3 rd December - 9 th December Product and credit offers begin Wednesday 3rd December 2014 and end Tuesday 9th December 2014, or while stocks last. See pages 2 and 3 for terms & conditions. FCBNOE5501 Carrera 1:20 Scale Red Bull Buggy Model: CT201017 125585 2 See Pg 5 for details $ $ 69 69 99 99 HTC One M8 Smartphone - Gold Model: OPEN NETWORK PHONE 133068 35 See Pg 10 for details colour colour Philips AirFryer Model: HD9220/20 124973 11 Also available in lavender white in selected stores only. Props not included See Pg 25 for details $ $ 299 299 or weekly from $ 3 30 ¥ $ 899 or weekly from $ 8 13 ¥ each each get more Christmas for less maximise your prezzies While stocks last Baking Tray WORTH $ 49 99 bonus bonus ^ ^ $ $ WIN †† the ultimate the ultim be in to † †† † †† †† †† †† † † † † 30min free free ^ ^ device introduction $ $ 99 99 99 99 Learning Learning Games, 2 Protective Bumpers and Screen Protector includes includes ^ ^ Funtech 7” Kids Tablet Model: FTTAK001 132580 3 See Pg 13 for details full HD 100Hz HDMI X4 USB X2 full HD 100Hz HDMI X4 USB X2 Sony 60” Full High Definition SMART LED Model: KDL60W600B 134767 79 See Pg 20 for details Playstation 4 bonus bonus ^ ^ your 1 r ur week guide uid to xmas shopping Xbox One 500GB Ultimate Racing Bundle Model: XB1XMASBUN 134526 23 See Pg 2 for details $ $ 1999 1999 or weekly from $ 16 97 ¥ See pages 2&3 of the Gift Generator#3 insert $ $ 599 599 or weekly from $ 5 72 ¥
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
3rd December - 9th December
Product and credit off ers begin Wednesday 3rd December 2014 and end Tuesday 9th December 2014, or while stocks last. See pages 2 and 3 for terms & conditions. FCBNOE5501
Product and credit off ers begin Wednesday 3rd December 2014 and ends Tuesday 9th December 2014, or while stocks last. Personal shoppers only, trade not supplied. ¥Up to 48 Months to Pay Weekly Repayment Terms and Conditions: Weekly repayments are calculated on products over $250 over 48 months to approved purchasers. An establishment fee, monthly service fee, and interest apply. The weekly payments shown include optional protection insurance (chattels and payment protection). Credit is provided by Finance Now Limited. Normal lending conditions and credit criteria apply. See in store for details. Quadruple Fly Buys on LG Whiteware: **4x Fly Buys are not available in conjunction with any other Fly Buys promotional off er. 4x Fly Buys consists of 1 standard Point plus 3 Bonus Points for every $25 you spend at Noel Leeming. Fly Buys Points shown on LG whiteware products reflect quadruple Points. Fly Buys consist of 1 standard Point for every $25 you spend at Noel Leeming. Fly Buys shown reflect single points. ^Includes/Free/Bonus/½ Price item available only with purchase of associated product at advertised price. +Discount terms and conditions apply: Excludes combo/package deals. †Price Promise terms and conditions available in store and online. ++Prices shown reflect discount. #^Heat Pump off ers are valid for all enquiries recorded between 03/12/2014 and 09/12/2014 and where the sale is completed by 16/12/2014 or while stocks last. The standard back to back installation price is $850 incl GST back to back installation applies when outdoor compressor is less than 3 metres from indoor unit. Extra electrical or wiring maintenance charges may apply. Call 0800 44 44 88 to arrange for a specialist to visit your home. See instore for details. **Our Lowest Price Ever refers to the advertised price. Tech solutions Terms and conditions and exclusions apply. This
Xbox One500GB Ultimate Racing Bundle Model: XB1XMASBUN 134526
23
Xbox One
or weekly from $572^
$$599599or weekly from $572^
Xbox One500GB Hard-core Bundle Model: XB13GAMEBUN 134532
23
$$599599
Xbox One
or weekly from $354^
Xbox 360 500GB Holiday Bundle Model: XB360500GBBR 134786 13
$$329329SAVE $20
Xbox One Controller• Wireless controller. • AA batteries x2 Model: S2V-00004 123542 2
nownow $$69699999SAVE $40
Turtle BeachXO Four Xbox One Headset• Compatible with Xbox One and Mobile Gaming Model: XOFOUR 124630 6
nownow $$1169699999
Xbox OneMinecraft Model: 44Z-00005 134529
$$2424 9999
SAVE $20
Electronic ArtsUFC 2014 Model: EAXB12112538 128460 2 Also available in PS4 (128459)
nownow $$69699999
Xbox OneThe Crew Xbox One Model: THECREWXB1 128606
3 Also available in PS4 (128498)
$$8484 9999
Xbox OneGrand Theft Auto V Model: GTA5XB1 130811 3 Also available in PS4 (130809)
$$89899999
2
