OER July 2010

Eco

Rev

iew

20.

5 x

27

Al-Khuwair: 24601569, Muscat City Centre: 24558063, Sohar (near Globe Roundabout): 95119692/95119687 UAE • Saudi Arabia • Kuwait • Bahrain • Qatar • Jordan • Egypt • India www.homecentre.net

partne

rshipm

e.co

mA DIA DIA DIDIA VISIVISIVISIVIS ON OON OON OON F LAF LAF LAF LANDMANDMANDMANDMARK RRK RRK RRK RETAIETAIETAIETAIL LTL LTL LTL LTD.D.D.DD

is usually taken.in the house

THE BEST SEAT

BECKY CHAISE

EDITORIAL

Editor-in-ChiefHH Sayyid Tarik Bin Shabib

Group EditorMayank Singh

Assistant EditorVisvas Paul D Karra

DESIGN

Senior Art DirectorSandesh S. Rangnekar

Art DirectorMinaal G. Pednekar

Senior DesignerM. Balagopalan

Senior PhotographerRajesh Burman

PhotographerSathyadas C. Narayanan

Concept and Cover DesignMohamad Nazar

Production ManagerGovindaraj Ramesh

MARKETING

Business HeadJacob George

Senior Advertising ManagerAvi Titus

Assistant Advertising ManagerJinu Mathew Varghese

CORPORATE

Chief ExecutiveSandeep Sehgal

Executive Vice PresidentAlpana Roy

Vice PresidentRavi Raman

Senior Business Support ExecutiveRadha Kumar

DistributionUnited Media Services LLC

OER Presentations

Published byUnited Press & Publishing LLCPO Box 3305, Ruwi, Postal Code - 112Muscat, Sultanate of OmanTel: (968) 24700896, Fax: (968) 24707939Email: [email protected]

All rights reserved. No part of this publication may be reproduced without the written permission of the publisher. The publisher does not accept responsibility for any loss occasioned to any person or organisation acting or refraining as a result of material in this publication. OER accepts no responsibility for advertising content.

Copyright © 2010 United Press & Publishing LLCPrinted by Oman Printers

Correspondence should be sent to:Oman Economic ReviewUnited Media ServicesPO Box 3305, Ruwi 112, Sultanate of OmanFax: (968)24707939Email: [email protected]: www.oeronline.com

No 120 July 2010

The response to Oman Green Awards held on June 12, 2010 has been

humbling to say the least. For the people of Oman, the inspiration for

environment conservation comes from our benevolent leader His Majesty

Sultan Qaboos bin Said. It has always been the belief of His Majesty that it

is in the best interest of humanity to preserve the environment; sustain its

assets; and maintain its resources. Only then can we pass on a safer, more prosperous

and greener world to our future generations.

The evidence of His Majesty’s continuous care and interest in environment at both

the national and international levels is seen in the institution of the international

“Sultan Qaboos prize for Environmental Protection,” in 1989. The prize is administered

by UNESCO.

The importance of preserving the environment can hardly be overstated. While one does

not want to sound alarmist, the statistics speak for themselves – human beings add six

to eight billion tonnes of carbon dioxide to the atmosphere every year by burning fossil

fuels and destroying forests. Over 40 per cent of all tropical forests have been destroyed

and another acre is lost every second. The last two decades of the 20th century were

the hottest in 400 years; Arctic ice is disappearing rapidly, and the region may have its

first completely ice-free summer by 2040 or earlier. Over 100 pesticide ingredients are

suspected to cause birth defects, cancer, and gene mutations. The annual catch in 13 of

the world’s 15 major fishing zones has declined and in four of those in the Atlantic and

the Pacific oceans - the catch has shrunk by a startling 30 per cent.

And the danger is closer than we think, Coral reefs, which are highly sensitive to water

temperature have suffered the worst bleaching or have died-off in response to stress

recorded since 1998. Some areas have seen bleach rates of as high as 70 percent. This

should sound a warning for Oman as well.

In the last couple of years as people searched for glimmers of hope in the wreckage of

the world economy -- politicians, economists and commentators used one phrase so

repeatedly that it became something of a mantra for our times: In crisis lies opportunity.

Nowhere does that maxim apply more than to the problem of climate change. The

financial crisis only crippled a global system; climate change is hurting the globe itself.

While we may think that hard decisions are the responsibility of our leaders alone, when

it comes to the environment each one of us can make a difference.

TOGETHER WE CAN

Mayank Singh

To read, click on link at: www.oeronline.comOER -magazine

6 July 2010

INSPIRING SAGAIt was really inspiring to read the cover story on Oman’s young executives in the June issue of OER. It is not an exaggeration to write that I could not put the book down without completing all the ten profiles of promising young executives who were finalists of NTI BizPro Awards, 2010.

The vignettes on the life of these young men testify to the talent, ability and hard work of Omani youth. They have exposure to the outside world and vision for the future. They are also accommodative and willing to work hard. I request schools and colleges in Oman to invite them to interact with students. These achievers are fit to be the role models for children. I expect OER to profile more such talented youth in future.

Kumar P via email

HATS OFF TO OMAN OILThe interview with HE Maqbool bin Ali Sultan, minister of commerce and industry and chairman of Oman Oil Company in the June issue of OER was highly informative.

It gave a fair idea of investments of the

company abroad, its guiding principles and the focus areas in the current year. The prudent acquisitions made by Oman Oil in 2009, when valuations were attractive will stand the company in good stead in the coming days.

Investors in Oman are really excited to learn that some of the subsidiary companies of Oman Oil may launch initial public offerings in the coming years. With a wise leadership exploring all opportunities to sustain its growth momentum, it is sure that the company will reach new heights in the coming years.

Alex Benny

WHITHER DOWNTURN?At a time when the rest of the automobile industry was reeling under the double impact of a global financial crisis and vehicle recalls due to faulty manufacturing, Peugeot seems to have been busy building up a nice little sports coupe (Ref story: Peugeot RCZ – Emotion in Motion).

Peugeot Automobiles seems to have been undaunted by the fact that globally, the consumer confidence in car makers

had taken a beating with hundreds of recalls being effected by some of the top automobile manufactures.

The RCZ itself is endowed with delightful curvaceous looks, probably resembling the twists and turns of the mountainous terrain, where it was test-driven by the Oman Economic Review journalist.

I do hope that the car will be launched in Oman soon as it will usher in a refreshing change on the Sultanate’s roads, which are filled with big and ugly cars that have little aesthetic appeal.

Hamood Aziz, Muttrah

Write to us with yourcomments/feedback at: [email protected]

LESSON IN POETRYThe Beyond Boardroom column titled ‘Passion for poetry’ makes for an interesting read mainly because there are a number of CEOs like Sameer Gupta who have innate talents apart from their professional skills. OER has also published a nostalgic and touching poem written by Gupta on memories. Gupta, as it turns out does seem to be a multi-faceted personality with literature and poetry running in his blood. But what is interesting to note is that he became a financial officer in some of his earlier companies, which is actually a far cry from poetry. Further, he is now at the helm of Infoline, an IT services company.

For the detractors of arts and literature, this is a big lesson that you need to study arts and literature in order to develop your other professional skills. As William Shakespeare the greatest poet and litterateur of all times says, ‘the object of art is to give shape to life’, we all need to take a lesson or two from the beyond boardroom life of Gupta.

Rudraprakash Bhatt, Wattayah

CORRIGENDUMIn the June 2010 cover story ‘Young executives to watch out for’, the designation of Aliya Ali Humaid Al Balushi in the photo caption should read as ‘Relationship Manager, Wholesale Banking and International Operations, Executive Management, BankMuscat’. The error is regretted.

Editor

8 July 2010

HEROES OF THE ENVIRONMENT

22IN THE NEWSDhofar AutomotiveTwo of Oman’s leading business groups have joined hands to distribute Chrysler, Jeep and Dodge vehicles across the Sultanate

58VIEWPOINTMeeting global challengesPower and utilities businesses must assess their core assets and determine which new assets and functions will help them remain competitive in the market

EVENTMemorable success

NPA Events won the Middle East Event award for organising the ‘Rembrandt in

Oman’ arts exhibition

92

COMPANY PROFILE

Affordable exclusivityY Rajeev Reddy, Chairman and Managing

Director of Country Club India talks about the company’s foray into Oman and the way ahead

54

INTERVIEWPotential in solar

Dr Inderjeet Singh, Senior Manager at PricewaterhouseCoopers talks about a

range of subjects from renewable energy to water foot print

68

23REAL ESTATEScientific approachProfessional property valuers use cost plus profit and income capitalisation methods to arrive at the fair value of a property

70ECONOMYA line for growthWith feasibility studies underway for a nation-wide rail network and a pan-GCC railway, it is only a matter of time before the Sultanate of Oman begins to reap benefits from the railways

C O V E R S T O R Y 24

10 July 2010

84CLOSE UPGCC’s mighty economic sizeOil prices leave their imprints on the regional economies and puts the GCC in the ranks of top GDPs of the world

61SPOTLIGHTSecuring your futureTaking a good insurance policy should be the first step towards financial planning as it provides help in case of emergencies

By Kannan Murali

CARTOON CORNER

Editorial 2

Economy Watch 12

Business Briefs 14

Executive Movements 20

Auto News 76

Industry 81

Billboard 86

Golf Update 88

Browsing Corner 89

Market Watch 90

Gizmos 91

78PERISCOPECrude oil, Saudi Arabia and RussiaRussia’s return to the international capital markets and Saudi Arabia’s spectacular development story are the money-earners

74 AUTO TALKDiscover the challenge

82CONSUMER DURABLESSamsung 3D TVsThe ability of Samsung TVs to convert from 2D to 3D brings a new dimension of home entertainment to the living room

12 July 2010

NUMBERSInvesting in a rebound

Source: A.T. Kearney FDI Confidence Index

According to A T Kearney FDI Confidence Index, while economic conditions have improved, few expect a full turnaround before 2011

0

10

20

30

-30

-20

-10

4032%

-7%

ChinaOther Gulf States* Canada

-8%

India

31%

-2%

Brazil

22%

-22%US

17%

Germany

-8%

15%

-3%

Vietnam

15%

-7%

Poland

15%

Australia

-7%

14%

-3%

14%

More positive More negative

-16%

14%

Region that will recover first (Percentage of respondents)

0

10

20

30

40

50

60

70

80

Asia-Pacific

Central America

North America

Europe Middle East

South America

Africa

1% 1%

72%

15%

6% 4% 2%

Main drivers of investment in the current economic climate

0

10

20

30

40

50

60

70

Access to new markets

Central America

Building up capacity to prepare for the economic

rebound

Low M&A target prices

Cuttingcosts

Hedge for current

business’ regional eposure

Financial subsidies

9%

63%

36%32%

24%

14%10%

14 July 2010

SADOLIN TIE-UP WITH IDDESIGN STUDIOSadolin Paints, the largest paint manufacturer in the Sultanate, has recently collaborated with IDdesign at Markaz al Bahja to help create a unique design studio within their store. The IDdesign team has selected several shades from Sadolin’s vast colour palette to go with different parts of their interiors at the store. In order to highlight the colour and hue of the furniture placed at IDdesign, several sections of the store have been painted using Sadolin Paints.

INFOLINE LAUNCHES MICROSOFT SOLUTIONSInfoline, the leading IT and ITES organisation in Oman, recently added a complete suite of Microsoft IT Training solutions and services being a Microsoft Gold Certified Partner and a Microsoft Certified Partner for Learning Solutions. The training division of Infoline diversifies its service offerings with Microsoft Technological Trainings and Certifications based on the Microsoft official curriculum.

WORLD SICKLE CELL ANAEMIA AWARENESS DAY CELEBRATEDOman Hereditary Blood Disorder Association commemorated World Sickle Cell Anaemia Awareness Day at Muscat City Center in Seeb. Several activities like free educational sessions with a healthcare professional and a bazaar took place at the event. The Awareness Day is designed to raise public awareness about Sickle Cell Anaemia and to eliminate harmful prejudices associated with the disorder.

Jet Airways, India’s premier international airline, and Jet Lite, a wholly owned subsidiary, have achieved the best on time performance in May, as per the figures released by the Director General of Civil Aviation. The month of May, which is the peak summer season, has

seen a sharp turnaround following the unwavering dedication and commitment displayed by the staff of Jet Airways and Jet Lite on the network which has played a decisive role in enhancing Jet Airways and Jet Lite OTP.

During May, Jet Airways

has recorded an on-time performance to 88.9 per cent. The month of May has also seen the airline carrying 8.69 lakh revenue passengers registering a sharp 41.2 per cent growth as compared to the same period last year with a seat load factor of 82.5 per cent.

Jet Airways on-time performance soars

Aster Hospital, Sohar of DM (Dr Moopen’s) Healthcare opened its doors to the people of North Batinah region. This is the first private hospital in the area and will form part of the largest network of medical facilities in the GCC.

The 60-bed Aster Hospital (Al Raffah hospital), like all other DM healthcare hospitals and medical centres, shall strive hard to help the people who require health care with a personal touch. With a dedicated team of healthcare

Aster Hospital opens in Sohar

professionals of global standards, delivering quality health care at an affordable

cost, Aster Hospitals shall provide personalised care at the doorsteps of the people.

Nawras, a Qtel Group company, is the exclusive sponsor of two Muscat residents, including the first Omani woman, in their

expedition to climb Africa’s highest mountain, Mount Kilimanjaro in Tanzania. Muna Al Shanfari, a successful Omani bank executive and

mother of three, will be making the trek together with her friend Catherine Lonie, a long time resident of Muscat as well as a lecturer at Sultan Qaboos University, to raise awareness for road safety and in particular, to encourage parents and drivers to use car seats to keep children safer when travelling.

Both Al Shanfari and Lonie are keen mountain walkers, taking regular treks up and down local hills to exercise and clear their minds.

Nawras sponsors Kilimanjaro expedition

16 July 2010

CUMMINS-UES CONDUCTS POWER TRAININGUniversal Engineering Services (UES), a part of Bahwan Engineering Group, the authorised sales and service dealership of Cummins for Sultanate of Oman and Cummins Middle East FZE jointly conducted a course on Power Training (Generator Set Application and Fundamental Course). It was a technical seminar on international standards for genset ratings, generator selection, mechanical and electrical fundamental of generator set installation, application, digital synchronising etc.

CLUTTONS SIGNS MOUFOR KSA OFFICECityscape Jeddah, KSA, a leading international property consultancy and chartered surveyors, Cluttons, signed a memorandum of understanding (MOU) with Saudi International Development Company (SIDC), a subsidiary of Al Bundakji Holdings, to jointly undertake commercial property consultancy operations in the growing real estate market in the Kingdom of Saudi Arabia.

MELC OFFERS ADVICEFOR CATARACTOur eyesight is such a natural part of our lifestyle that we often take it for granted and sometimes neglect the care our eyes require. Just like any other ailment, as soon as you sense there is a problem in your eyes, consult a doctor immediately urges Dr Jose Ricardo Lievano S, ophthalmologist and cataract surgery consultant at Muscat Eye Laser Center (MELC). Two of the main diseases that are prominent in Oman and can cause blindness are cataract and glaucoma.

Intilaaqah has launched its new and revamped programme, wherein the Intilaaqah and Intilaaqah Enterprise Fund are merged as a single programme under the brand name Intilaaqah.

On the occasion of Oman’s 40th anniversary, and to make

Intilaaqah Fund sustainable, Shell also announced its gift to the nation, this year, by adding another $7mn to the fund.

Going forward, Intilaaqah will be a one stop shop for entrepreneurs, which will provide financial support and business development

services. The main focus of the Intilaaqah programme will be on creating sustainable businesses and job creation. In addition the programme will offer funding ranging from $50,000 to $1mn to qualified SMEs, along with comprehensive online training capabilities and tools.

New, revamped Intilaaqah launched

BankMuscat and Omantel, banking and telecom majors respectively of the Sultan-ate, joined hands to launch a national initiative in com-memoration of the 40th Renaissance anniversary of the reign of His Majesty Sultan Qaboos Bin Said. Bringing together the nation as one family and targeting children who are the building blocks of the Sultanate, the ‘Celebrate Together’ campaign primarily revolves around an art contest aimed at instilling time-tested Omani values in the younger generation. The theme of the contest will focus on the Sultanate’s achievements in

Kids painting contest launched

The new label will remain on the Oasis bottles until

Oasis Water Company unveiled a new label for its bottles to mark the occasion of Oman’s 40th anniversary celebration. This new label can be found upon 0.5 and 1.5 litre bottles of “Oman Oasis” balanced drinking water. The newly outfitted bottles can be found all around the capital area, as well as at all distribution points around the Sultanate.

Oman Oasis presents new labelthe end of this year. The Omani national flag resides colourfully within the ‘O’, the phrase “40 Glorious Years” is displayed prominently underneath. The wrap-around portion of the new label is cleverly brushed with the red, green and white of the Omani flag in swooping, graceful and intersecting lines; as if to symbolise national flags swaying majestically in the wind.

the economic, social, health and educational fields and the role of the Omani citizen as the main objective of all such achievements. Parents will be encouraged to motivate chil-

dren from all regions of Oman to participate in the contest, which is expected to generate more than 40,000 paintings embodying the 40th year of His Majesty’s rule in Oman.

18 July 2010

OMAN AIR, BANKMUSCAT TIE-UPOman Air, the national airline of the Sultanate of Oman, has signed a Memorandum of Understanding (MoU) with Bank Muscat, the leading Omani financial services provider to work across a range of activities to promote each other’s products and services to their employees and customers. The MoU is wide-ranging and paves the way for a broad range of initiatives, including a co-branded credit card and the extension of Oman Air’s Sindbad loyalty programme to holders of the new credit card.

A’SAFFA FOODS INTRODUCE NEW CHICKEN NUGGETSA’Saffa Foods, Oman’s number one producer of poultry, has expanded its range of chicken products to include a new, fun range of chicken nuggets intended to make “kids happy” across the Sultanate. Bursting with flavour, the new range comes in two mouthwatering varieties including; Chicken Kids Happy Nuggets and Chicken & Cheese Kids Happy Nuggets, both of which are prepared using the best quality ingredients, including A’Saffa chicken breasts which are 100 per cent natural and tasty.

NBO CONDUCTS FIRST SALES CAMPAIGN IN DHOFARNational Bank of Oman (NBO), in order to create large-scale awareness about its biggest ever prize scheme ‘Al Kanz’, recently conducted its first sales campaign in Dhofar region. These sales campaigns were conducted by NBO’s new Salalah branch team in collaboration with the respective branch managers, regional managers and branch staff.

The Ministry of Tourism is preparing for the large number of visitors expected to travel to Salalah, the capital of Dhofar Province and the country’s second largest city, during the Khareef season, which began in June and extends to early September.

Last year, Salalah welcomed almost 300,000 local and international guests during the said period. The World Travel and Tourism Council predicts a 7.8 per cent compound annual growth rate for Oman’s tourism sector over the next 10 years. The Council expects

Oman to emerge as the Middle East’s top tourism growth market and third globally in 2010. The Omani government plans to generate 3 per cent of the national GDP from tourism and match 80 per cent of tourism jobs with citizens by 2020.

MOT prepares for Salalah tourism

Mustafa Sultan Enterprises (MSE) has entered into a joint venture with Indian air-conditioning and engineering services company Voltas to execute electro-mechanical projects in the Sultanate. The Voltas Group will hold 65 per cent stake, while MSE will keep the balance 35 per cent

in the company named as Voltas Oman.

The formation of Voltas Oman represents the union of two leading corporate entities who are leaders in their respective markets, said Akber Mustafa Sultan, managing director of MSE.

According to Shukat Ali Mir, EVP and COO of Voltas International Operations Business Group, Voltas wants to be a long-term player in providing turkey solutions and world-class products and services. These will cater to the growing opportunities arising in Oman.

MSE, Voltas form joint venture

Gargash and Trade Links Insurance Services, a newly set-up company in Oman, offering professional insurance intermediary services launched their corporate identity and logo at a function in Muscat recently. The company is set up jointly by Dubai based Gargash, with its presence in different

sectors like financial services, real estate and automobiles and Trade Links, a leading business group based in Oman. Dr J Retnakumar CEO of the company said the aim is to provide proper advice to those who want to take insurance policies and tailor a product to fit their needs. Mustafa O Vazayil,

vice chairman of the company said the company also plans to offer online services to customers in the future. Insurance market in Oman is growing and we hope to emerge as a top player, he added. Tariq Ali Mirza, director of Gargash and Trade Links was also present at the press conference.

New insurance brokerage company launched

19July 2010

Samsung Electronics, a leading mobile phone and telecommunications provider introduced its vision of ‘Smart Phone for Smarter Life’ with the launch of two flagship products Samsung Wave and Samsung Galaxy S.

Sandeep Saihgal, general manager, mobile phones, Samsung Gulf Electronics commented: “Samsung is committed to the smartphone market; delivering a smartphone to suit any user or lifestyle. This strategy points to delivering devices, applications and services relevant for every lifestyle to

empower users with access to the information and connections that produce valuable user experience.”

While the Samsung Wave features Bada, a proprietary operating platform; the Samsung Galaxy works on the Android platform. Both the phones are loaded with various applications and software including social media and also the world’s first Super Amoled display. The ‘Smart Phone for Smarter Life’ concept “delivers a smartphone experience that is simple, organised and integrated. Smart Life is

flexible and versatile, allowing consumers to customise their experiences based on their needs. Such a philosophy embodies Samsung’s drive to build a new class of smartphones that will maximise user experience.

The Samsung Wave features the world’s first Super AMOLED display; delivering an unrivalled screen experience on a smartphone while the Bada platform offers a genuine smartphone experience rich with mobile applications, new technology and possibilities to Samsung mobile phone users.

Samsung introduces Smart Phone

BANKDHOFAR BAGS ‘SUN & SEA’ CERTIFICATEBankDhofar, ranked number 1, as the “Best Bank in Oman 2010” by the Oman Economic Review, was rewarded with the ‘Sun & Sea’ certificate of appreciation by the Omani scouts association for its participation in a beach clean up on the occasion of the Arab Environment Day. The award was received by Hani Macki, AGM Strategy and Planning, BankDhofar.

KUWAIT EXPO IN OCTOBERAs part of its goal to organise major events across the region, Oman International Trade and Exhibitions (OITE) and Kuwait International Fair (KIF) will be holding the Kuwait Environment, Water and Energy Exhibition (KEWE) for the first time October from October 3-5 at the International Fairs Ground, Mishref, Kuwait. A spin-off of the Sultanate’s Gulf Eco Expo, KEWE is set to attract the biggest names in Kuwait’s environment sector focusing on Environment, Water and clean Energy.

BANKMUSCAT’S CD AUCTION OVERSUBSCRIBEDBankMuscat, the leading financial services provider in the Sultanate, successfully closed its last and 14th Certificate of Deposit (CD) auction recently. The issue was subscribed to the extent of RO22.3mn against the issue size of RO15mn with the weighted average yield accepted for one year and five years being 2.50 per cent and 4.75 per cent respectively. There were no bids for the 3-year tenure.

The Oman Power and Water Procurement Company (OPWP) has awarded built, own, operate and transfer (BOOT) contracts for the country’s next two independent power projects (IPPs), Barka 3 and Sohar 2.

The contracts to construct and operate the plants

have been awarded to a consortium consisting of the Kahrabel GDF Suez Group, the Bahwan Engineering Group, the Public Authority for Social Insurance, and the Shikoku Electric Company and the Sojitz Corporation. EPC contractors for the project are Germany’s Siemens AG and South Korea’s GS Engineering.

The combined investment for both projects will be around $1.7mn. Barka 3 and Sohar 2 are greenfield natural gas-fired power projects with a capacity of 744MW each. The electricity produced by each project will be sold under a 15-year Power Purchase Agreement to the Oman Power and Water Procurement Company.

Barka 3, Sohar 2 IPP contracts awarded

20 July 2010

Shiva Dean has joined Port of Salalah as the chief commercial officer bringing with him a wealth of experience in the commercial field. Dean joins Port of Salalah from the Safmarine West and Central Asia regional office in Dubai where he headed the commercial activities across 14 countries. Dean was previously based in Singapore with Safmarine Asia where he was responsible for their commercial activities across the Asia/Pacific region. Academically, Shiva is a graduate of the University of Western Ontario, Canada and has also attended executive education programs at Harvard and Columbia Business Schools.

Standard Chartered announced the appointment of Christos Papadopoulos as regional CEO for the Middle East and North Africa. Christos replaces Shayne Nelson, who moves to Singapore as CEO of the private banking. The appointment will be effective September 1. He will be based in Dubai and report to V Shankar, CEO, EMEA and Americas. For the last four years, Christos, a Cypriot, has successfully led and transformed the financial

institutions practice within the wholesale bank department. Prior to joining Standard Chartered, Christos was senior partner at KPMG in London where he specialised in the financial sector for over 17 years.

DAR AL ATTA’A SUPPORTS CYCLONE PHET VICTIMSDar Al Atta’a (House of Giving) has taken on the responsibility of reaching out to many Cyclone Phet victims who were stranded without basic necessities. The charity called on many volunteers who were able to reach many affected areas in Oman such as – Quriyat, Al Kamil, Al Wafi, Assarain, Sur, Daghmar, Hail al Ghaf, Al Rustaq and many other small villages.

