

aripiprazole ad libitum-fed group [r(n=10)=0.77,

pf0.01], but not in the olanzapine ad libitum-fed

group. In contrast, volume estimates based on the MRI

images (Fig. 5) demonstrated a clear trend towards

significant increase in adipose tissue mass in the

olanzapine ad libitum-fed group relative to control ani-

mals (324¡84%), p=0.09), while no significant alter-

ation was observed in the corresponding aripiprazole

treatment group, despite the observed weight gain

and increased mesenteric WAT mass (Table 4).

Pearson’s correlation analysis yielded no correlation

between dissected WAT mass and MRI estimates of

WAT volume (data not shown).

Discussion

In the present study, we demonstrated that both

olanzapine and aripiprazole induced hyperphagia and

weight gain in female rats. In contrast, the effects on

blood lipids differed between the drugs. Serum tri-

glyceride levels were elevated by olanzapine in both

ad libitum-fed and pair-fed rats, whereas no such in-

crease was observed for aripiprazole. Similarly, olan-

zapine, but not aripiprazole, weight-independently

induced lipogenic gene expression in peripheral tis-

sues, with the most pronounced effects in perimetrial

WAT. The different propensity of these drugs to

induce lipogenic effects may be relevant for their

different metabolic profiles reported in humans

(Rummel-Kluge et al. 2010).

Drug-induced weight gain is caused by hyperphagia

Drug-induced weight gain was highly correlated with

increased food intake, which, in agreement with pre-

vious findings, indicated that the obesogenic effects of

the drugs are mainly caused by hyperphagia (Albaugh

et al. 2006; Arjona et al. 2004; Coccurello et al. 2008;

Ferno et al. 2011; Goudie et al. 2002). However, differ-

ent mechanisms may coincide, and our finding of

reduced thermogenic markers in BAT supported a

recent study suggesting decreased thermogenesis as a

relevant mechanism for olanzapine-induced weight

gain in rats (Stefanidis et al. 2009). Nevertheless, the

lack of weight gain in pair-fed rats in our study demon-

strated that drug-induced reduction in BAT thermo-

genesis was not solely sufficient to induce weight gain.

Weight gain was positively correlated with dis-

sected adipose tissue mass when all animals were

Olanzapine-induced lipogenic activation in rat 173

analysed as one group. We investigated MRI as

a potential non-invasive method of adipose tissue

quantification, which would facilitate regular moni-

toring of WATmass during treatment with obesogenic

drugs. However, despite the acquisition of high-

quality images, we failed to demonstrate correlation

between body-weight gain and MRI-based WAT vol-

ume estimates. Furthermore, we found no correlation

between dissected WAT mass and MRI volume esti-

mates. Clearly, the MRI protocol used needs further

development. Ideally, the number of MRI slices should

be increased in order to acquire images of all intra-

abdomnial WAT depots, circumventing the challenge

of limited acquisition time for each rat due to issues

such as time spent anaesthetized, body temperature

increase, and general time consumption.

Serum triglycerides are elevated by olanzapine

treatment, independent of weight gain

Serum triglycerides were elevated by olanzapine

treatment, both in ad libitum-fed rats that gained

weight and in pair-fed rats that did not, suggesting

that this increase occurred independently of weight

gain. The fact that aripiprazole did not increase serum

triglycerides, despite inducing marked body-weight

gain, supports this notion, which was confirmed

by correlation analysis of triglyceride levels and

Fig. 4. Antipsychotic-induced effects on markers of energy expenditure. (a) Quantification of locomotor activity during 180 s

on treatment day 9, in vehicle- or antipsychotic-exposed rats (n=9). Average of total time spent on different activities, given in

% relative to vehicle-treated rats. Move=vertical movements ; rear=time standing on hind legs ; sit=standing on all four legs ;

groom=scratching, washing. Statistical testing revealed that none of the results reached statistical significance. (b) Thermogenic

gene expression in brown adipose tissue (n=9). Data are given as fold change relative to vehicle, normalized against Rplp0, and

presented as mean¡S.E.M. * pf0.05 vs. vehicle ; ** pf0.01 vs. vehicle ; *** pf0.001 vs. vehicle. Olanz AL, Olanzapine ad libitum ;

Olanz PF, olanzapine pair-fed.