Gaming
Product and credit off ers begin Wednesday 3rd December 2014 and ends Tuesday 9th December 2014, or while stocks last. Personal shoppers only, trade not supplied. ¥Up to 48 Months to Pay Weekly Repayment Terms and Conditions: Weekly repayments are calculated on products over $250 over 48 months to approved purchasers. An establishment fee, monthly service fee, and interest apply. The weekly payments shown include optional protection insurance (chattels and payment protection). Credit is provided by Finance Now Limited. Normal lending conditions and credit criteria apply. See in store for details. Quadruple Fly Buys on LG Whiteware: **4x Fly Buys are not available in conjunction with any other Fly Buys promotional off er. 4x Fly Buys consists of 1 standard Point plus 3 Bonus Points for every $25 you spend at Noel Leeming. Fly Buys Points shown on LG whiteware products reflect quadruple Points. Fly Buys consist of 1 standard Point for every $25 you spend at Noel Leeming. Fly Buys shown reflect single points. ^Includes/Free/Bonus/½ Price item available only with purchase of associated product at advertised price. +Discount terms and conditions apply: Excludes combo/package deals. †Price Promise terms and conditions available in store and online. ++Prices shown reflect discount. #^Heat Pump off ers are valid for all enquiries recorded between 03/12/2014 and 09/12/2014 and where the sale is completed by 16/12/2014 or while stocks last. The standard back to back installation price is $850 incl GST back to back installation applies when outdoor compressor is less than 3 metres from indoor unit. Extra electrical or wiring maintenance charges may apply. Call 0800 44 44 88 to arrange for a specialist to visit your home. See instore for details. **Our Lowest Price Ever refers to the advertised price. Tech solutions Terms and conditions and exclusions apply. This
PlayStation 4500GB Mega Game Bundle Model: PS4XMASBUN 134524
27
$$699699
PlaySSttattiiioonn 4444500GB M G BB ddl
or weekly from $612^
PlayStation 4500GB Ultimate Family Bundle Model: PS43GAMEBUNDLE 134533
25
$$649649
SAVE $50
Turtle BeachSTEALTH 500P Model: TBEARS500P 134484
7
Wireless DTS surround sound gaming headset for PS4 & PS3
nownow $$119999or weekly from $330^
PlayStation Vita Minecraft and Little Big Planet Marvel bundle Model: VITAMC&LBPMARVEL 134522 11
$$299299or weekly from $411^
PlayStation 3500GB Singstar bundle Model: PS3500GBSINGSTAR 134534 15
$$399399
PlayStation 4 & Xbox OneRUGBY 15 Model: RUGBY 15 PS4 133948 / 133949
3
$$89899999eacheach
Ubisoft Farcry 4 PlayStation 4 & Xbox One Model: FARCRY4PS4 130333 / 130335
3
$$8484 9999 eacheach
PlayStation 4 & Xbox OneAssassin’s Creed Unity Model: ASSUNITYPS4 129198 / 129199
3
$$8484 9999 eacheach
New PS3 Essential Games Model: 9248774 122846 / 122446
$$2424 9999eacheach
service is available at all Noel Leeming stores nationwide. Customers must complete the terms and conditions declaration prior to work commencing. Please contact your local store in regards to service areas. The Free diagnosis and quote services are only off ered in selected stores. There is an additional travel charge of $49 per 30KM outside of serviced areas. Prices are subject to change without notice. Courier charges may apply. Ask in store for full terms and conditions and service policy. Excludes all Noel Leeming Clearance Centres. Contact us on 0800 44 44 88 or visit www.noelleeming.co.nz
Disney InteractiveDisney Infinity Toy Box Combo Pack Model: DISNEYTOYBOX PS4 134101 3 Available on PS4, PS3, Xbox One and Xbox 360
$$84849999eacheach
Nintendo 3DSPokemon Omega Model: OMEGARUBY 130164 / 130167 2
$$55999999eacheach
$$999999eacheach
SkylandersSWAP Force Characters
124705
125366
125636
SWAP Force Cha
125636
Skylanders Trap Team Traps Model: AIR ELEMENT 133640 / 133466 / 133471
Range may vary by store
$$77 9999eacheach
Nintendo 2DS Model: 125301 131336 / 131337 6 Colour options may vary by store
$$1174749999eacheach
ActivisionSkylanders SWAP Force Starter Kit Model: 84702AU 127369 2 Available on PS4, PS3, Xbox One and Xbox 360
$$55999999
Skylanders Trap Team Master Character Model: KRYPT KING 133472 / 133473 / 133474
Range may vary by store
$$11999999eacheach
4
Gaming and toys
48 months¥ to payon products $250* & overup to
An establishment fee, monthly service fee and interest apply. Normal lending conditions and credit criteria apply. See in store for details. Credit is provided by Finance Now Limited.
