NoeClone - SJTU

1

NoeClone

Advanced Cloning Lab

Version 3.0

NoeGen, Inc.

2

License #:______________________________

NoeClone: Advanced Cloning lab Version 3.0

NoeGen, Inc., Gaithersburg, MD, USA

http://www.noegen.com/

1st Edition, August 2010.

Copyright © 2010 NoeGen. All rights reserved.

NoeClone® is a registered trademark of NoeGen

Macintosh® is a registered trademark of Apple Computer, Inc.

Windows®

Grant of License. You have the non-exclusive right to use NoeClone program on a single computer.

You may physically transfer the program from one computer to another provided that the program is

used on only one computer at a time. Concurrent use of the program on more than one computer is

not permitted unless multiple Licenses are purchased.

is a registered trademark of Microsoft Corporation.

All other brands and product names are the trademarks and/or copyrights of their respective

owners.

NoeGen Software License Agreement

This is a legal agreement between you, the end user, and NoeGen Inc. If you do not agree to the terms of

this agreement, promptly return the package with all accompanying items to NoeGen, or the place you

obtained it.

Copyright. The NoeClone program and documentation and any portion thereof are properties of

NoeGen and are protected by the United States copyright laws and international treaty provisions.

You may not make copies of the program except solely for backup or archival purposes. You may

not copy the written materials accompanying the program.

Other Restrictions. You may not rent or lease the program. You may not modify, decompile, reverse

engineer or disassemble the program.

http://www.noegen.com/�

3

Single-user License

The single-user license entitles the licensee, the principal investigator (and possibly his

Students/Technician/PostDoc), to use in his/her laboratory or other research environment. The

single-user license permits activation of two copies of the program in the lab or office computers. Each

additional computer license needs to be purchased separately.

Network License

The network license authorizes the installation of this program on the network server and permits the

concurrent use of the program on a given number of client computers stated in the license contract.

The license does not allow the installation of the program on computers other than those stated. The

network licenses require that the network administrator or the users register with NoeGen Inc or a third

party distributor.

Software Limited Warranty

NoeGen warrants to the original purchaser that the NoeClone User's Guide and the disk on which the

NoeClone software is recorded are free from defects in material and workmanship, under the normal

use for 30 (thirty) days after the date of original purchase as evidenced by a copy of your receipt. If a

defect occurs during the 30-day period, you may return the disk to NoeGen for a free replacement or a

refund.

In no event shall NoeGen be liable for any damages, including but not limited to loss of profit, loss of

data or other incidental or consequential damages or other similar claims arising out of the use of or

inability to use the software, even if NoeGen has been advised of the possibility of such damages.

The software is licensed and delivered on an "as is" basis. Except for the express warranty set forth

above, NoeGen makes no other warranties, either express or implied, by statute or otherwise, with

respect to the NoeClone software and NoeClone User's Guide, their quality, accuracy, performance,

merchantability, or fitness for any particular purpose. Some states do not allow the exclusion or

limitation of liability for consequential or incidental damages so the above limitation may not apply to

you.

4

Table of contents Chapter 1 Introduction and installation ......................................................................................... 6

1.1 Unique and innovative features of NoeClone ..................................................................... 61.2 Registering your copy of NoeClone ..................................................................................... 71.3 Technical support ................................................................................................................ 71.4 Hardware and software configurations ............................................................................... 71.5 Program download .............................................................................................................. 81.6 Files in the NoeClone program package .............................................................................. 81.7 Installation on Microsoft Windows ..................................................................................... 91.8 Installation on Mac OS X ................................................................................................... 131.9 Installation on Linux with an installer ............................................................................... 161.10 Installing and creating databases .................................................................................... 191.11 Getting started and Tutorial ............................................................................................ 23

Chapter 2 Quick start and Tutorials ................................................................................................. 262.1 Concepts and Interface ..................................................................................................... 262.2 Tutorials ............................................................................................................................. 34

2.2.1 Lesson one: quick plasmid construction ................................................................ 352.2.2 Lesson two: cloning example ................................................................................. 382.2.3 Lesson three: gel simulation example .................................................................... 41

Chapter 3 Drawing molecular maps ............................................................................................. 453.1 Starting a new map ........................................................................................................... 453.2 Working with sites ............................................................................................................. 483.3 Working with regions ........................................................................................................ 503.4 Working with map objects ................................................................................................ 563.5 Handing multiple maps in a window ................................................................................. 58

Chapter 4 Sequence handling and analysis .................................................................................. 614.1 Using DNA sequences in NoeClone ................................................................................... 614.2 Restriction enzyme analysis .............................................................................................. 644.3 Generating restriction site summary ................................................................................. 674.4 Modifying enzyme library ................................................................................................. 714.5 Other sequence analysis functions ................................................................................... 73

Chapter 5 Virtual cloning ............................................................................................................. 855.1 Cloning basics .................................................................................................................... 855.2 Defining insert fragments .................................................................................................. 875.3 Setting up a ligation reaction ............................................................................................ 905.4 High-throughput cloning ................................................................................................... 965.5 Quicker and simpler cloning .............................................................................................. 985.6 Gateway cloning .............................................................................................................. 1025.7 TOPO cloning ................................................................................................................... 1045.8 Define PCR reactions ....................................................................................................... 105

Chapter 6 Gel simulation ........................................................................................................... 1076.1 Gel overview .................................................................................................................... 1076.2 Creating gels .................................................................................................................... 1086.3 Loading gels ..................................................................................................................... 1096.4 Adjusting gel display ........................................................................................................ 1116.5 Describing gel as text ...................................................................................................... 112

Chapter 7 Managing data and files ............................................................................................ 1147.1 Working with relational databases .................................................................................. 1147.2 Working with files ........................................................................................................... 1217.3 Printing files .................................................................................................................... 1227.4 Program preferences ....................................................................................................... 123

Chapter 8 Summary of menu commands .................................................................................. 124

5

8.1 File menu ......................................................................................................................... 1248.2 Edit menu ........................................................................................................................ 1258.3 Project menu ................................................................................................................... 1268.4 Molecule menu ............................................................................................................... 1278.5 Map menu ....................................................................................................................... 1288.6 Clone menu ..................................................................................................................... 1288.7 Analyze menu .................................................................................................................. 1308.8 Gel menu ......................................................................................................................... 1308.9 Window menu ................................................................................................................. 1318.10 Database menu ............................................................................................................. 1318.11 Language menu ............................................................................................................. 1328.12 Help menu ..................................................................................................................... 132

Index .............................................................................................................................................. 133

6

Chapter 1 Introduction and installation 1.1 Unique and innovative features of NoeClone

NoeClone provides a knowledge-enhanced and comprehensive solution for virtual

cloning, gel simulation, plasmid map drawing, sequence analysis, and cloning data

management. NoeClone transforms the complex molecular cloning process into a

pleasant working experience. Empowered with versatile functionalities of NoeClone,

molecular biologists can truly enjoy the fun of molecular manipulation and clone

design in silico. Below are some main highlights of the NoeClone software:

• Interactive graphic interface. Graphic maps are completely interactive and can

be manipulated as in a drawing program.

• Intuitive virtual cloning. NoeClone’s visual clone designing resembles the

actual laboratory cloning process and supports advanced cloning operations

such as modifying fragment ends, adding adaptors, electronic PCR,

high-throughput cloning, TOPO cloning and Gateway Cloning.

• Plasmid map and cloning flowchart. The plasmid map editor supports multiple

maps, making it easy to create cloning flowcharts.

• Advanced sequence decoration. NoeClone includes SeqCorator functions that

allow feature decoration with unprecedented flexibility.

• Gel simulation. An integrated gel simulator can be used to display patterns of

digestion and isolate gel bands as fragments for cloning.

• DNA sequence analysis. NoeClone comes equipped with a suite of sequence

analysis tools with graphic output integrated seamlessly into the NoeClone

environment.

• Multiple sequences alignment. NoeClone can do multiple sequences alignment

with FASTA format data or sequences from database.

• Data management. Information on plasmid clones and cloning steps are

managed through relational databases in either distributed or centralized ways,

providing an essential solution for corporations and laboratories to manage

cloning data effectively.

7

1.2 Registering your copy of NoeClone

After installing the software (detailed below), you need to register your NoeClone

license so that you can stay connected with NoeGen for receiving program updates

and upgrade notices. The registration process can be completed online

at www.noegen.com. If you are registering your product on the NoeGen web site for

the first time, you will need to create an account first with a username and password.

Keep a record of the account information so that you can log into the on-line system

for other uses such as submitting technical support requests.

1.3 Technical support

Technical support is available to registered users. When you request technical support,

have the following information available, or include it on your fax or E-mail.

o Your name

o Name of the licensed end user, if different

o Institution

o NoeClone license number

You can choose from many options to obtain help information or request technical

support, including:

• Web: You can find answers for commonly encountered questions in FAQ or

submit help request using web forms on www.noegen.com

• Email: You can send email to [email protected]. Make sure that you

describe your questions in enough details so that we can efficiently track down

the problems and provide solutions in a timely manner.

• Fax or phone: You are welcome to call or fax us the questions. Please contact

your NoeClone distributor for fax and telephone number. You can also use the

main number found on NoeGen web site.

1.4 Hardware and software configurations

·Windows 2000, Windows XP, Windows Vista, Windows 7

· Mac OS 9.2, OS X 10.4 or newer



mailto:[email protected]�

8

· Linux/Unix systems

· 32 or 64 bit

· 256 MB RAM required

· 512 MB RAM recommended

· 1024 x 768 display recommended

1.5 Program download

NoeClone can run on Windows, Mac OS 10.6 and Linux operating systems. The

software for either platform can be downloaded from http://www.noegen.com/. The

program can also be sent on a CD-ROM by regular mail.

Before you download the program you are asked to fill certain information in the

Download dialog box. In the dialog box you must choose:

·Which operating system you use

·Whether you want to include Java or not

(This is necessary if you haven’t already installed Java)

·Whether you would like to receive information about future releases

Depending on your operating system and your Internet browser, you are taken through

some download options.

When the download of the installer (an application which facilitates the installation of

the program) is complete, follow the platform specific instructions below to complete

the installation procedure.

1.6 Files in the NoeClone program package

The NoeClone software package contains the following items:

1. A master CD containing the NoeClone program and associated files. Note that the

program serial number is printed on the CD label, which is required to activate

program during its first use.


9

2. The NoeClone Installation Guide.

3. Program registration card. Please fill out this card and send back to Noegen, Inc.,

so that we know you received program and that we will be able to inform you of

news about NoeClone.

1.7 Installation on Microsoft Windows

1.7.1 Installing NoeClone executables Starting the installation process is done in one of the following ways:

If you have downloaded an installer:

Locate the downloaded installer and double-click the icon.

In most cases, the default location for downloaded files is your desktop.

If you are installing from a CD:

Insert the CD into your CD-ROM drive.

Choose the "NoeClone_windows_3" and double-click the icon.

Click the “install.html” file and select the “NoeClone_windows”

Here need the screen shot

If you do not have Java installed on your computer, the installation will

automatically set up the Java run-time environment.

Installing the program is done in the following steps:

·On the language selection screen, choose the language and click OK.

·On the welcome screen, and click Next.

10

·Read and accept the License agreement and click Next.

·Choose where you would like to install the application and click Next.

11

·Enter a name for the Start Menu folder used to launch NoeClone and click Next.