174 S. Skrede et al.

Fig. 5. Representative MRI images from vehicle-, olanzapine- and aripiprazole-treated rats (n=10). Adipose tissue appears

white (marked with arrows). (a) vehicle ; (b) olanzapine ad libitum-fed ; (c) olanzapine pair-fed ; (d) aripiprazole ad libitum-fed ;

(e) aripiprazole pair-fed. Left panels, prior to initiation of treatment (treatment day 0 ; indicated by labels a–e). Right panels,

treatment day 13 (indicated by labels ak–ek).

Olanzapine-induced lipogenic activation in rat 175

body-weight gain for each treatment group. It should

be noted that when analysing all treatment groups as

one, a moderate but significant positive correlation

between serum triglycerides and body-weight gain

was observed, demonstrating that although weight

gain alone did not account for the triglyceride increase

in olanzapine-treated rats, this factor probably con-

tributes to dyslipidaemic effects. The observation that

elevated triglyceride levels were not entirely attribu-

table to weight gain is of major importance, as it in-

dicates that mechanisms other than those involved in

increased body weight are relevant for antipsychotic-

induced dyslipidaemia. This notion is in agreement

with evidence from several clinical studies demon-

strating significant elevation in serum triglycerides,

independent of weight gain, in patients treated

with olanzapine (Birkenaes et al. 2008; Meyer, 2002;

Procyshyn et al. 2007).

Olanzapine, but not aripiprazole, exerts direct

lipogenic transcriptional activation

The transcriptional up-regulation of SREBP-controlled

lipogenic genes in WAT observed in both olanzapine-

treated and aripiprazole-treated ad libitum-fed rats

agrees with the established fact that hyperphagia-

induced weight gain is associated with increased

WAT mass and up-regulation of lipogenic gene ex-

pression (Shimano, 2001). Increased lipogenic gene

expression was also observed in olanzapine pair-fed

rats that did not gain weight, an effect not observed

in pair-fed, aripiprazole-treated rats. This suggests

that similar to the effect on serum triglyceride levels,

the major impact on lipogenic transcriptional acti-

vation by olanzapine was related to pharmacological

effects in WAT and not simply a secondary effect

of weight gain. Similarly, marked lipogenic activation

by olanzapine, but not aripiprazole, was observed

at the protein level in the liver. Our demonstration

of weight-independent lipogenic up-regulation by

olanzapine is in agreement with previous findings of

elevated levels of the SREBP1 target gene Fasn in intra-

abdominal adipose tissue from male rats chronically

treated with olanzapine without gaining weight

(Minet-Ringuet et al. 2007), and with a clinical study

showing BMI-independent up-regulation of the fatty-

acid biosynthesis genes Fasn and Scd1 in peripheral

blood cells from a group of patients receiving olanza-

pine (Vik-Mo et al. 2008). Scd1 is an SREBP1 target

gene placed at the branch point between lipid

synthesis/storage and fatty-acid oxidation, and may

prove a critical regulatory step in the development

of metabolic disorders by acting as a ‘metabolic

switch’ between fatty-acid synthesis and catabolism

(Ntambi et al. 2002). SCD1 catalyses delta 9 mono-

desaturation of fatty acids, and the olanzapine-specific

elevation of the monodesaturated fatty-acid oleic acid

in serum observed in our study suggests that in-

creased Scd1 expression by olanzapine has functional

consequences, possibly relevant for olanzapine-

induced metabolic disturbances. Interestingly, our

findings confirm a recent study of elevated plasma

18:1/18:0 ratio after treatment with olanzapine as

well as other antipsychotic drugs (McNamara et al.

2011). Indeed, antipsychotic agents have also been

shown to increase the proportion of monounsaturated

fatty acids in plasma from patients (Kaddurah-Daouk

et al. 2007).

Lipogenic transcriptional activation in visceral

WAT possibly occurs independently of SREBP

activation

Although olanzapine-induced up-regulation of

SREBP-controlled lipogenic genes was evident in

parametrial WAT, it was not accompanied by the ex-

pected SREBP1 activation, neither at the tran-

scriptional nor at the protein level. However, in

Table 4. Wet weights of dissected adipose tissues (n=10), given in % of body weight

Mesenteric Parametrial Perirenal Retroperitoneal Total

Vehicle 1.21¡0.06 0.97¡0.08 0.46¡0.08 0.63¡0.11 3.27¡0.28

Olanz ad lib-fed 1.43¡0.09* 1.26¡0.11* 0.64¡0.08 0.83¡0.07 4.17¡0.29*

Olanz pair-fed 1.35¡0.06 1.06¡0.06 0.54¡0.06 0.54¡0.07 3.48¡0.18

Apz ad lib-fed 1.43¡0.09* 1.06¡0.10 0.58¡0.08 0.70¡0.04 3.78¡0.26

Apz pair-fed 1.23¡0.06 0.78¡0.11 0.47¡0.08 0.63¡0.04 3.12¡0.19

Olanz, Olanzapine; Apz, aripiprazole.