Get ready for the festive season with the Vodafone family of handsets
$149991 2 5
At this price this phone is set up to only work with a Vodafone NZ SIM
$49
Stay close all summer with 5GB Free
$
Data lasts 6 months. Must be activated by 31/12/2015. Auto-renews if you have enough credit.
Vodem StickK4607z
1 3
lasts 6 months
Free 5GB
$79Vodafone WiFi hotspot R209z
6
VODAFONE: 4G not available everywhere and requires a 4G capable device. See vodafone.co.nz/4G. Included value off er valid until 15 Jan 2015. *Free mins and TXTs is Prepay $9 and are to standard NZ numbers. Prepay $9, $19 and $29 last 30 days and auto renews if you have credit. Included mins and TXTs are for personal use only. Free weekend calling is 7pm Friday to 7am Monday. Prepay terms apply see vodafone.co.nz/prepay. Fantastic Friday terms apply, not available to business customers and some deals only available with top up. See vodafone.co.nz/fantasticfridays for details. To use with other networks a $30 unlock fee applies. For HD to work, you and the person you are calling both need to have 3G coverage, HD voice compatible phone and be on the Vodafone network.2DEGREES: 2degrees terms and conditions: *Fair Use Policy applies. Handset off ers end 09/12/14 or while stocks last. Plan conditions & early termination charges apply. Standard NZ & Aus mins & texts only. NZ data usage only. Calls rounded up to the nearest minute. Handset price based on using your Plan Bonus. See 2degreesmobile.co.nz for full Fair Use Policy & conditions. Free NZ Text off er only if you redeem your code received with purchase of this phone before 09/12/14. 5000 standard NZ texts applied on every top up made on the Prepay SIM until 31/12/15. Texts valid 1 month. 1.5GB promotion ends 09/12/14. Promotion only available to 2degrees Prepay & Pay Monthly customers, excl Business. Visit 2degreesworld.co.nz/redeem to enter & for full conditions. Handset off ers while stocks last. Free Google Play Music trial redeemed on Android devices before 11.59pm, 31/01/2015 & is valid 90 days from redemption. 5000 standard NZ texts applied on every top up made on the Prepay SIM until 31/12/15. Texts valid 1 month.1.5GB promotion ends 1/02/2015. Visit 2degreesworld.co.nz/redeem for info how to redeem. For full conditions visit 2degreesmobile.co.nz. Google & Google Play are trademarks of Google Inc.SPARK: Spark terms and conditions: Value Pack Terms: Spark terms, conditions and charges apply. Value Pack valid for one month. See Spark.co.nz for more details. Spotify Terms: Data charges plus Spark and Spotify terms and conditions apply. See spark.co.nz/Spotify for more information. Wifi Terms: Available free on selected Spark value packs only. “For Life” means whilst the eligible pack or plan is made available and you continue to renew it. Socialiser available on packs and plans above $19 p/m and customers must opt in. Only available on smartphones with off icial Facebook and Twitter apps. Standard data charges apply after 1GB has been used up and to any click through links. Available to consumer customers
Colour options may vary by store Smartphone not included
from from $$49499999
eacheach
only and excludes legacy plans. Socialiser off er ends 3 February 2015. SKINNY: 3GB off er for new customers (1 per customer), who activate SIM & purchase a $16, $26 or $40 Combo & renew it for the following 2 renewal periods. Each 1GB Data is valid for 30 days. Phones set up to only work with a Skinny SIM. To use with another network’s SIM seeskinny.co.nz for unlock code, $30 fee may apply. Personal use in NZ only. See skinny.co.nz for terms and extra charges. Excludes Noel Leeming Clearance Centres. For more information contact us on 0800 44 44 88 or visit www.noelleeming.co.nz.