·Wait for the installation process to complete. When setup has finished installing

12

NoeClone on your computer, click Finish.

When the installation is complete the program can be launched from your

Applications folder, or from the desktop shortcut you chose to create. If you like, you

can drag the application icon to the dock for easy access.

13

1.8 Installation on Mac OS X

Starting the installation process is done in one of the following ways:



The default location for downloaded files is your desktop.


Insert the CD into your CD-ROM drive and open it by double-clicking on the

CD icon on your desktop.

Launch the installer by double-clicking on the "NoeClone" icon.



The installation jdk on Mac is forbidden, only we can do is to require user to use

high version MacOS(10.6)




14



15






16

1.9 Installation on Linux with an installer



The default location for downloaded files is your desktop.


Insert the CD into your CD-ROM drive.

Choose the NoeClone installer and double-click the icon.



If you do not have Java installed on your computer, the installation will

automatically set up the Java environment.




17



18

·Choose where you would like to create symbolic links to the program and click

Next.



19




1.10 Installing and creating databases

NoeClone can work with either a local database on the same machine where

NoeClone executable is installed or a database on a remote server. Installing the local

database is done automatically during the installation of the NoeClone executables.

By default HSQLDB is installed on the local machine, after which a NoeClone

database is created automatically.

To make NoeClone work with a database on a remote server, you need to make

different configurations for every database.

For mysql, you need to create a NoeClone database instance in a remote database

server on a remote computer. etc. your database instance name is "npnc2"

Differ from other database, mysql need to create a user for remote connecting, So,

under MySQL command line, excute the command below to grant your power:

"grant all privileges on *.* to 'noegen'@'%' identified by '123456' with grant option; "

20

"noegen" is your username and "123456" is the password.

If you want access the database by "root" account , please enable the remote access

permission

If your mysql is installed on windows OS, you can grant the root power by the setting

below:

After the database server configureration, open the "Connect to database dialog" and

input the romote connection information.

21

Complete the configuration and click "ok", NoeClone will operate the data from the

remote mysql databse server.

For oracle, NoeClone didn't support DDBS(Distributed databse system) , so the

Database name option will be the name when your oracle database.

22

In the application, the database name is "XE"

Be sure your username and password is exist and correct, the NoeClone will operate

the data from the remote oracle databse server.

For SQLServer and Sybase, NoeClone is designed to support Microsoft SQL Server

(6.5, 7, 2000, 2005 and 2008) and Sybase (10, 11, 12, 15).

To select SQLServer as your database type and input the correct username and

password.

Then you can use SQLServer as the remote database server.

Now, you can select a kind of database that display in the "database type" combbox as

23

the remote database.

If the connection fails, an error message will be issued. Please check your network

connection, and make sure your remote server is available.

1.11 Getting started and Tutorial

When you are ready to run NoeClone after its installation, double-click the NoeClone

program icon in the program folder. When you run NoeClone for the first time you

will see an input screen.

24

Please enter your product number and service number.

Starting NoeClone When you launch the program, the user interface looks like the figure as follow.

You can start working with NoeClone by creating a new project or loading existing

NoeClone projects. Practicing with sample projects is a good way to get familiar with

the program fast.

25

26

Chapter 2 Quick start and Tutorials 2.1 Concepts and Interface

Plasmid map basics

Plasmid maps serve to highlight relevant functional or structural features of linear or

circular DNA molecules. These features can be represented by either specific sites or

contiguous segments. In a plasmid map, features are displayed to their positions on

the map in proportional scale. In NoeClone, a plasmid map consists of two major

components, the actual DNA molecule, which is represented by a line or a circle (the

map object), and associated features, which are drawn as sites or region segments

together with the map object. A feature is defined by its name, coordinate(s), and

other display attributes. Map features are linked to the map object in the following

manner:

Moving the map object moves all the associated features such that their relative

positions are maintained.

Insertion and deletion of map fragments automatically update the changes in the

positions of the affected map features.

Anatomy of a plasmid map

Cloning basics

Virtual or electronic cloning attempts to simulate the joining of DNA molecules and

keep track of changes resulting from the process. It aims to achieve the following:

27

1. Automatic joining of DNA sequences.

2. Automatic scanning of the restriction sites after each cloning step.

3. Correctly and automatically update sequence features and map features.

4. Keeping a record of cloning notes.

5. Providing easy ways for modifying fragment ends.

NoeClone provides all of these through integration with the map editor. Most relevant

commands for cloning are grouped under the Clone menu. Details on cloning are

given in Chapter 5.

Terminology

Several terms in NoeClone and this guide are used with specific meanings. They are

summarized below for easy references.

Plasmid map or map: Graphic representation of a DNA molecule, usually includes a

map object (a line or a circle), a name label, a size label, and some features (sites and

regions).

Map object: The map circle for a circular map or the map line for a linear map is

sometimes referred to as a map object, to distinguish it from other screen objects, such

as map features and drawing objects.

Map features or features: Features are map annotations in graphic form. You define

a feature by supplying relevant attributes, usually its name and location(s), and

display attributes such as font, color, and pattern. There are two fundamental types of

features: sites and regions. A region defines a contiguous segment on a map, and a

site refers to a single base marker on the map.

Sequence features: Sequence features are sequence annotations in text form. They

can be easily converted to map features by adding graphic information. Sequences

from some databases, such as GenBank and EMBL, often contain a list of sequence

features called features table. This table can be converted into map features when

NoeClone reads the sequence files from these formats.

Map fragment: A fragment is a piece of the map, defined by its first and last

nucleotides. A fragment may contain sequence and features. Map fragments are useful

in cloning operations.

28

Drawing object: Drawing objects are graphic shapes in the map window created by

one of the drawing tools available in the tool palette. Drawing objects can be moved

and resized with the mouse pointer.

Cloning project – key organizing concept in NoeClone

NoeClone uses the familiar “project” concept to organize activities and tasks for

creating related clones. In a laboratory setting, a particular cloning project can involve

multiple molecules, primers, adaptors, and enzymes, all geared toward creation of one

or more clones for a specific experiment. Similarly, electronic cloning in NoeClone

starts with creating a project, into which one can add molecules and design cloning

steps. The project window in NoeClone is a sophisticated workplace which includes

four coordinated work areas aimed at making the cloning process logical, intuitive and

convenient. The four work areas, called panes, are the map pane, the sequence/feature

pane, the content tree pane, and the overview pane, as shown below.

The map pane. This is the main working area where most actions take place. This

pane can contain multiple tabbed sub-panes, each of which can contain a map window

29

for drawing maps and other windows for holding text information. Note that each map

window can contain multiple maps, multiple gels, as well as other types of drawing

objects such as drawing shapes, floating texts, and images. Most of your interactions

with NoeClone take place in map windows, which function as an environment for

map drawing and annotation, cloning, and gel manipulation.

Thus, a project can contain multiple cloning flowcharts in different sub-panes.

Each sub-pane is an independent graphic environment where multiple maps and other

graphic objects can reside.

The Sequence pane. Located below the map pane, the sequence pane contains an

advanced, graphics-oriented sequence viewer for displaying sequences and feature

annotations. Two-way coordination between the map view and the sequence view is a

powerful feature of NoeClone designed to facilitate electronic cloning and sequence

manipulation. Selecting a map in the map view will update the sequence view with the

corresponding sequence of the map. Selecting a restriction site on the map leads to the

display of the sequence around the site with the actual cut pattern of the site shown.

This is useful for visualizing ends of sequence fragments during cloning. Selecting a

region feature on the map leads to highlighting of the corresponding range of

sequence in the sequence view, with the start of the range shown.

The sequence pane can be turned on and off by using Project | Show Feature Table

Pane and Project | Hide Feature Table Pane, respectively.

Another tab in this pane contains the feature table view which displays a list of

feature of the molecule being worked on in the map view.

The content tree pane. The content tree, located at the top-left corner of the project

window, servers as a “table of content” for objects in the project. It contains trees with

nodes denoting molecules, features in the molecules, gels and lanes in gels for the

project. Clicking on a tree node will either generate more information about the object

or select the object in the map pane. Right-clicking a node typically activates a

drop-down menu with commands related to the object, providing an easy and direct

way of manipulating objects in the project.

30

The Overview pane. Located at the lower-left corner of the project window, this pane

gives a bird’s eye overview of the map pane. A rectangle is drawn showing the

boundary of the current map pane. Moving the rectangle in the overview pane will

update the map view to the corresponding range, allowing you to quickly navigate

through the map view, which can be very handy when the map view is very large (e.g.,

containing many molecules).

Map view as a graphic front-end

The main working area in NoeClone is the map window, which can contain one or

more plasmid maps. Map window can be viewed as a multi-map, multi-page plasmid

map editor that functions as a repository for storing and presenting information about

DNA molecules. Each map window is correspondent to a document or belong to a

projectwhich can be saved and retrieved as a unit. Usually the first step is to create a

map window, or map document or a projectfrom the File menu. Then you place

maps onto the window.

Contained within a map are map features, usually restriction sites and regions. The

appearance of map features can be controlled by various means, such as size, style,

color, position, patterns, etc.

Tools in the toolbar

The toolbar contains tools for several common operations. The following is a brief

explanation for each tool. More details on their use are given in their respective

sections throughout this manual.

Create a new project

Open a sequence file

Open sequence from online database

Close current window

Save

Print current window

Cut

31

Copy

Paste

Search primers

Zoom in

Zoom out

Circularize or linearize map

Select enzyme to display

Add new feature

Define cloning fragment

Modify fragment ends

Ligate two fragments

Ligate fragments interactively

Create a new gel

Load gel

Draw shapes

Open help file

Set text font

Set text size

Bold

Italic

Underline

Cancel the change in the text font

Fill color

Line color

Font color

Fill pattern

Line width

Line style

Region style

Region thickness

Site style

Zoom percent

The active window (project)

32

Although NoeClone supports multiple document windows (each corresponding to a

project), there can be only one window at any time that can receive commands and

user actions. The status in this active window determines the accessibility and status

of other commands in the menus and in the toolbar. To make a window active, simply

bring it to the front by either clicking on it or by choosing its name from the Windows

menu.

Linkage between map and sequence

As explained previously, in NoeClone, plasmid maps are linked to their underlying

sequences, such that changes made in the map window are automatically updated at

the sequence level. Conversely, changes in the DNA sequence cause necessary

adjustment in the map views. Such two-way communications between the map and

the sequence gives you extra flexibility in manipulating maps in either the map

window or the sequence window.

Organization of NoeClone menus

Menu commands are organized according to their functions. Commands that perform

related tasks are usually grouped together. Following the convention of typical

applications, the File menu contains commands for dealing with documents, such as

for creating, saving, and printing files. The Edit menu contains commands for edit

sequence, graphic objects libraries. The Project menu contains commands for adding

molecule, modifying the map window and project properties. Commands for dealing

with map related tasks, such as defining and displaying map features, are organized

under the Map menu. Sequence-related commands, especially those for identifying

and displaying restriction sites, are listed under the Analysis menu. Commands

related to the formatting and display attributes of map elements, such as font, site

style, region style, are under the Molecule menu. Cloning and gel related commands

are listed under the Clone and Gel menus, respectively. Database menu can bring up

the database browser in your default web browser and brings up the database

connection dialog box for NoeClone connecting to database.The Windows menu

33

contains a list of window names corresponding to windows currently open. The name

of the active window (the topmost window) is checked.

