of subtype N6, N7 and N9 by Real Time PCR · N6, N7 and N9-specific RRT-PCR primers/probe sets: The table in APPENDIX 1 shows the 5’ – 3’ sequences of the ‘Hoffmann’ and

OIE/FAO international reference laboratory for AI

Detection of avian influenza A viruses of subtype N6, N7 and N9 by Real Time PCR

Page 1 of 18

Detection of avian influenza A viruses of subtype N6, N7 and N9 by Real Time

PCR

This protocol is a copy of the standard operating procedure used by the

OIE/FAO international reference laboratory for AI at the Animal and

Plant Health Agency. If you have any technical queries please contact

[email protected]



Page 2 of 18

Contents

1. INTRODUCTION .......................................................................................................................... 3

1.1 PURPOSE/SCOPE OF THIS PROTOCOL ...................................................................................... 3 1.2 BACKGROUND INFORMATION ................................................................................................... 3

2. SAFETY ........................................................................................................................................ 4

3. MATERIALS ................................................................................................................................. 3

3.1 DOCUMENTATION AND SOFTWARE ........................................................................................... 3 3.2 CHEMICALS AND REAGENTS .................................................................................................... 4 3.3 EQUIPMENT ............................................................................................................................ 5

4. PROCEDURE/METHOD .............................................................................................................. 6

4.1 TEST RELIABILITY ................................................................................................................... 6 4.2 PREPARATION OF PCR MASTER MIX AND LOADING ..................................................................... 6 4.3 PREPARATION OF N6, N7 OR N9 AIV RNA STANDARDS ............................................................... 7 4.4 MANUAL ADDITION OF SAMPLES AND STANDARDS ...................................................................... 7

4.5 REVERSE TRANSCRIPTION (RT) AND PCR…………………………………………… ……7

5. RESULTS ..................................................................................................................................... 9

5.1 ANALYSIS AND DISPLAY OF RESULTS BY USING MXPRO SOFTWARE ........................................... 9 5.2 INTERPRETATION OF N6, N7 OR N9 RRT-PCR RESULTS ........................................................ 9

6. REFERENCES ........................................................................................................................... 11

APPENDIX 1 ....................................................................................................................................... 12

APPENDIX 2 …………………………………………………………………………………………………. 13 APPENDIX 3 …………………………………………………………………………………………………. 14



Page 3 of 18

1. INTRODUCTION

1.1 Purpose/Scope of this Protocol

1.1.1 This protocol provides the details required to detect avian influenza viruses (AIVs) of subtype N6, N7 or N9 by independent reverse transcriptase RealTime (RRT)-PCR assays (against each subtype) in swabs, tissues and egg-amplified material.

1.2 Background information

1.2.1 Two versions of the each of the N6, N7 or N9 RRT-PCR assays are included in this protocol: Version (i) is referred to as the ‘Hoffmann’ N6, N7 or N9 PCR where the RRT-PCR assay amplifies specifically within a region of the neuraminidase (NA) gene of the respective subtype N6, N7 or N9 AIVs, with primers and probe designed for detection of N6, N7 or N9 AIVs currently in global circulation, precisely as described by Hoffmann et al., 2016. (ii) The second version, referred to as the ‘Modified’ N6, N7 or N9 RRT-PCRs, produces the same amplicon but the primers and probe sequences were modified for optimal detection of more recently-circulating AIV subtypes H5N6 and H7N7 which caused outbreaks in poultry and other birds across Asia and Europe, respectively. Simultaneously, H7N9 and a separate lineage of H5N6 AIVs threaten to incur into Europe from Asia, bringing additional zoonotic risks. Version (i) of the N6-specific RRT-PCR (‘Hoffmann N6 RRT-PCR’) is recommended for use in the first instance for detection of suspect HxN6 AIV strains while version (ii) is initially recommended for both the N7 and N9-specific RRT-PCRs (‘Modified N7’ or ‘Modified N9’, respectively) on suspect AIV HxN7 or HxN9 strains, respectively. Version (ii) of the N6 RT-PCR assay (‘Hoffmann N6’) is recommended for the detection of ‘zoonotic’ lineage H5N6 viruses which are currently circulating in Asia.