HTC Corporation, a global designer of smartphones, has announced the recent appointment of Geetika Gupta as the company’s new regional marketing manager. Gupta’s key responsibilities in her new role include planning and developing the marketing strategy for the MENA region, planning and implementing the regional marketing plan and initiatives across direct and indirect channels, building relationships with local distribution and retail partners and operators to develop joint cooperative marketing plans, in addition to other branding and marketing related tasks. Gupta was previously

HTC’s brand and retail manager. Commenting on the appointment, Nikitas Glykas, regional

director of HTC South Eastern Europe and the Middle East, said, “We believe that

Gutpa’s domain expertise and vast experience will significantly help HTC consolidate its presence in the Middle East and North African markets. A fast-growing brand like HTC requires the contributions of young and dynamic marketing managers like her and I wish her success in her new

role.” Prior to joining HTC in 2007, Geetika Gupta – who is a MBA gold medalist from one of India’s premier

business schools - worked as product marketing

executive at Sony Gulf FZE, Dubai.

gthe appointment, Nikitas Glykas, re

director of HTC South Eastern Ethe Middle East, said, “We be

Gutpa’s domain expertise anexperience will significantlyconsolidate its presence inEast and North African mafast-growing brand like HTthe contributions of youngdynamic marketing managand I wish her success in

role.” Prior to joinin2007, Geetika Gupis a MBA gold medfrom one of India

business schooas product ma

executive at SFZE, Dubai.

BAE Systems has unveiled a new build standard of its highly-regarded CV90 tracked armoured vehicle – named

Armadillo. The armoured personnel carrier variant was on display at Eurosatory exhibition in Paris. The CV90

Armadillo family of vehicles combines extremely high levels of protection with excellent mobility. The flexible modular design involves a rear roof section, which can be unbolted to allow simple changeover between different mission fits. This ensures up to 80 per cent commonality between variants and easy re-roleing of the base chassis. CV90 Armadillo has horizontal ballistic protection well above the NATO STANAG 4569 Level 5 standard.

BAE Systems unveils Armadillo

22 July 2010

An exciting new era for world beating American car brands is now underway in Oman with the launch of Dhofar Automotive – an innovative

new joint venture from the Zubair and Shanfari companies. Before the joint venture both Zubair Automotive Group and Shanfari Automotive distributed and sold Chrysler, Jeep and Dodge throughout the Sultanate but now customers will have a far simpler interaction through one Dhofar Automotive outlet in Oman’s main population centres. The newly formed automotive powerhouse is creating a single company for the sale and distribution of the popular Chrysler, Jeep and Dodge (CJD) brands of cars and SUVs from showrooms across the Sultanate.

Customer service and satisfaction is at the very heart of the new company with management committed to ensuring trouble free motoring combined with a low cost of ownership for new and existing Chrysler, Jeep and Dodge vehicles that has seen record breaking sales in the Sultanate in the last three years.

Service is the keySpeaking at the launch of the new company, Zubair Automotive Group chairman Hani Al Zubair, who will be chairman of the new joint venture company, said: “We are very proud to announce this new joint venture that introduces an exciting new era for Chrysler, Jeep and Dodge customers and our commitment to offer them trouble free motoring delivered through the best prices and levels of services, better maintenance and repair that will give them a lower cost of ownership.”

The new Dhofar Automotive Board of Directors will comprise Hani Al Zubair as chairman, Dr. Adil Said Al Shanfari as vice chairman, board members Husam Al Zubair and Sachin Bawa and managing director Serdar Toktamis. Chris Edwards

The new company will sell, distribute and service cars and parts for Chrysler, Jeep and Dodge vehicles across the Sultanate

Zubair, Shanfari groups tie-up for Dhofar Automotive

IN THE NEWS

will become general manager of the newly created company. He currently manages the Chrysler, Jeep and Dodge brands on behalf of Shanfari Automotive. The new company will also include the RAM and Mopar brands within its portfolio.

Dr. Shanfari, vice-chairman of the Shanfari Group of Companies added: “Today’s announcement is a major step forward for the automotive business here in Oman and our joint venture has been developed based on putting the interests of the customer first and foremost in our thinking. Our customers will now benefit from highly competitive maintenance prices for their vehicles and

we are making a significant investment in tools, equipment and training of our technicians to help deliver trouble free motoring in the future.”

The investment that is being committed by Dhofar Automotive also includes the development and construction of a state of the art showroom, sales and servicing (3S) facility in Wattayah as the company’s flagship operation. The company has also identified another location in Muscat that will have a servicing and parts facility with the option to develop a showroom as well to provide another convenient location for customers in the capital area. The new company has the full support and backing of Chrysler Group Middle East and North Africa. Its managing director Jack Rodencal says, “We have enjoyed a long and hugely successful partnership with these leading Omani business houses. The creation of this new integrated business is a development we fully endorse as a logical progression that reflects the way that our three brands of Chrysler, Jeep and Dodge have become one business in recent years.”

DHOFAR AUTOMOTIVE

Shareholding pattern

Shanfari: 30%

Zubair: 70%

From L-R. Hani Al Zubair, Jack Rodencal and Dr. Adil Said Al Shanfari

23July 2010

Professional property valuers like Al Habib use cost plus profit and income capitalisation methods to arrive at the fair value of a property

Scientific approach

The author is General Manager, Al Habib & Co.R

ecently one of our clients told us that he was looking to make a small

investment in real estate by buying an income yielding building. We told him that the sellers were asking for prices based on the present income of the building. Any building generates income over many years and if the value is to be based on capitalisation of the rental revenue stream, one must have a good idea of where rents are headed in the years to come. A quick and easy way to find out if price is high is to compare the value of a building arrived at using the income (based on present rents) capitalisation method with the cost method. After all, any investor would not be willing to pay much more than what it would cost him if he bought a similar piece of land in a similar location and constructed a similar building. He would, of course, pay a premium, called the entrepreneurial profit, in order cover for time value of income and the risks involved in building (costs could go up, a contractor could default on his commitment, quality tenants may not be found etc.). However this premium should be “reasonable”

and professional property valuers have a good estimate what this is at various points of time.

Calculating gains When these “premiums” are too high and as the cost plus profit method and income capitalisation method have to converge, something has to give way, which means that either costs have to go up or rents have to go down. Costs could go up if commodity and labour costs move up and this depends on global factors like the growth in the global economy which drives commodity prices and inflation which could be triggered by quantitative easing (in layman’s language printing money) that many central banks are resorting to. However at the moment investors are not betting on inflation in the short term although “slight” inflation is always targeted by central banks and is always going to be there in the long run since deflation can be catastrophic. Typically, these “premiums” depend on the economic cycle with premiums being high in boom phases and low (could be negative) in downturns.

Another likely scenario is

that rents will fall. Therefore, investors must be cautious while buying real estate assets and must ensure that there is not too much of a gap between the cost and income capitalisation methods. It is, of course, possible that costs themselves could drop but investors have to take a view on this based on global and national economic factors.

Rents depend on supply and demand but ultimately developers will continue building as long as the returns are attractive meaning rents are high and therefore, supply will keep rising when there is a gap between the income capitalisation and cost methods. Thus in the long run the two methods of valuation have to converge and any divergence is a signal to buy or sell.

REAL ESTATE PRICE Cost plus profit method: Cost of building plus a premium

Income capitalisation method: Based on future rental income

SUDHAKAR REDDYREAL ESTATE

COVERSTORY

HEROES OF THE ENVIRONMENTOman Green Awards honoured companies and individuals who

are driven by a simple notion – We can all make a difference.

Mayank Singh and Visvas Paul D Karra report

The first National Environment Awards – Oman Green Awards held at Shangri-La’s Barr Al Jissah Resort & Spa on June 12, 2010 proved to be a

memorable affair. The venue was turned into a veritable green enclave with over 200 plants on display, inspired rockery and an artificial waterfall. The lighting and music added to the ambience.

While the atmosphere may have been surreal, the seriousness of issue at hand was not lost on anyone. Business leaders and senior government officials had gathered to honour companies, institutions and individuals who had shown remarkable environmental initiative. In his inaugural address Sandeep Sehgal, Chief Executive, UMS called upon everyone to contribute their mite to the environment. Lamees Daar, Executive Director, Environment Society of Oman, focussed on the imminent threat to the environment and asked companies to look at saving the environment as a part of their corporate social responsibility.

The Guest of Honour, HE Sayyid Hamood bin Faisal al Busaidi, the Honourable Minister of Environment and Climate Affairs and HH Sayyid Tarik bin Shabib al Said, Editor-in-Chief, Oman Economic Review handed over the awards to the winners.

The complete work of the winners of Oman Green Awards can be seen on omangreenawards.com. Oman Green Awards was held in association with the Ministry of Environment; the Ministry of Health – Department of Environment and Occupational Health; Muscat Municipality; and the Environment Society of Oman. Bahwan Engineering Company-Carrier, Voltamp, V-Kool Oman, Oman Oil Marketing Company, MB Holding Company, Panasonic and the Shangri-La’s Barr Al Jissah Resort & Spa were Green Oman partners. Majan Electricity Company, Proscape Al Ansari, Business International Group and Oman Printers and Stationers were support partners while Times of Oman, Al Shabiba and Oil and Gas Review were the media partners.

A group shot of Green Oman Partners

Sandeep Sehgal, CE, UMS

Alpana Roy, Executive Vice President, UMS, with guests Evening’s entertainment

Lamees Daar, Executive Director, ESO

25July 2010

COVERSTORY

26 July 2010

Green Campaign of the YearWinner: Haya Water

(Oman Wastewater Services Co)

Special Commendation: Muscat Asian Beach Games Organising Committee

Green Guardian AwardWinner: Six Senses Hideaway Zighy Bay

Special Commendation: BankMuscat

Green Landscape AwardWinner: Al Nahda Resort & Spa

Special Commendation: Gardening World Oman

Green Habitat AwardWinner: Muriya Tourism

Special Commendation: National Pharmaceutical Industries Company

Public Choice AwardWinner: Bahwan Engineering Company

Special Commendation: Cartridge World Oman

Green Education AwardWinner: Indian School Nizwa

Special Commendation: ABA – An IB World School

Green Champion AwardWinner: Pravin Amudan

Special Commendation: Ojas Bhatia

The Green Innovation AwardWinner: Crowne Plaza Sohar

Special Commendation: GoPoint Ta’meer

The Green Research AwardWinner: Sultan Qaboos University

Special Commendation: Mitsubishi Corporation

Green Footprint AwardWinner:

AES Barka Power & Desalination Plant

Special Commendation: V-KOOL

LIST OF WINNERS

Special Jury AwardsPort of Salalah

Petroleum Development Oman

Months of research and brainstorming went into creating an award plaque that would be befitting for the event. Scores of suggestions were looked at by team OER before selecting the one which made the cut. A brief explanation about the plaque follows.

One Earth: One Choice: Make it Now!

The plantain tree (Scientific name: Musa acuminate and again musa balbisiana) is an edible fruit plant widely grown commercially in Sri Lanka and other South East Asian tropical countries. Traditionally, farmers cut off the stem of the plant and discard it once the fruit has been removed from the plant, leaving it to die. The discarded plants usually become garbage, polluting its surroundings as it slowly rots above the ground.

The Oman Green Awards plaque was specially made out of banana barks discarded from plantations in Sri Lanka. The effort was to reuse this natural resource and to extend its life-time and usefulness, underlining the adage: reuse, reduce and recycle.

Oman Green Awards Award plaque – The making

27July 2010

SIMPLE AND CLEANHaya Water’s campaign conveyed the intended message

about a healthier, cleaner and greener tomorrow

ENVIRONMENT CREDENTIALS

The most tangible proof of ›success is the growing fan base of Haya Water on social networking site FacebookThe medium is now also a ›platform allowing the brand and its target audience to interact The campaign addressed ›people across age, gender and nationality Integrated campaign making ›use of different mediums and multiple messages

Haya Water launched one of the biggest awareness campaigns to preserve the environment and apply safety procedures

at its work sites in 2010. The challenge for the company was to create awareness and correct perceptions in the minds of people about Haya Water’s activities and to let them know about the great efforts being made by the company for the benefit of the residents and visitors of the Muscat governorate. The strategic approach adapted, given the objective was to create awareness about the benefits of the brands. The campaign was supposed to set the tone for communications targeting specific locations where the laying of pipelines for a greener future were being laid and educating the audience about the real time benefits.

A metaphorAll of this was made possible through an integrated communication approach with a mix of above the line, below the line and social media platforms which reinforced the message. The ongoing advertising campaign aims to change the mindsets and position of Haya Water as the harbinger and enabler of a sustainable future.

Communication was designed to be simple, clean and easy to comprehend. This was in view of the diversity of the target audience. The clean layouts extended the company’s healthy, clean and green cause. The underlying theme of the entire campaign was ‘Green’. Green for a greener and cleaner Muscat which was ‘eco-friendly.’

The campaign addressed people across

age, gender and nationality in Muscat. It was an integrated one making use of dif-ferent mediums and multiple messages. The immediate response was an increased level of awareness about the brand Haya Water and a correct interpretation of its activities and services.

The most tangible proof of the success of the campaign is the growing

fan base of Haya Water (group) on social networking site Facebook. The medium is now also a platform allowing the brand and its target audience

to interact constantly. The campaign has increasingly seen support

and appreciation from well wishes.

The Muscat wastewater project is one of the biggest environmental projects

in Oman. In this project sewage water is converted from materials that cause harm to the environment into environment friendly products. Within this project, sewage networks, water treatment plants and TE networks for distributing the treated water used for irrigation, gardening and other usages are carried out. This is in addition to constructing a plant for converting solid wastes resulting from the sewage treatment into organic fertilisers.

wawawawawawawawawwwww s ss s sss ananananananannna i i i iiiiiiiintntntntntntntntntntntntntntn eegegegegeegegegeegfefefefefefeffeererererererererr ntntntntntnttn m m mm mm mmmmmmedededdededee iuiuiuiuiuiuuuiiThThThThThhThhThThThhhhee e e ee eeeeee imimimimiimmmemememememeedididididiiiiiiiiaaaaaaalelelelelelellel vevevevevevevvevevevell l l lll ofofofofofofffofoo a a a aaa aawawawawawawawwwawawawwawww rrrrWaWaWaWaWaWaWWWWWWWWW tetetetetettteteteeet r rr rr r rrrrrr anananannnnd d d d d aaaaaaaacacacacacaaccactitititititititiiitiviviviiviviviviviivvv titiiiititiiiiitiitieseseseseeseese a a a aaaandndndndndndndd

ThThThThThThhhThTThhhhe e e eeee momomomomoooooooom stststststsst t t t t t ttttaaaaaaofofofofofofofo t tt ttttttttttttttttttttthehehehhehhehhehhehehhhhhhhhhh

fafafafafafafaaaaan n nnnn n bbbbbononononononononFFFFFFFFFFFFFFFFaaaaaabbbbbbbbbbb

tototototototo cacacacacacaacac mpmpmpmpmpmpmppppmpppmpmpppppmpmpmppmppmpaiaiaiaiaiaiaiaaigngngngngngngngngggngngngggggg h hhh h hhhhhhhhhaaaa

anananananannnnnnnndd d d d dddddddddddddddddddd apapapapapaapapaapapapprprprprprprrprrecececececeeeeece

ThThThTThThTThTThThTTT e e e e eee MuMuMuMuMuuMuMuM scscscssccsofofofofofoffoooooo t t t ttthehehehehehehhhhh b b b bbbbbbbbbigigigigigigigig

ininiiniininiiiin OOOOOOOOOOOOOOmamamamamamam nnnnnnnn IIIIInnnnn

2July 2010

eeeeertrtrtrtrtililililililisisisisisisisssserererererere s.sss.s.s.

GreenCampaign of the Year

Award

Winner

Green

Award

nnerWinn

COVERSTORY

28 July 2010

In December 2010 the Sultanate will welcome athletes from 45 countries across Asia to compete at the 2nd Asian Beach Games Muscat 2010. The Muscat Asian

Beach Games Organising Committee (MABGOC) has launched the Muscat 2010 Mascots - Al-Jebel (Tahr), Al-Med (Green Turtle), and Al-Reeh (Houbara) representing the sky, land and sea in Oman respectively. The effort is to promote the natural beauty of Oman to the countries and regions attending the beach games and to highlight the importance of protecting and conserving these animals and their habitats for future generations.

Out of the boxAn innovative method was crafted to address ‘real issues’ through a fictional platform. On October 31, 2009, MABGOC presented the mascot concept to the Olympic Council of Asia’s (OCA) executive board at the 55th OCA executive board meeting in Hanoi, Vietnam. The executive board approved the concept and the initial steps in this direction have been taken by creating visuals ‘drawings’ of the mascots.

Over the coming months MABGOC will distribute material and information on the ideals of the mascots. Children’s storybook will be launched prior to the Games, and ‘real life mascots’ (ie costumed mascots) will be available for community activities/events and photo opportunities with the public. The Muscat 2010 website will soon provide a Mascots section providing further details about these three friends. The mascots will spread their message both in English and

LEAVING A LEGACYMABGOC is using the Asian Beach Games as an opportunity to

promote environmental issues through the use of mascots


Green Turtle – Representing ›the sea turtles are amongst the oldest and important marine species living in the Omani watersHoubara – Representing the sky ›houbara is known as one of the most beautiful and magnificent birds of the desert, Oman has one of the few healthy resident breeding populations in the Arabian PeninsulaTahr – Representing Land. The ›tahr is native to Oman and lives on steep rocky slopes in the north

Arabic within Oman and across Asia. The mascot story and messages will highlight the importance of these animals within the Sultanate and the natural settings in which they are found.

The MABGOC has been the first Games under the Olympic Council of Asia to dedicate its mascots to the protection of the environment. ‘Environment’ is one of the most important theme globally in the 21st century for sustainable development and coexistence, and the OCA is working to deliver this message to the 45 National Olympic Committees (NOC) across Asia. Amongst other activities, the OCA has created a new initiative to recognise the efforts and achievements of its 45 NOCs in tackling environmental issues, and the Oman Olympic Council saw an opportunity to highlight the importance of environmental protection during Muscat 2010.

2010GreenCampaign of the Year

Award

Special Commendation

2010Green

Award


The core purpose of Six Senses Resorts & Spas is to ‘create innovative and enlightening experiences’ that rejuvenate its guest’s love of ‘Slow Life’

(Sustainable-Local-Organic-Wholesome Learning- Inspiring- Fun-Experiences). Six Senses Hideaway Zighy Bay recognises that its operations affect the surroundings and the resort is committed to improve its ecological and carbon footprint and to give back to the community.

At the heart of the resort’s responsible practices is the implementation of an Environmental Management System based on the Six Senses Holistic Environmental Programme and Green Globe, designed to continuously improve its performance and to benchmark efforts. Through this the resort strives to ensure that it improves its ecological and carbon footprint through raising environmental awareness into the day to day lives of hosts, guests and the local community. One of the ways in which the resort contributes to sustainable development of the region is through the Social and Environmental Responsibility Fund where 0.5 per cent of the resort’s total revenue goes towards both environmental and community projects in Zighy Bay, the Musandam region and the rest of the Sultanate of Oman.

Environmental projectsThe Six Senses Holistic Environmental Management Programme (HEMP) focuses on improving the ecological and carbon footprint of Six Senses operation. HEMP sets out the principles, guidelines and standards for responsible operation and constitutes the framework of Six Senses

PRESERVATION PROGRAMMESix Senses Hideaway Zighy Bay uses a range of environmental and

social initiatives to further the cause of sustainable development


Waste water generated is ›channelled to the resort’s waste water treatment plant The resort now purifies and ›bottles its own Six Senses Drinking Wate Re-usable glass bottles replace ›plastic bottles, hence a plastic-fee environment is created

Hideaway Zighy Bay’s Environmental Management system.

The sustainability policy is the resort’s guiding document and Green Team meetings ensure frequent and regular follow-ups of environmental issues in all departments. Like all Six Senses Resorts, Six Senses Hideaway Zighy Bay follows the Green Globe Company Standard, an international sustainability certification scheme for hotels, resorts and spas. The

nt ifies and Senses

ttles replace ce a plastic-created

ssss E E E EEEnvnvnvnvnnvnvnvnvvvnviriririririririri onononononnonmemememmememmmemmmmm ntntntntntntn alalalalalal

yy y y y y y isisisisisississssisssss t tt theheheheheheheheheheheheheehe r r r rrrrrresesesesesessessse ororororooroooooooooo t’t’t’t’’’t s s ss ssssdddddd G G G GGGGGGGGGrrererererererrerrrreenenenenennenene T T T T TTTTeaeaeaeaeeaeaeam m mm m mmmmmmmmmmmmmmmmeeeeeeeentntntntntnnnntntnntnnnnnn a aa aaaandndndndndndndddndndnnnn r rr r r rrrregegegegegegggulululululuulululululululuuululuu araaraaaraaaraaraaara enenenenenntatatatatatat l ll l llll isisisisiisiiisi sususususususuuuesesesesesses i i ii iiiinnn n n n nnnn aalalalalalaaaaaaaaa l l lllllllllllllllllx x x x SeSeSeSeeSeSeSeeeeeeeensnsnsnsnnssnsssesesesesesesesesesssssss R RR R R RRRRRRRRRResesesesesorororororooooo tststststtss, , , ,iiiiiiighghghghhghhhhhhhhhghgghy y y y y y yyyy BaBaBaBaBaBBaBaBaBBB y y y y y yy y fofofoffofoffffofoffofollllllllllllllllllllowowowowowowoowowowooooo s s s s ssanananananny y y y y yy yy yyyy y y y yy StStSStStStStSStStanananananana dadadadadadadadaadaaddd rdrdrdrdrdrdrdrd, , , , , ,, anananananan iiiiililililiiliitytytytytytty c c c ccccerererererereeeererererrrtititititititititttt ficficficficficficfificatatatatattatatattttatiiiiioiiioioiiiioiioioon nn n n n nnrrrrrtststststststs a a a aa andndndndndd s s s s s s ssspapapapapapas.s.s.ss.s.ss T T T TTTTheheheheheheh

GreenGuardianAward

Winner

GreenGuardianAward

nnerWinn

task during the first year is to set up a functioning environmental management system and to collect data of water and energy consumption, waste generation, paper use, chemical and pesticides use, and social commitment. Once the resort is Green Globe benchmarked the performance of the second year is compared to that of the first year in each of the respective areas. The resort will then have the benchmarking results audited to achieve Green Globe Certified status.

Design for the EnvironmentDuring the design and construction of Six Senses Hideaway Zighy Bay, care was taken to design the resort according to the traditional Omani style. The use of natural material, naturally ventilated areas and shaded areas to minimise the need for air-conditioning and lighting, reduces the resort’s need for energy. An outdoor Omani summer house has been re-created for guest use and is made from Jareed (date palms) that have been in twined in the traditional way allowing the temperature inside to drop a few degrees for comfort.

COVERSTORY

30 July 2010

FINANCING GREEN PROJECTSBankMuscat has taken the lead in subscribing to international

best practices in the field of environment protection

BankMuscat has adopted the ‘Equator Principles’, a set of globally recognised, voluntary guidelines established to assess and

manage social and environmental risk in project financing, especially in emerging markets. The goal of the project is to ensure that BankMuscat finances projects that are developed in a socially responsible manner. The bank keeps a track of the projects financed through the concerned department to ensure that they are in line with the Equator Principles. The bank reports back every two year to the Equator Principles.

The bank has also joined the United Nations Environment Programme Finance Initiative (UNEP-FI), which is a unique global partnership between the United Nations Environment Programme (UNEP) and the global private financial sector.

First amongst peersBankMuscat is the first bank in the Mid-dle East region to adopt the ‘Equator Principles’ and join the UNEP-FI thus becoming a role model in preserving the environment and adhering to best prac-tices. The bank is committed to financing environment-friendly projects for life.

Internally, the bank is promoting environment friendly practices among its employees. For example, it recycles waste paper produced by various departments in BankMuscat’s head office building. To make the process more scientific, it tracks the amount of paper collected and sent for recycling. Between May to Oct 2009, the bank saved 17 trees through recycling

around 1,975 kgs of waste paper. Paper recycling is an ongoing project whose operations are managed by the support services department of BankMuscat. The

Corporate Social Responsibility (CSR)team will keep encouraging employees through internal communications via e-mails and presentations on the importance of saving paper, water and electricity.

The bank is encouraging employees and their families to reduce wastage of water and electricity. Office utility bills are tracked in an effort to minimise waste. Calico bags are used for collecting waste paper instead of plastic ones. The bank’s CSR team visits employees at the head office giving them presentations on green tips along with distributing green gifts.

As a result of these measures employees of BankMuscat are (and will be) more aware about the best practices related to the environment. These measures will also help the bank to reduce spends both internally and externally. A leader in the financial sector, the bank is demonstrating its CSR credentials with these socially responsive measures.