Menu command convention

Throughout this guide, menu commands are written as Menu Name | Menu Item.

For example, File | Open Project refers to the Open menu item under the File menu.

Map elements as drawing objects

In NoeClone, plasmid elements resemble object elements in general drawing

programs and thus can be treated by conventional techniques for manipulating

drawing objects. In particular, NoeClone adheres to the following aspects of the

object manipulation convention:

The select-act approach. Like in other drawing programs, plasmid elements can be

selected by using the pointer tool, and commands can then be issued on selected

objects to achieve a specific effect.

Selection of objects by either clicking on them or by enclosing them with a

rectangle formed by dragging. Shift-clicking continues the selection without

de-selecting previously selected objects.

Click and drag an element to adjust its screen position.

Numbering system

In NoeClone, plasmid coordinates are expressed in base-pair (bp). Screen-related size

parameters such as the size and thickness of map circle are expressed in pixels. They

must be integer values.

When drawing a plasmid map, NoeClone uses a reference point for placing plasmid

features on the map. This reference point is the plasmid map origin, located at the top

of the circular map or at the left end of a linear map.

Restriction site numbering

NoeClone identifies restriction site locations by actual cut sites, not by recognition

sequences. For example, the location of the Sma I site in ATCCCGGGA is 6, not 3

(Sma I cuts at CCC|GGG). Note that the base after the cut site, i.e., G6, is identified as

the location.

34

Sequence handling

When constructing maps from DNA sequences, you can obtain the sequences from

the following sources.

Disk file. Sequences in text files can be read. NoeClone recognizes the following

sequence formats: plain ASCII text, GenBank, EMBL, GCG, and more.

Clipboard. Text or sequence in the clipboard can be used directly (for example, Paste

Sequence As Map in the Edit menu).

Program preferences

Several global parameters can be set in the Preferences dialog, available from Edit |

Program Options. Since these parameters are stored to the disk, they take effect even

when you exit the program and re-launch it. Preferences are explained in detail in

Chapter 7.

2.2 Tutorials

This section gives several tutorial lessons for you to quickly get acquainted with some

major aspects of NoeClone. Relevant files used by these lessons are in the Tutorial

folder of the program distribution. The lessons follow a step-by-step guided style,

without detailed explanation at each step. It aims to provide a quick view of the

program functionality, at the same time enabling experienced users to start using the

program quickly. Due to selected nature of these tutorials, many aspects of the

program cannot be covered. The rest of this manual contains expanded information

about all the functions encountered in these lessons, as well as functions not covered

here.

This section contains the following three lessons:

Plasmid map drawing

Cloning

Gel simulation

35

2.2.1 Lesson one: quick plasmid construction

1. Launch NoeClone from your NoeClone applications folder, or from the

desktop shortcut. Then create a new project and click OK.

2. Open the NM_003701 file in the sample folder using File | Open Sequence

To Project | From File.

3. A map is drawn in a new map window. Choose Map | Map View Option |

Show Common And Unique Enzyme Site to display unique enzymes in the

molecule.

36

4. Choose Map | Circularize Map to convert the map to the circular form.

5. Choose Molecule | Add/Edit Features to open the feature list dialog box.

Click New button, then enter a feature name, choose the type of the feature,

start and end location of the feature, and click Save. Exit the dialog box by

clicking OK. The defined feature should appear together with the map.

37

6. Use the arrow cursor, click on the map circle and drag the mouse to move the

map. Features move together with the map as a unit.

7. Similarly, click and drag the enzyme name to adjust the site location on the

screen.

8. Click and drag the feature segment to 'tear off' the region segment from the

map.

9. Click on the feature segment to select it, the click on the color palette on the

tool palette to select a color.

10. Click on the map circle, move the cursor over the selection box at the side of

bottom of the map, click and drag the box to enlarge or shrink the plasmid

circle. All map elements are adjusted after resizing.

38

2.2.2 Lesson two: cloning example

This lesson gives a simplistic example of combining map fragments in NoeClone.



2. Open the file named NM_173180 in the sample folder using File | Open

Sequence To Project | From File.

3. Select the two enzyme sites in the NM_173180 map, by clicking on EcoRI

287 first, hold the Shift key down, and click on SphI 3020. Choose Clone |

Define Fragments, noticing the correct sequence and sites in the dialog box,

enter name (eg1) and click OK to exit the dialog box. Click the top pane

where the fragment will be shown. The fragment is named fragment eg1.

39

4. Open the file named pUC18 in the sample folder using Project | Add

Molecule To Current Page | From Sequence File.

40

5. Select the pUC18 map, Choose Clone | Define Fragments, noticing the

correct sequence and sites in the dialog box, select left site EcoRI 451 and

right site SphI 410, enter name (eg2) and click OK to exit the dialog box.

Click the top pane where the fragment will be shown. The fragment is named

fragment eg2.

41

6. Choose Clone | Ligate Two Fragments to ligate fragment eg1 and fragment

eg2. In the dialog, select fragment eg1 and fragment eg2 respectively, check

A-C and B-D, then click OK button.

7. Click somewhere in the window to place the recombinant map. The new map

appears after clicking. Note that sequences, genes and sites have been

correctly updated with the new one.

2.2.3 Lesson three: gel simulation example

This lesson shows you the basic steps involved in using NoeClone gel simulator,

including setting up a gel, loading samples, and displaying digestion results.



42

2. Open the file named NM_173180 in the sample folder using File | Open

Sequence To Project | From File.

3. Click on the Gel Tool from the tool palette, Click the window to create a gel

dialog box. You can enter gel name, number of lanes, marker location, marker,

then Click OK button, a gel with will be created in the window. Lanes are

initially empty except marker lane. Marker lane is preload with specifically

ladder.

43

4. Click on the gel loading well on empty lane (the white box near the top of the

well). And choose Gel |Load Selected Lane, click Digest Molecule button.

Double click EcoRI in the enzyme list, then click OK button. The digestion

pattern of NM_173180 by the enzymes shown on the map is displayed on the

gel.

44

5. Drag a band to the working area, a new sequence will be shown.

45

Chapter 3 Drawing molecular maps A central part of NoeClone is its ability to draw molecular maps. Skills in

manipulating plasmid maps will help you better utilize other functions, such as

cloning and sequence analysis. This chapter focuses on map drawing functions, giving

you a step by step guide on how to create and organize maps in the map document

window.

3.1 Starting a new map

Sequence maps are created in map windows. A map window can hold multiple maps

across multiple pages. A new map can be created either from DNA sequence data or

from structural information of the map. Depending on your preference, the new map

can be put into a new window, or added to an existing one. The following table

summarizes various menu commands associated with creating new maps and opening

sequence files.

Add molecule In new sequence Adding to existing window

Molecule from disk file Project | Add Molecule

As New Page | From

Sequence File

Project | Add Molecule To

Current Page | From

Sequence File

Molecule from database Project | Add Molecule

As New Page | From

Accession Number


Current Page | From

Accession Number

Molecule from clipboard Project | Add Molecule

As New Page | From

Clipboard


Current Page | From

Clipboard

Without molecular

sequence

Project | Add Molecule

As New Page | Without

Sequence


Current Page | Without

Sequence

Note! Before you add molecule, your must create a project in File menu.

Keep in mind that you can copy a map in one window (Edit | Copy) and paste it into

46

another window (Edit | Paste).

Starting a map from DNA sequence

To create a map from a DNA sequence file on disk, choose Project | Add Molecule

As New Page | From Sequence File to open the sequence file. To create a map form

database, choose Project | Add Molecule As New Page | From Accession Number.

To create a map from DNA sequence stored in the clipboard, choose Project | Add

Molecule As New Page | From Clipboard. Any command first creates a new map

window, and then places the new map in the window.

Note! NoeClone can open sequences in standard text files in many sequence formats.

It determines the format automatically while reading the file so you need not specify

the format explicitly.

When a map is drawn from molecule sequences, NoeClone will do a search for

restriction sites and sequence features. You can control how NoeClone should display

the search results in the Preferences dialog box (Edit | Program options). For

example, you can have NoeClone automatically show unique enzyme sites on the map,

and show all the features (those are factory default settings).

If you already have a window open and wish to add a sequence-based map to the

window, choose Project | Add Molecule To Current Page | From Sequence File.

This command will prompt you to open a sequence file, and create a new map in the

existing window. The new map is initially placed near the center of the window. To

move the whole map, click and drag the main map to a new location.

Starting a map from without molecule sequence

You can define a plasmid map in the absence of any DNA sequence data by simply

supplying a size and a name for the plasmid molecule. Choose Project | Add

Molecule To Current Page | Without Sequence to bring up a dialog box which

prompts you to define the name, size, diameter, scale and map form of the new map.

The information entered in this dialog box serves as an initial setting to draw the map.

They can also be changed at later times.

47

Dialog box for creating a new map without sequence

Map name. The name of the plasmid will be drawn together with the map object. You

can change plasmid name any time using the Molecule | Properties menu command.

You also can rename the plasmid if you double click the existed name.

Molecule size. Enter the size of the plasmid molecule in base pairs. After a plasmid

size is set during the map setup stage, you should avoid changing it manually

afterwards. Cloning operations that change plasmid sizes, such as deletion and

insertion, update plasmid size automatically.

Screen diameter. Screen diameter determines the physical size of the map as drawn

on the screen. This number is expressed in pixels. Screen diameter can be changed

later by either re-entering this value or by interactive on-screen resizing.

Map scale. Map scale lets you specify the number of base pairs per screen pixel when

drawing the map. This provides an easy way to draw proportional maps.

Plasmid form. Select one of the radio buttons to set the map to either linear or

circular form. You can also linearize/circularize maps freely using the Map |

Linearize/Circularize command.

A new map window is created and the specified map will be placed in the center of

the window. You can then add other features and modify their screen display to

48

complete the map drawing. All sequence related operations (such as restriction site

searching) will be disabled if the current map is a map without sequence.

3.2 Working with sites

What are sites?

A site is a map feature defined by its name and map location. Sites are linked to their

maps with user-defined display properties, such as text attributes for site names, styles

for connecting sites to the map, and options for show/hide site locations.

Controlling the appearance of sites

A newly created site is drawn using the current default settings of font, font size, color,

and style. You can change these display attributes after the site is drawn. First select

the site (or a group of sites) with the arrow tool, and then choose appropriate

commands, as follows:

Screen position: Drag the cursor to move the selected site to a new position.

Font: Choose in the toolbar to set the font, size, style, and of the selected sites.

Site style: Choose to set options on whether the location should be drawn with the site, and how the site should be connected to the main map. Note that the connecting line between the map and the site is not mandatory in NoeClone.

Site Style

Color: Use the in the toolbar to set the color for the selected sites.

Pop-up color palette

49

Aligning and distributing site names

Groups of site names can sometimes be conveniently arranged by aligning and/or

distributing them along a reference line. Use commands from Map menu to make

such adjustments. Make sure the sites to be affected are selected prior to applying

the menu commands.

Align Site Name (submenu). Align a group of site names along a reference

line specified by five menu items.

Distribute Site Name (submenu). Distributes a group of text strings to a given

distance interval defined by positions of the outermost items in the selected

group.