1.2.2

2. SAFETY

2.1 It is your laboratory’s responsibility to ensure all work described in this protocol is conducted to a high safety standard.

2.2 Areas within this procedure which refer to Safety Critical activities are

denoted in the paragraph number column with the sign to highlight these areas to users.

3. MATERIALS

3.1 Documentation and software



Page 4 of 18

3.1.1 Protocol and other procedures references:

Procedure for isolation and detection of viruses from avian species using embryonated eggs.

Eurasian H5 avian influenza RealTime PCR

H7 Eurasian reverse transcription RealTime (RRT-) PCRs for the detection and pathotyping of Eurasian avian influenza viruses

RNA extraction from biological samples

Extraction of nucleic acids from swabs using the QIAGEN BioRobot Universal

Influenza-Detection of influenza A matrix gene by real time

Taqman® RT-PCR

3.2 Chemicals and reagents

3.2.1

3.2.2

N6, N7 and N9-specific RRT-PCR primers/probe sets: The table in APPENDIX 1 shows the 5’ – 3’ sequences of the ‘Hoffmann’ and ‘Modified’ primers/probe sets for each assay:

N6, N7 and N9 RRT-PCR assay controls

1. Negatives:

Include at least one “no template controls” (NTC) where 2l RNase free water are added.

2. N6, N7 and N9 AIV extraction control (positive):

Currently, no extraction positive controls are run with the tests as each test is ALWAYS run in conjunction with the H5 RRT-PCR (which does include an H5 AIV extraction control) and also usually with the Nagy M-gene influenza A screening RRT-PCR (including an H5 or H7 AIV extraction control).



Page 5 of 18

3. N6, N7 or N9 AIV RNA dilution series (“standards”):

Use an N6, N7 or N9 AIV RNA preparation as appropriate from extracted egg fluid recommended by the AI International Reference Laboratory as a 10-fold dilution series (to cover a range of at least 4 dilutions). This series (entered appropriately as “standards” with relative quantities indicated by using the software while setting up the RealTime experiment) can be used to determine the N6, N7 or N9 RRT-PCR efficiency. See APPENDIX 2 for preparation of new batches

AIV RNA is prepared in batches with a designated arbitrary value of 107

and stored at -70C. Take out an aliquot and thaw. Carefully prepare ten-fold dilutions of RNA in DEPC water as follows:-

Ten-fold dilution from 107

Designated value

(label tubes with these values)

10-1 106

10-2 105

10-3 104

10-4 103

10-5 102

10-6 101

Mix each dilution by agitation / flicking and briefly centrifuge. Make sufficient of each dilution so that enough is made to use for all the N6, N7 or N9 RRT-PCR runs for that day. Store the aliquots on ice. Discard at the end of the working day. Each standard to be run is indicated on the worksheet using the designated value.

3.3 Equipment

3.3.1 Microcentrifuge tubes (1.5ml) Biomek2000 robot or similar

-70C or lower freezer 20l robot barrier tips

Pipettes -18C or lower freezer

Sterile, Rnase-free pipette tips with aerosol barrier

Vortex mixer

Mx3000/3005 real time RT-PCR plates/strips

Microcentrifuge (with rotor for 2ml tubes)

Mx3000/3005 real time RT-PCR plate caps

Mx3000/3005 real time RT-PCR quantitative machine



Page 6 of 18

4. PROCEDURE/METHOD

4.1 Test Reliability

4.1.1 Process of assuring ongoing test reliability:

Method & frequency: An annual EU AI PCR Proficiency Panel is tested as part of an external QA (EQA) scheme, where testing of this panel provides evidence of ongoing test reliability. In addition to this panel, the a “Mini Panel” of anonymous AIV samples to include at least one representative an N6, N7 or N9 AI virus, is supplied annually. This and other AIV RRT-PCR protocols note the importance of gauging RRT-PCR performance by monitoring the Ct values and standard curve obtained from the 10-fold dilution series (RNA standards) to determine the efficiency of the RRT-PCR run (see APPENDIX 2). This is crucial for the routine use of the AI RRT-PCRs in Reference / Diagnostic Laboratory work.