Has adopted the ‘Equator ›Principles’ a set of globally recognised, voluntary guidelines established to assess and manage social and environmental risk in project financing Joined the United Nations ›Environment Programme Finance Initiative (UNEP-FI)Saved 17 trees through recycling ›around 1,975 kgs of waste paper between May to Oct 2009Encourages employees to reduce ›wastage of water and electricity

2010GreenGuardianAward


2010GreenGuardianAward


Ruwi H

.O. S

howr

oom

247

0600

4,

Ruw

i Hig

h Str

eet -

Sha

rp 2

4832

891,

Sohar 2

6840

763,

Sur

255

4461

3, Salalah

232

9140

5.NEW

Fre

nch

4 D

oo

r R

efri

gera

tors

- Ant

i-bac

teri

al a

nd a

nti-s

mel

l H

oney

com

b fil

ter

- Pla

smac

lust

er io

n te

chno

logy

- Hyb

rid

cool

ing

Alu

min

um p

anel

Styl

ish,

Effi

cien

t &

Am

azin

gly

Sp

acio

us.

COVERSTORY

32 July 2010

The project started as early as 1987 with the purchase of 10 acres of land and over the last 22 years the resort has gone on to develop 350

acres of acres of barren land into lime plantations, green houses and nurseries, resort, spa, rainforest restaurant, rose, solar and jojoba gardens and agricultural lands which include banana plantains, sugar cane, vegetable and natural foliage waste areas for compost development. Says Stephen Hatton, general manager, Al Nahda, “We have combined natural science and art to create gardens and greenery which are beautiful, culturally rich and eco-sustainable.”

Multiple benefitsThe effort of the resort is to create major landscape changes which provide recreational, agricultural, horticultural and nature reserves for the benefit of the local community which operate within a green area protection plan and improved eco-sustainable practice over a total land area of 350 acres.

The resort uses a variety of innovative methods to apply and promote sustainable design. The talented design team worked together to develop various ideas such as use of gray water, organic management of the gardens, transitioning from little to no synthetic pesticide and composting of dead foliage for use as fertiliser. The reduction of the usage of water and its conservation has been achieved through water-efficient landscaping or Xeriscaping. The process is

BARREN TO BLISSFULAl Nahda Resort & Spa has used a combination of art and

science to create beauty and environment sustainability

one of the biggest reasons that ensures the sustainability and viability of the resorts plantations. Resource efficient landscapes are the way forward for truly effective continuity.

Plants that are drought-resistant and in-digenous to a region’s soil and climate conditions can survive and thrive, gen-erally with less care or water. The use of native plants is also environmentally pref-erable because they are more resistant to pests and disease, thus requiring less fer-tilisers and pesticides. Long-lived, hardy vegetation can lower labour costs and re-duce spending on maintenance supplies.

Grand vision Says Hatton, “We are all inspired by the vastness of our company’s endeavours and have adopted a re-use, re-buy, re-cycle and reduce mentality.” The 22 year dedi-cated programme shows incredible for-titude and persistence from the Al Bhaja Group, which owns Al Nahda. The group has demonstrated environmental change over 350 acres of previous barren lands.

The development has led to a number of benefits for the local community like the creation of new job opportunities, cost, waste and energy efficiency, improved air quality, reduction of harm to the environment, providing habitat to wildlife and healthier places to work in and a place where people can come with their families to for recreation purposes. Positive changes like the one created by Al Nahda makes a difference and creates benefits both for the short and long term. The resort is a living example of how human efforts can contribute towards a greener world.

333333333232323232323333232232322 JulJulu y 2y 222y 2 0100100100101000

tototototooooo nnnnoo oooo o o sysysysyyyyntntntntnnn heheheheehh ttititicccc c pepepepepepepppppppppppppp stststtstsstttiiiicididddde e eee ananana dd ddd d cocococompmpmpmpmpmppppppppppppppppppososososossttingngngng ofofofofoofoffffffoff d d d d d ddddddddddddddddd ddddddd eaeaeaeaeeaaeaaeaeee d d d d dd ddddddddddd fofofofofofooofooofofofof lililililillliliiagagagagagagaggge e ee e fofofofofofofforr r r rr rrr ususususususuusssse e eee eeeeee asasasasasaa f f f ff erererererereeereeeerrtitititiitititililililillillillll sesesesesees r.r.r.r. ThThThThThTThTTTThThThTTTTThThe ee e eeeerererererreedududududuuduuuuuductcttttttctctcttctctcc ioioioioioioioion nnnn nnn ofofofofoff t tt t tthehehehehehehhehhhehhehhhehhhe u u u uuuuuuuusasasasasaaasas gegegegegegegeeegegeegegegegeeggeggeege o o o of f f f ff wawawawawawwwwww tetetetetetetet r r r r anananananaanand d d d dddditititittitti s s s s ss cocococoocooooooc nsnsnsnnsnsnsnn ererererrrrvavavavavavavavavvvv tiitittittitionononononnn h h h hhhasasasasasasss b b b bbbbbbbeeeeeeeeeen n n n acacacacachihihihihhiihihhhhhhh evevevevevevvvevevevevvevedededededeedee ththththththththhthhhhrororororororororororr uguguguguguuguuuuuuuuuuuuuu h h hhh h h wawawawawaawawatetetetetett r-r-r-r-r-r-r efefefefeffefficfifificficficficfificcieieieieieiieeeeeeentntntnntntntntntntntntttnn l l l lllllllllananananananananananannanannannnnnnnnnndsdsdsdsdsdsddsdsdd cacacacacacaccaaaccc pipipipipipipippiingngngngngnngnngnnnnngng ororororrorro X X X XXXXXXXXXXerererrerereeerisisisisisiisiiii cacacacacacaaaaaaapipipipipipipipppppipppp ngngngngngngnn .. . . ThThThThThThThThTTThTThThTT e e e e e eprpprprprrpprpprocococococococcocceseseseseseseseseeeesesessesess s ss s sssssss iisiisisisisii

wiwiwwww llananananannanthththththththeeeeePoPoPoPPPPoPPPoPPPoPPoAlAlAlAlAlAlAlAlAlA bebbebebebeebebebbbebebbebbbThThThThTThhuhuhhhhhhuhuhhhhhhhgrgrgrggrgrgrgrgrgrggrggrrgg


Use of gray water ›Organic management of the ›gardensTransitioning from little to no ›synthetic pesticideComposting of dead foliage for ›use as fertiliserConservation of water ›through Xeriscaping

2010GreenLandscape

Award

Winner

2010Green

Award

nnerWinn

33July 2010

AN EARLY STARTGardening World is looking at inculcating environment

awareness amongst school going children

Catch them young seems to be the motto of Gardening World Oman. The company is working on creating eco friendly redevelopment of

schools grounds in the Sultanate. The company aims at involving children at every level to understand the importance of saving the environment.

Says Ali al-Abdullatif, managing director, Gardening World, “The project started with the desire to demonstrate that everyone can play a part in helping the environment if they have an understanding that it is about what we do on a daily basis and how plants can play a significant part in environment preservation.”

Flora and faunaLocated in Ghala as a part of the project, Ali has had two sessions with the children, the first to show them the importance of saving a native tree and secondly educating them on how to prepare a tree to be moved from one location to another. The project design has also included many native, near native and traditional plants which require less water naturally.

Once the children had gone through this theoretical exercise, they pruned the tree themselves and did the work to prepare the tree to be moved. Each child and the teachers had a part to play and they learnt the process first hand.

Gardening World is an ongoing project which will involve children from all nationalities. A number of these students have motivated others to contribute to a greener Oman. “The key phrase we have

applied in our business plan and business card is the slogan, ‘The pioneers of Eco landscaping’ foresight and persistence,” says Ali.

Long term goal The company has started to propagate native plants and plans to develop this further to a fully fledged Omani native plant nursery with plants for sale as well as for projects. Each plant will have a write up on the significance, origin and benefits to the environment.

Gardening World is looking at saving plants in perpetuity that are naturally being destroyed by the rapid growth and urban development in Oman. Once people are more aware, they will be more receptive towards landscape projects. This will ultimately reduce the amount of water used to keep Oman as beautiful


Eco friendly redevelopment of ›schools grounds Showing children the importance ›of saving a native tree Educating them on how to ›prepare a tree to be moved from one location to anotherIt’s an ongoing project which ›will involve children from all nationalities

as it is and will sustain the ecology and preserve the flora and fauna. The company has a long term vision and its efforts and work is sure to help in preserving the environment in Oman.

GreenLandscape

Award


Green

Award


COVERSTORY

34 July 2010

Al Sodah Island a project being developed by Muriya Tourism is designed as an ‘ecolodge development’ to meet the principles of

eco-tourism (a nature dependent tourist facility) in Oman. Located 32 kms from the mainland of Dhofar it is designed to meet the equator principals of eco tourism, by developing a project and charting a path towards sustainability and environmental protection.

The project endeavours to maximise the use of natural light through design. Environment friendly lighting principles are being be used to limit turtle attraction. Low density building and infrastructure design will minimises adverse environmental impact. An in- depth Environmental Impact Assessment (EIA) study has been conducted by a leading environmental consultant and the recommendations of the study are being used. Muriya is doing a management of environmental impact through preparation and implementation of an Environmental Management Plan (EMP) following ISO 14000 protocols. Site selection and design has been done to avoid native vegetation and to protect threatened species, populations and ecologically sensitive areas such as turtle nesting beaches.

To ensure periodic environmental monitoring, a specialist environmental consultant carries out an on-site quarterly review. The project will maintain the abundance, species and geographic diversity of corals and marine turtles. All wastes will be removed off-island. Pests (brown rats) that feed on breeding bird colony eggs will be eradicated and regular

HOLISTIC APPROACHAl Sodah Island project hopes to be a pioneer in the field of

environmental protection in the Sultanate in a few years


Environment friendly lighting ›principles to limit turtle attractionLow density building and ›infrastructure design An in- depth Environmental ›Impact Assessment study has been conducted Environmental Management Plan ›following ISO 14000 protocols

beach clean-ups will be undertaken.

Success principlesThe project planning and design is largely based on nature dependent tourism principles. Monitoring and regular internal audits have been conducted to modify work practices and improve environmental outcomes. An EIA has been prepared to ensure all the adverse environmental impacts are mitigated and in progress for a EMP roll out. The Marine

Turtle Management strategy has been initiated for proactive protection of these species on the island. Floating jetties to prevent any adverse impacts on the coral reefs are being designed and implemented. The ideas and strategies were chosen after a rigorous site Environment Health and Safety (EHS) compliance and extreme environmental site vigilance by the site EHS staff, innovative design team and the concerned departmentt.

Says Muthu Govindraj, Corporate HSE director, Muriya Tourism, “The project is unique and will lead by example as an eco friendly tourist destination in Oman and finally with the use of alternative energy sources technology it is anticipated to be the most green island project in Oman.”

The project is in line with Murya’s core phi-losophy of light construction and having 70 per cent as free and open areas. In the long term, Al Sodah hopes to be the most effec-tive eco friendly habitat in Oman with sig-nificant nature dependence and with very low contribution to global warming.

2010GreenHabitatAward

Winner

2010GreenHabitatAward

nnerWinn

35July 2010

house as a first step, the industrial used water is treated and analysed

as per Oman Environmental Regulation and then used for irrigation of the green part of the site. The size of green land on the factory

is 20 per cent as compared to the total site area (40 per

cent when compared to open land) with five palm trees and other flowery trees. All sanitary waste water outlets are connected to the underground Al Rusayl Industrial Estate System for treatment outside the plant.

NPI is minimising the use of paper through the application of an internal communication network. It has a Central Industrial Vacuum System for cleaning the whole plant. The dust collected in this system is not released into the atmosphere but is treated and dissolved in water. It is then released into the ETP where the same is treated and then released. NPI has demonstrated its concern for preserving this scarce resource by utilising the waste water (duly treated) to maintain its greenery (consistently over the past 10 years) thereby serving the dual purposes of greenery and water conservation. It extends this training to students from other colleges in Oman every year. NPI is committed to providing a very healthy and green habitat for its employees and visitors.

A CLEAN SLATENational Pharmaceutical Industries Company’s premises at

the Rusayl Industrial Estate is a model for others to follow


Open land covered with lawn and ›treesThe quality of air in the plant is ›monitored constantly to comply to class 100,000 specificationsWater is purified through regular ›filtration and a double reverse osmosis plantThe well controlled ETP ensures ›effective waste disposal management

National Pharmaceutical Industries Company (NPI) located at the Rusayl Industrial Estate has built a state of the

art pharmaceutical formulation facility to create an environment friendly and healthy work place. The effort is to purity incoming and outgoing air and water and to conserve water while at the same time keeping the area green.

Except for the area where the building has been constructed all the other open land over the 30,042 sq mtrs plot has been covered with lawn and trees. The quality of air in the plant is monitored constantly to ensure that the factory complies to class 100,000 specifications. Water is purified constantly through a regular filtration process as well as through a double reverse osmosis plant. The well controlled Environment Health Practioners (ETP) ensures effective waste management. Good Management Practices (GMP) training is conducted for the staff to educate them on various topics like cross contamination, good housekeeping and personal hygiene.

Innovation and creativityTo ensure a healthy work place all the air is filtered through high efficiency particulate air filter with controlled humidity and temperature ( 25 degrees +/- 2% & 45 % RH +/- 10%) of 0.22 microns. Air filtration or air expelled to environment from all the 35 air handling units is clean as it is filtered through very fine filter that captures particles of more than five microns. Drinking water is purified and distributed as an in house supply avoiding the accumulation of plastic containers. Water for all industrial use is purified in

hhohohohohhhohohohousususususe e e e eeee asaasasasass aa a aawawawawawawawwaaatetetetetetttt

asasasasasas

ttttttt

managem

55555555 r r r r rrrrttttttt

n nn nrrrrr r rreeeeeeeeeeeee ddddddd gggggg .. ... ..

nnnnn

GreenHabitatAward


GreenHabitatAward


COVERSTORY

36 July 2010

awareness will, in the long term, result in design and construction of buildings which are more energy efficient.

36 July 2010

Bahwan Engineering Compa-ny – Carrier (BEC-Carrier) has been promoting envi-ronmentally sound cooling solutions amongst various

buildings in Oman. This is being achieved through the promotion of Energy Efficient Carrier 30XA chillers. The chillers result in lower electric energy consumption as compared to other similar chillers in the market. The installation of such chillers has led to an annual saving of electric en-ergy to the tune of 22.9 million KwH.

Knowledge driveBEC-Carrier has been spreading knowledge about its energy efficient products through technical seminars, factory visits, one-to-one discussions with consulting engineers and building owners. As a result of these efforts a number of companies, institutions and owners have installed and benefit-ted from such solutions. Says a company spokesperson, “A number of consulting engineers, building owners are more aware about the benefits of using energy efficient products and have started insisting on us-ing such products for their projects.”

Globally, Carrier’s competitors are striv-ing to manufacture products which match Carrier 30XA chillers in energy efficiency, but the company remains a leader by a stretch. With the relatively low cost and adequate availability of electric energy in the Sultanate, the need for having en-ergy efficient systems was not felt for a long time. BEC was the first company in the country to start spreading awareness about the benefits of en-ergy saving products in partnership with global leaders such as

COOLING EFFECTBEC-Carrier is working on reducing electricity consumption by air-conditioning

systems in various buildings in Oman

Carrier, Bry Air, SPC, Ruks etc. It is the result of such persistent efforts that more and more buildings are now being built with the attendant environmental impact in mind.

Every building in Oman will continue to require cooling (Air-conditioning). Air-conditioning systems are a major user of electric energy in any building and the use of energy efficient air-conditioning products and systems is thus a very sustainable initiative for the future.

The focus on improving energy efficiency of air-conditioning products/systems and the use of innovative methods to reduce power consumption of air conditioning system can only further improve the situation in the long run. The company sees its efforts as being a mere beginning of an awareness effort towards the need for energy conservation in buildings – this


Promoting the use of of Energy ›Efficient Carrier 30XA chillersThe chillers result in lower ›electric energy consumption Installation of such chillers ›has led to an annual saving of electric energy of 22.9 million KwHSpreading knowledge through ›technical seminars, factory visits, one-to-one discussions with consulting engineers and building owners

2010PublicChoiceAward

Winner


nnerWinn

Be distinguished

Achieve Your GoalsStart Anew with Horizons Capital Markets

OUR SERVICESBrokerage

Brokerage in Oman and Regional MarketsOnline Trading

Portfolio Advisory and Administration

Asset Management

Horizons Capital Markets (S.A.O.C), P.O.Box 685, Postal Code 115, Sultanate of Oman

Tel.: +968 2482 6000 Fax: +968 2482 6099 www.horizons-capital.com

COVERSTORY

38 July 2010

Cartridge World has successfully completed more than four years of its operations in the Sultanate of Oman. Its business model

helps companies to save money by recycling their printer cartridges. The company has a manufacturing unit for recycling laser toner cartridges and a warehouse in Ruwi to serve its large client base. It’s customers include ministries, banks, real estate and construction companies, embassies, private colleges, power companies, finance companies, investment and securities companies, home users etc.

Printer cartridges are one of the leading contributors of contamination and runoff in a nation’s landfills. Cartridge World is committed to the highest environmental standards in its own right, seeking to minimise material waste, through recycling. The company has been at the forefront of cultivating a habit for recycling by collecting tonnes of electronic waste for proper recycling.

Omani firstIt’s laser products are locally re-manu-factured and are 100 per cent guaranteed within the OEM (Original Equipment Manufacturer) stated warranty. Based on the service cycle, the appropriate parts are replaced with new parts. Great care is taken to ensure proper assem-bly and 100 per cent test prints prior to delivery. The company has tied up with PEIE (Public Establishment of Indus-trial Estates) Rusayl to use the Omani logo, since the Cartridges are remanu-factured locally in Oman. In brief, Ori-gin Oman products offers every Oman

REDUCE REUSE RECYCLECartridge World is proving its commitment to the triple bottom

line - meeting social, environmental and economic standards


Six Steps for recycling their ›printer cartridgesAnalysing waste ›Separating the recyclables ›Find a waste carrier by providing ›bins to customers for keeping the emptiesMonitor and record ›Motivate the customers ›Attract environmentally ›conscious customers

based resident an opportunity to help promote the Sultanate’s products and services and by doing so helps create employment opportunities, stimulates

the national economy and reduces carbon emissions. Remanufac-turing cartridges locally supports the local com-

munity by creating more job opportunities.

Cartridge World has been successful in placing recycling bins and encouraged recycling habits. It provides printing tips for an environment friendly office and has been propagating recycling

habits by placing advertisements in leading newspapers and magazines thereby lessening the amount of cartridges ending up in the landfills of Oman.

Cartridge World provides a programme to help customers easily identify issues, products and services with the environment in mind. It is focusing on the importance of recycling as it is not only beneficial for the earth but also for businesses as the

latter can secure a better relationship with their consumers by showcasing

their environment efforts. As recycling reduces production costs it proves to be economical for consumers. Cartridge World and its customers are working together for making a difference to the earth’s health. Recycling along with reducing consumption is

our best means to counter the damage to the Environment of

Oman and Cartridge World is throwing its weight behind this

cause.

hhhhhhhhhhhhhasasasasasss llllllllleteetetettttttetedededededeedeeeeed

oooooof f f ff ffff itititititittittttts s s s sssanannanannannaaaaannatatatataaattate e e ee eeeee

momomomomomoooodedededeededel l l llllly yy y yy bybybybybybyybyyyyby

ThThThThhThhhhhThhhhhhheeeee ee eee eeeeeettttt f f f fffffffffffororororrooooror ndndndndddndndddnddddndd a aa aa ccccccclililililllienenenenenenenennenenent t t t tttttt trtrtrtrtrrrrrrrrrrrrieieieieieiieieiiiiiiiiii s,s,s,s,s,s ctctctcttcctccc ioioioioioon n nn negegegegegegeggegegggesesesesesees, , , , nnnnnnnnieieieieieieieiiii s,s,s,s,s,,, nnnnnnieieieieieieiiiiiiiii s,s,s,ss,s,s,

thththththththhhthhe e e e e eeananananananaaaaaaaanaaaa d d d dememememmmmmmiiiiitututuututuririririrrirsususususuuppppppppppppppp

mumumumumumumummmmm ninniniinitytytytyyytyy jojojojojob b b b bbb opopopopoppppopopopoopopopoopop rtrtrtrtttrtrttttttrtuuuuu

CaCaCCCaCaCaCaCCCaartttrtrttrtrtttririririririrridgdgdgdgdgdgddgggggggggggggdgge e e e eeeee WWWWWWWsusususususucccccccccccccesesesesesessfsfsfsfsfsfululululullululuu i i i i iiiiinnnnnnnbibibibibibibibibibbiibb nsnsnsnsnsnsss a a a aa aaaandndndndndndndndndnddnnn e ee e e eeeennnnnnnnhahahahahhahaaaaaabibibibibibibbb tststststts. . .. ItItItItItIIttIIItt pp p ppppppprorororororororfofofofoffoofofofofofoor r rrrr anananananannnnnnnnn e e e e eeeeeeenvnvnvnvnvnvnvnviririririirirononoononnooooananananannnnnnnnnnnd d d d ddd d hahahahhahahahahahhhhhaas s s s sss bebbebeebebeeeneneneneeneen p p p p pppppppp

hahahahahhahahahhhhaaabibibibbibibiiiibiiiiiiiiibiibiitststststststststststststststststststststststststsstsstttstss b b b b bb bb bb b bb bbby y yy y y yy plplplpllplllplplpllplllllp acacacacacacacaaacaa iiiiiiiiiniinininiininiiiiiiiin l l l lllleaeaeaeaeaeaeaadidididididdidid ngngngngngngng n n n n nnnnnnnnnnnnewewewewewewwewspspspspspssppsss apapapappapapapap

rating the recyclablesa waste carrier by providingo customers for keepingmptiesor and recordate the customers

ct environmentallycious customers

iiiiiidededededededed ntntntntntntnntnnnnn aaaa aaaaaaaannnnnnn n nn nnnnn opopopopopoopppopopopopoppoppppppppp rtrtrtrtrtrtrtrtunununununununnitititititiitittity yy y y y tototototototo h h h hh hhelelelelelele p p p p ppthththththtthttthhe e e e SuSuSuSuSuSSSSSSSuSSSuSSSSuSuSSultltltltltltananaanaanananaaa atatatatatattaaa e’e’e’e’eeee s sss s s sssssssssssss prprprprodododododdducucucucucuucucucu tststsstststs a a a andndndndnddnddddddnn ndndndndndndddddn b bbbbbb bb by y y y yyyy dododododododdddddddddddodddd ininininnnnnng g g g gg gggg sososososoossosososssosssss h h h hh hh hhelelelelelelpspspspspspspp c c c cc c ccccrererererererereererererrererrerreeatatatatatatataaatataatte e e ee ee

eeeeentntntntntnnt o o o o o oo oppppppppppppppppporororororororoo tutututuuunininininininininnnnnn titititititititiesesesesesesses, , , ,,, stststststststimimimimimimimulululululullatatatataa eseeseseseseesesesessessss

thththththththtttt e e e e ee ee eaeaeaeaeaeaeaeaeeaeaeaeaartrtrtrtrtrttttrth h h h h bubububububuuuubbuuut t t t ttt alalalalalalalalala sososososoosssssss lalaalalalallaattttttttttttttttttttttttttttttererererererererreereererere cc ccc cccc cccc c cananananananaaaanananananaaaaa ss s s s ssssecececeecececececururururururruruuuu eeeeee

wiwiwiwiiwiwithththththththtththththththh t t t tttttttttttttthehhehehhehhhehh iriririririr c c c c ccononononononononononoonooththhththththhhthheieieieieeieieeeeee r r r rr r rr enenenenennnnnnnenenvvvvv

rererererereeeeeeeer cycycycycycycyyclclclcllccclcccccccclinininininininiiniinncocococoocccccc ststststtsts s s s ss ececececcceconononnnononnononononnonnonononnnnooooooCaCaCaCaCaCaCCaartrtrtrtr rrrrcucucucucuccuststststststtststooooooooooooooototototototttotogegegegegegegeththththdididididdidid ffffffffffffererererererererererreheheheheheheeh alalalalalaaaaa ththththtrerererererrredudududududuudddddddd ccccc

ouououououoouour r rrrrrrr bebebebebebebebebebbebbbbbbbbb ssssssdadadadaadadaadddd mamamamamamaaaamaaamm gegegegegegggggg

OmOmOmOmOmOmOmOmOmOmOmOmOmOOOmOmOmOmmmOmmmOOmanananananan a a a a aaannnnnnnnnnnnnnnnnthththththhthrororoororooowiwiwiwiwwiwiingngngngngngngngngnnnngnnngnnn i i i i

cacacacacacacaac usususususussuuuse.e.ee.e.eee





39July 2010

SAVING MOTHER EARTHMaking everyday an Earth Day is the clarion call given by the

students of Indian School Nizwa. Now it’s time for others to join in

Indian School Nizwa’s (ISN) Green Clean Earth campaign endeavours to make the earth a better place to live in for us and the future generations. The goal of the

campaign include making Oman a plastic free zone. As a start the school has made its campus plastic free. The students are also creating awareness about harmful BT products and their consequences.