* pf0.05 compared to control, analysed by Student’s t test.

176 S. Skrede et al.

subcutaneous WAT, with only moderate elevation of

lipogenic SREBP1-controlled gene expression, we ob-

served a striking elevation of Srebp1c expression and

SREBP1 protein levels. These seemingly paradoxical

findings may be explained by the fact that fatty-acid

biosynthesis in adipose tissue is not exclusively con-

trolled by SREBP1 (Sekiya et al. 2007). In fact, it has

been demonstrated that WAT-specific transgenic

overexpression of Srebp1c reduced fat accumulation in

mice, with concomitant down-regulation of PPARc-

controlled genes involved in adipocyte differentiation

(Shimomura et al. 1998), a state resembling the anti-

psychotic-induced effects observed in subcutaneous

WAT in our study. PPARc agonists, such as thioglita-

zones, have been used to treat metabolic disturbances

in patients (Festuccia et al. 2009). Thus it is tempting

to speculate that PPARc antagonistic effect of

antipsychotic drugs could represent a molecular

mechanism involved in their associated metabolic

dysfunction, including glucose dysregulation. We

found few alterations in fasting glucose and insulin

levels, but studies employing clamping techniques

have demonstrated antipsychotic-induced glucose

dysregulation (Albaugh et al. 2010; Chintoh et al. 2009).

It should be noted that marked down-regulation of

PPARc target genes was observed both in rats treated

with olanzapine and in rats treated with aripiprazole,

and thus the apparent PPARc antagonistic effect does

not offer a straightforward explanation for the anti-

psychotic-induced metabolic disturbances observed in

the clinical setting.

In summary, we have demonstrated that both

olanzapine and aripiprazole induce significant weight

gain in female rats, attributable mainly to hyper-

phagia. Interestingly, olanzapine elevated serum tri-

glycerides independently of weight gain, an effect that

was not observed for aripiprazole. The concurrent

olanzapine-induced up-regulation of lipogenic gene

expression in adipose tissues implied a potential

mechanism of antipsychotic-induced dyslipidaemia,

possibly involving the SREBP transcription system.

We also showed that olanzapine appears to exert

PPARc antagonistic effects in subcutaneous WAT, a

property shared by aripiprazole. Further studies are

required in order to elucidate the role of these effects

in the development of metabolic dysfunction in

patients.

Note

Supplementary material accompanies this paper on

the Journal’s website (http://journals.cambridge.org/

pnp).

Acknowledgements

We greatly appreciate the excellent technical assist-

ance from Marianne S. Nævdal, Liv Kristine Øysæd,

Kari Williams, Pavol Bohov, Kari H. Mortensen, and

Cecilie Brekke Rygh. We acknowledge the research

infrastructure provided by the Norwegian Microarray

Consortium (NMC; www.microarray.no), a national

FUGE technology platform (Functional Genomics in

Norway; www.fuge.no), by the Molecular Imaging

Center (MIC), Department of Biomedicine, University

of Bergen, and by the laboratory animal facility

(Vivarium), University of Bergen. This study has been

supported by grants from the Research Council of

Norway (including the FUGE programme and

‘PSYKISK HELSE’ program), Norwegian Council for

Mental Health, ExtraStiftelsen Helse og Rehabilitering,

Helse Vest RHF, and Dr Einar Martens Fund (J.F.), the

Medical Research Council, UK (A.V.-P. : G0802051),

Wellcome Trust (A.V.-P. : 065326/Z/01/Z), Xunta de

Galicia (M.L. : 10PXIB208164PR), and Fondo Investi-

gationes Sanitarias (M.L. : PS09/01880), Ministerio

de Ciencia e Innovacion (M.L. : RyC-2007-00211), the

European Community’s Seventh Framework Pro-

gramme (FP7/2007-2013) under grant agreement

no. 245009 and by Ministerio de Educacion y Ciencia

(CD: BFU2008-02001). CIBER de Fisiopatologıa de la

Obesidad y Nutricion is an initiative of ISCIII.

Statement of Interest

None.