4.2 Preparation of PCR master mix and loading

4.3 Preparation of N6, N7 or N9 AIV RNA standards

4.3.1 Include subtype N6, N7 or N9 AIV positive control RNA” standards” as a dilution series in the respective RRT-PCR run.

4.2.1 Preparation of PCR master mix and loading of RealTime plate / strips(s) to be carried out in the PCR clean room.

4.2.2 Preparation of the N6, N7 or N9 RRT-PCR master mixes with the first choice primers and probes (version (i) for N6 RRT-PCR assays but version (ii) for N7 or N9 RRT-PCRs; see 1.2.1) is described in APPENDIX 3. For each of the N6, N7 or N9 RRT-PCR assays, master mix preparation utilises the Qiagen OneStep RT-PCR kit (Cat No. 1044287). Reagents not contained in the kit can be obtained from other suppliers. Volumes indicated will be sufficient for

10 x 25l reactions for either assay, ie divide the master mix into 10 x 23l

volumes then add 2l extracted RNA to each (APPENDIX 3).

4.2.3 Thoroughly mix the master mix and briefly centrifuge to remove bubbles.

4.2.4 Aliquot 23l of master mix per well of the RealTime plate / strip(s).

4.2.5 Loosely place the plate caps on the portion of the plate being used.

4.2.6 Bring the plate / strip(s) out of the PCR clean room and place on ice before addition of sample RNA and controls.



Page 7 of 18

4.4 Manual addition of samples and standards

4.4.1 In order to minimise the risk of contamination, the different types of

controls and test specimens should be added in the following chronological order. It is important to keep wells covered after addition of control / sample, and also to add in such a manner to minimise any carry-over contamination risk into open wells to which control / sample has not yet been added. Change gloves frequently and do not hold tips containing RNA above the incorrect wells.

Referring to plate layout, add 2l DEPC water as a no template control

(NTC), Add 2l of the negative extraction control, Replace caps on tubes. Then add the sample RNA to the master mix. Replace caps on tubes. Add the real time PCR RNA standards (from weakest to strongest) to appropriate wells.

4.4.2 It is important that the caps are fitted firmly and correctly onto the wells before being used on the real-time machine.

4.4.3 If the real time plate/strip(s) are not to be loaded onto the real-time machine straight away, keep the plate/strip(s) on ice for a maximum of 2 hours until ready to test. Briefly centrifuge plate prior to placing the plate onto the thermal cycler.

4.4.4 Once used, store RNA samples at -70oC or lower for further analysis as required.

4.5 Reverse transcription (RT) and PCR

4.5.1 Place the RealTime plate / strip(s) in the appropriate RealTime instrument.

4.5.2 The thermocycling profiles for the Hoffmann (version i) or Modified (version ii) N6, N7 and N9 RRT-PCR assays are identical and are as follows:

RT step: 45C for 30 mins

95C for 15 mins

PCR step (x40 cycles) 95C for 15 secs

56C for 20 secs (annealing)

72C for 30 secs

NB: These are different from our more commonly used H5 / H7 cycling conditions.



Page 8 of 18

NB: Collect fluorescence data at end of 56oC step using the FAM filter. Use endpoint read option with one read. N.B: ’Filter Gain Setting’ - After servicing or repair this setting is often changed back to the factory default of FAM x8. On return correct the filters for use Cy5 ROX and HEX should all be set to x1, Fam should be set to x2. Please see example below. If prompted or you wish to check the filter settings, it is possible in the MXPro software to change the ‘Filter Set Gain Settings’ – click Instrument, then filter Set Gain Settings.

4.5.3 Open a new file on the instrument using the MxPro software and select the RealTime quantitative PCR (multiple standards) option for the experiment. The plate setup can be re-entered for each experiment or imported from previous experiments if desired.

Thermal profiles for import Note that the lamp on both RealTime machines requires 20 minutes to warm up, and this can occur during the RT step (4.5.2 above).

4.5.4 When the plate is setup and thermoprofile windows have been entered, select “run” to start thermocycling. A storage window will automatically open.