Making a differenceISN celebrated Earth Day on April 22, 2010. The theme for this year’s Earth Day celebration was – ‘Make each day an Earth Day’. Posters, charts and models were placed all around the school to promote awareness among students about earth day; a special assembly was conducted by the students of class 12.

During the assembly, important thoughts and ideas were conveyed about Earth Day. The seniors also shared tips to save nature and on how to reduce the depletion of resources. Facts and statistics related to earth helped the students to realise how human efforts were damaging the planet. The principal then spoke about Earth Day highlighting the agenda that the students should follow.

An Earth Day oath was taken where the students swore that they would strive to protect the earth, they live in. The celebration went on as students of senior classes spread the message of mother earth through effective speeches. Later on students from class 11 presented videos and powerpoint presentations related to Earth Day to junior classes which made students aware of the potential


Earth Day celebrations ›Special assembly and thought of ›the dayTips for saving earth and ›important facts about the planetEarth Day pledge ›Greeting songs, decorated ›school with posters, charts and models of earth

danger that could follow if no one cared for earth. Students circulated brochures informing students and parents about the harmful effects of BT products

during the school event. Shopkeepers in vicinity of the school agreed not to sell harmful BT products. Students pledged to plant trees in the school’s neighbourhood and to reduce the use of plastics and polythene bags. H E Anil Wadhwa, ambassador, Republic of India to Oman appreciated the schools efforts in promoting environment protection.

The students are confident that through their selfless commitment and dedication, they will achieve their goals. By educating the future generations the school is increasing the chances of having a green earth and living on a smarter planet. The spark ignited by the school is sure to snowball into a blaze in the years to come.

GreenEducation

Award

Winner

GreenEducation

Award

nnerWinn

COVERSTORY

40 July 20100 July 2010

students and parents. We have been running with this for about 18 months now. From, what seemed to be a very humble beginning with small goals, the number and range of projects and people involved continues to grow as the relevance, scope and impact is seen and felt.”

ABA feels that they are dealing with students who will, in many cases, go on to become major decision and policy makers of the future. Any role modelling and sensitisation they can achieve will have a ripple effect that is hard to quantify.

The ABA School’s wide ranging initiatives that challenge and promote change by highlighting common, environmentally unfriendly

practices has to a large extent ingrained in the student community the message that individuals can make a difference.

The school looked at continuity and sustainability as one of the guiding principles by providing opportunities and incentives to the students themselves to lead the charge in order to bring about a change in daily practices. Further, in deciding which initiatives to pursue and which to leave for later, ABA looked at cost effectiveness, impact, visibility and sustainability.

For example, the composting project was the work of students where the idea was to compost as much of the school’s waste as possible and use as little from outside as possible. ‘Energy’ monitors were appoint-ed in each of the junior classes. These students monitored a variety of activities including turning off lights and computer monitors when they leave the room.

The school is also inculcating responsibility by initiating a ‘don’t walk by’ campaign for everyone who enters the campus; forming a student group for preparing and planting native plant areas; and assigning the students to write an ‘green’ article every week for the school’s newsletter.

Small but promising startSays Terry Storer, examinations officer, ABA, “This is a team project that is supported by all members of the school including the administration, teachers,

IMPACTFUL INITIATIVESMaintained an ongoing audit of ›electricity and water use in the schoolTwo areas planted with native plants ›Last two school events only used ›recyclable plates and avoided sale of bottled waterAnnual ball used no cut flowers ›but had potted herbs as table decoration

Began selling reusable water bottles ›in schoolComposting project to re-use ›school green wasteParent-teacher association has set ›up a environmental subcommittee that will be funding seven different projects in 2010‘The environment’ was a main ›school wide curriculum

CREATING ROLE MODELSThe ABA School’s community-wide environmental initiatives has

given a green hue to the education process

2010GreenEducation

Award


2010GreenEducation

Award


COVERSTORY

42 July 2010

EFFECTIVE COMMUNICATIONPravin Amudan would like to translate words into action and

actually get people to adopt an eco-friendly stance in their daily lives

Global warming is such an oft-repeated term that, somewhere along the line, people have stopped relating to it. Therefore,

Pravin Amudan’s desire was to translate words into action and that came about in the form of “The Little Green Guide”, a bilingual (English and Arabic) booklet with over 70 easy and practical tips to help counter the global warming phenomenon.

The first print-run of this guide was 2000 copies and was backed by a host of related environment-friendly activities and got wide coverage in all the media.

“The idea of this ‘tips-book’ is to drive home the fact that each one of us can make a positive difference to the environment by taking small, simple steps. For example, it could be as simple as changing one 60-Watt light bulb to a CFC,” says Pravin Amudan.

To further his initiative, Amudan also created a blog (www.thelittlegreenpage.blogspot.com) where people can post their comments, share their ideas and download the online version of the book to spread the word. A dedicated email address ([email protected]) has also been created for enquiries and feedback.

Join the movementBesides the booklet and the blog, Amudan also initiated a recycling drive (paper and plastics) in his workplace of DDB Oman, which is part of the OHI group; and in his neighbourhood on a monthly basis with the support of the Environment

STRATEGIC DRIVESInitiating a recycling drive (paper ›and plastics) Publishing an awareness booklet ›(The Little Green Guide)Customised posters for video ›libraries urging people to hire, rather than buy CDs/DVDs, thereby reducing electronic wasteCreating an innovative tissue ›dispenserReusing office stationery, from ›the paper in the printers to make envelopes Circulating writing pads made ›from used, single-sided prints

Society of Oman (ESO). Over the last two years, around 2.5 tons of paper has been recycled within his office and he believes that this is just the beginning.

Taking his environment campaign a step further, Amudan also began to advocate eco-friendly initiatives among a number of DDB clients in Oman.

For example, the 2009 calendar with the global warming theme by Towell Auto Centre, the dealers for Mazda in Oman was inspired by him. Secondly, the ‘Work Environments and the Environment’ booklet for Mustafa Sultan Office Technology, which was distributed at the launch of Kyocera eco-friendly printers in 2008, was conceived by him. In addition, an internal

ambient media campaign targeting the employees of DDB and encouraging the responsible use of hand tissues in the washrooms was launched at his behest. Each of these initiatives required dedication and commitment, when faced with the arduous task of reminding people, following up for permissions and executing projects. The fact that Amudan’s efforts, however small they might have been, have inspired people to change is his greatest reward.

Adds Amudan, “Each time I see a colleague or a friend contribute towards this initiative, I consider it a measure of my success. If I can influence even a handful of people to think twice about wasting natural resources, I will feel my attempt has been worthwhile.”

2010GreenChampion

Award

Winner

2010GreenChampion

Award

nnerWinn

YOUTH LEADERFor a college student, Ojas Bhatia’s single-handed efforts

to raise green awareness is estimable

The students of Majan College led by Ojas Bhatia have been in the forefront of not only spreading environmental awareness but are also in the

process of manufacturing clean energy devices for sustainable development.

Says Bhatia, “As students we have discussed about solutions that can be implemented in Oman at a very low cost and can help a lot of people. For example, Dean Kamen (another student) has made a device which can take any source of water filled with pollutants and can change it to pure drinking water. The device costs around RO400 and can help provide water for over 500 people. We are in talks with the company to deploy this system in the interior of Oman.”

Bhatia says that as an individual, he is trying to spread the message about the environment among the youth by holding discussions and debates about the results of global warming and how clean energies can be deployed worldwide.

“Our aim is to bring about awareness on environment preservation and sustainable development by talking about solutions that are best suited for the environment and debate about carbon trading,” Bhatia adds.

Spreading awarenessHe wants to ensure that apart from Omanis, the topics related to environment should also reach the GCC youth through regional environmental debates and spread the message using the media like newspapers and radio.

In 2008, Bhatia won the All Gulf inter-college environmental debate. In 2009, he was chosen by Muscat Municipality to spread awareness among students during the environmental week. Now in 2010, he has been chosen to go to the Youth Assembly at the UN headquarters in New York. This speaks volumes about his vision, foresight and persistence.

As a role model, Bhatia has inspired other youth to take keen interest in participating in the environmental activities and he continues to inspire his fellow students.

Since it is the youth that is going to be leading the green

efforts in the future, their empowerment is necessary. They are the ones who will come up

with innovative solutions that are going to benefit the

world, Bhatia believes.

nnnnnnerererrrrrereererereererrgigigigigigigigigigigiggigigiiigiggg eseseseseseseseseseeesesesess

eeeeeesssssssssssssssss o o o oooooon n nnnn nnnninininininninababababababababbabablelelelelelellelelelleeeeeeeeeeee utututututu ioioioioioiooooioiooionsnsnsnsnsnsns nnnnnnmememememememmeentntntntnn g,g,g,gg,g,g,” ” ”” ”

ppppppararararaarrrt t t ttddd ddd totototototooototGCGCGCGCCGCGGCGCGCGCGCCCCG C CCC CC CCCCCCCCCCC

mememeemeeeeentntntntntntntnntnnnnnnnntnntnnnntnnntnttn alalalalllllllallllalllllllllllllllllllllllllllllllllllllllllllllllllllalllllllll uuuuuusisisisisisisingngnnngnggggggggnnggggggggnnggngggggggggggggggggggggggggggggggggggggggggggg iiiiio.o.o.o.o.o.oo

vivivivivivivviviviviviviviiiiiiiisisisisiiiiiisiisisisisissisisis ononononononnonononononononononono , , ,, ,, , fofofofofofofofofofofofofofofofffffffoffoooff rererererererererererereer sisisisisisisiisisissiighghghghghghghghhghhhghttt ttttt anananananananananaaa d d ddd dd ddddddddddddd pepepepepepepepeepepppeepppepepeep rsrrrrrrsrsrsrrrrrrrssrrsssisisisisisisisisiiisteteteteteteteteteencncncncncncncnncnnnn e.ee.e.e.e.e

AsAsAsAsAsAsAAAssAAAA a a a a aaaaa r r r r r ololololololollololololololooo e eee eee mmomomomomoodedededededel,l,l,l,llll BBBB B BB BBhahahahahahahahhahhhhhhahhhhhatititititititititia a a a a aa a hahahahahhhhahhass sssss sss ininininininnnnnnnnnnnspspspspspspsssssssssspiriririririrededededdededdedddddededde otototototttoo heheheheheh r rr rr yoyoyoyoyoyoooooy utututututtuttututu h h h hhh totoootoootoootoooooo t t t ttttakakakakakakkkke e e e eeee kekekekekkkkkkkkkeenenenenneneneneennnnnnnnnnn i ii i iii ntntntntnttterererererereeeeeeeeee eseseseseseseseeeeeese tt t t tt ininininininii papapapapapappppapp rtrtrtrtrtrtrtrtrrtticicicicicii ipipipipipippatatatatatata inininninngg g g g gggg ininininiinininnnnnnnnniinnninnnni t t t thehehehehehe e e ee eeeeeenvnvnvnvnvnvnvnvnn iririririiriiiiiri onononononmemememememmeeem ntntnttntntttntttnnn alalalalalallalaa acacacacacaacaaa tititiititiititittiviviviviviivivv tititititititiitieseeesesessesesssesese a aaaa aaaaaaaaandndndndndnddndndnnnnnddnnnnnnd h h hh h hhhhheeeeeee ee cocococoontntntntntnttinininininininnninueueueueuees s s s ss tototototottotooooooooo ii i ii i iiinsnsnsnsnsn pipipipipipipipipipipippiip rerererererrer h h h hhhhisisisissis fefefefefefefeeffefefeeelllllllllllllllllowowowowowowowowowowowwwowwwwwww ss sssss tututututuuuuuututt dededededeed ntnntntntn s.s.s.s.ss

SiSiSiSiiS ncncncncncncncncnn eeeee e e e ititititiiiiti i i i iiiiis s s ss ththththththhhththhhe e e e eee yoyoyoyoyoyoyyoyoy ututututuutu hh h hhhhhhh ththhhhththatatatatatatatatatatatatttat i i i iiiiis s s ssssss gogogogogogogoggooogooogogoog inininininnininng g gg ggggggggtototototootototttt b b bb b bbbe e ee eee lelelelellel adadadadaddaddininininininninnng g g gg g g g ththththththtthhhht e e e eee ee grgrgrgrgrgrgrreeeeeeeeeeeeeeeeeeeeen nn n nnn nnnnnnnnnnn

efefefefefefeeeeee fofofofofooortrtrtrttrtrtrtrts ss s sssssssss ininininininninnnii t t tt ttttttttthehehehehehhehhehehhehee f f fff fffffutututututtttu urururururururururuurrururrururrurururu ee,e,e,e,ee thththththhthhhhthttthheieieieieiieieeeiee r r r r rr emememememememmme popopopopoowewewewwwewewew rmrmrmrmrmrmmmeneneneneneeeeeeeneeeeeneneeeeneeeeneeneeeeeeeeneeeeneneneeennnntt t ttttt isisisisissssssssssssssssssisis nenenenneneenececececeececececc sssssssssssssararararrarary.y.y.y.y.yy.yyyyyy T T T TTT TTTTTTTTTTThehehehehehehhhhehehheh y y y y yy y arararararaaaaaaaaa e ee e e e eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee ththththththththhe e ee eeeeeeeeeeeononononononoo esesesesesesseees w w w w wwwwwwwwwhohohohohohhohohohho w w w wwwwwwwiliililillillililliiiiii lll llll l l ll cocococococococooocoooooomemememememeememmeememmeme u u uuuu uuuup p pp p pppp

wiwiwiwiwiwiwiwiwiwiwiwiw ththththththtt i ii ii iiiiinnnnnnnnnnnnnnnnnnnnovovovovovooooooooooooooooooooooovoooooooooovoooooo atatatatatattaatatatataatatttaativiviviiviviiiviivi eee e e e eee sososososososososooooosooolulululululuuluuutitititiiitiiiititiiiiiiiiiiiiitiiiiiiiiiiiiiiitiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiionononononononononoononnnoonnonoonnnononnononnnnnnnnnnnnnnonnnnnonnnnnnnnnnnnnnnnnnnnns s s s ss sssssththththththhhhhhhhhhhhhatatatatatatatattat a a a aaaaaaaaaaaaarererererererereerereeeeereeeeeeere g g gg gggggggoioioioioooioioiiooiooooiooooooooooooooooooooooooooooooooooooo ngngngngngngggnggng t t ttttt tttto o o o oooo bebebebebebebebebebebebbbbbebebeeeeeeeeeeeneneneeneeneneenneeneefitfitfitfitfitfitttttfitfitfitfittfitfitfitfitfifittfittfitttfitfittttttttfittfitttttfittttfitfitfittttttttfitttfittfifitttfitfitttttfifittfifififitfittfifitttfifitt t t t tttttttt ttttttthehehehehheheeeeeeeeehheeeeheeeeheheeeeheheeeheeheeeheheeeeeeheeeeeeeeeeeeeeeeeeeeeeeeeeheeeeeeeeeeeeeeeeeeeeeeeeee

wowowowowowowoowwwwoorlrllllrlrlrlrllrlr d,d,dddd,d,dd,d,d,d B BB B BBBBBBBBBBBBBBBBhahahahahahahhhhhh tititititiiiitiiitiiiiiiiiiiiitiiiitiiiiiiiiiiiiiiiiiiiiiiiiitiiiiiiia a a aaaaaaaaaaaaaaaaaaaaa bebebebebebebbebb lililililillll evevevevevevevvvesesesesesssesesssssssssssesssssssss...

INSPIRATIONFrom 2008 onwards, created ›interest among youth towards natureLed groups of students to ›participate in youth environmental based activitiesMotivated others to contribute to ›a greener OmanChosen by Muscat Municipality ›to spread awareness among students during the environmental weekChosen to go to the Youth ›Assembly at the UN headquarters in New York

GreenChampion

Award


GreenChampion

Award


COVERSTORY

44 July 2010

Crowne Plaza Sohar gave a new lease of life to the word ‘garden-fresh’ literally with a backyard full of freshly sprouting herbs and

vegetables. It was little wonder then that it won the ‘Green Innovation Award’ at the Oman Green Awards.

The hotel introduced a separate corner at the buffet table for food cooked from naturally grown vegetables and herbs as a choice and preference for the guests. And the management says that it has been the delight of the hotel guests to have freshly plucked, safe and fully organic vegetables for their salads and vegetable dishes.

Jann Nasri Bahdousheh, purchasing manager and environment projects leader says, “we initiated the ‘Organic Garden Project – 001’ to grow fresh vegetables and herbs as an environmentally safe project in order to place full organic cooked food on our buffet table.”

Talking about the benefits of this move, Bahdousheh says this project has an impact on the quality of food, service and guests’ satisfaction scores. He also points out that the hotel is more interested in becoming environment-friendly more than any financial gains from the project, which in any case are very negligible in the beginning.

Green messageIn order to propagate and promote this project, the hotel designed and printed awareness

BACKYARD SUCCESSCrowne Plaza Sohar has developed a mouth-watering way to

motivate people to take the environment-friendly route

posters and created educational packages and organised small talk shows for guests, management and staff.

The Organic Garden project became a great motivator for everyone to contribute to a greener Oman as the hotel made efforts to achieve the Hotel Wheel Goal with a responsible business term known as ‘Green Engage’.

The aim of this Green Engage is to ensure continuity and sustainability of the Organic Green project and make it an educational and awareness tool.

Green Engage will be used for different purposes namely, to give a choice

GREEN ENGAGEGave the first choice of organic ›vegetable to hotel guestsDesigned and printed awareness ›postersCreated educational packages ›Organised talk shows for guests, ›management and staffInitiated community ›environmental programme

to the hotel guests to use environment-friendly products; propagate the green culture amongst the hotel staff, and increase general environmental awareness among the local community.

aaaanynynynynynynyy fifi fifinananannancncncncn iaiaiaialll ctctctctct, , , , ,,, whwhwhwhwhhwhwhhiciciciciiiii h h h h hhh inininininininnn eeeeeeeeeeeglglglglglglglg igigigigiiggigigibibibibibbibbbbbbbbi leleleleellelel i ii i in nnn nn

atatatatatattaaaa e e e e eejejejejeeeejejejejjectctctctctctc , ,, , ,nnnnnnedededededdedee

nnnnnesesesesesseeeeeeeeeeeeeee s s s s ss

ThThThThThTThThhe e ee e aaaaaaaisisisisisisis ttt t tttto o o oo o oosusususususussussusustststststttaiaiaiaiaaa nnnnnnprprprprprprprojojojojojojjjjjececececeecececece tttttananananannd d d d dd awawawawawawawwawwawa

2010GreenInnovation

Award

Winner

2010Green

Award

nnerWinn

45July 2010

Many clients have welcomed the initiative of GoPoint Ta’meer to implement green elements in their real

estate projects. And one of the biggest real estate developer in Oman is considering using their system to build more than 250,000 m2 of buildings due to high-energy savings that the system offers.

“Since the beginning GoPoint Ta’meer’s client-based approach helped us to penetrate the market with seamless efforts, by considering the clients’ perspective. All GoPoint Ta’meer’s current and future projects will use EVG-3D system as standard system,” says Eyhab Al Hajj, managing director, GoPoint Ta’meer.

The secret of the success is the EVG-3D panel system – a foam-steel composite that creates a tightly sealed building envelope, making the home efficient and strong. Structurally, the goal is to build the house to withstand extreme weather with use of EVG-3D panels anchored to reinforced concrete foundations.

Inviting natureBy using alternative green and innovative construction system i.e. EVG-3D panels, the model home is designed to be open and welcoming, maximising natural light while minimising passive solar heating in the warm climate. It allows for natural ventilation and steady airflow, reducing the need for air conditioning and heating.

It has dark flooring, which reduces the shines in the afternoon light and white coloured walls to provide maximum

GREEN HOMEGoPoint Ta’meer has built Oman’s first green building with heat

insulation, solar power and environment friendly techniques

initiatives will be promoted via bundled services that GoPoint Ta’meer proposes to project owners. Along with lead consultants, GoPoint Ta’meer is working closely to introduce the concept of green housing in Oman.

“When we first started operations, our Chairman made an important comment saying, this is going to be the future of construction. We have since worked on this basis, and the message has been spreading to our clients, partners and suppliers. We however, believe this system will further increase its market attractiveness since we are planning to commission factories in Oman soon and thus provide even greater value for money,” says Al Hajj.

Requests have come from major developers in Oman to carry out a combined study in seeing the effect of building communities with this system. This is driven by the belief that such systems mean significantly less electrical consumption and thus a more environment-friendly solution.

GOALS OF PROJECTTo reduce the electricity usage ›upto 60 per cent and reduce CO2 emissionReduce the need for cooling ›equipment upto 30 per centReduce the use of wood ›materials during construction upto 70 per centMinimum workforce compared ›with traditional method (30 per cent less) which will reduce the waste and emission produced by workers during constructionReduce total construction debris ›and waste by 40 per cent

lights reducing the need for artificial lighting during the day.

By demonstrating the actual result of its green initiative and the unforeseen benefits of the system, more green

GreenInnovation

Award


Green

Award


COVERSTORY

48 July 2010

REAPING THE ROOFAn SQU team tested the feasibility of having green roofs

with a novel capillary siphoning irrigation system

GREEN TOPGreen thermal insulation of flat ›roofs of Omani private housesMinimal water usage for ›irrigationSupplementary fruits and ›vegetables harvested from otherwise unemployed areas of house roofsBetter harvesting of natural ›rainfall Engagement of physically ›challenged family members in productive work

Ateam from the department of Soil, Water, Agricultural Engineering (SWAE) of Sultan Qaboos University undertook an unique

agriculture activity in which different types of small crops were cultivated in pots filled with three types of soil – coarse sand, recharge dam silt and soil from the SQU Agricultural Experimental Station plot.

The pots were placed in an open area of the roof of SQU buildings and water was diverted to the pots from containers through siphons made of used T-shirts, which were rolled and filled with soil. Siphoning flow rate, moisture content in the pots, hydrological parameters and the development of the plants were measured and monitored.

The team members of this project were Prof Anvar Kacimov, head of department; Jokha Al Issai, masters student; Muna Al Amri, lab supervisor; and Mohammed Al Balushi, senior technician from the SWAE department.

Feasibility of further greening of roofs of Omani houses and their passive thermal insulation was assessed. Pot modules at the extreme temperature and dryness of Omani climate proved to be efficient thermal insulators of the roof and suitable bio medium for plants.

It is a novel irrigation system with continuous (annually) irrigation without any scheduling and does not involve additional labour; and meets optimal crop-water requirements. The system also does not utilise any electrical energy

and brings huge electricity savings as well because by cooling the roof, the use of air-conditioning is reduced.

Novel irrigationAlong with improving building thermal regimes and flood attenuation the collateral benefits are: Utilisation of otherwise idle roof space; cheap and simple subsidiary farming; direct roof-to-family supply of basic vegetables in urban households; recycling used family cloth and plastics; engaging urban family members in agricultural activities.

Daily-average temperature of the roof is shown to have reduced by 6-8 degrees in June with mid-day temperature peaks reduced by more than 20 degrees.

Several plants (ivy, sunflower, succulents and others) are shown to grow well on the roof when the maximum concrete/gravel temperature of the roof reaches more than 70 degrees.

The capillary siphoning of green roofs

has been tried at SQU since 2001 and the siphons are mechanically robust. Water supply to the tanks is as sustainable as the house or building itself. Soil is less sustainable due to secondary salinisation but common leaching can be practised. Siphoned pots served as good buffers for regular regional rainfalls.

2010GreenResearchAward

Winner

2010GreenResearchAward

nnerWinn

49July 2010

Once the trees grow and grow into forests, more water will be collected to grow more vegetation. This recovered vegetation will be able to supply water to the groundwater table enhancing fresh water resources in Dhofar.

As of April 2010, more than 80 per cent of the transplanted trees are surviving. The irrigation for these trees will be stopped during the current Khareef to see whether the trees stabilise and take deep root, enough to survive without irrigation. If they can survive until Khareef 2011, it can be said they will survive for good. According to the forestry standard worldwide, if the survival rate of transplanted trees is above 30 per cent, the activity is considered successful.

“In Dhofar, we can expect Khareef every year even though the duration is just two month and a half maximum, but we can call Khareef as a sustainable water resource that we can rely on every year. We are using the water captured for re-vegetation purposes,” says Shoji.

The Mist-Catcher Project for re-vegetation of the mountainous area in Dhofar is designed to combat desertification caused by

over-grazing in the region. This will be done by transplanting indigenous plant species in affected areas and growing them by irrigation using water collected from mist by mist-catchers during the Khareef season, the June-August period when rain and mist settle on the hills and mountains of Dhofar.

The Ministry of Environment and Climate Affairs (MECA) has commissioned this project in association with Mitsubishi Corporation (MC). Describing the project’s importance, Tomoo Shoji, senior manager, says, “At the plateau areas of mountainous areas in Dhofar, their original vegetations have been severely damaged by over-grazing by domestic animals for long time. This is a kind of typical desertification. This project is aimed at recovering the original rich vegetation in the areas to combat on-going desertification by transplanting indigenous plant species using water collected from mist by mist-catchers during Khareef.”