SWITCH ON AT SPARK.CO.NZ/SOCIALISER BEFORE 3 FEBRUARY 2015
“ For life” means for the life of the pack or plan above $19. Packs must be renewed monthly, and is available on official Facebook and Twitter apps only. See spark.co.nz/socialiser for full details. SP
121770 / 121771 / 121772 / 121773 / 121774 / 121775 1 Colour options may vary by store
$$349999 each
Single Wall ChargerModel: F8J052AUBLK
124464 / 124465 / 124466 / 124467 / 124468 / 127742 1 Colour options may vary by store
Lightning CableModel: CNSLIGHT
131659 / 131661 / 131663 / 131664 1 Colour options may vary by store
$$339999 99 eacheach
from from
$$262699 99 eacheach
ee
Belkin MIXIT USB 2.1
Mobile accessories
Available to purchase in store and online
Cover Me Customised Phone Cases Model: COVERMECASE 130139 1
$$29299999eacheach
The best phone case is the one that you design yourself, and is a great xmas prezzie for family and friends! You customise the design from photos of your favourite pets, to family or that not to forget summer holiday!
Visit noelleeming.co.nz/coverme to purchase a case today.
MAKE YOUROWN CASE
10
Mobiles & GPS
like us on facebook for updates on the latest products, news & off erswww.facebook.com/noelleemingonline
Tom Tom GO 50 Navigational Unit• Tap & go • 3D city maps • Quick keyword search
Model: 1FC5.069.00 130214 9
5” screen$$229229
OOOOOOOOO 555555555555555555000000000000 NNNNNNNaaaaaavvvvvvvviiiiiiiggggggggggaaaaaaaaattttttttttiiiiiiiiiooooooooooooonnnnnnnnnnnnnaaaaaaaaaaallllllll UUUUUUUUUUUUUUUnnnnnnnnnnnnnnniiiiiiiiiitttttttty my mmmmapsapsapsaps •••• QuiQuiQuQuiQuQuiQuickck ck ck keykeyke worrwororoord sd seaarrearararararchchchchchcccch
When you buy a new device there’s no better way to discover the possibilities of what it can do than with a session in our Open Learning centre.
Open Learning is only available at the following stores: Albany, Queen Street, Wairau Park, Sylvia Park, Manukau, Te Rapa, Tauranga, Lower Hutt, Dunedin, Napier, Palmerston North and Nelson
maximise your device with a
FREEFREE^ 30 Minute 30 Minute one-on-one one-on-one introduction to your deviceintroduction to your deviceCall us to book a session today on 0800 555 989 or for more information visit noelleeming.co.nz/openlearning.
An establishment fee, monthly service fee and interest apply. Normal lending conditions and credit criteria apply. See in store for details. Credit is provided by Finance Now Limited.