Align and distribute sites

NoeClone also provides automatic re-calculation of site name positions as another

means for arranging sites. To do this, you can use Map | Calculate Site name

positions, causes re-positioning of site names as determined by NoeClone.

Deleting sites

Delete a site from the plasmid definition.

Using the arrow cursor, select the site (or sites), and then do one of the following:

♦ Hit the right button of the mouse.

♦ Choose Delete Site.

Sal I 652

Eag I 940

Xma III 940

Nru I 975

Sty I 1370

Ava I 1426

Msc I 1447

Original sites Aligned to the right and thendistributed over the height

Align to the right

Sal I 652

Eag I 940Xma III 940

Nru I 975

Sty I 1370Ava I 1426Msc I 1447

Sal I 652

Eag I 940Xma III 940

Nru I 975

Sty I 1370Ava I 1426Msc I 1447

50

3.3 Working with regions

What are regions?

NoeClone uses the term "region" to refer to map features that span a contiguous

segment on a map. When defining a region, the following attributes are specified

either explicitly or automatically from the default settings:

Name: The name of the region.

Start and end: The two locations that specify the first and last bases underlying the

region.

Region direction: On a circular map, does the region run clockwise or

counterclockwise from the start to the end? See next section for details about this

property of a region.

Drawing attributes: Text attributes for drawing region names and graphics attributes

for drawing region segments. The default document settings are applied when a region

is initially created, but they can be changed during later editing.

The direction of a region

A unique property of a region is its direction. NoeClone always draws a region from

its start point to its end point. This direction can be made visible when the region is

drawn with an arrow head: the arrow is at the end point of the region. This works well

on linear maps, where there is only one way to go from the start to the end.

On a circular map, however, the start and end of a region cannot unequivocally

determine how the region should be oriented, because two possible arcs can be drawn

from these two locations, one runs clockwise (CW) and the other counterclockwise

(CCW). To circumvent this, NoeClone uses another attribute, the direction, to specify

which direction the region is oriented from the start to the end. Thus, on a circular

map, a CW direction means the region will be drawn clockwise, and a CCW direction

means that region will be drawn counterclockwise. On a linear map, a CW direction is

equivalent to drawing a region from left to right, and a CCW one is equivalent to

drawing it from right to left.

51

The direction of regions: Gene 1 and gene 2 have the same start and end locations, but

appear differently on the map because they run in opposite directions.

Adding regions manually

To add a region to a map, use Molecule | Add/Edit Feature to open a dialog box (see

figure below). This dialog allows adding, deleting and changing sequence features

(sites and regions), usually associated with GenBank sequences as annotations. The

regions are not only graphically displayed in the Sequence window but are present in

feature table. You can select which molecule you want to edit in the top of this

window.

Each region takes one row in the feature list. The list of the regions is display in the

bottom of the feature list. When you select one region in the feature list, the

information of the feature is show in the right of the Add/Edit Features window.

There are three parts of a region in this window, Feature Details, Feature Range

Location and Feature Note.

Gene 1(1000-4000)Clockwise (CW) direction

Gene 2(1000-4000)Counterclockwise (CCW) direction

Map 110000 bp

52

Dialog box for add and edit features

Feature Details: You can enter the regions name and choose the type of the region.

Feature Type: You can select the predefined feature type or enter a name to define a

new feature type.

Feature Range Location: Select the format of range location. You can enter the start

site and end site in the Simple format. If you choose the GenBank location string,

please enter two numbers separated by two dots (100..282) or if it is a non-continuous

entity, such as introns, write it in this format: 100..150, 230..355, 2451..3781 (omit the

comma). The region will be in the complementary sequence if you select

Complementary in the window.

Feature Notes: There are two columns in the region notes: the NoteName and the

NoteContent column. If the list is long, a scroll bar appears on the right of the table.

You can edit any content in the table if you double click any text in the NoteName and

NoteContent column.

· Click Add Note to add new note in the Feature Notes.

· Click Delete Note to delete a row note in the Feature Notes which you selected.

· Click New to enter a new region. The insertion bar will automatically move beyond

the last feature. You can define the region details, region range location and region

notes of the new feature.

· Click Save to save the information of the selected region.

53

· Click Delete to delete the selected region. When you delete the selected region, the

region will be disappeared. So a box will ask you continue or not.

When you deleted a selected feature, a box will appeared.

· Click Import to open a text file from disk, the feature in the file will be added.

· Click Export to generate a text file which contains the information of the selected

feature.

· Click OK to confirm the edit of the sequence feature.

· Click Cancel to return main interface without change the sequence feature.

· Click Help to open the help file.

Controlling region appearance

You can modify the appearance of a region after it is initially defined in the feature

dialog box. All of the actions described below require the region to be selected first

(with the arrow tool).

Style: Region style determines whether the region should be drawn with an arrow to

indicate the orientation, and what type of arrow to use. The default region style is the

‘green arrow’, which may be changed to other styles by using button in the

toolbar.

Region Style

Thickness: The thickness of region segments can be controlled by clicking

button in the toolbar. Simply choose the desired thickness and apply it to the selected

regions.

54

Region Thickness

Shading pattern: The shading pattern of a region is controlled by using the pattern

pop-up palette in the toolbar. After selecting a region, you can assign it a pattern from

among 22 standard patterns available in this palette.

Pattern pop-up palette

Color: Color is controlled in the same way as shading patterns. Use the pop-up color

palette from the toolbar to assign a desired color to selected regions.

Pop-up color palette

Line style: The line of a region is controlled by using the pattern pop-up palette in the

toolbar. After selecting a region, you can assign it a desired style to selected regions.

Pop-up line style palette

Line thickness: The line thickness of region segments can be controlled by clicking

button in the toolbar. Simply choose the desired line thickness and apply it to

the selected regions.

Line thickness pop-up palette

55

Line color: Line color is controlled in the same way as color patterns. Use the pop-up

line color palette from the toolbar to assign a desired color to selected regions.

Line pop-up color palette

Changing region position

Region segments need not be aligned exactly on top of the map object. You can tear

the segment off the main map by directly dragging the segment with the arrow tool.

The region is drawn in proportion to the position of the segment. The map coordinates

of the region are not altered. This function is useful for organizing multiple regions in

the same map segment.

Deleting regions from a map

There are two ways to delete a region from a map.

1. Using the pointer cursor, select region segment, and then do one of the

following:

♦ Hit the right button of the mouse.

♦ Choose Delete.

♦ The region will be disappeared. So a box will ask you continue or not.

Choose Yes, the region will be deleted.

2. Inside the Add/Edit Features dialog box, select a region and hit the Delete

button.

Extract sequence from regions

Sometimes it is useful to view and subsequently use the sequence of a region on a

map. This can be done in NoeClone by using the Molecule | Extract Sequence From

Features on regions that are selected by the arrow tool. The extracted sequence is

created in a new text window, in FASTA format.

56

3.4 Working with map objects

A map object refers to either the main circle of a circular map or the main line of a

linear map. Although they behave as normal graphic objects (for example, they can be

moved and resized), map objects also play a special role in uniting map features as a

group, and accordingly bear special properties needed for these tasks.

Basic behavior of map objects

A map object contains information about the map that controls its graphic

representation and behavior. Most significantly, a map object links all the features

such that they together behave as a group, as follows:

♦ Moving a map object also moves all the features contained in the map.

♦ Resizing a map object scales all the features.

♦ Deletion or insertion of map fragments updates map features.

Moving a map

To move a map object, click on it with the mouse pointer and then drag the mouse.

Make sure to place the mouse pointer near the line during dragging. The map will

remain selected after moving. All the features in the map will move along with the

map.

Resizing a map

You can change the screen size of a map (i.e., the size of the map circle for circular

maps and that of the map line for linear maps) at any time during map construction.

There are two ways to do this:

1. Select the map, move the mouse pointer to one of the selection handles and

drag it, just as resizing any drawing objects. For linear maps, you need to

click and drag using the bottom-right handle in the selected map.

57

2. Open the NoeClone dialog box, and change the map scale field. This

dialog box can be opened by using the Map | Scale Maps menu command,

by select the map.

Resizing a map changes its map scale. The map scale is automatically updated when

you change it. Map scale is a useful parameter for drawing related maps with the same

scaling, by setting the map scale to be the same for all the maps.

Circular/linear map conversion

You can linearize a circular map at any position of the map circle. To do this, choose

Map | Linearize Map, and enter a location BEFORE which the molecule will be

opened (the default is 1), and click the OK button. You can also linearize a circular

map using restriction enzyme.

Note If the linearization origin lies within a region, the region will be spliced

into two smaller regions in the linear map.

58

To circularize a linear map, choose Map | Circularize Map. This command joins the

two ends of the linear map, and places the joint point at the 0 degree of the circular

map. The joint becomes the origin of the circular map.

The scale of the map is maintained during map conversion, which determines the

screen size of the new map.

Molecule properties

The Molecule | Molecule Properties command opens a dialog window, allowing you

to enter additional information pertinent to the molecule sequence. Molecule

properties are stored with the map, and can be viewed and edited anytime in the

properties window.

3.5 Handing multiple maps in a window

Multiple maps and the current map

NoeClone allows multiple maps to be placed in the same map window. Each map in

the window is treated as a group tied together by the map object. The most obvious

effect of this grouping is that moving the map object also moves all the features in the

map such that their relative positions to the main map are maintained. At any given

time there can be only one map that is active, which receives menu commands and

mouse actions. This active map is also referred as the current map.

Note that when a map window is initially created with File | New Project, there is no

map in the window.

Activating a map to make it the current map

If there is only one map in a map window, the map automatically acts as the current

map. If there is more than one map in the window, you can make a map to become the

current map by doing one of the following:

♦ Click on the map object to be activated. This also selects the map.

♦ Click on a map feature, either a site.

59

Note that the current map needs not always be selected. Once a map is made into the

current map, it remains so until another map is activated, even though it may not be

selected. In other words, if you activate a map by selecting it, deselecting the map will

not change its state as being the current map, unless another map is simultaneously

activated.

Adding a new map to a project

A map can be added to the current map window by one of several means: creating

from scratch, pasting from clipboard, duplicating from the current map, or generating

by a cloning process.

To add a map from scratch, choose Project | Add Molecule To Current Page |

From Sequence File or Project | Add Molecule To Current Page | Without

Sequence.

To add a map from the clipboard, select the map first and copy it to the clipboard

using Edit | Copy. Note that this copies the map and all its associated features as a

whole to the clipboard. Activate the map window to paste the map in, which can be

the same window as the clipboard map or a different window, and then choose Edit |

Paste. The map in the clipboard will be placed in the window.

Use Clone | Duplicate Map to duplicate a selected map in the same window. This is a

quicker way to generate a starting map in the same window.

New maps can be produced through virtual cloning as recombinant map from existing

map. Cloning is explained in detail in Chapter 5.

Removing maps from a map document

To delete a map from a map window, select it first and then hit the right button of the

mouse. Then choose Delete. You can also select the feature or the sequence map,

choose Edit | Clear to delete, and can click the name of feature or the molecule on the

left side of the content tree pane, click right button of the mouse and select Delete.

Duplicating a map

60

To make a duplicate of the current map, choose Clone | Duplicate Map. The copy of

the current map, whether selected or not, is created in the same map window. The new

map inherits all the properties of the map, including features and sequence if available.

The name of the new map is that of the old map + ‘copy’. If the duplication is

successful, the new map becomes the current map. It needs to drag manually to

position it to the specified location.