The facility was constructed and began to operate in June 2009. Even though Khareef 2009 was weak and with short period, the facility collected around 200 cubic metres of water. Nearly 250 seedlings of local plants were already t r a n s p l a n t e d

THE MISTY MAGICMitsubishi’s project is a perfect example of how nature can be

utilised to undo the effects of a natural adversity in Dhofar

FORESIGHT, PERSISTENCEIn order to minimise costs the ›project is utilising materials easily available in agricultural shopsPublic participation was through ›locals employed in the Ministry of Environment and Climate Affairs nurseryThrough on-the-job-training, ›the transfer of knowledge was achieved for continuity and sustainabilityWater collected through the ›project can be converted as drinking water after chlorination

at the end of August and the beginning of September 2009 and have been irrigated every three days consecutively during Khareef and every five days during the rest of the period.

ThThThThhThTTT ee e e eee fafafaffaf ciciciciciiciicccililililililililllililiiiitytytyttytyttttttttttttt w w ww wwwasasasasaass c c c cconononononnnnonnnnnoo ststststs rururururururuructctctctctctctccctedededededddeded a a a a aaa andndndndndndndndnddd b b bbb bbegegegegegegegeggananaananaan tototototototototottt o o oo o ooopepepepeepepep rararararaaaaaaaatttetetetetetetetttetet ii i i iiiiinn nn nn n nn JuJuJuJuuJuuuJuuuuuuunenenenenenne 2 2 2 2222222222000000000000000000009.9.9.9.9.9999999.999 E EEEE E EEEEEEvevevevevevevevevev n nnn n nnnnnnnnnnn thththththhhththhthhhththhthhthhouoououououo ghghghghghghhghghgh KhKhKhKhKhKKhhKhararararara eeeeeeeeeeeeeff ff fff 2020202020200200909090999999 w w w w w wwasasasasasasasasaasssssasas w w w www wweaeaeaeaeae k kk k k k k k k anananananananannnannanndd d dd d dwiwiwiwiwwiiththththhhhhhhthhthhhhh s s s s hohohohohhohooooooortrtrtrtrtrttt p p p ppp pppererererrrrrioioioioiooioood,d,d,d,d,d,,d, t t t tt tttttthehehehhhhhehhhhhehheh fafafafafaffafaciciciciciciciciciilililililililllllllll tytytytytytyyyy ccccccololololllllo lelelelelelelellelll ctctctctctcttededededdededed a a a aaarorororororr unununununnu d d d dd dddd2020202020200 0 00 0 00000 00000000000000000 cucucucucucuuuucubibibbbibibbibicc c cc memememememememeeetrtrtrtrtrrtresesesesesesesesseeeseofofofofofoffooo w w w wwwwwwwwwatatatatatatatatattererererererrerrerererererrrrrrre .. NeNeNNeNeNNeNNeNNeN ararararararrrrrraa lylylylylyy 252525225522 0 00 0 0 seseseseseseeseededededededdedededededddddlillilllilillililiiil ngngngngngnnnnnnnggngs s s s ssofofofofofoffoff l l l lococococococcococococococcalalalalaalal p p p p ppppplalalalalallalaantntntntntnnnn s ss ss sssweweweweweewewewerererrrrrrrerrrrererrrrr a a a aaaalrlrllrlrlrlrrrrlrrl eaeaeaeaeaeaaaaddddydydydyyd t rt rt rrt rt rttt a na na na na na na nnn s ps ps ps ps ppp l al al al al al al al aaal all n tn ttn tn tn tnn e de de de de de de de de d

Water c›

project drinking

atataatatatatattatatttttat t t tttttttttthhhhhhhhhbebebebebebebb gigigigigiigiggg nnnnanananannd d d d ddththththththhhthrererererereeKhKhKhKhKhKKKKKKKKdudududududdu

GreenResearchAward


GreenResearchAward


COVERSTORY

50 July 2010

ENVIRONMENTAL CREDENTIALS

Reduction in energy consumption ›and CO2 emissions by cutting down on water usage in demineralisationHazardous chemical usage cut ›down by 60 per centInternal energy consumption ›reducedImproved employee awareness ›on environmental protectionRaised public’s eco-awareness ›

is to conserve the natural resources by optimising its consumption to ensure that future generations are also able to enjoy the beauty of the earth,” adds Al Nofli.

Even in its core business of power generation, AES Barka has taken care to install eco-friendly machinery. The gas turbines, which generate power, are equipped with dry low NOx (DLN) burner technology to control air emissions levels of NOx (nitrogen oxide) which is harmful to human health.

AES Barka consistently tries to improve its various other efforts with the objective of conserving the environment. This includes developing a green belt in the facility; and ensuring that oil/ chemical usage or storage is not causing soil or ground water contamination by providing storage areas with non-permeable platform for secondary containment and spill palettes to prevent soil contamination.

AES Barka is committed to conserving the environment while continuing to meet its goals of supplying clean and reliable power and

water to the people of Oman. It has embraced environmental protection as one of the core values to conserve the environment and strives to improve itself continuously in conserving natural resources. The company strongly believes that excellence in management of environment is an essential element within its overall business.

“AES Barka has implemented a number of initiatives for protecting the environ-ment taking note of the three R’s namely re-using, recycling, and reduction/ opti-misation of energy consumption. Mitigat-ing environmentally hazardous material usage and taking part in environmental conservation programmes showing that commitment is not limited to words, but it is being converted to action for conser-vation of the environment where we are living,” says Abdullah Al Nofli, Environ-ment, Health and Safety team leader, AES Barka.

Sustainable projectsAll the programmes, which AES Barka has initiated are ongoing projects, which have a positive impact on the environment. For instance, by the judicious use of power and water, the company has reduced internal energy consumption thereby helping to reduce power and steam generation ultimately bringing down the consumption of natural gas and cutting down on emissions. This has been done by plugging the leakage of steam and water from steam traps, sampling points

ENVIRONMENT POWERHOUSEAES Barka has implemented multiple initiatives to enhance

environmental awareness and protect the environment

etc. All the online and manual sampling points of water and steam, for instance, is an area where a lot of water was lost if the flow rates were kept at more than required. These sample points flow was monitored in every shift and adjusted as per the requirements in order to avoid wastage of water.

Plastic perilsAES Barka believes that one of the major threats for the next generation will be the health and environmental hazards of plastic. Through its innovative plastic minimisation programme, the company has been able to eliminate the environmental hazard posed by around 3,600 PET bottles per month.

“As an organisation, AES Barka is really concerned about the increasing usage of plastic, which is going to pose multiple hazards to the earth. Equally important

AEAEAEAEAEAEAEEAAAAAAAAAAA S SS S S SSSSS BaBaBaBaBaBaaaaaBaaaaaaaaaaaaaaBaaaaaaarkrkrkrkrkrkrkrrkrkkrrkrrkrkrrrrrrrrrrkrka a a a aaaaa cococococococccc nsnsnsnsnsnsnnnnnnnnsnnsisisisiisisississttetetetetetetetetttteeentntntntntnnntn lylylylyylyylyy t t t t tririririiririririrr eseseseseseeseseese t t ttoo o o ooo imimimimimmmmmmmprprprprprprprrrrrovovovovovovove e e e eeitititiititiiitiiiiititti sss s s vavavavavavavvaririririririiiiiouououououououo s s ssss s otototototototoootthehehehehheheheheheheheehhhhhhh r r rrr r efefefeffffefeffeeffofofofofofoffooofofoortrtrtrtrrtrts ssss ss wwiwwiwiwiwwwiw thththththththhhh t t t ttthehehehehehehhe o o o oooooooooobjbjbjbjbbjbbbbjbjbjbbbbbbbbbb ececececececeectititititit veveveveveve ofofofofofffffffffffffffo cccccc ononononnononnnnsesssesesesessessseservrvrvrvrvrvrvrvr ininininnining g g gg g ggg gg thththththhhhe ee e e eee enenenenennnnnvivivivivviv rorororororor nmnmnmnmnmnmnmmnmenenenenenennnnnnneee t.t.tt.t.tt T T T TTTTThihihhihihihihhihhhhiiisss sssssssssinininininininniiiii clclclclclududududddudeseseseseesse d d d dddddevevevevevevvevvelelelelellllllllelelllopopoppopopopooppininiiiinniniininng g g g gggg a a a aa a grgrgrgrgrgrgrgreeeeeeeeeeeeeeeeeeeeenn n n n nn n bebebebebbebebebbbb ltltltltltlttltlt i i iiii iin n n n nnn thththhththhthhe e e e eeeeefafaffafafafaaciciciciciciicicc lililililill tytytytytytytttytytytytytyyyy; ; ; ; ;; anananananana d d d d d d d dd enenenenenennnsusususususussusuuuuuririririririiiiiiiiingngngngngngngngggngngggngg t t ttt t tt t hahahahhhhahahahhhhhhhhh ttt t t oioioioioioiiioiiiiiioiiiiiiiioioioo l/l/l/l/l/l/l/l/ll/l/l//// c cc cc chehehehhehehehh mimimimimimimicacacacacaacacalll lll l l lllllllllusususususussuu agagaagagagaaaa e e e e e ororororororro s s s ssssstototototot rararaaraagegegegegegegegegegegegeggeggggggggggg i i i i iiiiiis s s ssssss nononononnoonot t tt cacacacacacacacacac ususususususu ininininininng gg g g ggg sosososososss ilililili ororororororoooooooooooor g g g g gggggrororororooooooooooooounununununuu d d d d dd wawawawaawaw teteteteteteteer rr r rr cococococoocontntntntntntntaaaamamamamma ininininininiinatatatatatatatatatioioioioiioioiooioiooioioioiioioioioioiooooon n nn nnn bybybybybyyyyyyyyy prprprpprprppprprp ovovovovovovoo ididididdidddddi ininninininininnininnnniniiiinnggg gg g g gg gg stststststssstsssttorororororrrrrragagagagagaggaggee e eeeeee arararararararaaraaarrreaeaeaeaeaaaaaaaas s s ssssssss wiwiwiwiwiwiiw ththththththh n n n nnnnonononononnonoonnn-----pepepepepepepepeppeepep rmrmrmrmrmrmrmmmmeaeaeeaeae blblblblblb e e e e e plplplplplplpp atatatataaaata fofofofofofofoofoff rmrmrmrmrmrrrr f ff f fffffffffffffffforooroorororororrorororoororororoooorrr s sssssssssssecececececececceee onononononononnnoonondadadadadaadaaaaaaaaryryryryryryy cocococcocccc ntntntntnttnn aiaiaiaiiiiinmnmnmnmnmnmmnmnmenenenennnt t t tt ananananana dddd d d d dddddddddd spspspspsssssssss ililililililililllilllilllllllll ll l ll papapapapapapapapaaaap leleleleleleleelell ttttttttttttttt esesesessesessssssesssssesssss tttt ttt tttoo o o oo oo prprprprprprppppreveveveveveveevvvveneneneneeneeneeeeneeentt t t tttttttt sosososoosoililililililil cc c ccconononononononnooonooono tatatatatatatattaamimimimimimiminanananannnnannn tititititt onononononononnonononnnnnnnononononnnnnnnonnnnnnnnnnno .......

2010GreenFootprint

Award

Winner

2010GreenFootprint

Award

nnerWinn

PROTECTIVE SHIELDV-Kool Oman has endeavoured to educate the public about dangers of

CO2 and the need for installing heat-reducing glass films

The goal of V-Kool Oman is to educate the public about climate change and global warming and demonstrate how V-Kool film installation

on the glass of vehicles and buildings reduces the CO2 emissions in the atmosphere.

While educating the public about the increase of CO2 concentration in the atmosphere through green campaigns; V-Kool also wants people to know about energy saving methods while using electrical equipments and appliances.

Explaining about the product, Alaa Jarrar, general manager, V-Kool Oman, says, “By selectively rejecting solar heat, and reducing air conditioning loads, V-Kool improves the fuel efficiency of a car by 3 per cent, translating to a132 kg reduction in CO2 emissions every year.”

As for buildings where flat glass is used for windows etc, the V-Kool film selectively rejects solar heat thereby reducing air conditioning loads and saves 103.3 kwh/m2 of energy, translating to 30.6 kg reduction in CO2 emissions every year.

V-Kool Oman also wants to increase the number of cars and flat glass areas installed with V-Kool to reduce the emission of CO2 in the atmosphere.

CO2 reductionIn Oman, V-Kool installs an average of 3200 cars with the protective film, which means that vehicles using V-Kool contribute to 422 tons of CO2 reduction per year at the rate of 132kg per car.

yyyyyyuccucucucuccccccccccccccccccccccccininininninininiing g g ggggg gggg aiaiaiaiaiaaaiaiaiaaaaaaaaaairr r r r rrrrrr33333.3.3.3.33.3 k k k kkkkkkkwhwhwhwhwhwhwwwwhwh//////////33333333333330.0.0.00.0000 6 6 66 666 6666 kgkgkgkgkgkkkgkkkgkkgkgkkggg yyyyyyyeaeaeaeaeaaar.r.r.r.r.

inininininini crcrcrcrcrrcreaeaeaeaeaeaaeasesesesess aaaaaaaaaasssssssssssssssssssssssssssssssssssss aa a a aa aaaa aaarererereasasasasasasasass ucucucuccccccccuce e eeeee ththththhhhhhthththhthhtttht e e e e eeerererereer ..

avavavavaverererererrreeragagagagagagagagaggge eeeee ee eeiiiiveveveveveveev fi fi fi fifififififififififififilmlmlmlmlmmmmlmmmmm, , , g g gggggggg V-V-V-V-V-V------KoKoKoKoKoKoKoKKoKKKKKKKKKKKKoKoKKKK ololoololol edededeededede ucucucuccucu titiitititititt onooonononononononon cacacacacacaaacaaaaaacaaaaar.r.r.rr.r.r.rr.

Over 18 million cars worldwide are installed with V-Kool films. This means that there is more than 2.3 million tonnes of CO2 reduction in the earth’s atmosphere.

Meanwhile, the area of buildings coated until date with V-Kool is about 4,64,684m2. This saves 48 million kwh of electricity, thus reducing 14240 tonnes of CO2 emission. There is 30 per cent annual increase in the number of cars installed by V-Kool, while the area of glass fitted with V-Kool is also increasing yearly by 20 per cent.

With extensive green campaigns launched by V-Kool, many people adapted the green concept in their lives and became fully aware that it is the responsibility of every individual to implement means that can lead to fuel and energy savings, which will in turn reduce the danger of environment pollution.

ENVIRONMENTAL CREDENTIALS

A car installed by V-Kool will ›improve 3 per cent of fuel efficiency translating to 132kg reduction in CO2 emissions annually. Eleven trees are needed to absorb 132 kgs of CO2

Average number of cars installed ›yearly by V-Kool in Oman is 3200, which means 422 tonnes of CO2 reduction per yearConducted seminars for ›governmental sectors such as Diwan Of Royal Court, Sultan Qaboos UniversityPrinted and distributed marketing ›collaterals that educates people about the global warming and CO2 problem

GreenFootprint

Award


GreenFootprint

Award


COVERSTORY

52 July 2010

ECO-FRIENDLY QUAYSPort of Salalah took various environmental steps to decrease its

carbon footprint by reducing its energy consumption

Project Qudam is an Environmental Performance Improvement initiative launched by Port of Salalah to make itself a “Green Port” and

achieve reduction of carbon emissions by 15 per cent by December 2010 and a 25 per cent reduction by the end of 2014 with respect to the baseline year 2009.

As a first step, the port began a structured approach of identifying the sources of green house gases emission (GHG). Key equipments and operations contributing to the significant portion of GHG emis-sions were identified and potential oppor-tunities were identified to reduce/replace technology and processes. Going forward, in 2010, independent expertise of Ernst and Young was hired to further assess the carbon footprint of the Port using interna-tionally acknowledged best practices.

“As we are a transshipment handling port, our major contribution to the environment would be in energy consumption. Therefore, our strategy comprised of ‘reduce’ and ‘replace’,” informs Kutaiba Al Hatmy, corporate communications manager, Port of Salalah.

Project Qudam environmental initia-tives include reducing the idle engine speed of the rolling terminal gantry (RTG) handling the containers and modifying the air conditioner regula-tion of quay cranes.

Further, in order to save fossil fuel, the port installed shut off system in the yard tractors; and reduced the waiting time of tugboats for vessels. The port also installed auto switch off system for floodlights of

quay cranes; and planted trees around the perimeter of the port compound.

Sustainable initiativeSustainability is the crux of Project Qudam. The initiatives undertaken under this project have a payback of less than three years, which ensures that these projects are implemented and managed properly. These initiatives have been approved by the top management of Port of Salalah.

Apart from reduction in the carbon footprint of the port, these initiatives also result in saving fossil fuel, which contributes, to the GDP of the nation. The Port of Salalah is also planning to take up a few of these projects under the Clean Development Mechanism of United Nations Framework for Convention on Climate Change (UNFCCC).

The initiative to go green by Port of Salalah has drawn interest from other ports in the region – considering the fact that Port of Salalah is the first amongst the few in the world and the first in Middle East to do so. In addition, the entire initiative serves as an enormous source of awareness and motivation for various stakeholders. For example, after the launch of the Project Qudam, the employees of Port of Salalah have taken the energy conservation attitude back to their home and are implementing energy efficiency measures both at work and at home.

REDUCE AND REPLACE

Technology

Reducing idle engine speed of ›Rolling Terminal Gantry (RTG) operations by the installation of 3rd party parts: G-PAC, Emerson’s RISGA or Shutdown system

Installing shut off system in yard ›tractors if left idling for more than 12 minutes

Reduction of the actual terminal ›lighting by replacing sodium bulbs with LED solid lights which consume 50-75 per cent less power

Installation of auto switch off ›system for the flood lights of quay cranes during idle state

Process Improvement

Modifying the air conditioner ›regulation of quay cranes to switch off automatically to room temperature

By reducing the time the tugboats ›wait for a vessel, the fuel consumption could be reduced

Planting trees around the ›perimeter of compound to help absorb carbon dioxide from atmosphere

2010SpecialJury

Award

2010SpecialJury

Award

53July 2010

CLEAN POWERA radical rethink in PDO’s energy consumption has enabled it to

find environment-friendly solutions to its strategic investments

considerable extra cost, it chose to locate the plants at oilfields where waste heat could be used to generate steam for oilfield injection using an innovative process hitherto unused in Oman.

“From these power stations, PDO will generate steam using exhaust heat that previously would have been wasted by direct venting to the atmosphere. The temperature of these exhaust gases is over 500 degrees celcius and can be used to make steam – a process referred to as cogeneration,” explains Abdul-Amir Al Ajmi, manager, Qarn Alam Cogeneration project.

Three power plants linked to cogeneration units currently under construction will save nearly 1 million tonnes of CO2/yr compared to the traditional direct-firing approaches. A further network of linked thermal EOR projects and power stations will be constructed over the coming years. These projects will help PDO realise a total emissions savings of over 4 million tonnes of CO2/yr within five years.

PDO recognises that what makes good environmental sense also makes good business sense. It also shows that in addition to protecting the planet by reducing the carbon footprint, there is an eventual payback in terms of the reduced fuel requirement.

POWER POINTSThree power plants linked to ›cogeneration units currently under constructionThe new power generation ›process will save nearly 1 million tonnes of CO2 per year compared to the traditional direct-firing approachesNetwork of thermal EOR projects ›and power stations will help PDO realise a total emissions savings of over 4 million tonnes of CO2 per year in five yearsPower station and EOR ›expansions will yield savings totalling over 6 million tonnes of CO2 per year within the decade

For large corporate incumbents in the oil industry, making a positive contribution to the environment does not always come naturally. A

major change in the company’s DNA is required not to mention a commitment by management and shareholders alike to put the planet before financial performance.

But changing its corporate DNA is precisely what Petroleum Development Oman (PDO) has done. And the result has been a radical re-think of the way it consumes energy and how it can mitigate the effect of its operations.

PDO has been producing oil and gas for over 40 years and operates over 120 oilfields throughout Oman. In order to maintain oil production and secure Oman’s income for future generations, PDO consumes a massive amount of electric power.

To put this into perspective, PDO’s operations use as much electricity as the whole of greater Muscat (population 1 million). Much of this power is used to pump water into oilfields to maintain reservoir pressure and for enhanced oil recovery.

Environmental achievementTo meet its rapidly growing power requirements, PDO planned to construct several new power stations. The goal was to ensure that this could be achieved while reducing its carbon footprint. As a direct result of its new planet-friendly mindset, PDO scrapped plans to site plants where the power was required. Instead, at a

SpecialJury

Award

SpecialJury

Award

COMPANYPROFILE

55July 2010

One of the endearing images of Country Club India (CCIL), India’s largest leisure infrastructure company, is of Y Rajeev Reddy, the company’s chairman and managing director who appears in the promo advertisements with his trademark

thumbs-up sign. The thumbs-up sign which often suggests a positive attitude, happiness, good spirit, or a sense of accomplishment could well symbolise the life of Rajeev Reddy who began with a modest real estate company – the Amrutha Estates – and is today at the helm of one of the fastest growing entertainment and leisure conglomerates in India.

Family clubbingA multi-million dollar entity and a listed company on BSE (Bombay Stock Exchange), CCIL is a pioneer in the concept of family clubbing in India and has established 205 properties of which 50 are owned and 155 are franchised. It has over 172 affiliations plus a global gateway via Country Vacations and RCI affiliation of 4000 resorts for its esteemed members. For the year ended March 31, 2010, CCIL reported net sales of RO40.37mn and its consolidated net profit was RO6.5mn.

The Limca Book of World Records has recognised CCIL as India’s biggest chain of family clubs. With 51 of its own clubs, it is truly a pioneer in family clubbing offering state-of-the-art facilities in all its clubs for heightened pleasure.

All CCIL properties are set amidst sprawling green environments with swimming pools, indoor games, health clubs, well-serviced rooms and professionally trained manpower to meet everyone’s need. The clubs are also equipped to handle banquets, entertainment and business needs where you can organise weekend activities, competitions and contests to engage and build a clubbing community. A unique benefit to members

AFFORDABLE EXCLUSIVITYCountry Club changed the concept of

clubbing in India by bringing it to the

reach of families. Y Rajeev Reddy,

Chairman and Managing Director tells

Visvas Paul D Karra about the company’s

foray into Oman and the way ahead

56 July 2010

joining Country Club is the facility of transferability of membership from one city to another, paying the differential membership fee, in case the fee at the city to which transfer is sought is higher.

Regional expansionCCIL, which has a presence in UAE, is now expanding across the region and has opened a new office Country Vacations International in Muscat in June, with an objective to promote and sell Country Club Memberships. The office is located at Royal Tower, Near Centre Point in MBD Area. In an exclusive interview with Oman Economic Review after the soft opening of the office, Reddy said, the Sultanate of Oman is an ideal location for the Country Club group to venture into as they intend to cater to expat Indians across the region, while at the same time raising the brand awareness among the local community.

“We see immense potential for the growth of tourism and our office in Muscat, Oman, is an entry point for us to introduce the group membership offers and we are certain of attaining our set targets for this region,” Reddy said.

Apart from the club membership, CCIL has introduced the concept of Fractional Ownership of buying a portion of an expensive asset like CCIL properties. A percentage share of the luxury asset is divided amongst the owners. As a fractional owner the member can enjoy the priorities and privileges, such as using the property as his or her holiday destination, while his asset increases in value.

Focus areasHaving achieved an enviable status as a premier family clubbing chain, Reddy says that now Country Club is intent on consolidating its position as a niche leisure provider. For this, four core thrust areas have been identified as part of their expansion plans.

The first is wildlife holidays through Country Club India’s Wildlife Resort Bandipur, an exotic resort situated on the outskirts of Bangalore. This property is nestled in the Mangala Valley and surrounded by the lush forests of Bandipur, a protected sanctuary and home to the most exotic fauna and flora.

COMPANYPROFILE

Reddy believes in spreading joy and happiness to people and therefore organises entertainment for club members and guests. Mega entertainment shows which involves Bollywood celebrities and beauty pageants are held during Indian festivals

Adventure, wellbeingThe second focus area is intended for those who have the adventure streak in them. CCIL’s 155 clubs combined together create a spirited entanglement of adventure sports to bring out the high-end adrenalin rush. Country Clubs situated at various geographic locations offer premium adventure sports facilities to its members. These include the best rapids in India, white water rafting in Sri Lanka (Country Club Babylon); paragliding, scuba diving and snorkelling in Goa (Country Clube de Goa); and mountaineering and light aircraft gliding in Nepal.

Medical tourism is the third area in which Country Club has invested considerable resources and has plans to market its facilities all over the world. The Country Spa; and Country Club Treasure Cove, Asia’s first floating Spa – both located in Kovalam, Kerala have been specially crafted for providing Ayurvedic rejuvenation therapies.

“Since naturopathy is increasingly becoming popular among the urban populace, the two facilities have specially trained staff to provide complete medical therapy. They are aided by the fully equipped Ayurvedic treatment centre, pharmacy, Ayurvedic restaurant, yoga hall; curio, library, herbal gardens along with Ayurvedic cooks and dietician for a revitalising stay,” informs Reddy.