*Offer available on Offi ce 365 University, Personal or Home one year subscription purchased 1/11/14 – 31/03/15. Redeem by 15/04/15. For full terms and conditions visit microsoft.co.nz/offi ceprezzy
Receive a $25 Prezzy Card when you buy Offi ce 365.*
120984/109923
128769/128937
120983/109916
or weekly from $1054^
Acer 15.6” Touchscreen Notebook• 1.7GHz Intel i5-4210U dual core processor • 4GB RAM• 1TB hard drive • Intel HD graphics with 128MB dedicatedModel: E5-571P-004BUN 134263
Fujifilm S9200 Ultra Zoom Camera Model: S9200 129335 15
16.2 Megapixel
Sensor
50x Optical Zoom
3” LCD TFT Screen
10 Advanced
Filters
or weekly from $403¥
Only at Noel Leeming
Sony DSCH300 Cyber-shot Black CameraModel: DSCH300 134068 11
SAVE $100
20.1 Megapixels
35x Optical Zoom
3.0” LCD Screen
DSLR-like body & EVF provide
steady shot when zooming
nownow $$299299or weekly from $330^3 ^
SAVE $60
Nikon Coolpix P600 Super Zoom Includes 8GB SD CardModel: P600 RED 8GB SD CARD 129029 / 129026 23 Colour options may vary by store
nownow $$589589eacheach
16 Megapixels
60x Optical Zoom
3.0” Vari-angle
LCD Screen
1080P Full HD Video up to
60 FPS
or weekly from $564^
Thomson7” Wooden Style Digital Photo Frame• 7 inch TFT LCD Screen• Panel Resolution: 480x234 (16:9)• Supports SD, MMC, MS Memory cardModel: DPF1707W 132811 2
$$59599999
Bo-nusbb oonnuuss^̂
16GB SD Card
WORTH$3499
130630
CanonSX170 Super Zoom CameraModel: SX170ISR 126315 9
16 Megapixel
Sensor
16x Optical Zoom
3” LCD Screen
32x Zoom Plus
colourcolour $$249249
$629**Visit canon.co.nz for details. Offer ends 10th January 2015
WITH $50 CASHBACK VIA REDEMPTION**
or weekly from $636^
Canon SX60 Ultra Zoom Camera with Wi-FiModel: SX60HS 133582 27
$$679679
16.1 Megapixel
Sensor
65x Optical Zoom
21mm ultra wide angle lens
Optical image stabiliser
Worlds biggest optical zoom camera
JCMatthew8” Ultra Slim Digital Photo Frame• Ultra slim Design, only 6mm• 800 x 600 Resolution• Built-in Light-Sensor , auto detect the ambient
brightness and adjust the panel brightness accordingly.
Model: PF8082E 119868 3
$$89899999
Bo-nusbb oonnuuss^̂
16GB SD Card
WORTH$3499
130630
JCMatthew 12” Classic Black Wood Digital Photo Frame• 12” LCD Screen• 800 x 600 Screen Resolution• SD, MMC, MS, XD, and CF Card SlotsModel: DPF1210AAN 119899 7
$$1179799999
Bo-nusbb oonnuuss^̂
16GB SD Card
WORTH$3499
130630
bonus^̂Outdoor Extreme Bluetooth Speaker
WORTH $179with any of the below super / ultra zoom cameras134068 / 126315 / 129335 /
133582 / 129029 / 129026
BlueSpeaker
WORT$179with abelo/ ulca13
1
• Splashproof • Built in lantern• Charge your phone
zoom in closer than ever before
18
Cameras
Did you know we have our own life prints photo lab?Visit our website www.noelleeming.co.nz/stores to see which of our stores have a photo lab or you can order prints online at www.lifeprints.noelleeming.co.nz
full HD smart Wi-Fi built in Wi-Fi SubCompatiblefull HD smart Wi-Fi built in Wi-Fi SubCompatible
or weekly from $547^
Sony32” Full High Definition SMART LEDModel: KDL32W700B 128526 22
$$569569
full HD 100Hz HDMI X4 USB X2full HD 100Hz HDMI X4 USB X2
or weekly from $1697^
Sony60” Full High Definition SMART LEDModel: KDL60W600B 134767 79
$$11999999
Playstation 4
bonusbonus^̂
ultra HD 100Hz smart Wi-Fi built in
or weekly from $3305^
Sony 65” Ultra High Definition 3D SMART LEDModel: KD65X8500B 132166 187
$$44994499
ULTRAHIGH
DEFINITION
Playstation 4
bonusbonus^̂
SAVE $20
Sony Blu-Ray PlayerModel: BDPS1200 135703 4
nownow $$1109099999
21% OFF
+ +
SAVE $150
Sony 2.1 Channel Sound BarModel: HTCT370 130420 21
nownow $$549549or weekly from $531^
Sony Hi-Fi SystemModel: SHAKE77 132094 43
$$1099
Buy an HTM77, SHAKE77 or SHAKE99 between 28/10/14 and 24/12/14 and receive a bonus Coleman NXT300 barbecue in store at time of purchase. While stocks last.