4.5.5 The complete run takes approximately 2.0 hours. If the machine is not booked for immediate use by another colleague upon completion of the run, select the option to turn off the lamp at the end of the run. This is because the lamps have a limited lifespan.

5. RESULTS

5.1 Analysis and display of results by using MxPro software

5.1.1 The fluorescence data can be viewed during and / or after the PCR using the raw data plots tab in the “Run” section by using the MxPro software.

5.1.2 When the run is complete, the MxPro file should be saved.

5.1.3 To analyse the data select the Analysis section button and select the wells to be examined in the Analysis / Setup window.



Page 9 of 18

5.1.4 To view the results click on the Results tab in the Analysis section and view the amplification plots. There are four options for analysing the fluorescence:

R (Multicomponent view) displays the raw fluorescence in arbitrary units.

dR displays the baseline-corrected fluorescence. As all reactions and wells will start with slightly different fluorescence readings, this option sets a baseline value of 0 to all plots. This correction is determined by the fluorescence values obtained during the initial rounds of the PCR. The adaptive baseline algorithm calculates the best baseline for each plot individually.

Rn displays the fluorescence normalised to the passive reference dye (ROX). This allows for fluctuations in fluorescence, which are not due to cleavage of the TaqMan probe.

dRn displays the baseline-corrected normalised fluorescence.

The dRn option with the ROX channel switched on is the most appropriate option for analysis of the data.

5.2 Interpretation of N6, N7 or N9 RRT-PCR results

5.2.1 Analyse the data by comparing the results obtained for the negative (NTC) and N6, N7 or N9 AIV RNA dilution series “standards”

5.2.2 Negative controls (NTCs):

All NTCs should give “No Ct” as their final result. High Cts in all NTC wells with a linear character (eg >37) and giving a very low level final fluorescence (ie little greater than the initial “flare” fluorescence values at early cycles) suggest that probe degradation may have occurred, eg the probe has been excessively frozen and thawed. Although such observations may not invalidate the experiment, it is advised to discard the aliquot & thaw-out a fresh aliquot of the relevant N6, N7 or N9 probe for subsequent experiments & note result.

If the late Ct value (>37) has a logarithmic / sigmoidal character where clear final fluorescence values are observed, then contamination of the NTC wells with N6, N7 or N9 AIV RNA may be considered. It is also possible that such very late Ct signals may occasionally occur spuriously. Repeat the N6, N7 or N9 RRT-PCR assay run.

5.2.3. N6, N7 or N9 AIV RNA dilution series “standards” (section 3.2.2, paragraph 3)

Ten-fold dilution series should yield a straight line with R2 value of >0.975 (ideally >0.985), slope in the range of -3.1 to –3.9 which should correspond to N8 RRT-PCR efficiency in the range 80 – 120%. Deviation from these conditions may be due to (i) inaccurate assembly of the master mix / inaccurate pipetting, (ii) inaccurate RNA addition (iii) degradation of the



Page 10 of 18

6. REFERENCES

Hoffmann, B. et al. Riems influenza a typing array (RITA): An RT-qPCR based low density array for subtyping avian and mammalian influenza a viruses. Sci. Rep. 6, 27211; doi: 10.1038/srep27211 (2016). http://www.nature.com/articles/srep27211

Slomka, M. J., T. Pavlidis, J. Banks, W. Shell, A. McNally, S. Essen, and I. H. Brown. Validated H5 Eurasian real-time reverse transcriptase- polymerase chain reaction and its application in H5N1 outbreaks in 2005-2006. Avian Dis. 51, 373-377 (2007).

James. J., S. M. Reid, S. S. Thomas, S. Mahmood, A. M. P. Byrne, J. Cooper, C. Russell, B. C. Mollett, E. Agyeman-Dua, S. Essen, M. J. Slomka, I. H. Brown, and S. M. Brookes. Development and application of real-time PCR assays for specific detection of contemporary avian influenza virus subtypes N5, N6, N7, N8 and N9. Manuscript accepted for publication in Avian Diseases 10th AI Symposium Issue, December 2018.

RNA standards by inappropriate storage or (iv) inefficient thermocycling / fluorescence reading due to an instrument problem. This indicates a need to address these matters for subsequent N6, N7 or N9 RRT-PCR runs.