References

Albaugh VL, Henry CR, Bello NT, Hajnal A, et al. (2006).

Hormonal and metabolic effects of olanzapine and

clozapine related to body weight in rodents. Obesity

(Silver Spring) 14, 36–51.

Albaugh VL, Judson JG, She P, Lang CH, et al. (2010).

Olanzapine promotes fat accumulation in male rats by

decreasing physical activity, repartitioning energy and

increasing adipose tissue lipogenesis while impairing

lipolysis. Molecular Psychiatry 16, 569–581.

Allison DB, Mentore JL, Heo M, Chandler LP, et al. (1999).

Antipsychotic-induced weight gain : a comprehensive

research synthesis. American Journal of Psychiatry 156,

1686–1696.

American Diabetes Association, APA, American

Association of Clinical Endocrinologists, North

American Association for the Study of Obesity (2004).

Consensus development conference on antipsychotic

drugs and obesity and diabetes. Journal of Clinical

Psychiatry 65, 267–272.

Arjona AA, Zhang SX, Adamson B, Wurtman RJ

(2004). An animal model of antipsychotic-induced

Olanzapine-induced lipogenic activation in rat 177

weight gain. Behavioural Brain Research 152,

121–127.

Ascher-Svanum H, Stensland MD, Kinon BJ, Tollefson GD

(2005). Weight gain as a prognostic indicator of therapeutic

improvement during acute treatment of schizophrenia

with placebo or active antipsychotic. Journal of

Psychopharmacology 19(6 Suppl.), 110–117.

Bai YM, Lin CC, Chen JY, Lin CY, et al. (2006). Association of

initial antipsychotic response to clozapine and long-term

weight gain. American Journal of Psychiatry 163, 1276–1279.

Birkenaes AB, Birkeland KI, Engh JA, Faerden A, et al.

(2008). Dyslipidemia independent of body mass in

antipsychotic-treated patients under real-life conditions.

Journal of Clinical Psychopharmacology 28, 132–137.

Bligh EG, Dyer WJ (1959). A rapid method of total lipid

extraction and purification. Canadian Journal of

Biochemistry and Physiology 37, 911–917.

Boyda HN, Tse L, Procyshyn RM, Honer WG, et al. (2010).

Preclinical models of antipsychotic drug-induced

metabolic side effects. Trends in Pharmacological Sciences

31, 484–497.

Caminos JE, Nogueiras R, Gallego R, Bravo S, et al. (2005).

Expression and regulation of adiponectin and receptor in

human and rat placenta. Journal of Clinical Endocrinology

and Metabolism 90, 4276–4286.

Chintoh AF, Mann SW, Lam L, Giacca A, et al. (2009).

Insulin resistance and secretion in vivo : effects of different

antipsychotics in an animal model. Schizophrenia Research

108, 127–133.

Coccurello R, Caprioli A, Conti R, Ghirardi O, et al. (2008).

Olanzapine (LY170053, 2-methyl-4-(4-methyl-1-

piperazinyl)-10H-thieno[2,3-b][1,5] benzodiazepine),

but not the novel atypical antipsychotic ST2472

(9-piperazin-1-ylpyrrolo[2,1-b][1,3]benzothiazepine),

chronic administration induces weight gain,

hyperphagia, and metabolic dysregulation in mice.

Journal of Pharmacology and Experimental Therapeutics

326, 905–911.

Colton CW, Manderscheid RW (2006). Congruencies in

increased mortality rates, years of potential life lost, and

causes of death among public mental health clients in

eight states. Preventing Chronic Disease 3, A42.

Cooper GD, Pickavance LC, Wilding JP, Halford JC, et al.

(2005). A parametric analysis of olanzapine-induced

weight gain in female rats. Psychopharmacology (Berlin)

181, 80–89.

Cooper GD, Pickavance LC, Wilding JP, Harrold JA, et al.

(2007). Effects of olanzapine in male rats : enhanced

adiposity in the absence of hyperphagia, weight gain or

metabolic abnormalities. Journal of Psychopharmacology

21, 405–413.

Despres JP, Arsenault BJ, Cote M, Cartier A, et al. (2008).

Abdominal obesity : the cholesterol of the 21st century?

Canadian Journal of Cardiology 24(Suppl. D), 7D–12D.

Essali A, Al-Haj Haasan N, Li C, Rathbone J (2009).

Clozapine vs. typical neuroleptic medication for

schizophrenia. Cochrane Database of Systemic Reviews.