Leisure Infrastructure is the fourth focus area. CCIL is the fastest growing leisure infrastructure company in India and its foray into this niche segment began with the very first leisure infrastructure project ‘Country Club Coconut Grove’ near Bangalore. Similar projects across India include Country Club Mango Grove, Chennai; Country Club Bamboo Grove, Lonavala, Mumbai; Country Kuteeram, Lepakshi, Hyderabad etc.

CCIL has further identified markets and regions like Thailand, Malaysia, Europe and Africa along with various GCC countries for its global expansion. The Country Club Hotel in the UAE is part of the RO100mn strategic expansion plan of the group in the region.

Outgoing personalityReddy, a graduate in commerce, decided to venture into real estate and construction when he was 21 years old with Amrutha Estates named after his mother in the year 1981. The first ambitious project he undertook was Ashiana, a residential complex consisting of 20 deluxe flats, in the capital city of Andhra Pradesh. Since then he has completed 38 prestigious projects in Bangalore and Hyderabad.

Realising that many clubs make it difficult for common people to obtain membership, Reddy started the Country Club in 1989, which now stands as a landmark in the city of Hyderabad. His motive has been to create a club that is accessible and affordable for all sections of society.

The 52-year-old Reddy is a fitness enthusiast who loves swimming and was a state tennis champion while studying. He also enjoys outdoor sports like paragliding, river rafting and scuba diving. Reddy has two sons and a daughter who are also the board members of CCIL.

58 July 2010

Power and utilities businesses must assess their core assets and determine which new assets and functions will help them remain competitive in the transformed market

Meeting global challenges

BY SRIDHAR SRIDHARAN

In the last article, we looked at the lessons learned by banks as they respond to the economic

crisis. In this article, we look at how power and utilities companies react to the crisis and plan for the road ahead. Power and utilities companies held up well in the global recession compared to other industries but there are lessons from change that are taking on new importance for these companies as well, to thrive in the new economic environment.

The simple model of providing power, collecting revenue and securing rate increases is disappearing. The power and utilities sector faces a lengthy period of transformation. New power plants will be needed but given the higher costs of construction and financing, power and utilities companies will be under greater pressures to plan for long-term investment. The industry cannot maintain the status quo. Companies must make tough decisions today.

Tomorrow’s infrastructureThe power and utilities industry must undertake a massive investment to address global challenges in new ways.

As new technologies find their way to emerging markets and the recession lifts, power demand is expected to surge. The sector faces a lengthy period of active transformation that is projected to continue for some time. These changes are driven by the need to decarbonise energy supplies, reduce exposure to volatile commodity markets and embrace new, “smart” technologies, while continuing to show a profit under evolving market conditions.

The major challenges in trans-forming the industry are:

Integrating new, clean technologies into the generation mix and existing networks Competing for funding, talent, equipment and other resources Securing reliable energy supply Influencing, anticipating and complying with ever-changing regulations and marketsOffering affordable energy to customers

Cash preservationPower and utilities companies have historically been per-ceived as a safe business and

investment haven. To some extent this perception is still justified particularly given the recession’s heavier impact on other industries. However, cash can no longer be taken for granted. The recession saw customer demand decrease, bad debt increase and credit become less available. World-wide, companies have had to be much more proactive in their cash management. Power and utilities businesses with substantial trading positions must maintain adequate re-serves to cover adverse move-ments in commodity prices.

Counterparty has counterpartiesFinancial instability in key suppliers can prove to be a lethal contagion for any business. Counterparty risks can be found within several degrees of separation from the business. Ongoing assessment of counterparty risk can help prevent a crisis. In addition, diversifying the supply base is a straightforward way to reduce counterparty risk. Now more than ever, it is important to achieve and maintain a strong credit rating.

Identifying key risksToday’s power and utili-ties companies must also be

The author is a tax partner with

Ernst & Young (sridhar.sridharan@

om.ey.com). This article is extracted from Ernst

& Young’s publications on Lessons From

Change

59July 2010

VIEWPOINT

THE INDUSTRY NEEDS TO ARTICULATE ITS POSITION

TO GOVERNMENTS AND REGULATORS, SINCE, IN

THE END, IT IS THE POWER AND UTILITIES COMPANIES

THAT MUST IMPLEMENT AND SUSTAIN POLICY INITIATIVES

risk management compa-nies. For power and utilities companies, strategic risk arises directly from the new low-carbon agenda, the in-creasing insecurity of tradi-tional energy supplies and a potential skills gap. These new strategic risks, driven by the transformation agenda, could fundamentally change the industry’s entire risk pro-file. As customers and trad-ing counterparties of energy companies continue to strug-gle, credit risk continues to be an important considera-tion for the sector. The risks of long-term storage, capaci-ty or transportation contracts should continue to be evalu-ated, but power and utilities companies need to go further, assessing the full spectrum of potential risks.

Remaining alertWhile operational effective-ness is always important, adaptability has become an in-creasingly essential trait. The strong impact of the global financial crisis has elevated the existing focus on perform-ance improvement. New op-erational models need to be adopted to help the power and utilities industry recali-brate its business successfully as it transforms, particularly

around carbon reduction and green initiatives.

Technology is a wise spendCreating more effective and efficient IT systems has a massive influence on cost containment and reduction. New IT systems are especially needed in the case of recent carve-outs. With significant changes on the horizon — including advanced metering, smart grids and low-carbon generation — legacy systems are unlikely to be able to meet even medium-term needs.

The current economic crisis has also had a positive effect on financial transformation initiatives in the sector. Financial information affects every part of an organisation and many utilities companies are now seizing the opportunity to match best practice with other sectors.

Embracing changeThere can be no doubt that the significant strategic changes in the power and utilities industry during the last five years have been heightened by the economic crisis. Economists globally are associating green technologies as the next driver for growth.

All players in the industry should be prepared to pinpoint exactly where the business stands in the value chain and build the best case for that position. To prepare for a low-carbon, competitive landscape, any asset acquired must fit into a portfolio of activities that respond to an impending reality. And low-carbon, renewable resources, nuclear power, advanced carbon capture technology and smart-grid capabilities are components of the energy portfolio of tomorrow.

Anticipation and agilityIn this sector, regulatory decisions are one of the most important factors in investment. As the supply chain and the market become more complex, there is a strong need for companies to maintain close relationships with regulators, governments and customers, which will allow them to explain the realities of delivery against the expectations for change.

While the credit markets are beginning to loosen, access to capital will undoubtedly continue to be relatively tight during the next 18 to 24 months. Companies needing cash will have to dispose of

noncore assets, with a view to minimising losses.

The transformation agendaPower and utilities companies have not been as severely affected as other sectors by the financial crisis and the downturn. Although industrial power demand has been hard hit, demand for energy among residential customers is relatively stable. To some extent, government support and subsidies have leveled out demand fluctuations. However, the sector has faced increased financing costs and problems accessing finance.

The main lesson from this downturn is that the business environment is more challenging. Decisions must be faster and bolder, and based on a clear vision and a core strategy that embraces the transformation agenda. Executives, who show ingenuity, have the courage to make tough decisions and demonstrate the foresight to apply lessons from change will guide their companies to success in the power and utilities sector. They will be the leaders who establish the foundation upon which our new global economy will rise.

61July 2010 6611611JulJulJJulu y 2y 2y 2y 2y 010101010

Taking a good insurance policy should be

the first step towards financial planning as it

provides one’s family with much needed financial

assistance in case of a fatality

SECURINGYOUR FUTURE

In some sense we can say that insurance appears simultaneously with the appearance of human society. Early methods of transferring or distributing risk were

practised by Chinese and Babylonian traders as long ago as the 3rd and 2nd millennia BC, respectively. Chinese merchants travelling treacherous rivers would redistribute their wares across many vessels to limit the loss due to any single vessel’s capsizing.

The Babylonians developed a system which was recorded in the famous Code of Hammurabi, c. 1750 BC, and practised by early Mediterranean sailing merchants. As a part of the deal, if a merchant received a loan to fund his shipment, he would pay the lender an additional sum in exchange for the lender’s guarantee to cancel the loan should the shipment be stolen or lost at sea. Insurance is designed to protect people from disasters and their financial

consequences. There are many kinds of insurance and the most important of these is considered to be life insurance which makes financial provision for your family following your death.

As there are various financial commitments, you need to meet in life you also need to provide something even in death to ensure the security of the family, and to help them meet expenses at least for a short time,

SPOTLIGHT INSURANCE

SPOTLIGHT INSURANCE

62 July 2010

to protect dependent parents or to provide security for your spouse and children. These financial obligations could well include funeral expenses, unsettled hospital and other medical bills, mortgage payments, business commitments and meeting the college expenses of one’s children.

In law and economics, insurance is a form of risk management primarily used to hedge against the risk of a contingent, uncertain loss. Insurance is defined as the equitable transfer of the risk of a loss, from one entity to another, in exchange for payment. An insurer is a company selling the insurance; an insured or policyholder is the person or entity buying the insurance policy. The insurance rate is a factor used to determine the amount to be charged for a certain amount of insurance coverage, called the premium. Risk management, the practice of appraising and controlling risk, has evolved as a discrete field of study

and practice. The transaction involves the insured assuming a guaranteed and known relatively small loss in the form of payment to the insurer in exchange for the insurer’s promise to compensate (indemnify) the insured in the case of a large, possibly devastating loss. The insured receives a contract called the insurance policy which details the conditions and circumstances under which the insured will be compensated.

Peace of mindPrecisely how much insurance you will need varies depending on your lifestyle, financial needs and sources of income, debts and the number of dependents you are responsible for. In the main, an insurance adviser or agent would recommend that you take insurance cover that is five to ten times your current yearly income. An important part of your financial planning, whole life insurance gives you peace of mind for any uncertainties in life.

Adequately planned life insurance will provide funds in the case of unexpected death to deal with debts, mortgage payments and day-to-day living expenses. It offers protection to the family that one leaves behind and serves as a cash resource. It secures your estate on death by providing tax free cash which can be utilised to pay estate and other death duties. Life insurance policies can also have a savings or pension provision which can help to fund you during retirement.

Understand ridersSome policies have riders such as restricted coverage of term insurance or critical illness for the children or spouse. There are particular rules considering eligibility for riders, which you will have to clearly understand.

In case of bankruptcy the cash value, together with the death benefits of any insurance policy is exempt from your

What are the best ways to choose a right travel insurance policy?Contrary to other insurance products, make sure you choose the product that offers a protection on different areas of risks. Basically a package of solutions for personal accident, personal liability, emergency medical expenses for in-patient and out-patient covers, travel related exposures such as luggage delay/losses, accidental loss of money, important documents and personal belongings as well as trip cancellation/curtailment following insured perils. Another side of the story is to choose the right insurer that owns a direct global presence through branches and operations within the country of destination and capabilities to service inquiries and claims by the 24/7 approach.

What are the biggest myths about travel insurance?The moment of truth generally happens at the time of the claim. You need to be sure that your insurer has the appropriate infrastructure that can help you to find the necessary support at the right time and in the right place. When you are abroad, you are in unfamiliar surroundings and it is important to eliminate complications through a clear and simple process so that you as a customer have easy access to the insurer together with a clear set of procedures to submit a successful claim. It is important to know what has to be done following a loss with regard to the time of

notification, loss declaration, determination of proximate cause as an insured peril whether connected or not with the chain of events that have finally caused the loss or losses and the collecting the required official documents etc.

What are the biggest mistakes people make when it comes to travel insurance?They miss the fact that travel insurance is not just a product but also the ability of insurer to provide a global network of support to efficiently handle claims in terms of quick time response and quality of service.

How badly did the recent flight disruptions caused by Iceland’s volcanic ash affect travel insurers, especially UAE-based? And how are you facing the situation?There is no doubt that the said disruption has created a negative impact and stopped people from catching-up on their obligations and pre-arrangements at both business and personal levels. However, it is important to have clarity in terms of what is covered, what is not covered and what is excluded to measure the expected losses sooner than later.

Does travel insurance provide coverage against natural calamities?Natural calamities are generally excluded from any travel insurance coverage.

For a risk-free travelFor a travel insurance, it is always important to choose an insurer who has a global presence to support you while you are abroad says Hemant Gupta, Regional Manager-Travel, Axa Insurance

SPOTLIGHT INSURANCE

64 July 2010

Al Madina Gulf Insurance, which has established itself as Insurer of repute in the Sultanate of Oman within its 4 year’s of existence, has made a significant contribution in the insurance sector with its products and services- both in corporate and retail segments.

The Company has the ability to listen to its customers, the experience to understand their needs and the skill-set to devise the right solution that they require at a price which is competitive. Client’s need and financial security are two most important criteria factored in our insurance solutions.

Al Madina’s endeavour is to set a high standard of excellence and set-up a process that can deliver it consistently. To this end Al Madina provides Service level Agreements which the company promises to deliver on at the beginning of a relationship with any customer. The Turn Around Time (TAT) is constantly being improved in every aspect of comapny’s business - from Documentation to Claim servicing. This, the company believes, will help in creating and building long-term relationships.

Looking at the future, the Company is in the process of launching some new retail products very shortly such as a high end Domestic Helper insurance and a very comprehensive Travel insurance. There will be some more retail products in property & health segment to follow during 2010.

The Company has entered into strategic & exclusive partnership with world’s leading Insurer on financial

lines insurances – Chubb Insurance Group, to offer a range of speciality line products such as Financial Institution Professional Indemnity, Director’s & Officers etc. The Company has also recently enrolled itself as sole representative of Oman for a ‘Regional Engineering Cooperative’ initiative. It enables the Company to draw upon underwriting experiences of “Best of Class” Engineering Insurance Specialists and high insurance capacity that allows the Company to provide lead terms for large engineering and construction projects.

One of the key drivers for the Company is to develop web based applications for selling pre-underwritten off the shelf products in the retail segment. The company expects to bring efficiency and real time service to the customer by uploading most of the retail products on a Web platform.

Al Madina prides itself as Company that takes into account the sensibilities and the Cultural & Social ethos of the community and believes that working alongside the Public sector can help achieve this objective. Towards this end, it has recently launched a low cost insurance scheme for the employees of the Ministry of Education. It has also been an active participant in the Road safety & Traffic initiatives of the Royal Omani Police and has put in place internal underwriting procedures to encourage safe drivers. The company believes that these schemes and initiatives will go a long way in creating a secure future for the Omani Population and these steps are indications of its Social responsibilities towards the society.

Al Madina Gulf Insurance: Providing cover with care & confidence

creditors. Holding a valid insurance plan is considered as having a financial asset and this will improve your credit rating when you need medical insurance or a home loan or business loan. Insurance forms a vital part of sound financial planning but you do have to evaluate both your personal risk and your longer term commitments. Plans, like a whole life insurance plan, give you the security you need for your dependents and also act as a good form of financial security against which you are able to borrow.

Strong and steadyDespite the global financial crisis hitting worldwide financial institutions, Oman’s insurance sector remained relatively insulated mainly because of the strong financial regulations of the country. Oman’s insurance sector was less affected by the global financial

crises and its impact on the financial markets, banking and real estate sectors because insurance companies have diversified investments. Because of the strong regulatory environment of Oman, insurance investments are governed by the Insurance Companies Assets Investment Regulation issued by the CMA in April 2007 which requires that the investments of local insurance companies shall not exceed 25 per cent of the total investments and the cash shall not be less than 40 per cent of such percent. Investments in shares shall not exceed 30 per cent and in real estate 20 per cent of the allowed investment abroad.

Thus the companies maintained their solvency that enabled them to continue their business without any exposure to the credit crunch. The Capital Market

Authority (CMA) continued its efforts to develop the insurance sector in 2008. It achieved remarkable progress in the regulatory supervision through the application of international standards and continued enhancement of legislative infrastructure and building institutional capabilities of the sector, diversification of the services provided to the participants of the sector, easing the processes and upgrading the skills and efficiency of the employees.

Oman has a backlog of financial assets to enable it to ramp up expenditure on key economic projects. The government’s gross financial assets plus the central bank’s foreign exchange reserves amounted to around 75 per cent of GDP at end-2008, according to Moody’s estimates. Overall debt levels remain comparatively small.

SPOTLIGHT INSURANCE

66 July 2010

Many companies were reluctant to start operations in 2009 when the world was reeling under a global financial meltdown. But you decided to go ahead irrespective of the crisis. How was your beginning?

All of us can see a quantum leap forward in the development of economic, industrial and tourism projects across the country because of the development of economy based on non-oil sectors. The sources of income in the Sultanate are diverse and the economy need not depend on one source only. The Sultanate’s joining of several international organisations particularly the World Trade Organisation has helped a lot to create conditions for the private sector so that it will be able to deal with the requirements of the market. Successful work depends on two very important things: successful management and knowledge of market needs and, ultimately, all the rest remains the grace of God Almighty.

After Cyclone Gonu insurance market in the Sultanate became buoyant. Was it the case after cyclon Phet?Everyone knows the negative and positive effects of Hurricane Gonu in Oman, which had revealed a lot of mistakes. It helped us to make necessary preparations ahead of Phet. As for the insurance market, there is no doubt that it became more active after the cyclone Phet. But despite that, the total claims are less compared to the situation after the cyclone Gonu. It indicates the growth of awareness and understanding among the citizens and residents of such attitudes.

How would you describe the insurance market in the Sultanate?His Majesty the Sultan accorded special importance to reducing traffic accidents. This was well reflected in the

national campaign “Yes, to reduce traffic accidents.” There is no doubt that it will have a positive impact on the insurance sector. The increase in the number of accidents would land insurance companies in trouble as they are forced to compensate for both material and human losses. Moreover, the efforts and supervision of the Capital Market Authority for the insurance sector and the

enactment of legislation to promote labor sector, which proved successful during the economic crisis, boosted the confidence of Oman insurance market giving positive indications of its stability and persistence.

There is an increase in the number and competitiveness of insurance companies. But it seems insurance companies in Oman appear to be somewhat timid. What is your take on this?As for the competition, ours is a sub agency of New India Insurance company and both companies combined provide services to keep pace with

the times and the needs of the citizen and the residents. For instance, Reef Al Batinah employees go to the workplace of the customer for processing transactions. For this we found an excellent response during cyclone phet, specifically on Friday and Thursday when the company was working round the clock.

With regard to insurance, it is no doubt that keeping insurance premiums within the Sultanate through domestic reinsurance companies will be better than exporting premiums for companies outside the Sultanate. This will inevitably lead to prosperity and growth of the sector. The Capital Market Authority’s decision to launch the first reinsurance local company is a bold step. However, it will take time before locally operating insurance companies filing installments in modern-era companies.

Satisfying customers is the first and foremost objectiveAnas Qais Al Sheikh, General Manager of Reef Al Batinah sub agaent for New india aassurance Company is not looking for a big market at least for the time being. On the contrary, he prefers to concentrate on providing the best insurance services available in Oman. Excerpts from an interview with Fatma Al Araimi

68 July 2010

You are part of the sustainability team at PricewaterhouseCoopers (PWC). What does being part of the sustainability team imply?Being part of the sustainability team implies a complete range of activities. It could involve consultancy services in lowering carbon footprint, water footprint, carbon capture and storage, energy aspects, including renewable etc.

How is water foot print different from carbon footprint?Carbon footprint is a global issue, while water footprint might not be so. Consider an example of advisory services to a beverage company or a brewery company; water footprint would be a local subject here, if the consumption by these industries adversely affects the local community. This is because water may be scarce in that locality, and this affects the life of the people in and around the locality where the industry is situated.

You talked of water footprint. The oil and gas industry too has a lot of water to be disposed off. Typically, this is the other side of the coin. As explained before what we are talking of here is the water scarcity problem that affects the local population. In the instance of the oil and gas industry it is safely disposing of the water. Also, water foot print could include contamination of water. There are some pollution control boards in India that have now opted for consent to operate on the grounds that there will be zero discharge of water.

Could you elaborate on the clean development mechanism (CDM)?To give you an example, in the Middle East, power is generated through the use of natural gas. In India a lot of power is generated with the use of coal. According to the clean development mechanism, if you are taking-up any opportunities

A GREAT POTENTIAL IN SOLARDr Inderjeet Singh,

Senior Manager at

PricewaterhouseCoopers

(PwC) holds a Ph.D in

energy efficiency in buildings

from the Indian Institute of

technology Delhi, and has

been working in the area of

GHG emission reduction,

carbon foot-printing and

emissions trading right

in India. Currently, he

has been associated with

various capacity building

programmes related to

promotion of renewable

energy technologies, efficient

building design and GHG

emission reduction in the oil

and gas sector. Dr Singh talks

to Sunil Fernandes on a range

of subjects from renewable

energy to water foot print

INTERVIEW

which reduces the emission of green-house gases and it is not viable on a stand-alone basis, then such projects will be registered as candidates for CDM. What then happens is that the emission reduction achieved through these initiatives becomes a tradable commodity in the international market.

What is the potential for renewable across the globe and in the Middle East?Germany is the country that is leader in the field of wind power generation. Countries like India do not have wind for the entire year and the potential is in select places. In India eight states were identified, with the state of Tamil Nadu having the maximum wind power generation. With the level of incentives and tax holidays, these projects are competitive. Also, there are no fuel costs with wind energy and there is always an advantage if you have CDM. In countries like Oman, there is a huge potential for Solar energy.

PwC has recently been awarded the first Carbon Capture and Storage project by ONGC, India. Can you give more details?

Recently, PwC has been awarded with the first Carbon Capture and Storage (CCS) project by Oil and Natural Gas Corporation of India. Work on Clean Development Mechanism advisory will commence once CCS is adopted as a CDM activity. CCS has its own set of issues. Presently, what CCS involves is capturing carbon dioxide from the atmosphere and then sealing it. Technology providers are giving assurances that the carbon dioxide pumped into the ground will stay there for

several hundred years. The issue is that there is no certainty and no guarantee that there would be no carbon dioxide leakages. Tests have been done and it is seen that there has been no leakage for the last 10 years. The fact remains that there has to be a political decision to allow CCS to be one of the plausible mechanisms to reduce green house gas emissions. I can assure you that once this happens, the Middle East and North Africa region can see substantial reduction in green house gas emissions, by pumping a lot of carbon dioxide into the ground.

When choosing a location for CCS, as in the case of ONGC, what are the factors involved?ONGC’s CCS project is located at Ankleshwar and geology plays an important role while selecting a location.

Are these CCS projects viable?I do not think it is a question of viability; the pertinent point is first getting the ap-provals in place. There has to be a legis-lation and then investments, benefits and other aspects can well be worked out.

DISTINGUISHED SERVICESPwC has more than 400 sustainability professionals from across 20 different countries working together to provide climate change services to governments and public sector organisations. In the Middle East, and with a dedicated sustainability team, PwC distinguishes itself in its offerings in climate change and carbon management projects that lie in helping organisations comply with environmental, health and safety laws, regulators and corporate policies.

70 July 2010

ECONOMYOLIVER CORNOCK

When the US’s great eastern and western rail networks

were linked in 1869, the final spike was cast out of gold to symbolise the wealth, which the transcontinental railroad would generate for the young country. In Russia, TsarAlexander I commissioned the Trans-Siberian railway to link supplies of raw materials in the east with manufactur-ing centres in the west, gener-ating enough income to fund an empire, which stretched across eleven time zones. The lesson of history, it seems, is that train networks are vital ingredients in a country’s eco-nomic development. Invest-ing in this particular mode of infrastructure lays the rails, so to speak, for volumes of commerce which auto, sea, and air networks would have trouble supporting. Having a rail network is, therefore, a mark of a truly advanced eco-nomic powerhouse.

PAN-GCC NETWORKThis point has not been lost on the GCC member countries. After years of planning, a de-cision was reached in 2004 to develop a pan-GCC rail net-work. The current proposal, unveiled in 2009, calls for a line, which will stretch, some 2000km from Kuwait’s bor-der with Iraq down to Salalah

in the southern tip of Oman. Arabian Business reported early this year that tenders for the estimated $25bn network will be announced in the first quarter of 2010, with con-struction beginning by 2013 and the first commercial use as early as 2017. Trains are to run at up to 180 km/h.

This project will link to a series of rail developments already underway within the GCC. Saudi Arabia is far and away the furthest ahead in the game, with over 1000km of track already operational and two massive projects underway: the North South Rail, an exclusively freight line linking Riyadh to the north of the country, and the East-West rail, also known as the Landbridge, which will link Jeddah to Riyadh and upgrade the existing track onwards to Dammam.

The UAE has also spearheaded rail development with the opening of the region’s first metro, in Dubai, and with the Union Railway, which will link nascent networks throughout the seven Emirates.

Qatar has signed a Memoran-dum of Understanding with Deutsche Bahn, the German state railway company, for a $25bn integrated system of metro, tram, and inter-

city trains, including a 40km causeway linking Bahrain. Only in Kuwait have plans faltered somewhat. While the country is eager to connect to the pan-GCC network, mo-mentum to develop a metro within Kuwait has dropped off significantly after a study in 2008 concluded the project would likely be a loss-maker.