Copying and pasting a map

You can also select a map, copy it to the clipboard using Edit | Copy, and paste it

back to either the same map window or a different one, using Edit | Paste. The new

map inherits all the properties of the map, including features and sequence if available.

The name of the new map is that of the old map + ‘copy’. This allows you to move

maps between different map documents. If paste it in the same map window, the new

map will overwrite the current map. You need to drag manually to position it to the

specified location.

Scaling maps in a map document

The map scale parameter in each map controls the ratio of the actual size (in base

pairs) over the physical display size (in pixels). Drawing maps in the same map scale

lets you display maps in the same proportion, useful for drawing cloning flow charts

that require a constant scale for all maps involved.

To set or change the map scale, first select the map, then choose Map | Scale Maps.

The scale of the selected map is displayed in the dialog box. Enter a different value if

desired. If you wish to change other maps in the same map window to the same scale,

check on the box ‘Scale all map in view’ in the dialog box before clicking the OK

button. The map(s) will be resized according to the new scale.

Map scale dialog box.

61

Chapter 4 Sequence handling and analysis 4.1 Using DNA sequences in NoeClone

In NoeClone, sequences are owned by their respective maps, i.e., they are properties

of plasmid maps. A map can exist with or without a DNA sequence, but a sequence is

always associated with a map, except when a sequence is initially created within

NoeClone and a map has not been generated for the sequence. If a sequence exists for

a map, certain functions will be activated that can be used to take the advantage of the

available sequence information. This map-centric approach differs from many other

DNA analysis programs, which work primarily on sequences and generate graphic

maps as an additional function. In practice, however, you will notice little difference

when using commands to analyze sequences.

The following summarizes some of the major behaviors of sequences in NoeClone:

♦ Sequence input, whether from a file, clipboard, or database, triggers automatic

generation of maps. Thus, a map, not a sequence, is presented when you open

a sequence file.

♦ You can view and edit sequences after the map is drawn.

♦ Maps and sequences are linked so that changes in one are reflected to the

other.

Sequence file formats supported by NoeClone

Before you use DNA sequences with Noeclone, you need to have a file that contains

your sequence in a recognizable format. The sequence file can be created using a text

editor, a word processor or a DNA analysis program, or downloaded from the network.

When reading a sequence, NoeClone attempts to determine the sequence format

before accepting sequence data.

Note: NoeClone does nucleotide base filtering while reading sequence data. The

following codes (and their lower case equivalents) will be accepted into nucleotide

sequences: A, C, T, G, N, all other characters are ignored.

62

NoeClone can read the following sequence formats: GenBank, EMBL, FASTA, GCG

(Wisconsin), and Plain Text. Below are examples of some of the formats. In each

format, a short description is given followed by an example sequence.

GenBank: Sequence starts after the ORIGIN line, and terminated by //.

ORIGIN 193 bp upstream of EcoRV site.

1 gctgagctat gattagccgc tatttttttg tcctgaatga

EMBL: Sequence starts after the SQ line.

SQ Sequence 1542 BP; 357 A; 425 C; 425 G; 335 T; 0 other;

gctgagctat gattagccgc tatttttttg tcctgaatga

GCG: Sequence starts after two adjacent periods.

..

1 GCTGAGCTAT GATTAGCCGC TATTTTTTTG TCCTGAATGA

Fasta/Pearson: Comment lines begin with a semicolon, followed by a title line. Sequence

starts after the title line.

; pcnB sequence

; more comments

pcnB

GCTGAGCTATGATTAGCCGCTATTTTTTTGTCCTGAATGA

Plain Text: Sequence starts from the beginning of the file. No comments allowed.

GctgagcTatGattagccgctatttttTTgtcctgaatgA

Opening text-based sequence files

Once you have a sequence file ready, you can open it with File | Open Sequence to

Project | From File. A dialog box appears to let you select a sequence file. When one

file is successfully opened, the program searches for all the sites in this sequence for

every enzyme present in the enzyme library. When the search is done, a new linear

map will be created, showing all unique sites found in the sequence.

Note: If you open a GenBank or EMBL sequence file, the sequence features in the

feature tables will be converted to map features.

If you wish to have the program display other sites, you need to re-define your

selection of enzymes, described in a later section, Selecting enzymes to display on a

map.

63

In addition to text files, NoeClone can import sequence data from native files created

by several other sequence analysis programs, including CloneMap and MacPlasmap.

These choices can be made by using the File | Import From Other Programs

command.

Using sequences in the clipboard

If you have sequence data in the clipboard, you can use File | Open Sequence to

Project | From Clipboard to convert the sequence into a map. This function

bypasses the requirement for a disk file, and should prove more convenient than the

disk file if you have copied sequence from other text sources.

Sequences stored in the clipboard can also be inserted as a fragment into an existing

map, using Clone | Insert Fragment Chapter 5 (Virtual Cloning) describes this

function in detail.

Viewing and editing sequence

After creating a map from a sequence, you can view and edit the sequence. Changes

made in the sequence are automatically incorporated into the map view. NoeClone

provide a friendly interface for sequence view and edit.

The bottom portion of the map window (the sequence view) can display sequence and

locations of selected features. If this view is not already visible, choose Project |

Show Feature Table Pane. To hide the sequence view, choose Project | Hide

Feature Table Pane. Note that this view is not only for display but also editable.

The range of sequence display and selection respond to features selected in the map

view. Clicking on a site in the map, which selects the site, moves the display range to

the corresponding location in the sequence view. Selecting a region feature selects the

underlying range of the sequence in the sequence view. To select a range of sequence

flanked by two sites, click on the first site, hold down the left mouse button, and then

drag on the second site. The selected sequence can be copied to the clipboard using

Edit | Copy. This mechanism of copying sequences is useful for combining sequences

from different regions in a cloning operation.

64

The sequence feature table pane

Editing sequences

You can also edit the sequence of the current map in the feature table pane. However,

since the sequence is linked to the map, the changes you make in the feature table

pane will be updated on the map. Insertion or deletion of sequences in the feature

table pane leads to corresponding changes in the map, which could potentially slow

down your sequence editing.

4.2 Restriction enzyme analysis

Restriction enzyme analysis of DNA sequence constitutes a major portion of sequence

handling in NoeClone. This section explains each available function in detail.

Automatic restriction site scan

Since restriction site analysis is an inherent part of cloning, NoeClone does this

analysis automatically and implicitly. Automatic restriction site scan is done

whenever needed, for example, when the following situations arise:

♦ When a sequence file is opened.

♦ When a piece of DNA is inserted or removed from the map, causing previous

restriction data invalidated.

Selecting enzymes to display on a map

65

When a map is generated from a sequence, you can control what enzymes to display

on the map. There are two ways to accomplish this. One is to use the enzyme

selection dialog box, the other is to use pre-defined enzyme filters.

Use Map | Map View Option | Show Selected Enzyme Sites to open the enzyme

selection dialog box. This dialog box contains a list of enzymes in the current enzyme

library. Four separate selection criteria are provided, and enzyme recognition sites that

meet all four will be converted to site features and displayed on the map.

Dialog box for selecting enzymes and defining enzyme filters

1. Cut frequency. You can choose enzymes whose recognition sites occur at a certain

frequency in the sequence. The number of occurrence is entered in the Cut

Frequency field. In addition, you can use a pop-up menu to determine if the cut

number should be equal or smaller than the frequency. For example, Cut

Frequency <=3 will select enzymes that cut three times or less, but Cut

Frequency =3 will select enzymes that cut exactly three times in the sequence.

This pop-up menu can be activated by clicking on the compare sign.

66

If you enter ‘0’ as cut frequency, no enzymes other than the manually selected

ones (see below) will be displayed on the map.

2. Cutter size. This option lets you select enzymes based on the size of their

recognition sequences. For example, you can choose enzymes whose recognition

sequences are six base pairs (6 cutters) or longer, using Cutter size>=6.

3. Hanging type. You can use this option to select enzymes based on the following

three types of fragment ends after the cut: 5' overhang, 3' overhang, and blunt. A

total of seven options are available from a pop-up menu which can be activated by

clicking on the name of the cutter type.

4. Manual pick. You can also select specific enzymes of interest by clicking their

names in the enzyme table. Enzymes selected by this method will be used

regardless of the above three criteria. Multiple enzymes can be selected by holding

down the SHIFT key during clicking.

Note: To display only manually picked sites, enter ‘0’ in the Cut frequency in the

automatic enzyme selection section.

Note: This enzyme chooser dialog box is used in two other occasions. The first is

when doing a digestion of a plasmid to obtain fragment information (Analyze | Digest

DNA). The second is when changing enzymes in the gel lane (Gel | Load Selected

Line).

Your selection of enzymes in the enzyme selection dialog box can be saved to disk as

enzyme filters, which can be applied to new sequences, avoiding the need to re-select

the enzymes in the dialog box.

To create an enzyme filter, open the enzyme selection dialog box using Map | Map

View Option | Show Selected Enzyme Sites, select the enzymes to be used in the

filter, provide a name for the filter, and then click the Save Selection As Filter button.

All the options available in the enzyme selection dialog box can be utilized in the

filter. The new filter appears in the filters list in the dialog box. Next time when you

67

need to use the same set of enzymes as defined in the filter, simply choose the

corresponding enzyme filter in the filter list.

To edit an existing filter, open the enzyme selection dialog box, and select the filter to

be edited by clicking on its name in the filter list. Change the filter settings, and click

the Save Selection As Filter button to save the changes.

4.3 Generating restriction site summary

NoeClone allows you to list and view restriction sites from a DNA sequence in a

variety of ways. Graphic plasmid map is only one abstractive way of displaying

restriction sites from DNA sequence. Other options available from NoeClone are:

♦ Showing all the restriction sites together with DNA sequence, its translations,

and sequence features in text form.

♦ Listing sites sorted by enzyme name, cutting position, and cutting frequency in

either text or graphic form.

♦ Listing unique sites and absent sites.

♦ Summary of sites in the sequence.

♦ Listing of DNA fragments after digestion by selected set of enzymes.

These summaries are very useful for data presentation and experimental design. The

following sections explain these reporting functions in details.

Steps for generating a restriction site report

The restriction site reporting functions are available from the Map menu, and can be

applied to the current active map, as follows.

♦ In a map window, select the map from which the report is to be generated.

♦ Choose menu commands from Map menu.

♦ A text or picture window appears containing the requested information.

♦ To produce a different type of report, repeat steps 1-3 above, which produce

another output window.

68

Sorted text summary

You can obtain a text summary of restriction sites in the current map in a text window.

Several sorting schemes are available, all from the Map | Summarize Restriction

Sites submenu. To use them, first select the map to be analyzed, and then choose a

menu command. A text window appears containing the requested information. Below

are available options:

♦ Unique sites: enzymes that cut only once in the sequence.

♦ Absent sites: enzymes whose sites are not found in the sequence.

69

♦ Summary of each enzyme: locations of each enzyme, if found in the sequence,

arranged in alphabetical order.

Example of a sorted enzyme summary by name

♦ Enzyme usage. Number of cuts for each enzyme in the library.