Issue No. 1. Art. No. CD000059.

Ferno J, Raeder MB, Vik-Mo AO, Skrede S, et al. (2005).

Antipsychotic drugs activate SREBP-regulated expression

of lipid biosynthetic genes in cultured human glioma cells :

a novel mechanism of action? Pharmacogenomics Journal

5, 298–304.

Ferno J, Skrede S, Vik-Mo AO, Havik B, et al. (2006).

Drug-induced activation of SREBP-controlled lipogenic

gene expression in CNS-related cell lines : marked

differences between various antipsychotic drugs. BMC

Neuroscience 7, 69.

Ferno J, Varela L, Skrede S, Vazquez MJ, et al. (2011).

Olanzapine-induced hyperphagia and weight gain

associate with orexigenic hypothalamic neuropeptide

signaling without concomitant AMPK phosphorylation.

PLoS One 6, e20571.

Ferno J, Vik-Mo AO, Jassim G, Havik B, et al. (2009).

Acute clozapine exposure in vivo induces lipid

accumulation and marked sequential changes in the

expression of SREBP, PPAR, and LXR target genes in

rat liver. Psychopharmacology (Berlin) 203, 73–84.

Festuccia WT, Blanchard PG, Turcotte V, Laplante M, et al.

(2009). Depot-specific effects of the PPAR{gamma} agonist

rosiglitazone on adipose tissue glucose uptake and

metabolism. Journal of Lipid Research 50, 1185–1194.

Goudie AJ, Smith JA, Halford JC (2002). Characterization

of olanzapine-induced weight gain in rats. Journal of

Psychopharmacology 16, 291–296.

Han M, Deng C, Burne TH, Newell KA, et al. (2008).

Short- and long-term effects of antipsychotic drug

treatment on weight gain and H1 receptor expression.

Psychoneuroendocrinology 33, 569–580.

Henderson DC (2001). Clozapine : diabetes mellitus, weight

gain, and lipid abnormalities. Journal of Clinical Psychiatry

62(Suppl. 23), 39–44.

Henderson DC, Fan X, Copeland PM, Sharma B, et al.

(2009). Aripiprazole added to overweight and obese

olanzapine-treated schizophrenia patients. Journal of

Clinical Psychopharmacology 29, 165–169.

Kaddurah-Daouk R, McEvoy J, Baillie RA, Lee D, et al.

(2007). Metabolomic mapping of atypical antipsychotic

effects in schizophrenia. Molecular Psychiatry 12, 934–945.

Kalinichev M, Rourke C, Daniels AJ, Grizzle MK, et al.

(2005). Characterisation of olanzapine-induced weight

gain and effect of aripiprazole vs. olanzapine on body

weight and prolactin secretion in female rats.

Psychopharmacology (Berlin) 182, 220–231.

Komossa K, Rummel-Kluge C, Hunger H, Schmid F, et al.

(2010). Olanzapine vs. other atypical antipsychotics for

schizophrenia. Cochrane Database of Systemic Reviews.

Issue No. 3. Art. No. CD006654.

Lauressergues E, Staels B, Valeille K, Majd Z, et al.

(2010). Antipsychotic drug action on SREBPs-related

lipogenesis and cholesterogenesis in primary rat

hepatocytes. Naunyn Schmiedeberg’s Archives of

Pharmacology 381, 427–439.

Leucht S, Corves C, Arbter D, Engel RR, et al. (2009).

Second-generation vs. first-generation antipsychotic drugs

for schizophrenia : a meta-analysis. Lancet 373, 31–41.

178 S. Skrede et al.

Lieberman JA, Stroup TS, McEvoy JP, Swartz MS, et al.

(2005). Effectiveness of antipsychotic drugs in patients

with chronic schizophrenia. New England Journal of

Medicine 353, 1209–1223.

Lopez M, Varela L, Vazquez MJ, Rodriguez-Cuenca S, et al.

(2010). Hypothalamic AMPK and fatty acid metabolism

mediate thyroid regulation of energy balance. Nature

Medicine 16, 1001–1008.

McNamara RK, Jandacek R, Rider T, Tso P, et al. (2011).

Atypical antipsychotic medications increase postprandial

triglyceride and glucose levels in male rats : relationship

with stearoyl-CoA desaturase activity. Schizophrenia

Research 129, 66–73.