INDUSTRIAL LINKSOman, for its part, has signalled its commitment to the vision of a thoroughly rail-connected GCC with plans for a northern rail network linking the industrial cities and ports of Sohar, Barka, and Khatmat Malahah in the Batinah region. The Sultanate appointed consultants to carry out a feasibility study in April 2008 for a 200km line from Sohar to Barka, but growing enthusiasm for rail projects has led to a rapid widening in scope for the project. Authorities have been exploring the feasibility of adding a branch line in the Dhahirah region, and expanding into the capital.

This is the most complicated part of the project, as a de-tailed study of traffic pat-terns – as they exist, and as they are likely to develop – is needed to assess whether the rail network should continue into the city on the ground

A line for growthWith feasibility studies underway for a nation-wide rail network and a pan-GCC railway, it is only a matter of time before the Sultanate of Oman begins to reap benefits from the railways

The author is Regional Editor,Oxford Business

Group

1

72 July 2010

ECONOMY

level or underground. At the moment, thanks to prudent planning, Muscat does not suffer the legendary traffic seen in many of the rapidly-growing capitals throughout the Gulf. In cities like Doha, heavy industrial vehicles must slog directly through the city centre in some cases, clogging traffic arteries. In the fast-developing emirate of Ras Al Khaimah, a lack of public transport means taxis must sometimes be booked well in advance. The National Engineering Office has part-nered with Systra Consulting, a French rail firm, to produce an exhaustive feasibility study weighing the costs and ben-efits of the system.

They may well come up with surprising results. Given the momentum building behind railway development in the rest of the Gulf, many see Oman’s participation as a foregone conclusion. But while a connection with the pan-GCC network is a good idea, and the proposed Batinah line will do much to ease congestion in the crucial industrial area, it is far from certain that Oman needs a country-wide rail network in the immediate future.

SUPPORT STRUCTUREExisting transport infra-structure in Oman is funda-

mentally different from that of its neighbours. Oman’s relatively large territory – the second biggest in the GCC, after Saudi Arabia – is already criss-crossed with a large road network. Major paved highways link the cities and an efficient and popular bus system is in place, both within the capital and between cities.

Furthermore, the government has injected significant capital into air transport options. The government’s airport operator, Oman Airports Management, plans to award a dozen contracts this year and next to upgrade facilities in Muscat and Salalah, and build four additional

airports along the coast and in the country’s heartland. Additional capacity should bring down the admittedly high cost of airfreight.

This is not to say that a rail network would not benefit Oman. In the words of Hussain Al Nowais, chairman of the UAE’s Union Railway Company, “Rail is safer, faster, cleaner and a more economical mode of transportation.” In particular, Oman’s ports would benefit hugely from the kind of rapid, high-volume, low-cost transport a good rail network could provide.

But this long-term competi-tive advantage in industry will

come with a hefty price tag. Oman’s geography poses chal-lenges that many of its more rail-oriented GCC neighbours do not have to face. Unlike sandy Saudi Arabia, much of Oman – especially its most economically active regions – is rocky and crossed by rivers, requiring bridges and tun-nels. Part of what made Mus-cat such a historically strong city is the fact that it is sur-rounded by mountains, which will provide as much trou-ble to rail engineers as they once provided to prospective invaders.

Much depends on what value Oman decides to put on the development of industry as opposed to other popular sectors like tourism. Tourist traffic, which is often seasonal or hard to predict, is actually more effectively served by automobiles and airplanes than fixed-line trains.

At this point, it is a question of when, not if, Oman will see fit to make a significant investment into rail project development. The economic benefits, especially to industry, are undeniable. But in keeping with Oman’s reputation for cautious development, large-scale investment in rail may be something to expect in the longer term rather than the shorter.

TRAIN NETWORKS ARE VITAL INGREDIENTS IN A COUNTRY’S ECONOMIC DEVELOPMENT AND HAVING A RAIL NETWORK IS, THEREFORE, A MARK OF A TRULY ADVANCED ECONOMIC POWERHOUSE

TRACK CHECK

Pan-GCC rail proposal: 2,000 km from Kuwait’s border to Salalah. Estimated cost: $25bn. First commercial in 2017

Saudi Arabia: 1,000 km of track operational. Two massive projects underway: the North South Rail and the East-West rail

UAE: Region’s first metro in Dubai. Union Railway to link all seven emirates

Qatar: MoU with Deutsche Bahn for a $25bn integrated system of metro, tram and intercity trains

Oman: Northern rail network linking the industrial cities and ports of Sohar, Barka and Khatmat Malahah in Batinah region

74 July 2010

AUTOTALK

DISCOVER THE CHALLENGEDISCOVER THE CHALLENGE

75July 2010

LAND ROVER

Engine: 5 litre V8

Power: 385 bhp

Torque: 520Nm

The previous model in the dis-covery series, the LR3 made great strides in improving the performance and reliability of the Discovery series. When introduced in 2004, it was a

complete redesign of the discovery formu-la that shared practically no components with the previous generation model. De-spite this it retains the key features of the Discovery, such as the stepped roofline and steeply-raked windscreen.

At first glance the new model, the LR4, doesn’t seem to have changed much in comparison to the previous model aside from the slightly altered headlights, tail lights, grille and bumper. But eyes can be deceiving since most of the changes are under the skin. The new model is not so much a revolutionary redesign but rather

an evolution of an already impressive ve-hicle. Land Rover has done with the LR3, what Volkswagen has done with the new Gti, which is to hone the performance of the existing model to perfection rather than completely redesign it.

More muscleFor starters the there is the all new en-gine from Jaguar, a five litre V8 beast that produces 385 bhp and 520 Nm of torque. With so much power and torque under the bonnet it comes as no surprise that the LR4 will be a lot quicker in a straight line than it looks. But what is truly impressive is the way in which it handles bends. While it may not be as agile as some other mod-els in the same class, it is definitely well planted and deceptively quick through bends. And if that wasn’t enough, once at cruising speed there is some wind noise

THE LAND ROVER DISCOVERY IS CURRENTLY IN ITS FOURTH GENERATION AND IT IS LOOKING BETTER THAN EVER. AN OER REPORT

produced by the large mirrors but aside from that the cabin is nearly as quiet as some of the best premium luxury sedans in the market today. Even the suspensions do a great job of soaking up all manner of poor road surfaces keeping you com-fortable and relaxed, regardless of the trip. Once you enter the rough stuff, the LR4 is head and shoulders above the rest. Its Terrain Response system makes it almost criminally easy to look like an off-road king. All you have to do is set the suspen-sion height, choose the type of terrain that you want to traverse on the dial and off you go. Yes! It is actually that simple.

Inside the cabin, even after a slight rede-sign, it still feels like a Discovery, albeit in a much more refined guise. And few ve-hicles can provide you with such gener-ous seat articulation or such a command-ing view of the road ahead. If you in the mood for transporting a large number of people or a tonne of camping gear? No problem at all. The LR4 is easily one of the most spacious vehicles in its class, pro-viding ample seating space for upto seven people or the seats can be folded flat to increase cargo space. The boot even fea-tures a useful split-opening tailgate.

As far as equipment and safety is con-cerned, you need not worry at all since even the basic model comes equipped with nearly all the important features, in-cluding nearly all the safety equipment and the ‘all too important’ Terrain Re-sponse System. So, while the basic ve-hicle is more than capable of meeting your needs, you will never regret spending more to option it up. Because all money spent on such a fine vehicle only serves to make it even better, so how can you pos-sibly go wrong?

76 July 201076

Kia’s new 2011 Sportage SUV was formally launched in Oman recently. Speaking on the occasion, Y K Park, president, Kia Motors Corporation, Middle East and Africa said, “In the recent past, Kia has moved into overdrive with the launch of many new and interesting products. All these models have done exceedingly well, won positive recognitions for design, quality and customer satisfaction across the globe.” Tarun Singhal, general manager, Reliable

International Automotive, remarked, “I would like to mention the economic recession has forced several car manufacturers to defer, delay or even cancel the launch of new models. Kia in contrast continues to launch several models each year. Two models, the Cadenza and Koup, have already been launched this year. The Sportage will be the third and there are more to follow. Kia continues to move from strength to strength truly showing its power to surprise.”

Third Generation Kia Sportage launched

The spacious Nissan TIIDAIf you guess the number of footballs inside the 2011 Nissan Tiida on display at either the Nissan showroom at Qurum, or the enticing new Tiida at the Muscat City Center, you have a good chance to win a 40” LCD TV! Draws will be held once every fortnight. Suhail Bahwan Automobiles (SBA), the sole importers of all Nissan vehicles into Oman, have added the excitement of FIFA Fever to the unveiling of the

simply-gorgeous new Nissan Tiida 2011 model. Winning at football is an intriguing combination of art and power. The all-new 1.8L 2011 Nissan Tiida is very much an awesome combination of great looks and power! The 2011 Nissan Tiida comes with a compact and lightweight 1.8-litre engine that has the ability to generate as much as 135 HP at 5200 RPM, with a gross torque of 19.0 kg-m at 4,800rpm

Mercedes-Benz SLS AMG supercar in OmanThe Mercedes-Benz SLS AMG Gullwing supercar that pays homage to the legen-dary Mercedes-Benz 300 SL that was first seen at the New York Motor Show in 1954, is now available in Oman. The new Mercedes-Benz SLS AMG was launched during an exclusive event held at the Shangri-La’s Barr Al Jissah Resort & Spa recently. The function was inaugurated by Waleed bin Omar Zawawi, deputy chairman of Zawawi Trading Co. “The car was designed from scratch, which means the SLS AMG is not

based on any other Mer-cedes-Benz vehicle platform. And, anyone who truly wants to understand AMG and what lies at the heart of our performance brand has to drive the Mercedes-Benz SLS AMG” said Frank Bernthaler, director sales and market-ing Mercedes-Benz Cars, Daimler Middle East. “This highly desirable interpretation of one of the world’s great-est sports cars will certainly become a classic in its own right,” said Adarsh Taneja, acting GM, passenger car sales, Zawawi Trading Co.

Renault’s new branch in Ibra showcases modelsOfficials from various ministries and the office of the Wali of Ibra turned out in large numbers for a grand showcasing of popular Renault models at the new Suhail Bahwan Automobiles (SBA) Renault –Nissan showroom in Ibra. On display were the immensely-popular Renault Logan and the Safrane. The deputy wali of Sur, Khalifa Salaleh Salim Al Busaidi, inaugurated the show. A Renault–Nissan Alliance

audio-visual presentation highlighted the advanced technology available in the group. Various models of cars and SUVs under the Renault-Nissan Alliance are available at over 15 centres throughout Oman. Unveiling the Renault Safrane before a gathering of nearly 200 people, Khalifa said the people of the Ibra – Sharqiya region would be very happy to experience an exquisite feature-laden car like the Safrane.

77July 201077

Zubair Automotive scores on serviceContinuing their commitment to “Delivering an outstanding Customer Experience –The Zubair Way,” the Zubair Automotive Group has just achieved an important milestone of 90 per cent of the 4,000 customers surveyed in April awarded their recent experience as a ‘Good’ experience.

After the launch of the new customer relations centre (CRC) in November 2009, the new operation has grown from strength to strength. The CRC team has been work-ing hard to achieve excellent standards of service, meeting daily targets with all customer enquiries. Some of the targets met included a minimum of 85 per cent of the calls being answered within 15 seconds

whilst ensuring customers are not being left on hold for more than 20 seconds. Cus-tomers also receive a 48 hour courtesy call where they can provide full feedback on their recent after sales or sales experience. One of the high-est areas scored included the quality of the car wash and vacuum provided after each service. “The increase in this particular area is very impor-tant to us, over the last few months our customers have commented that we need to improve regarding the quality of our car washing. Taking this feedback into account we discussed the feedback with our car washing team and agreed on an improve-ment plan,” said Matthew D’Emanuele, head of quality and customer experience

Amazing features, great valueSuzuki, in Oman, has a history of offering ‘Value for Money’ to their valued customers. This tradition is being taken forward by SX4 Sedan and SX4 intelligent all-wheel drive (i-4WD). The SX4 Sedan comes with the option of two power trains, the 1600cc with 111 horsepower on two variants, the GLX & GLX ‘Special’ models and the 2000cc, 160 horsepower. The 2000cc model, now available starting from RO4995, comes

with alloy wheels and fog lamps as standard features in addition to many other details. The emphasis on safety is highlighted by antilock brake system (ABS), electronic brake distribution (EBD) with front dual airbags as standard options on all models of Suzuki SX4 Sedan. These models further boast of having the widest tyres in its class providing better stability and road handling that increases safety.

100 points free checkup at TACMazda has always encour-aged its customers to main-tain their vehicles with regular checkups and this latest offer-ing from Towell Auto Centre (TAC), the official distributors of Mazda in Oman, is surely not to be missed. Under this scheme, TAC has announced the start of their ‘100 points free checkup with a chance to win 100 fabulous prizes!’ The 100 points free checkup is being conducted at TAC’s various service centres across

the Sultanate. On spending a minimum of RO20, one can get guaranteed redemption and raffle coupons too. “Cus-tomer service at Mazda does not end once the car is sold to the customer. We are con-stantly bettering and upgrad-ing our after sales services. This offer too, is a means to ensure that our customers are better served even after the sale of the vehicle”, says R. Sarvanan, national manager - service, Towell Auto Centre.

Luxury has a new name

Porsche Centre Oman, Sata, has unveiled the long awaited second generation Porsche Cayenne. As a premiere for the Porsche brand, the model is offered as a hybrid version, the Cayenne S Hybrid. A highly sophisticated parallel full hybrid drive ensures fuel consumption of just 8.2 litres/100 kilometres with CO2 emissions of just 193 g/km. The Cayenne S Hybrid combines the performance of an eight-cylinder with the economy of a six-cylinder

running on much less fuel. Based on the manufacturer’s principle of “Porsche Intelligent Performance”, all Cayenne vehicles offer more power on less fuel, greater efficiency and lower CO2 emissions. Compared with the former generation, fuel consumption is down by up to 23 per cent making the new models trendsetters in their respective segments. These objectives result from the introduction of the new Tiptronic S eight-speed automatic transmission.

78 July 2010

PERISCOPE

Crude oil, Saudi Arabia and RussiaRussia’s return to the international capital markets and Saudi Arabia’s spectacular development story are worth putting your money where your mouth is

BY MATEIN KHALID

The onset of risk aversion has a traumatic impact on crude oil prices. After

trading in a narrow $80-87 range for three months, crude oil prices lost almost a fifth in May, falling as low as $70 before the risk on trade that followed China’s stellar 50 per cent year-on-year growth export data lifted the black gold to the $74-76 range.

Oil’s brutal fall from grace vindicates the assertion of the Saudi Petroleum Minister that stratospheric prices above $85 resulted from speculative funds that dominate the London and New York futures exchange, where the marginal price of West Texas Intermediate and North Sea Brent market sweet crude is daily set by the leveraged gladiators in the NYMEX and ICE pits.

So investor’s psychology, Wall Street’s mood swings and the economics of margin calls, not physical supply and demand fundamentals, set the stage for the rampage of the oil bears.

Broken quota disciplineYet, I would definitely cau-tion against going long on

crude oil above $80. OPEC compliance to its supply cuts is a mere 51 per cent, mean-ing quota discipline has bro-ken down. Iraq and Angola, let alone Russia and Mexico, have begun to boost their production volumes. Sum-mer seasonals argue against higher oil and gas prices. Glo-bal spare capacity has risen to six million barrels, mainly in Saudi Arabia and Ali Naimi has ruled out any additional cuts in the Kingdom’s produc-tion at a time when Riyadh, Kuwait and Abu Dhabi, suf-fer most from the impact of OPEC quota violations.

The IEA (International Energy Agency) has cut estimates of global demand, US oil inventories are bloated and Chinese industrial production data has softened. This means the next wave of sovereign risk aversion could hit oil prices by another $10-15 dollars, meaning it is entirely possible that crude oil bottoms at $65 this summer.

Undervalued but attractiveSaudi Arabia and Russia are the planet’s two energy superpowers. They are also two of the most undervalued financial markets in the world.

Two attractive petrocurrency investment themes are Russian equities/sovereign debt and Saudi Arabian (non-bank) shares, ideally when crude oil trades in the $60-65 range.

Russia’s return to the international capital markets since the 1998 Yeltsin default is an event of seminal significance. In late April, just as the market fireworks began, the Kremlin raised $5.5bn in a dual tranche sovereign Eurobond with five and ten year maturity. Finally, Russia has a credible sovereign debt yield curve and a liquid, benchmark new issue. I was amazed that the world’s smart money investors bought Russian sovereign risk at a mere 125 points over US Treasury five years (135 basis points over ten year Uncle Sam paper for the ten year tranche), incredibly cheap pricing since the Russian Federation’s sovereign debt rating is a mere BBB.

Greek repercussionNaturally, the bonds sank in the secondary markets, despite the best efforts of deal lead managers Barcap, Citi, VTB Capital and Credit Suisse, though the Greek debacle

The author is a renowned investment

banker based in Dubai

80 July 2010

PERISCOPE

TWO ATTRACTIVE PETROCURRENCY INVESTMENT THEMES ARE RUSSIAN EQUITIES AND SOVEREIGN DEBT AND SAUDI ARABIAN NON-BANK SHARES, IDEALLY WHEN CRUDE OIL TRADES IN THE $60-65 RANGE

repriced emerging markets debt risk worldwide. Yet the Russian Eurobond proves beyond a shadow of doubt that the world’s perceptions of emerging markets risk has changed beyond recognition in the last three months.

We live in a world where Russian debt trades cheaper than Italian, Spanish, Portuguese and Irish government debt. Meanwhile, Russian equities trade at a mere eight times earnings, a huge discount to the Morgan Stanley emerging markets indices at a time when GDP growth is accelerating, $75bn of corporate debt has been refinanced, the rouble is undervalued, the Kremlin has cracked down on corruption and backed judicial reform, even promoted Moscow as a capital markets hub. Russian debt has been rerated in the global capital markets. Russian equities will be next.

Mauled marketSaudi Arabia’s seven-year bull market was as long as it was spectacular, with the Tadawul index rising sixfold to 21,000 by early 2006. However, the Saudi stock market has been mauled by the grizzlies in

the past month, trading in a 6000 – 7000 range. While oil prices have fallen, the col-lapse of the Euro also means inflation rates will fall even as private bank credit growth revives and the kingdom’s epic $400bn infrastructure spending programme boosts

economic growth. Saudi eq-uities are reasonaßbly valued at 12 time earnings and twice book value, a fraction of bub-ble valuations four years ago. Saudi Arabia is the world’s largest oil producer, the OPEC central bank of black gold, the largest consumer

market and economy in the Middle East.

Comforting factorsThe Saudi population exceeds 25 million and boasts one of the lowest median ages in the world. This means investors in Saudi consumer shares face the most attractive secular growth story in the Middle East – telecoms, insurance, mortgages, consumer credit, and home appliances.

King Abdullah’s reforms, the six mega economic cities, a surge in FDI, new multibillion dollar downstream petroleum projects, the least leveraged banking system in the Gulf (a mere 70 per cent loan-deposit ratio) are reasons why someone should be bullish about Saudi Arabia. Further, the world’s lowest cost oil reserves, the opening of local capital markets to foreign investors are some of the other reasons I am bullish about Saudi Arabian equities in the next two years.

In fact, I believe the Tadawul index could well rise to 10,000 in the next two years, still half its bubble peak in 2006. The Tadawul is a buy anywhere in the 6000 – 6300 range.

WATCH OUT FOR ENERGY SUPERPOWERS

RUSSIAIn late April, just as the market fireworks began, the Kremlin raised $5.5bn in a dual tranche sover-eign Eurobond with five and ten year maturity

We live in a world where Russian debt trades cheaper than Italian, Span-ish, Portuguese and Irish government debt

Russian Eurobond proves beyond a shadow of a doubt that the world’s perceptions of emerging markets risk has changed beyond recognition

The Kremlin has cracked down on corruption and even promoted Moscow as a capital markets hub

SAUDI ARABIAAn epic $400bn infrastructure spending programme boosts economic growth

Equities are reasonably valued at 12 time earnings and twice their book value

Population exceeds 25 million with one of the lowest median ages in the world, meaning it is a secular growth story

Six mega economic cities, a surge in FDI, new multi-billion dollar downstream petroleum projects, the least leveraged banking system in the Gulf are strongpoints

INDUSTRY

Al Maha Ceramic Tiles Company is amongst the first tile manufacturers in the Sultanate of Oman to have a state-of-art fully

automated plant in the Sohar Industrial Area. The plant commenced production of international quality wall and floor tiles from April 2008.

Using only locally available raw materials blended expertly with unique formulas, Al Maha manufactures an endless variety of world-class tiles for low traffic, medium traffic and high usage areas. The range has an impressive choice of glazed wall and floor tiles in a variety of designs and shades to suit every decor. A fully equipped firing plant manufactures wall border tiles as well. The sizes currently available by popular demand are of 45X45cm, 30X30cm, 30X45cms. Large format tiles are an Al Maha specialty.

Latest technologyAl Maha has cutting-edge technology for high-quality ceramics tiles manufacturing. The plant is fully integrated and has been built in technical collaboration with a leading international conglomerate. A team of experts from different countries supporting the production centre has enabled Al Maha to be among the key tile brands to offer international standards in tile manufacturing. Today, Al Maha is the only brand in the world that has large format tiles in its range. That apart, the roller print system offers customers the finest-finished tiles, good to complement any décor.

The entire range of Al Maha tiles is guaranteed for superior quality in terms of perfect uniformity of size, finish, endurance, dimension, colour and designs. This commitment has redefined the image and position of Oman origin products in quality-sensitive markets all over the world.

Al Maha Ceramics rolls out world-class quality tilesWith new technology and state-of-the-art processes, Al Maha Ceramics has plans to change the face of the tiles business in the country

In a short span of time since its inception, Al Maha Ceramics has established a sound reputation in many markets through its policy of continuous improvements. As a brand, Al Maha’s ceramic tiles are one of the largest selling ceramic tiles in Oman. That apart, Al Maha Ceramics presently exports to Saudi Arabia, UAE, Jordan, Lebanon, Qatar, Bahrain, Iraq and Yemen. Plans for other markets are being drawn up. Says Arvind Bindra, CEO of Al Maha Ceramic Tiles Company, “The rev-up has

commenced; a new management team is in place, and there are ambitious plans to expand both the product line and the markets that we will cater to. It’s a bit early to give insights into specifics. All I can say is that the management team is seized with placing Al Maha high in the minds of tile buyers anywhere in the world. We have the infrastructure, the penchant about quality, and the financial muscle to invest prudently in avenues that will systematically edge the Al Maha equity upwards.”

81July 2010

82 July 2010

Samsung Electronics, the award-winning innovator in consumer electronics, is seeking to consolidate its position as the market leader

through its new line-up of 3D TVs in the Sultanate of Oman. The 3D LED TVs 8000, 7000 and 6000 series mark a new dimension in TV entertainment. It had earlier launched LED, LCD and PDP models.

Samsung 8000 LED TVs come fully equipped with the latest 3D HyperReal Engine and Clear Motion Rate technology, allowing users to enjoy the 3D contents in a more three dimensional and realistic way. An impressive ‘movie-style’ launch ceremony was held in May to present the full range of Samsung 3D LED TV Series.

“SARCO is pleased to bring this new-age 3D revolution for the viewing pleasure of the people of Oman. We believe that this breakthrough product is going to create a revolution in home TV viewing experience by bringing what was until now a strictly select theatre viewing experience right into the homes of people,” says Ajay Ganti, CEO, SARCO, the Oman partner for Samsung.

Ram Modak, general manager, Digital Media Business, Samsung Gulf Electronics says that in the history of television there have been many improvements. The first was black and white TV. Then came colour, stylish designs and bigger screens. Now the next breakthrough is the introduction of the

CONSUMERDURABLES

SAMSUNG CONSOLIDATES POSITION WITH 3D TVSThe ability of Samsung TVs to convert from 2D to 3D brings a new dimension of

home entertainment to the living room

revolutionary Samsung 3D TV line-up. “Since its introduction at CES earlier this year, 3D has been regarded as the next big thing in TV, and as always, Samsung is in the forefront of bringing the vision to life. As of now, consumers in the Sultanate of Oman will be able to enjoy 3D entertainment in their own living room,” adds Modak.

3D contentA user-friendly feature to Samsung 3D TV technology in the Middle East is the 3D conversion to create a deeper, more realistic 3D experience. Moreover, with 3D content played back on a 3D-enabled Blu-ray disc player, the Samsung 3D TV detects 3D input signals, which generate superior stereoscopic images.

With a combination of hardware and software, Samsung 3D TVs are able to convert the 2D content in real time that are translated by the glasses as a 3D image. Samsung is the first and only to offer the 2D to 3D conversion for the 3D TVs. The 2D to 3D conversion features are the first of its kind in the Middle East line-up.

“Samsung has been the leading company in the global TV market for four straight years, and we remain committed to leading the market by deploying new categories of entertainment like Full HD 3D LED TVs, on which consumers around the world will be able to enjoy their favourite content,” said Modak.