Samsung 65” Curved Ultra High Definition 3D SMART LEDModel: UA65HU9000WXRD 129585 279
$$69996999
ultra HD curved edge LED 100Hz micro dimming
Ultimate
ULTRAHIGH
DEFINITION
Bo-nusBB oonnuuss^̂
Samsung Galaxy S5
4444444MMMM
33SS
555555MMMMM
1111111111
555555M
11
666666MMM
1
SSS
‘Tis the season to be jolly and this Christmas Panasonic is giving 50 lucky shoppers the chanceto win a 50” TH-50A400Z TV. Conditions apply. See in store for details.
WIN THIS
Panasonic BLUE XMAS
PanasonicBLUE XMAS
pan
asonic.co.nz/promotions. Terms & Condition
s ap
ply
.
Starter Table Top TV Service from $149*Television delivery, installation and configuration• Assemble your equipment
• Install and connect to existing power and antenna sockets
• Configure your television with functionality test and auto-tune
• Full overview and basic training on the features, functionality including: wireless, Internet
options apps, software available, updates , and media
• Connect up to three existing devices, e.g. Sky, FreeView, Blu-Ray, basic home theatre
connection
Our Tech Solutions mobile technicians make setting up your new TV & Home Theatre hassle free. They can deliver, install and show you how to get the most out of your new technology.
get the most out of your technology with our installation, delivery and setup service
Visit us in store or call us on 0800 555 989. See https://www.noelleeming.co.nz/techsolutions for details on other packages.
FROM $149 up to 1.5 Hour Service* Additional services are available by quotation upon request.
Any additional work required after 1.5 hours may be subject to additional charges.
George Foreman Infinity Chopper• Unique chopping and
blending blades• Two 1.2 litre stackable
bowls • 350 watt motorModel: 21510AU 133115
2 Props not included
$699999
GeorBraun 3 in 1 Mixer, Processor and Blender• 950 watt output power• Variable speed control with
auto pulse• Stainless steel mixing bowlModel: KM3050WH 131198
27
SAVE $100nownow $$699699
or weekly from $652^6 ^
$2649**Offer ends 24th December 2014.
See in-store for details
WITH $250 CASHBACK VIA REDEMPTION**
or weekly from $2420^
DelonghiPrimadonna Fully Automatic Machine• Patented auto cappuccino system: personalising
and memorising your coff ee has never been easier• Dedicated chocolate jug and thermal milk jug• Colour displayModel: ESAM6900 117645 115 Props not included Selected stores only. Customer orders available
$$28992899
Bo-nusbonubonuss^̂
Coffee Grinds
Bin WORTH
$70
Breville Cafe Venezia Espresso Machine• Italian made 15 bar pump • Thermocoil heating
system • Advanced dual wall crema systemModel: BES250BSS 102801 7
$$1199999999
99257
1
2
NespressoInissiaModel: EN80BAE 128272 / 128214
10
2
3
3
Nespresso U MilkModel: BEC300MW 122978/123924
13
Nespresso Lattissima ProModel: EN750MB 128279
35
Colour options may vary by store
$$899899or weekly from $813¥
$$349349or weekly from $371¥
Props not included
$$269269or weekly from $306¥
$799**Offer ends 11th January 2015.
See in-store for details
WITH $100 CASHBACK
VIA REDEMPTION**
$194**Offer ends 11th January 2015.
See in-store for details
WITH $75 CASHBACK
VIA REDEMPTION**
$274**Offer ends 11th January 2015.
See in-store for details
WITH $75 CASHBACK VIA REDEMPTION**
Nespresso
Cashback
Off erOff er$75 – $100 cashback
on Nespresso75 – $1 ssoon Nespres
Via redemption. See in store
for terms & conditions. Off er
ends 11th January 2015
1
SAVE $80
KenwoodPatissier Mixer Teal• 600 watts • All metal body for long term
durability • 4 litre brushed stainless steel bowl with large handle
PhilipsAirFryer• Rapid air technology for healthier frying and less smell• Great tasting fries with up to 80% less fat• With Airfryer you can fry, grill, roast and even bake
Model: HD9220/20 124973 11 Also available in lavender white in selected stores only.