Performing a digestion

The goal of doing a digestion analysis is to find out the length of fragments produced

by combinations of restriction enzymes. The same methods for selecting enzymes on

maps are used for selecting enzymes for digestion, although commands are located

under different menus. NoeClone offers two ways of achieving this:

70

1. Text summary. Choose an enzyme option from Analysis | Digest DNA

submenu. A dialog will be open as using Map | Map View Option | Show

Selected Enzyme Sites command. Note that the enzyme filters can be used to

achieve fast selection of enzymes, as described earlier. A text summary of

fragments will be generated in a new text window.

Example of a digestion summary

2. Gel display. Select the current map, choose Gel | Create New Gel and then

select a lane on the gel (by clicking on the loading well of the lane) and choose

Gel | Load Selected Lane. The fragments as digested by the enzymes

displayed on the map will appear on the gel, in a calculated migration distance.

The fragments can be converted into a text display by first selecting the lane

and then choose Gel | Describe Gel As Text. These functions are explained in

more details in Chapter 6.

Portion of the Gel menu, for details see Chapter 6

Finding sites with compatible ends

71

It is often desirable to identify restriction sites that are compatible with a given

enzyme cut. To do this, choose Clone | Find Compatible Sites. You then have

several options in the upcoming dialog box to specify the source of the sites (see

figure below).

The Finding compatible sites dialog box

♦ Pick an enzyme: You can choose an enzyme in the table, the selected enzyme

will display in the text box.

♦ Molecule: Choose the molecule to finding compatible sites.

♦ Result: The results are given in the bottom of the dialog box.

4.4 Modifying enzyme library

Editing enzyme library

The restriction enzyme library can be edited to add, remove, or modify enzymes.

72

Enzyme library editor

To edit enzymes in the library, choose Edit | Edit Libraries | Edit Enzyme Library

to bring up the enzyme editor dialog box. This dialog box consists of a list on the left

side that contains the names of all the enzymes currently in the library, and several

fields on the right for creating new enzymes and editing existing ones. When you

click on a name in the enzyme list, these fields will be filled with information about

the selected enzyme. You may want to click a few enzymes to understand the

meanings of these fields. Below are some rules when editing enzymes.

1. Recognition sequence should contain a sequence not interrupted by any

special characters. For example, the recognition sequence for BamHI is

GGATCC, not G’GATC’C, and that for AlwI is GGATC, not

GGATCNNN'N'N.

2. Cut sites for both plus strand and minus strand are numbers offset from the

first base of the recognition sequence. For example, the plus strand cut site and

minus strand cut site for BamHI (GGATCC) are 1 and 5, respectively, and

73

those for AlwI (GGATC) are 8 and 9, respectively. It is important to realize

that some enzymes, such as AlwI, recognize non-palindromic sequences, and

their cut sites are outside of the recognition sequences.

To add a new enzyme to the library, click the New button, and enter its name,

recognition sequence, and cut sites. Then click the Save button to save the enzyme.

The new enzyme will appear in the enzyme list, sorted in alphabetical order.

To modify an existing enzyme in the library, select the enzyme from the enzyme list,

and change the enzyme attributes in proper fields. Then click Save to save your

change. The original enzyme in the list will be replaced by the modified one.

To delete an enzyme from the list, select the enzyme first, and then click the Delete

button. The enzyme will be removed from the list.

After you are done with enzyme editing, click the OK button to exit the dialog box.

The changes you just made will be saved to the disk file, which means that from now

on these changes will take effect every time you use NoeClone.

Note: If you have a sequence file open, the changes you just made will not be

reflected automatically on your map. If you wish to find sites for modified enzymes,

you need to select the enzymes using the technique described earlier.

4.5 Other sequence analysis functions

In addition to restriction site mapping, NoeClone contains a number of other

commonly used analysis routines, including sequence editing and creation, translation,

ORF searching, sub-sequence searching, and sequence conversions. This section

summarizes how to use these functions.

74

Converting sequences

Existing sequences can be converted to its complementary sequence or parallel

sequence by using Analyze | Convert Sequence. In order to convert sequence, first,

you must input your DNA sequence. The sequence can be from current molecule or

pasted form clipboard. The Convert Sequence dialog accepts sequences in FASTA

format. It does no matter if the input is one sequence or multiple sequences.

The Convert Sequence dialog

The following three types of sequence conversions are available:

1. Reverse-Complement conversion. This conversion gives you the sequence in

the other strand. For example, converting GGGAAA results in TTTCCC.

2. Complement conversion. This conversion simply gives you complementary

bases. Thus, GGGAAA is changed to CCCTTT.

3. Reverse conversion. Reverse conversion gives you the sequence from the

reverse direction. In this example, GGGAAA is changed to AAAGGG.

· Click Keep Result to show result in the dialog.

http://www.ncbi.nlm.nih.gov/BLAST/fasta.html�



75

· Click Copy Result to copy the conversion result.

· Click Cancel to exit without conversion.

· Click Help to open a help file.

Translation

DNA sequences can be translated into protein sequences using the Analyze |

Translate command. Using this command, a translate sequences dialog will be open.

The Translation dialog

There are three ways for you to enter DNA sequence for translation.

1. You can select the molecule sequence from the drop-down list box. The box

contains all of the sequences which are open in the NoeClone.

2. Check Pasted Sequence. You can place the sequence of the clipboard into the text

area. The format of the sequence must be FASTA.

3. Click Open FASTA File to open a sequence from disk. The format of the sequence

must be FASTA.

There are six frames for you to choose. For example, you use the +1 reading frame

which means that the translation starts from the first nucleotide. It is possible to

76

translate in any combination of the six reading frames in one analysis. Stop codons

result in a dot being inserted in the protein sequence at the corresponding position.

You can choose the display style of the amino acid, 1-letter Translation or 3-letter

Translation. A drop-down list box allows you specify the genetic code for the

translation. The result of the translation will be shown in the bottom of the Translation

Sequences window.

· Click Translate to translate the sequence with the selected options.

· Click Keep Result to keep the result in the Translation tab.

· Click Cancel to return main interface without translation.

· Click Help to open a help file.

Finding open reading frames (ORFs)

NoeClone allows you to search for open reading frames (ORFs) and display the result

in the map. To start a search, choose Analyze | Find ORFs, and define your search in

the ORF dialog box. Enter the start codon (default is ATG), reading frames to search,

and the minimal length of the ORFs to be identified, then click Find.

77

The Open Reading Frame dialog box

If the molecule has a map in the current window, the ORFs that meet your

specification will be drawn as map regions on the map by clicking Show As Feature

button. They can be manipulated as regular regions.

Searching sequences

You can use search subsequences in a map created from sequence. Choose Analyze |

Find Subsequence to opens the sub-sequence detection dialog box for finding

specified sub-sequence string in the sequence, such as motifs. Use this dialog box to

specify search criteria for sub-sequence in the current sequence.

Search subsequence dialog box

·Click Find to search the subsequence.

·Click OK to show the result which you checked in the result list.

·Click Cancel to return.

·Click Help to open help file.

The adjustable parameters for the search are:

• Input Sub-sequence: Input a subsequence which you want to search.

• Location: The range of the sequence. If a sequence was selected, the sequence

range is listed in the Location of the dialog. If no sequence was selected, the

Location site is full-length sequence.

• Set mismatch: Specifies the number of mismatch bases.

78

• Complementary: Search complementary strand.

After completing the settings, click Find. The subsequences will be shown in the

result list. You can choose which subsequence you want to show in the Sequence

View Area.

Double/Single strand

Using the Double/Single Strand command in the Molecule menu, you can change

the strand style between double and single.

Translate the selected sequence

In NoeClone you can translate a nucleotide sequence into a protein sequence using the

Translate command in the Molecule menu. Usually, you use the +1 reading frame

which means that the translation starts from the first nucleotide. Stop codons result in

an asterisk being inserted in the protein sequence at the corresponding position. It is

possible to translate in any combination of the six reading frames in one analysis.

1. Translate selected sequence. You can select any region in the sequence and

translate the selected sequence into a protein sequence. You can choose the

reading frames.

2. Setting translation style. When you choose this menu item, a dialog box will

be opened which lets you specify the genetic code for the translation. A list of

genetic codes will be displayed. Choose the appropriate one and click OK.

79

This is available only for nucleotide sequences.

Setting translation

·Click OK to save the setting.

·Click Cancel to return without save.


3. Delete selected translation. Use this option to delete the selected translated

protein sequence.

1. Select a translate sequence by clicking it.

2. Select Molecule > Translate > Delete Selected translation. A dialog

appears, asking you to confirm your choice.

3. Click Yes to delete the feature or No to leave the feature and return to the

sequence.

4. Remove all translation. Use this option to delete all the translated protein

sequence.

1. Select Molecule > Translate > Remove all translation. A dialog appears,

asking you to confirm your choice.

2. Click Yes to delete the feature or No to leave the feature and return to the

sequence.

Primer analysis

NoeClone can report some basic parameters for primer sequences, which can help you

to assess the quality of primers. Use Analyze | Analyze Primers… to bring up the

primer analysis dialog box, enter or paste in a primer sequence, then click the Analyze

80

button to generate analysis results. You can copy the results as text to clipboard and

use them in other programs.

Blast analysis against sequences in local databases

The NoeClone database stores sequences of molecules in projects. If you wish to

identify sequences and associated projects that contain a particular query sequence,

you can use this convenient function to achieve.

81

Multiple sequence analysis

NoeClone allows you to align multiple sequcenes and display the result with Jalview.

To start a multiple sequences alignment, choose Analyze | Multiple Sequence

Alignment, and define your alignment in the dialog box.

82

You can input your sequences by two ways, from file or from database.

Click Open from file to open sequences file (The sequences in the file must be

FASTA format) for alignment.

83

Open from database to select sequence in the database for alignment.

After finished, choose the output format (default is a test result). If you select show

result with Jalview, you must install Jalview first and set the path of Jalview execute

file in the dialog.

Run to start align.

Click Cancel to return.

Click Help to open help file.

84

85

Chapter 5 Virtual cloning

NoeClone can simulate steps of laboratory cloning experiments, automatically

generating sequences of the resulting recombinant DNA products at each step. This

essentially involves joining two or three DNA sequences at specific locations and in

theory can be done manually with a sequence editor or even a text editor. However,

NoeClone provides many functions that make them easier and more complete than

manual editing. Specifically, you will find the following advantages in electronic

cloning.

1. Automatic joining of sequences.

2. Detection and modification of incompatible fragment ends.

3. Automatic joining and splicing of map features.

4. Automatic regeneration of graphic maps.

5. Visual interface for easy manipulation.

5.1 Cloning basics

Cloning in NoeClone resembles cloning at the bench. A fragment from one map can

be inserted into a destination map to create a recombinant molecule. Fragments can

also be deleted or inverted within a map. During cloning, NoeClone checks

comparability between fragment ends, and allows modification of ends when they are

incompatible. Additional flexibility is provided that simplifies map construction,

although they do not necessarily resemble bench manipulations. This includes

opening DNA molecules at any point, inserting fragments with unknown sequence,

placement of resulting maps in either the same window or a different window.

Cloning can be performed at either the map level or at the DNA sequence level.

Working directly with DNA sequence is conceptually simpler, but it requires that you

have the inserting sequence in the clipboard, and know exactly where to insert and

how to modify the ends, if necessary. On the other hand, working on the map level

offers more choices, although sometimes more steps are required to accomplish the

cloning. In addition, inserting at the map level has the advantage of moving map

86

features contained in the inserting sequence into the destination map, automatically

regenerating maps with updated features, will also be there for sequence cloning.