Samsung officials at the launch function

84 July 2010

Oil prices leave their imprints clearly on the fortunes of regional economies and puts the GCC in the ranks of top GDPs of the world

GCC’s mighty economic size

DR JASIM HUSAIN ALI

The author is an eminent economist

and Member of Parliament, Bahrain

([email protected])

The Combined gross national product (GDP) of Gulf Cooperation Council

(GCC) is projected to cross the trillion dollars level in 2010. This marks only the second time that the monetary value of economic activities of the GCC has crossed the trillion-dollar level, and helps putting its GDP within an exclusive club of nations.

A report by the International Monetary Agency projects nominal GDP of Saudi Arabia, the UAE, Qatar, Kuwait, Oman and Bahrain amounting to $1.021trn in 2010 and increasing further to $1.118trn in 2011. According to the same report, GDP of GCC countries amounted to $1.076trn in 2008, but dropped to $869bn in 2009 reflecting changes in oil prices. Right or wrong, the oil sector is uniquely significant to GCC economies by virtue of comprising nearly three quarters of each of treasury revenues and exports as well as one third of the GDP. Hence, oil prices leave their imprints clearly on the fortunes of regional economies.

Oil economies More specifically, nominal GDP of Saudi Arabia alone dropped by more than 20 per cent in 2009 to $375 billion

due to unfavourable conditions in oil market. Needless to say, Saudi Arabia is the world’s largest exporter of oil, and thus changes in oil prices no matter how small affect the country’s level of income and spending and thereby value of economic activity.

To much of their credit, Saudi authorities openly admitted plunge of GDP while releasing closing accounts of fiscal year 2009. In reality, Saudi Arabia’s economy accounts for a hefty 40 per cent of GDP of GCC, and thus has a material effect on value of regional economies. According to World Bank statistics, Saudi Arabia’s GDP ranks number 23 worldwide, ahead of numerous European countries including Norway, Austria and Finland.

Changing GDP value reflects improving conditions of GCC economies, in turn caused by firm oil prices in the international market. The petroleum sector is uniquely vital in GCC economies by virtue of accounting for more than two thirds of treasury income and three quarters of exports. In retrospect, oil prices reached a record $147 per barrel in July 2008 only to hover around $40 per barrel in the first quarter

of 2009. Sharp drop in oil prices occurred as a reaction to the global financial crisis, which amongst others caused confidence problems.

However, firm oil prices have since increased and remained strong as a sign of improving global economic prospects thanks to G-20 initiatives. Measures undertaken by G-20 include pumping money into local economies in order to generate demand and help raising oil prices.

Qatar leadsIMF projects GCC economies growing by 4.9 per cent in 2010 and rising to 5.2 per cent in 2011. Still, GCC economies grow merely by 0.8 per cent in 2009 on the back of turmoil in oil markets. This was particularly true in the first quarter of 2009 reflecting reactions to the global financial crisis.

Surprisingly, the IMF mainly attributes improved economic prospects in GCC economies to the outstanding growth level of Qatari economy. The Qatari GDP is projected to grow by 18.5 per cent in 2010 and 14.3 per cent in 2011. Undoubtedly, this is an exceptional achieve-ment, reminiscent to perform-ance of few economies like those of China and India.

85July 2010

CHANGING GDP VALUE REFLECTS IMPROVING

CONDITIONS OF GCC ECONOMIES, IN TURN CAUSED

BY FIRM OIL PRICES IN THE INTERNATIONAL MARKET

CLOSE UP

Amongst other things, the ex-traordinary development of Qatari economy is testimony of the sustained expansion of gas sector. In fact, Qatar con-tinues to consolidate its posi-tion as the largest exporter of liquefied natural gas (LNG). Latest available statistics put output at 54 million tonnes, up from 38 million tonnes a year only three years ago. Yet, nonstop efforts are being exerted to reach the goal of producing 77 million tonnes a year of LNG by 2012.

Abundant resourcesTogether, GCC economies comprise around 1.5 per cent of total GDP in the world. In effect, this means value of GDP of some 15 countries is independently more than that of GCC’s GDP. These countries include the US, Japan, China, Germany, France, Italy, the UK, Brazil and India. At more than $14trn, American GDP is undisputedly the largest in the world. As such, value of GCC economies combined accounts for merely seven per cent that of the US.

Yet, notwithstanding the limited size of GCC’s GDP in relation to other global economies, GCC states are particularly noted for controlling substantial oil and gas statistics. Together, GCC

in the world. Clearly, GCC states are offering significant resources to the world notably oil and gas, in turn essential for sustaining modern day living. Airplanes, vehicles and a significant number of machineries operate on petroleum products.

Economic diversificationStill, GCC authorities are required to use oil proceeds to diversify their economies away from the petroleum sector such as industrial development and thus addressing another challenge, namely creating employment opportunities for locals. GCC countries are noted for relatively high population growth rates, around 34 per cent altogether, which translates into entrants of new job seekers in big numbers.

In turn, economic diversifica-tion should help GCC econo-mies shield themselves in times of turbulences in oil markets, which occur every now and then, and cannot be ruled out in the future. As mentioned earlier, oil pric-es reached as high as $147 per barrel in July 2008 yet dropped sharply on the back of the global financial crisis, which caused uncertainties in directions of economies worldwide.

countries account for 23 per cent of global oil production. Saudi Arabia is both the largest producer and exporter of oil in the world.

Still, GCC states account for 41 per cent of proven oil reserves in the world. Again, Saudi Arabia alone accounts for 21 per

cent of proven oil reserves. At the same time, GCC countries hold for 23 per cent of proven gas reserves in the world. Qatar ranks number three in the world amongst countries with largest gas reserves after Russia and Iran. As in the case of Saudi Arabia in oil, Qatar is the largest exporter of gas

MONEY MATTERS

GDP

Nominal GDP of GCC countries: $1.021trn (2010)

Saudi Arabia GDP ranks number 23 worldwide

Qatari GDP to grow by 18.5 per cent in 2010 and 14.3 per cent in 2011

GCC ECONOMIES

To grow 4.9 per cent in 2010 and 5.2 per cent in 2011

Comprise around 1.5 per cent of total GDP in the world

OIL & GAS

GCC countries account for 23 per cent of global oil production

GCC states account for 41 per cent of proven oil reserves in the world

Saudi Arabia is both the largest producer and exporter of oil in the world and accounts for 21 per cent of proven oil reserves

GCC countries hold for 23 per cent of proven gas reserves in the world

Qatar ranks number three in the world amongst countries with largest gas reserves after Russia and Iran and is the largest exporter of gas in the world

86 July 2010

Oxygen wins award for Haya Water’s campaignAfter winning a Silver Award last year, Oxygen, the advertising agency, has now won another Summit International Silver Award, this time in the Green Marketing Category for its client Haya Water. This year’s Summit International Creative Awards, recognised worldwide as the industry’s most coveted awards, drew over 5000 entries from 24 countries in the Creative Competition in different categories. With Haya Water, the challenge was to create awareness and correct the perceptions in the minds of people about Haya Water’s activities and to let them know about the great efforts being made by the company for the benefit of the Muscat governorate.

Keeping up with their reputation of being a socially responsible bank, ahlibank is participating in Save Energy Oman, a campaign aimed at saving 10 per cent of the electricity consumption during the summer months. During these months, ahlibank will run the air conditioning system at a temperature of 23 degrees centigrade. Commenting on this Abdul Aziz Al Balushi,

CEO, ahlibank said, “ahlibank has always given paramount importance towards corporate social responsibility. We extend our services not only to our valuable customers but also to the society as a whole. Save Energy Oman is an initiative directed towards preserving the environment and we are particularly delighted in being a part of this”.

ahlibank participates in Save Energy Oman BankMuscat has achieved a rare

distinction, becoming the first and only corporate entity from Oman to be listed in ‘The Forbes Global 2000’ featuring the biggest and most powerful listed companies of the world. The prestigious ranking of the corporate titans of the world places the leading financial services provider in the Sultanate in a league of its own. AbdulRazak Ali Issa, chief executive, says: “BankMuscat is immensely proud to be ranked among the world’s

top corporates. The recognition is all the more creditable as this is the first time an Omani corporate is making it to the ‘Forbes Global 2000’. The bank is the recipient of almost all the prestigious foreign, regional and local awards. ‘The Forbes Global 2000’ ranking, however, takes the bank notches above to an unrivalled position in Oman as well as the region. The recognition clearly focuses on the global best practices pursued by the bank.”

Rare honour as BankMuscat enters ‘Forbes Global 2000’

The Public Establishment for Industrial Estates conducted a series of seminars set for Oman indus-trialists in 2010 entitled ‘Oman: A Manufacturing Haven’. The seminar discussed the most important topics related to the industry of Oman. It began with the challenges faced by the local industry and the successes achieved. Speakers covered several

sectors in this area such as finance, industry and investment promotion. This seminar is supposed to achieve the desired results, which are the un-derlying study of the current situation of the industrial sector in the Sultan-ate and its development through the display of proposals in this regard. It will also highlight the success stories of the local industries.

Oman: A manufacturing haven

Mistal, the designer watch boutique known for its exclusive clientele added Ranbir Kapoor, Katrina Kaif and Sarah Thompson, three of Indian cinema’s most loved superstars, to its list of admirers. Mistal sponsored a special event where an Omega Men’s Double Eagle Constellation fetched RO10,000, in an auction, the proceeds of which went to charity. The Omega box signed by all the stars who visited Mistal was auctioned by Arjun Rampal and Ranbir Kapoor and was picked up

by a lady admirer in the audience. In town for a special screening of Prakash Jha’s political drama “Raajneeti”, the stars, known for their immaculate taste, put in their efforts towards raising funds towards charity. The funds raised from the gala dinner and special screening will go to Dar al-Atta, an Indian school in Jalan, as well as director Prakash Jha’s NGO Anubhuti, which is working towards building a 1200-bed hospital in the northern Indian state of Bihar.

Raajneeti filmstars at Mistal

87July 2010

LG unveils world’s first Full LED 3D TV

Oman Air, the national carrier of Oman celebrated its recently launched flights to Lahore and Islamabad with gala events hosted by the management of Oman Air. In Islamabad, the occasion was held at Serena Hotel, whereas in Lahore, the Pearl Continental hotel hosted the function. A large number of Arab diplomats and the elite of both the destinations attended the dinner

cocktail functions. Leaders of the travel and aviation industries were present too. Commenting on the launch of operations, Peter Hill, Oman Air’s CEO said, “I am very pleased to finally be able to open this route officially. Lahore and Islamabad represents our 36th and 37th destinations respectively, and Oman Air’s second and third destination in Pakistan, after Karachi.”

Oman Air celebrates flights to Pakistan

BankDhofar bags ‘Euromoney’ award

LG Electronics (LG), a global leader and technology innovator in the flat panel display and audio-video devices market, announced today the launch of the LX9500, the world’s first Full LED 3D TV. Delivering a picture of outstanding clarity and brightness on LF’s innovative Infinia design, the LX9500, a two time award winner at this year’s CES and

a winner of the reddot design award 2010, introduces an entirely new world of 3D TV viewing. Thanks to its superb picture quality, the LX9500 offers a 3D experience unlike any other, where instead of just watching scenes, you can actually be part of them, says V R Dilip, CEO, OTE group of companies, the exclusive distributor of LG TVs in Oman.

BankDhofar has been named “Best Bank in Oman” by pre-eminent international finance magazine Eurom-oney. The awards were presented at the 2010 Euromoney Middle East Awards for Excellence in Beirut, attended by top banking executives from the Middle East. In recognising BankDhofar for the award of “Best Bank in Oman”, Euromoney editor Clive Horwood highlighted BankDhofar’s “impres-

sively consistent profit growth and the increased size of its loan book. There are also signs that this suc-cess is allowing the bank to expand more rapidly”.

The Indian Embassy and Art Select gave leading male and female artists from India and the Middle East an opportunity to express the strength of their gender through paintings in ‘At Eye Level’, a themed exhibition held at the Indian Embassy auditorium. Seventeen

artists from the Middle East, Indian subcontinent and Russia showcased their art, communicating their individual and combined qualities to viewers, addressing a variety of themes where gender is pertinent, such as society, culture, politics and religion.

‘At Eye Level’ art exhibition held

The National Bank of Oman (NBO) opened more branches and ATMs than any other bank in the country in 2009. In the recent past, more than 10 branches and 33 ATMs and Cash Deposit Machines (CDMs), have been opened. NBO’s ATM footprint has grown by 37 ATMs covering key locations across the Sultanate.

In addition, to its ongoing branch and ATM expansion, the bank also witnessed refurbishment of its branches offering ‘high standard’ ‘quality look’. The ‘Q-Matic’ System has also been introduced in major branches, to handle customers in a more organised and systematic way.

NBO expands branch, ATM network

Panasonic launched its new range of Lumix digital cameras and full-HD camcorders for the Oman mar-ket featuring the unique Panasonic technology. The features of the Lumix cameras included Intelligent Resolution Technology, power OIS (Optical Image Stabiliser), High Definition video recording, and GPS

technology backed up with the high quality Leica lens, the new sophis-ticated and stylish Lumix range is suitable to every level of photog-rapher. The semi-professional and Full-HD camcorders in the market feature a Full HD 1080 progressive recording and easy-to-use LCD touch screen interface.

Panasonic’s new range of cameras, camcorders

88 July 2010

Ian Baker-Finch turned pro in 1979, and won the first of his 16 championships in 1983 at the New Zealand Open in Auckland. His first major victory in Australia

came at the 1987 Australian Matchplay Championship at Kingston Heath. This was followed in 1988 by a stunning playoff win in the Australian Masters where he knocked a five iron within a metre of the cup on the first playoff hole to beat Craig Parry and Roger Mackay. He has a host of Australasian PGA Tour victories most notably the 1990 Coolum Classic, 1992 Vines Classic and the Open titles of Victoria, New South Wales and Western Australia.

Among his credits he has won tourna-ments on all four major tours, including the 1989 Colonial Invitational (USA), the 1988 ASO Open (Japan), the 1985 Scan-danavian Open, and the 1993 Australian PGA. But Baker-Finch’s moment of glory came in 1991 when he won the British Open at Royal Birkdale Golf Club. His fi-nal round 66 was one of the greatest ever in major championship golf and included an outward nine of 29 where he birdied five of his first seven holes. His final 36 hole total (64-66) is the best ever by an Open Champion.

Downhill drive Baker-Finch then famously suffered a complete collapse of his game. The prob-lems were often psychological, he would hit shots flawlessly on the practice range, and then go to the first tee and hit a weak drive into the wrong fairway. In the 1995 Open Championship at St Andrews, he notoriously hooked his first round tee-shot at the first out-of-bounds on the left side of the fairway shared with the 18th, with attention focused on him as his play-

STUNNING PLAYA childhood prodigy, Ian Baker Finch went

onto achieve great heights before he hit a

sudden slump in his game

GOLFUPDATE

ing partner was Arnold Palmer, compet-ing in his final Open. In 1995 and 1996 he missed the cut, withdrew after one round, or was disqualified in all twenty nine PGA Tour events that he entered. After shoot-ing a 92 in the first round of the 1997 Brit-ish Open, an extraordinarily bad score by tournament professional standards, he withdrew from the championship and re-tired from tournament golf.

After his game deserted him, Baker-Finch turned his interests to careers in broadcasting; and in golf course design and management. He was hired by ABC Sports to commentate on golf tournaments in 1998, and did so until 2006, when he was hired by CBS Sports. On broadcasts he is often known by the nickname “Finchy”. Reporting for CBS at the 2007 The Barclays tournament, Baker-Finch was one of the thousands gathered around the 18th green as Rich Beem hit his approach shot. The errant shot hit straight on Baker-Finch’s cheek and knocked him out behind the green. Baker-Finch recovered before Beem got to his ball.

His course design work includes the impressive Golf Club at Kennedy Bay regarded by some as Australia’s most authentic links golf experience. He recently bought a share in The Greg Norman designed Glades golf course on the Gold Coast and will be managing the course with the help of Troon Golf. In January 2008, he joined Gary Player Design as an international brand ambassador and golf course designer.

OFFICIAL TOUR VICTORIES 1983: New Zealand Open

1984: WA Open

1984: NSW Open

1985: Queensland PGA

1985: Victorian Open

1985: Scandanavian Open

1987: Australian Match Play

1987: Polaroid Cup (Japan)

1988: Australian Masters

1988: Pocari Sweat (Japan)

1988: ASO Open (Japan)

1989: Colonial Invitational (US)

1990: Coolum Classic

1991: The Open Championship

1992: Vines Classic

1993: Australian PGA Championship

Malcolm Glad-well’s new book, What the Dog Saw presents

nineteen brilliantly researched and provocative essays that exhibit the curiosity his read-ers love, each with a grace-ful narrative that leads to a thought-provoking analysis. The explorations here delve into subjects as varied as why some people choke while oth-ers panic; how changes meant to make a situation safer — like childproof lids on medi-cine — don’t help because people often compensate with more reckless behaviour; and the idea that genius is inextri-cably tied up with precocity.

“You don’t start at the top if you want to find the story. You start in the middle, because it’s the people in the middle who do the actual work in the world,” writes Gladwell in the preface to What the Dog Saw. In each piece, he offers a glimpse into the minds of a startling array of fascinating characters. “We want to know what it feels like to be a doctor,” he insists, rather than what doctors do every day, because “Curiosity about the interior life of other people’s day-to-day work is one of the most fundamental of human impulses.” Like no other writer today, Gladwell satisfies this impulse brilliantly, energising and challenging his readers.

Structured approach What the Dog Saw is organised thematically into three categories: part one contains stories about what Gladwell calls “minor geniuses,” people like Ron Popeil, the pitchman who by himself conceived, created, and sold the Showtime

TREATISE IN SOCIAL PSYCHOLOGY

THE AUTHOR OF THE TIPPING POINT, BLINK AND THE OUTLIERS GIVES READERS

ENOUGH FOOD FOR THOUGHT IN HIS LATEST OFFERING

rotisserie oven to millions on TV, breaking every rule of the modern economy.

Part two demonstrates theories, or ways of organising experience. For example, “Million-Dollar Murray” explores the problem of homelessness — how to solve it, and whether solving

it for the most extreme and costly cases makes sense as policy. In this particular piece, Gladwell looks at a controversial programme that gives the chronic homeless the keys to their own apartments and access to special services while keeping less extreme cases on the street to manage on their own.

In part three, Gladwell examines the predictions we make about people. “How do we know whether someone is bad, or smart, or capable of doing something really well?” he asks. He writes about how educators evaluate young teachers, how the FBI profiles criminals, how job interviewers form snap judgments. He is candid in his skepticism about these methods but fascinated by the various attempts to measure talent or personality.

Malcolm Gladwell selected the essays in What the Dog Saw himself, choosing the stories and ideas that have continued to fascinate and provoke readers long after their publication in The New Yorker. The book is an invaluable gift for his existing fans, and the ideal introduction for new readers.

The common theme that runs through all Gladwell’s pieces is his desire to show us the world through the eyes of others – even if the other happens to be a dog. Inevitably this becomes the world as Gladwell sees it through the eyes of others, but his cast of characters is strong enough to withstand the filter. This is what Gladwell does best: he takes an idea, recasts it as a human story, and works it through to its conclusion, taking a strip off conventional wisdoms as he goes. Even when the patterns he identifies are spurious or the conclusions flawed, the arguments he raises are clear, provocative and important. It’s as if he is saying, read this, then go and think for yourself. His pieces, he says, are meant to be “adventures”.

BROWSINGCORNER

89July 2010

90 July 2010

LUXURY REDEFINEDLuxury Swiss watchmaker Roger Dubuis announced the opening of its new point-of-sale in Muscat and a partnership with Ajit Khimji Group in Oman. Following the announcement, Mistal, distributor of luxury watches in the Sultanate will be the sole point of sale in Muscat for Roger Dubuis, best-selling collection of watches. Present at the inauguration of the POS included CEO Roger Dubuis, Matthias Schuler, and Dharmesh Khimji, managing director, Ajit Khimji Group.

DOWN MEMORY LANE Luxury Swiss watch manufacturer IWC Schaffhausen announced the Middle East launch of an exclusive new double chronograph that pays tribute to the performance of top pilots in the world. The new Pilot’s Watch Double Chronograph is a limited production timepiece and will be available in small quantities worldwide. IWC’s Top Gun is a special edition time piece that honours the skills and performance of elite aviators and distinguishes itself with unique red accented hands and the motif of the academy emblazoned across its back.

THE MAGICAL ONE Lionel Messi, the man the football world calls the “magical one”, has joined the world of Audemars Piguet and its 135 years of history. Understandably proud to be welcoming him, Audemars Piguet CEO Philippe Merk saluted the arrival of this exceptional personality who has successively overcome life’s various trials to reach the peak of his sport. Speaking on the occasion, Philippe spoke about how fascinating a sportsman Messi is, because he has managed to develop the skills that have made him not just an accomplished sportsman but an artist.

MODERN AND STYLISH For a dedicated appliance company that provides efficiency in the home, and a modern design to fit the kitchen of consumers, Samsung’s refrigerator line up offers best-in-class design, extremely accessible features and advanced technology. The Samsung RR82EERS and RR82WERS reversible door refrigerator feature the silver anti-bacterial coating. This innovation enables refrigerators to remain remarkably free of bacteria, which embodies Samsung’s people first policy and commitment to human health. The inner walls of a refrigerator are coated with silver particles that destroy 99.9 per cent of bacteria.

STATE-OF-THE-ART Oman Water sport fanatics looking to escape the scorching summer heat will be delighted to hear of the latest world leading Sea-Doo sport boat arrivals at the BRP showrooms in Azaiba and Marina Bandar Al Rowda off the water’s edge. Brought to Oman exclusively by the Zubair Automotive Group, the latest state-of-the-art Sea-Doo model additions include the 180 and 210 Challenger SE, as well as the 150 Speedster. This summer, all three models ensure safety and fun for the whole family on water.

CAPTIVATING IMAGESCanon Middle East has launched the new EOS 550D – a lightweight digital SLR that enables users to broaden their photographic horizons in stills and full HD video. The latest addition to Canon’s globally-acclaimed EOS range, is perfect for capturing memories in stunning detail and colour. Canon’s most advanced consumer DSLR to date the camera blends an extensive range of features with a compact, easy-to-use body – providing users with the perfect tool to explore and develop their creative vision.

91July 2010

92 July 2010

In one way, it was the meeting of theatre and art, with the common thread being creativity. Ashok Suvarna is a

passionate stage artiste and theatre personality with more than 50 commercial and non-commercial plays to his credit. As the executive director of NPA Events, Suvarna has been involved in organising a number of events, included notable plays.

Therefore it was a natural progression when Al Salmi Library wanted to bring

Rembrandt’s paintings and etchings for display in Oman, Suvarna’s NPA Events was chosen for the job, knowing that passion and creativity would come together befitting the 17th century artist.

The result was that Oman’s art connoisseurs were left breathless to see in flesh and blood more than 100 original etchings by the world-renowned Dutch artist Rembrandt Harmenszoon van Rijn. The event called “Rembrandt in Oman” was organised at the Grand

Hyatt Hotel from August 19-September 19 in 2009.

Winner laurelsFor organising this once in a lifetime exhibition, NPA Events bagged the first prize in the Best Arts and Cultural Event category at the Middle East Event Awards in Dubai in May this year, beating other contenders.

However, the organisation of this event was no easy task and it was only the tenacity, determination and dedicated efforts of NPA Events team,

which made it possible. The Afrah Ballroom of Grand Hyatt was converted into an art gallery within a short period of just four days em-ploying more than 65 people who worked non-stop day and night to complete all the settings including light-ing, security, flooring etc. A 4-metre high facade resem-bling Rembrandt’s house was also erected to complete the feeling of entering the Dutch maestro’s house. In addition, dehumidifiers imported from Dubai were installed in the gallery area to take care of the humidity issue and the pres-ervation of the prints.

“We at NPA Events believe in perfection and excellence, therefore, we work with passion to achieve that. At the end of the event, the entire team looks carefully into everything to see what is imperfect in that particular event. Then we try to assess what was ordinarily done which could have been done extraordinarily, and then rectify the same in our next event. It is an ongoing process for us. But we aim to create the ‘wow’ factor in every event we handle,” says Suvarna, while talking about the memorable event.

Suvarna also says that a large part of the success of ‘Rem-brandt in Oman’ event is due to the efforts of the creative department of NPA Events headed by Mansoor Taher, which left no stone unturned to completely change the look and feel of the posh ballroom into a classic, centuries-old Dutch art gallery.

The exhibition attracted over 6000 local and international visitors and scored excep-tional reviews in local as well as international print and online media.

Ashok Suvarna, Executive Director, NPA Events gives a recap of how ‘Rembrandt in Oman’ was organised which led them to win a Middle East Event award

Memorable success

EVENT

The team of NPA Events (L-R), Harmeet Singh, Production Supervisor; Thomas Joseph, Events Manager; Ashok Suvarna, Executive Director; and Mahira Saqib, Events Coordinator with their laurels

OER July 2010

Documents

oman printerscorrespondence

people of oman

environment conservation

advertising content

oman green awards

majesty sultan qaboos

dia dia didia visivisivisivis

international levels