5.2.4 If all controls are within acceptable limits, analyse the data for the test samples.

5.2.5 Criteria for assessing positive-negative results on test samples are as follows:

1. A test sample providing a Ct value < 36 in the N6, N7 or N9 RRT-PCR is considered clearly AIV-positive for the homologous NA subtype while a specimen recording “No Ct” value is clearly negative.

2. Test samples with Ct >36, but with a logarithmic / sigmoidal character giving clear final fluorescence greater than that observed during early cycles are generally considered as “inconclusive”. However, the following paragraph presents a possible strategy for confirmation as either “N6, N7 or N9 [very low] positive” or “N6, N7 or N9 negative”:

3. Check the Ct value when the same RNA extract was tested by the M gene RealTime PCR: A Ct value of 34-37 by M gene RealTime PCR suggests that this may be a very weak positive N6, N7 or N9 RRT-PCR result. A reproducible result obtained after re-extraction of RNA from the same clinical material by N6, N7 or N9 / M gene RealTime PCRs would tend to confirm this. However, it is unlikely that such “late Ct risers” (particularly those from field submissions) would yield positive results by other tests eg virus isolation or conventional AIV PCRs due to their lower sensitivity.

http://www.nature.com/articles/srep27211



Page 11 of 18



Page 12 of 18

APPENDIX 1

Details of the ‘Hoffmann’ (Hoffmann et al., 2016) and ‘Modified’ (James et al., 2018) N6, N7 and N9-specific RRT-PCR primers/probe sets:

Target Assay set name Primer or probe name

Nucleotide sequence 5’ – 3’

N6

Hoffmann N6 (version i)

IAV-N6-10F AGGGTGAARATGAATCCAAAYCA

IAV-N6-14F TGAARATGAATCCAAATCAGAAGATAA

IAV-N6-97R CAATCCTATYAGCAGRCTTACTAC

IAV-N6-43FAM FAM-TGCATHTCAGCHACAGGAATGACACTATC-BHQ1

N6

Modified N6 (version ii)

APHA-N6-10F AGGGTGAAAATGAATCCAAATCA

APHA-N6-14F TGAAAATGAATCCAAATCARAAGRTAA

APHA-N6-97R AATTCCTATYAGCAGRCTTACYAC

APHA-N6-43FAM FAM-TGCRTTTCAGCMACAGGARTRACACTATC-BHQ1

N7


IAV-N7-1305F GTTGAATTAATWAGAGGAAGRCC

IAV-N7-1430R GATYTGTGCCCCATCRGGGA

IAV-N7-1383FAM FAM-AGCCCADTCYCAGTTGGGTCYGGTTC-BHQ1

N7


N7_Mod_For GTTGAATTRATTAGAGGRAGRCC

IAV-N7-1430R GATYTGTGCCCCATCRGGGA

IAV-N7-1383FAM FAM- AGCCCADTCYCAGTTGGGTCYGGTTC-BHQ1

N9


IAV-N9-1363F AGYATAGTATCRATGTGTTCCAG

IAV-N9-1439R AAGTACTCTATTTTAGCCCCGTC

IAV-N9-1393FAM FAM-TTCCTBGGACAATGGAACTGGCC-BHQ1

N9


IAV-N9-1363F AGYATAGTATCRATGTGTTCCAG

N9_Mod_Rev AAGTACTCTATTYTAGCCCCRTC

IAV-N9-1393FAM FAM-TTCCTBGGACAATGGAACTGGCC-BHQ1



Page 13 of 18

APPENDIX 2

Preparation of TaqMan®real-time RT- PCR RNA standards These can be prepared from either live or inactivated egg-grown antigen and can be supplied either as an aliquot of freeze-dried material or an aliquot from a wet ‘antigen stock. NB - For live antigen follow safety procedures in place for the virus type being produced. Work at the appropriate containment level for the virus being used – refer to the virus categorisation risk document

1. If the antigen is supplied freeze–dried, reconstitute the vial with 1ml molecular grade water. Ensure the solution is mixed thoroughly by gentle vortexing.