Cloning on the map level involves two steps:

1. Defining insert fragments.

2. Defining a vector fragment and setting up a ligation with it. When setting up a

ligation, you work in a dialog box in which you select and arrange the insert

fragment(s) and the vector fragment, make modification if necessary, and

decide how to receive the cloning result.

Although not as commonly used as joining two DNA fragments in a ligation step,

"three-fragment ligation", which allows joining of three DNA fragments with

compatible ends in a single reaction, offers additional flexibility and efficiency in

designing cloning experiments. NoeClone supports three-fragment ligation by letting

you define and ligate two insert fragments and one vector fragment, which can all be

from different maps in either the same window or a different window.

For simple insertions and deletions that do not explicitly require a match of

compatible ends, NoeClone provides simpler dialog boxes that allow quicker, albeit

less flexible, joining of fragments.

Overview of cloning-related commands

87

5.2 Defining insert fragments

A common task during cloning involves specifying a fragment using two numbers.

NoeClone follows two simple rules, the inclusive rule and the clockwise rule, to

accomplish this. These two rules are described below.

The inclusive rule

A map fragment can be specified by two numbers that represent the first and the last

bases of the underlying fragment. Nucleotides at both locations are included in the

fragment. So if you define a fragment that runs from n1 to n2, the length of the

fragment will be n2-n1+1. This is the inclusive rule for specifying map fragments,

which is applied in places where fragments are encountered, such as when defining an

insert fragment and deleting or inverting a fragment within a map.

As an example, in a sequence GATC, the sub-sequence AT starts at 2 and ends at 3,

the length of which is 3-2+1=2. The following example illustrates an important

relation between locations of restriction sites and that of fragment definitions. The cut

sites of the two BamHI sites are 2 and 10, which are displayed on the map or the

sequence. However, when defining a fragment resulted from these cuts, you need to

give the first and last bases in the fragment, which are 2 and 9 (not 10) respectively.

Therefore, if you select two enzymes in the map and then open a fragment-related

dialog box, NoeClone puts the location of the starting enzyme as the first base, and

the location of the ending enzyme minus 1 as the last base in the dialog box.

2 10

G’GATCCTTG’GATCC

The clockwise rule

An important question when defining map fragments concerns with the orientation, or

direction of fragments, especially on circular maps. On a circular map in the figure

below, site A and site B can be used to specify two fragments, one goes across the

origin and the other does not. How does one specify which fragment to use?

NoeClone follows a simple Clockwise rule to resolve this problem.

88

The clockwise rule: A fragment always starts at a starting point, going in the

clockwise direction, and ends at an ending point. The clockwise rule of defining map

fragments. In this diagram, fragments A and B both run in the clockwise direction. In

the interactive mode within the program, to define fragment A, click on site A first,

hold the Shift key and click on site B. Reverse the order of clicking to define fragment

B.

Thus, in the figure above, the region from 200 to 999 defines fragment A, whereas the

region from 1000 to 199 defines fragment B which goes across the origin.

It follows that a fragment includes the origin if its starting point is larger than its

ending point, otherwise it does not include the map origin.

Define fragments

To define an insert fragment, open the Define Insert fragment dialog box by Clone |

Define Fragments.

Map1

3000 bp

Site A 200

Site B 1000

Fragment B 1000-199

Fragment A 200-999

89

Defining an insert fragment

This dialog box displays several types of information about the fragment to be defined,

including its name, start and end, the cutting enzymes, the sequences at both ends, and

the length of the fragment.

To define the fragment, you can get the fragment sequence from two ways. One is

From molecule, you can get a molecule sequence in the drop-down box. In addition,

you can get Sequence from clipboard. You can enter numbers that specify the start

and the end of the fragment.

To define an insert fragment flanked by two enzymes, construct the map so that the

desired enzymes are displayed on the map. Using Select Left site and Select Right

Site buttons, select the starting enzyme and end enzyme. When both enzymes are

selected, you will see the two selected enzymes now appear in the dialog box,

defining a fragment as indicated in the box. To define a fragment not flanked by

enzymes, open the dialog box by the same methods. In the dialog box, enter numbers

that specify the start and the end of the fragment. The fragment is treated as blunt

ends when defined this way.

The defined fragment sequence will be shown in the middle of the dialog box. You

can keep it as permanent molecule or use it as temporary (will not be saved).

90

If this fragment is what you wanted, click OK to exit. The defined fragment is

recorded as a new molecule in the project tree, and will be available for use in

subsequent cloning steps.

Defining fragments in the sequence editor

You can define an insertion when working in the sequence editor. First select the

sequence by dragging the I-beam cursor, then choose Edit | Copy, which copies the

sequence into the clipboard, then choose Clone | Define Fragments, get sequence

from clipboard.

5.3 Setting up a ligation reaction

Ligation of two fragments

The Clone | Ligate Two Fragments dialog box is the center of action during a

ligation reaction. It contains three main parts for setting up three stages of a ligation:

preparation of first fragment (vector molecule), preparation of insert molecule, and

the outcome of the ligation product (see below).

Defining a ligation reaction for two fragments

The meaning of each item is given below. They are explained in more details in the

next few sections.

91

♦ First fragment (vector): You can choose the first fragment in the drop-down

box. The actual ends produced by the enzymes selected before invoking the

dialog box are shown in the sequence box. These ends can be modified by

using the Modify Fragment button.

♦ Second fragment: You can choose the second fragment in the drop-down box.

The sequence and its ends are shown in the sequence boxes as with the first

fragment and can be modified in the same way.

♦ Resulting map. You can select the ends of the two fragments which will be

ligated. You can enter the name of the new molecule. The size of the resulting

is updated after every modification of the ends. The resulting map can be

created as a new map in the same window as the vector map, or as a new in a

new window.

Preparing first (vector) fragment

The first fragment (vector) map is the current map which you selected before the

ligation dialog box was invoked. The first (vector) fragment can be bounded by either

the enzymes selected prior to the dialog box was selected or by artificially supplying

map coordinates in the dialog box.

DNA sequences at and around the cut sites are displayed in a box to assist you in

achieving the correct cutting. The sequence changes when you change the cutting

positions and when fragment ends are modified. What you see at the sequence is what

will be incorporated in the final product.

If you choose to ignore the cutting enzymes and open the vector at two map positions,

you can enter first and last bases of the vector fragment in the corresponding fields.

Modifying fragment ends

You can modify the ends by clicking Modify Fragments button or Clone | Modify

Fragment Ends. A dialog for modifying ends will be opened. Click on the pop-up

menu to select a molecule to modify. The sequence box is displayed in the middle of

this dialog. The default option is no modification, but you can choose to either fill-in

or chew-back to create blunt ends, if necessary. The changes at the fragment ends are

immediately shown in the sequence box.

92

The dialog box for modifying fragment ends

The Partial Fill-in and Partial Chew-back let you modify the ends at the per-base

resolution. You need to enter the number of bases to be filled or removed in a dialog

box when choosing these commands.

Add adaptors

If the sequence end is blunt, the Add adaptor button can be clicked. When you add

adaptor to the sequence, a dialog box will be opened. Click on the pop-up menu to

select an adaptor library. You can choose an adaptor in the library.

93

The dialog box for adding adaptor

·Click Edit Adaptor to modify the adaptor in the library.

·Click Select to add the selected adaptor to the sequence end.



Preparing insert fragments

As described in the previous section, you should have defined a second fragment

before invoking the ligation dialog box.

Which fragments to use? You should have defined the second fragment before setting

up the ligation.

Modifying fragment ends. As with first fragment preparation, you can modify the

ends of the insert fragment as the first fragment.

Direction of insert fragments. The direction of the insert fragment as specified is

critical as it determines how the fragment is put together with the vector. By

convention, the enzymes and sequences in this dialog box are positioned such that the

left enzyme (or the left end) is always the lower end of the molecule, and the right

enzyme (or the right end) is the higher end (with a higher coordinate). Thus, during a

94

ligation, the enzyme shown on the left in the insert is matched to the enzyme shown

on the right in the vector, and the enzyme shown on the right in the insert is matched

to the enzyme shown on the left in the vector.

Controlling resulting maps

The ligation product is a new map representing the recombinant molecule. NoeClone

will inform you where the output map should be positioned.

A box informs you where the fragment will be shown

Ligation of three fragments

NoeClone allow you ligate tree fragments by select Clone | Ligate three fragments.

When you do this, it is important to know the relationship between the ends and

directions of the fragments as indicated in this figure.

Relationship among the three fragments during ligation. Letters depict fragment

ends. Arrow lines show links between fragment ends that are joined during ligation.

The ligation three fragments dialog box contains four main parts for setting up four

stages of a ligation: preparation of first fragment (vector molecule), preparation of

second molecule, preparation of third fragment, and the outcome of the ligation

product (see below).

Vector fragment

Insert fragment 1

Insert fragment 2

a b

c d

e f

a b

c

de

f

95

Defining a ligation three fragments reaction

The meaning of each item is given below. They are explained in more details in the

next few sections.

♦ First fragment (vector): You can choose the first fragment in the drop-down

box. The actual ends produced by the enzymes selected before invoking the

dialog box are shown in the sequence box. These ends can be modified by

using the Modify Fragment button.

♦ Second fragments: You can choose the second fragment in the drop-down box.

The sequences and ends are shown in the sequence box as with the first


♦ Third fragments: You can choose the third fragment in the drop-down box.

The sequences and ends are shown in the sequence box as with the first


♦ Resulting map. You can enter the name of the new molecule. The resulting

map can be created as a new map in the same window as the vector map, as a

new in a new window.

96

You can invert the insert sequence if you want to have the insert ligated in its opposite

orientation, by clicking on the ‘Flip fragment’ checkbox. The sequence in the

sequence box will be updated to reflect the inversion.

·Click OK to ligate the three selected fragments.



5.4 High-throughput cloning

NoeClone allows you to ligate multiple fragments to a vector. Using Clone |

High-Throughput Cloning command, you can specify this ligation. In the dialog box,

you can choose the vector in the drop-down menu, and then enter the number of the

insert region. The multiple sequences must be FASTA, and can be selected by clicking

Open File button. You can set the output file path and choose single file or multiple

files to save the results.

·Click OK to ligate multiple fragments.



Then you can get the corresponding result in the specified folder.

97

If you saved as single file format, you can get the single multiple sequences with

FASTA format and multiple recombinant molecules were shown in the same file.

And you can get a group of single-files if you saved as multiple sequence format file,

and every file represent a fragment.

The result can be read not only in text format, but also can read directly by software

and get the corresponding map format. Also, you can edit map at the same time.

Multiple sequence and result

The map of single file

98

Individual result map of Multiple File

5.5 Quicker and simpler cloning

In addition to the ligation dialog box described above, NoeClone provides several

simpler dialog boxes for quickly defining cloning operations that do not require the

match of compatible ends. They are useful for quickly joining fragments by map

locations.

Insert fragment

The insert fragment dialog box allows you to insert a fragment into a map without

requiring the match of compatible ends. It has less number of options than the ligation

dialog box, but provides a cleaner working area for simple cloning steps. To use the

quick insert dialog box, do the following:

1. Choose Clone | Insert Fragment, select the molecule and modify the insert

site if necessary. Note that the insert fragment will be placed BEFORE the

nucleotide represented by insert site.