$$299299Bo-nusBBoonnuuss^̂
Baking Tray
WORTH $4999
Props not included
While stocks last132034
Props not included
KambrookFlutter Butter Popcorn Maker• 1200 watt for fast, hot air
popping action• Transparent cover with
popping chute• Non slip feetModel: KPC10 106048
1
$$39399999
Yonanas Healthy Dessert Maker• Makes healthy dessert from 100% fruit • Perfect
for those with food allergies or intolerancesModel: SILVER/BLACK 123429 3 Props not included
Fat free, dairy free & guilt free
$$79799999
SAVE $80
BrevilleBanquet Pan• Large 38cm frypan with glass lid • Extra deep
non stick 78mm pan • Variable temperature control with 10 settings from simmer to sear
Model: BEF200GRY 49769
3 Props not included
nownow $$79799999
50% OFF
+ +
George ForemanRemovable Plate Grilling Machine• Removable plates• George tough pro non stick coatingModel: GRP1080AU 133128 3 Props not included
$$99999999
newrelease
BB oonnuuss^̂
Heston Blumenthal Cookbook
WORTH $85 SAVE $200
Breville Benchtop Oven• Bakes, roasts, grills, toasts and reheats with ease• Auto eject rack - for easy removal of hot dishes• 9 LCD pre-set functionsModel: BOV800BSS 102013 11
nownow $$299299or weekly from $330^
40%OFF
++
134253
$179**Offer ends 4th January 2015.
See in-store for details
WITH $100 CASHBACK VIA REDEMPTION**
or weekly from $314^
$$279279
Brother Mechanical Sewing Machine• Easy to load top loading bobbin• Free arm convertible sewing surfaceModel: GS2510 155471
Summer cooling is easy with Mitsubishi Electric Wi-Fi Controlyou can control and monitor these air conditioners from absolutely anywhere via your smartphone, tablet or online account*
AddAddAdd Wi-Fi Con-
troller for $299
or weekly from $1375^Mitsubishi ElectricClassic GE Series Heat Pump• 3.5 kW cooling / 4.0 kW heating• 19 dB(A) indoor, 48 dB(A) outdoor• NZ quietest heat pump / air conditionerModel: MSZ-GE35VAD-A1PKG 131203
63
$$11599599
Dyson Air Multiplier Tower Fan• Powerful airflow now
*Wi-Fi Controller and installation are an additional cost. To enable Wi-Fi Air Conditioner Control requires a Mitsubishi Electric Wi-Fi Controller, compatible WPA2-AES capable router with WPS and active Internet connection. For a list of compatible Air Conditioner models and for full system requirements please see http://www.mitsubishi-electric.co.nz/wifi/
Jabra Sport Pulse Wireless Earbuds• Bluetooth with NFC• Integrated heart rate monitor• Jabra SportLife app included
(Android and iOS)Model: SPORT PULSE 133591
9
Perfect for New Year’s resolutions
SAVE $70nownow $$249249Bo-
nusBonuBonuss^̂
3x Powerade
500ml MountainBlast
SonySRSX5 Bluetooth Speaker + MDRZX750BN Headphones• Speaker: Bluetooth with NFC• 20 Watts output • 2.1 channel
Model: SRSX5+MDRZX750BN 172883 11
Wireless audio super deal!
BBoonnuuss^̂
Noise Cancelling Bluetooth
Headphones WORTH
$279
or weekly from $330^
$$299299
or weekly from $371^
Tom TomRunner Cardio Sportwatch• Sports watch • Train in your optimal heart rate
zone • Track your real-time distance, time, pace and calories
Model: 1RA0.001.02 130117 / 129795 / 129726 13
$$334499 eacheach
Colour options may vary by store
Jabra Solemate Mini Bluetooth Speaker• Bluetooth with NFC • Up to 8 hours playback• 2 front facing speakersModel: 094166 133093 / 133096 4 Colour options may vary by store
Tom TomNike+ Sportwatch with Sensor Red• Sport watch • Tracks your time, distance, pace
or speed and calories burned• Reminds you to run and stores your run historyModel: TOMTOMNIKEWATCHRED 122865 5
Includes Nike+ Sensor for increase accuracy
$$1129299999
Sony 4GB B Series MP3 Walkman (Black)• FM Recording • Bass Boost • Quick ChargeModel: NWZB183FB 130464 2
SAVE $6nownow $$5353 9999
perfect giftsperfect gifts for those for those on the goon the go
Energise your day with Charge – a high-performance activity wristband that displays real-time fitness stats and caller ID to help you step up your routine.