Meyer JM (2002). A retrospective comparison of weight,

lipid, and glucose changes between risperidone- and

olanzapine-treated inpatients : metabolic outcomes after

1 year. Journal of Clinical Psychiatry 63, 425–433.

Minet-Ringuet J, Even PC, Goubern M, Tome D, et al.

(2006a). Long term treatment with olanzapine mixed

with the food in male rats induces body fat deposition

with no increase in body weight and no thermogenic

alteration. Appetite 46, 254–262.

Minet-Ringuet J, Even PC, Lacroix M, Tome D, et al.

(2006b). A model for antipsychotic-induced obesity in

the male rat. Psychopharmacology (Berlin) 187, 447–454.

Minet-Ringuet J, Even PC, Valet P, Carpene C, et al. (2007).

Alterations of lipid metabolism and gene expression in rat

adipocytes during chronic olanzapine treatment. Molecular

Psychiatry 12, 562–571.

Newcomer JW, Meyer JM, Baker RA, Eudicone JM, et al.

(2008). Changes in non-high-density lipoprotein

cholesterol levels and triglyceride/high-density

lipoprotein cholesterol ratios among patients randomized

to aripiprazole vs. olanzapine. Schizophrenia Research 106,

300–307.

Ntambi JM, Miyazaki M, Stoehr JP, Lan H, et al. (2002).

Loss of stearoyl-CoA desaturase-1 function protects mice

against adiposity. Proceedings of the National Academy of

Sciences USA 99, 11482–11486.

Procyshyn RM, Wasan KM, Thornton AE, Barr AM, et al.

(2007). Changes in serum lipids, independent of

weight, are associated with changes in symptoms during

long-term clozapine treatment. Journal of Psychiatry and

Neuroscience 32, 331–338.

Raeder MB, Ferno J, Vik-Mo AO, Steen VM (2006). SREBP

activation by antipsychotic- and antidepressant-drugs

in cultured human liver cells : relevance for metabolic

side-effects? Molecular and Cellular Biochemistry 289,

167–173.

Rosen ED, Hsu CH, Wang X, Sakai S, et al. (2002).

C/EBPalpha induces adipogenesis through

PPARgamma: a unified pathway. Genes and Development

16, 22–26.

Rozen S, Skaletsky H (2000). Primer3 on the WWW for

general users and for biologist programmers. Methods in

Molecular Biology 132, 365–386.

Rummel-Kluge C, Komossa K, Schwarz S, Hunger H,

et al. (2010). Head-to-head comparisons of metabolic side

effects of second generation antipsychotics in the treatment

of schizophrenia : a systematic review and meta-analysis.

Schizophrenia Research 123, 225–233.

Sekiya M, Yahagi N, Matsuzaka T, Takeuchi Y, et al. (2007).

SREBP-1-independent regulation of lipogenic gene

expression in adipocytes. Journal of Lipid Research

48, 1581–1591.

Shimano H (2001). Sterol regulatory element-binding

proteins (SREBPs) : transcriptional regulators of

lipid synthetic genes. Progress in Lipid Research 40,

439–452.

Shimomura I, Hammer RE, Richardson JA, Ikemoto S, et al.

(1998). Insulin resistance and diabetes mellitus in

transgenic mice expressing nuclear SREBP-1c in adipose

tissue : model for congenital generalized lipodystrophy.

Genes and Development 12, 3182–3194.

Stefanidis A, Verty AN, Allen AM, Owens NC, et al. (2009).

The role of thermogenesis in antipsychotic drug-induced

weight gain. Obesity (Silver Spring) 17, 16–24.

Stip E, Tourjman V (2010). Aripiprazole in schizophrenia

and schizoaffective disorder : a review. Clinical Therapeutics

32 (Suppl. 1), S3–20.

Tiihonen J, Lonnqvist J, Wahlbeck K, Klaukka T, et al.

(2009). 11-year follow-up of mortality in patients with

schizophrenia : a population-based cohort study

(FIN11 study). Lancet 374, 620–627.

Vik-Mo AO, Birkenaes AB, Ferno J, Jonsdottir H, et al.

(2008). Increased expression of lipid biosynthesis genes

in peripheral blood cells of olanzapine-treated patients.

International Journal of Neuropsychopharmacology 11,

679–684.

Yang LH, Chen TM, Yu ST, Chen YH (2007). Olanzapine

induces SREBP-1-related adipogenesis in 3T3-L1 cells.

Pharmacological Research 56, 202–208.

Olanzapine-induced lipogenic activation in rat 179