2. Manually extract the RNA from the whole reconstituted antigen from 1ml of wet stock according to the SOP VIR.0165, RNA extraction from biological samples.

3. Pool together the RNA extractions. 4. Freeze a 5µl aliquot at-70 ºC 5. Thaw this aliquot and prepare a 10-fold dilution series in molecular grade water

from as described above from 10-1 - 10-7 6. Test the dilution series by the appropriate real-time RT-PCR. Test the current

‘in-use’ RNA standard batch in parallel on the same PCR test run. 7. Directly compare the results of the two batches. The Ct values and test

efficiencies should be similar i.e. Ct values +/- 2.0 per corresponding dilution. If there is an apparent significant difference, adjust the dilution of the new batch of RNA (eg. make a 1/10 dilution) and repeat stages 3-7 above.

8. Once the required dilution is achieved, prepare 5µl aliquots, assign a batch number, label the tubes and store at -70 ºC.



Page 14 of 18

APPENDIX 3

Hoffmann N6 RRT-PCR – version (i) of the N6 RRT-PCR

N6 (Hoffmann) RRT-PCR Master Mix (Hoffmann et al., 2016)

Ingredients – all except primers & probe from Qiagen OneStep RT-PCR kit (cat # 210212) & other stated suppliers

Volumes for 10 reaction recipe

Final concentration / strength

DEPC treated (ie RNAse free)- H2O (Ambion [Thermofisher] or similar):

115.42 µl -

(x5) Qiagen 1-step RT PCR buffer: 50 µl (x1)

ROX ref dye, pre-diluted to 1:500 in DEPC treated (RNase-free)-H2O from neat stock (Stratagene or similar):

3.75 µl -

Qiagen dNTP mix: 10 µl -

Primer: IAV-N6-10F (50µM): 8 µl 1.6 µM


Primer: IAV-N6-97R (50µM): 8 µl 1.6 µM

Probe: IAV-N6-43FAM (30µM)*: 3.33 µl 0.4 µM

25mM MgCl2 (Promega or similar): 12.5 µl 3.75mM

RNAsin (40U/µl, Promega or similar): 1 µl 0.16U/µl

Qiagen 1-step RT PCR enzyme mix: 10 µl -

Total: 230 µl -

*NB: If probe is supplied lyophilised, it is important to reconstitute in (x1) TE buffer (available RNase-free from Ambion [Thermofisher] as a (x10) stock which you must dilute with RNase-free water) before adding to the lyophilised probe. This is to prevent probe hydrolysis during storage.

Modified N6 RRT-PCR – version (ii) of the N6 RRT-PCR



Page 15 of 18

N6 (Modified) RRT-PCR Master Mix (James et al., 2018)





115.42 µl -



3.75 µl -


Primer: APHA-N6-10F (50µM): 8 µl 1.6 µM

Primer: APHA-N6-14F (50µM): 8 µl 1.6 µM

Primer: APHA-N6-97R (50µM): 8 µl 1.6 µM

Probe: APHA-N6-43FAM (30µM)*: 3.33 µl 0.4 µM




Total: 230 µl -




Page 16 of 18







123.4 µl -



3.75 µl -








Total: 230 µl -


Modified N7 RRT-PCR – version (ii) of the N7 RRT-PCR uses the same master mix recipe as the Hoffmann N7 RRT-PCR except that the forward primer below replaces the forward primer IAV-N7-1305F: Primer: N7_Mod_For (50µM): 8 µl 1.6 µM



Page 17 of 18







123.4 µl -



3.75 µl -








Total: 230 µl -


Modified N9 RRT-PCR – version (ii) of the N9 RRT-PCR uses the same master mix recipe as the Hoffmann N9 RRT-PCR except that the reverse primer below replaces



Page 18 of 18

the reverse primer IAV-N9-1439R:

Primer: N9_Mod_Rev (50µM): 8 µl 1.6 µM

of subtype N6, N7 and N9 by Real Time PCR · N6, N7 and N9-specific RRT-PCR primers/probe sets: The table in APPENDIX 1 shows the 5’ – 3’ sequences of the ‘Hoffmann’ and

Documents