2. Select the source of insert using radio buttons. Note you can use a pre-defined

insert fragments, sequence from the clipboard, or an unknown sequence.

Predefined fragment. Clicking on this radio button selects the currently

defined insert fragment as the insert.

99

An undefined fragment. This option lets you insert an arbitrary fragment,

without underlying DNA sequence, into the current map. If you choose this

option on a vector map with sequence, 'N' will be inserted into the vector

sequence. You need to specify the length of the fragment in this option.

Sequence entered below. This radio button lets you enter a sequence in the

sequence box or open a sequence file. This is useful when you have copied

sequence from another map or another program that you want to insert into the

current map. The length of the sequence is calculated and shown. Note that

characters in the sequence which you entered are filtered and only legible ones

will be accepted during ligation.

3. Click Keep Map Scale if you want to resize the map after the insertion, click

this box off if you want the resulting map to be the same screen size as the

parent map.

4. Click OK. The selected destination map will be changed to reflect the changes

you made.

Dialog box for inserting fragments

You can specify the following options in this dialog box:

100

Site of insertion. Enter the base number BEFORE which the insert will be

placed. If you clicked on a site before invoking this dialog box, the site location

will be entered automatically in this box.

Source of fragment. Use the radio buttons to determine whether you want to

insert sequence from the sequence file or insert an un-specified region with a

given size.

Keep map scale. Turn this checkbox on if you want NoeClone to scale the

map after the insertion (i.e., map scale remains the same). Turn it off if you

wish to keep the map in its original size, in which case map scale will be

changed.

After the insertion the map will be redrawn with map features updated in the new map.

If the map contains DNA sequence, it will be re-scanned for restriction sites.

Delete fragment

The delete fragment dialog box allows you to delete a fragment within a map without

regard to the compatibility of fragment ends. To use this dialog box, enter the deletion

range specified by the locations of the first and last bases in the delete fragment, as

dictated by the inclusive rule. For example, to delete ATCGA in sequence

GATCGATC, the starting and ending numbers should be 2 and 6, respectively.

When working with circular maps, the specification of the deletion range also follows

the Clockwise Rule, i.e., the deletion runs in the clockwise direction. For example, in a

circular plasmid of 1000 bp, deletion from 10 to 99 removes a fragment of 90 bp,

whereas a deletion from 100 to 9 removes a fragment of 910 bp that spans the origin.

The order of these two numbers makes a big difference!

Note that in the deletion dialog box you specified a fragment which will be removed

from the map. This is opposite from creating a deletion in the ligation dialog box,

where you specified a fragment which will be kept after the deletion.

If you wish to keep the map scale after the deletion (i.e., map scale remains the same),

turn on the keep map scale check box. Turn it off if you wish to keep the map in its

original size.

101

Deletion of a plasmid fragment physically removes that region from the plasmid,

resulting in a decrease of the plasmid size. Plasmid features within the deleted region

are automatically removed. If the deletion ends inside a region, the region will be

truncated. The sequence of the map is updated after the deletion, and the restriction

sites will be re-scanned to reflect the changes in the sequence.

Dialog box for deleting map fragments

The deletion joint site is automatically marked with a site named ‘Junction’, which

may be used as a reference for subsequent insertion.

Inverting plasmid fragments

You can invert a plasmid fragment in a map. Use Clone | Invert Fragment to open

the inversion dialog box, enter the range of the fragment and select Invert.

Defining an inversion event

You can define the range of the inverted fragment. The two numbers are BEFORE the

affected bases, and the range follows the Clockwise Rule as described previously.

102

Example. In the following sequence GATCGATC, to invert the sequence ATCGA,

the range of the fragment should be from 2 to 7. Note that the bases between 2 and 7,

including base 2 but excluding base 7, are affected. The length of the affected

sequence is 7-2=5 bases.

Inversion affects all the plasmid elements within the region, all the features in the

inverted region are reversed relative to the region boundary.

5.6 Gateway cloning

Gateway is a cloning method based upon the site specific recombination of lambda

bacteriophage. Two types of recombination sites have been engineered to recombine

uniquely between the two ends of a source sequence and a host vector. The sites have

also been engineered to allow the recombination reactions to be completely reversible

using two sets of catalytic proteins. These two reactions are called LR and BP, so

named because of the recombination sites involved in each; LR recombines attL and

attR sites, BP recombines attB and attP sites. The recombined sites transform by

swapping opposite halves into the opposite set, so attL and attR become attB and attP

and vice versa. Vectors engineered to contain these sites have been given the names:

Entry Clone, Expression Clone, Donor Vector, and Destination Vector.

Creating entry clone

1. Select Clone | Gateway Cloning | Create Entry Clone to display the following

dialog:

103

NoeClone automatically creates the Entry Clone. The Advisor dialog prompts you to

select a Donor vector by clicking Select donor vector.

2. After you select the fragment from a drop-down box, you can add attB sequence to

the fragment ends. The fragment and the attB sequence will be displayed.

3. Select a Donor vector from the drop-down box, then click OK to extract the cloned

sequence to the current window or a new window, and the linear insert will be created

and stored as a sequence project within the front most cloning project.

Note: In addition to BP Cloning, there are two ways to create an entry clone (TOPO

Cloning and Restriction/ligase cloning). You can select one of them in the dialog box,

the steps of them are like those in BP cloning.

Creating expression clone

1. Select Clone | Gateway Cloning | Create Expression Clone to display the

following dialog:

104

NoeClone automatically creates the Expression Clone. The Advisor dialog prompts

you to select an expression vector by clicking Select Vector.

2. After you select the expression vector, you can add an Entry Clone by clicking

Add.

3. Enter the name of the new molecule, then click OK to extract the cloned

sequence to the current window or a new window. The linear insert will be created


5.7 TOPO cloning

Directional TOPO Cloning is a method that utilizes the binding activity of

Topoisomerase I. A sequence of interest is PCR amplified using a forward strand

primer with four additional bases (CACC). Commercial vector sequences have been

engineered with topoisomerase bound at 3’ and a complementary 5’ GTGG overhang.

The overhang invades the 5’ end of the PCR product and anneals to the added bases.

The 5’ hydroxyl group of the PCR product attacks the topoisomerase bound to the

vector, releasing it and causing the ligation of the phosphate backbone. Orientation of

the insert is determined by the 5’ overhang, allowing the other end to be blunt.

105

1. Select Clone | TOPO Cloning | TOPO Clone to display the Create Directional

TOPO Insert dialog. The selected sequence is extracted in a single step and it

simulates its amplification with a 5’ CACC prefixed primer. A sequence prepared in

that way is immediately ready to take part in a Directional TOPO Cloning reaction as

a directional TOPO®

2. Select the vector by clicking the Select Vector button.

3. Enter the name of the new molecule, then click OK to extract the cloned

sequence to the current window or a new window. The linear insert will be created


Note: In addition to BP Cloning, there are two ways to create TOPO clone (TA

Cloning and Zero Blunt TOPO Cloning). You can select one of them in the dialog box,

the steps of them are like those in BP cloning.

insert.

5.8 Define PCR reactions

In NoeClone, you can generate a sequence using PCR reaction. The PCR Fragment

command allows you define the reaction. There are three parts in the Define PCR

Reactions dialog, Template, Select primers and PCR parameters.

106

Template: The target sequence can be from current molecule or pasted form

clipboard. You can define the location of the template.

Select primers: In order to define a PCR reaction, you must define the primers. The

primer should be typed in the test area or picked from a primer library or a primerset

library.

PCR parameters: You can enter the parameters for the reaction, including 3’ Exact

matches, Mismatch and Product size.

·Click Run to generate the PCR product.

·Click Cancel to exit the Define PCR Reactions dialog.

·Click Help to open the help file.

107

Chapter 6 Gel simulation NoeClone provides an integrated gel simulator that can display the migration patterns

of DNA fragments on an agarose gel. The gel simulator is useful for predicting and

confirming patterns of DNA digestion and obtaining both graphic and text record of

the digestions.

6.1 Gel overview

A gel is a special type of graphic object in the map window. As with other drawing

objects, a gel is created by mouse clicking and dragging, and the gel image can be

moved, re-sized, and colored. The ability of setting gels in the same window as

plasmid maps adds convenience for recording cloning experiments. In addition,

multiple gels can exist in the same map window.

As illustrated in the figure below, each lane of a gel has a loading well. The loading

well can be selected by clicking on it. Once selected, the well becomes the current

active well, which can receive gel/lane-related commands such as loading, digestion,

and gel-text conversion. Similarly, once a gel is selected, gel-related commands in the

Gel menu will be activated, and become applicable to the gel.

Overview of a gel

108

6.2 Creating gels

To create a new gel, choose from the tool bar, or choose Gel | Create New Gel.

A dialog will be open for you to define the new gel.

Define a new gel. Several important gel parameters can be set in this dialog box.

In the dialog box shown above, you can specify the following parameters about a gel:

♦ Gel name: You can type a name about the gel.

♦ Number of lanes: Enter a desired number (default is 5). Gel lanes will be

added or removed from the right end of the gel.

♦ Marker Location: Enter a desired number (Greater than 0, less than the number

of lane). Marker will be show in the lane.

♦ Marker: A set of gel standard markers are provided in the combobox. You can

choose an appropriate marker.

♦ Show band sizes at Lane: Enter a desired number (Greater than 0, less than the

number of lane). Show band sizes at the lane.

♦ Note: You can type in notes about the gel. The note field is limited to 255

characters.

Click in the map window where you want the gel frame to be, and drag to enclose the

gel frame. A gel with five wells will be created. By default, the first well of the gel

will be loaded with a gel standard, which is 1 kb ladder as manufacturer setting. You

can change the gel properties of gel frame using Gel | Gel Properties.

109

6.3 Loading gels

To load a sample on a gel, you need to choose a map, a feature or a sequence,

representing a DNA molecule, as the loading material, and select a well on the gel to

load into.

Loading onto gel

Clicking on a loading well in the gel, and choose Gel | Load Selected Lane. A dialog

box will be open as follow.

Load gel lane. Several important gel parameters can be set in this dialog box.

In the dialog box shown above, you can specify the following parameters:

♦ Lane number: Enter a desired number (Greater than 0, less than the number of

lane). Load a molecule in the lane.

♦ Lane name: You can type a name about the lane.

♦ Load molecule: A set of molecule are provided in the combobox. These

molecules contain all sequences which are opened in the NoeClone. You can

choose the sequence that you want to load the gel.

♦ Load Marker: A set of gel standard markers are provided in the combobox.

You can choose an appropriate marker.

110

♦ Replace previous content: Whether or not to replace the original contents in

the lane.

♦ Digest Molecule: The button will open a dialog box for digesting sequence,

which allows you choose digesting enzymes. You can use enzyme filters to

select enzymes or pick them manually in the dialog box.

The dialog box to select enzymes

·Click OK to digest the sequence with the setting.

·Click Cancel to return without save.


·Click Save Selection As Filter to save selection as filter.

To set restriction enzyme filter:

1. To filter by cut frequency, check the Cut frequency check box and enter

the desired cut frequency. Entering a value of 0 will return all

non-cutters.

2. To filter by the size of the recognition sequence, check the sequence

size check box and enter the desired size.

111

3. To filter by the type of resulting ends (blunt, 5' overhang, or 3'

overhang), check the Overhang check box and select the desired type.

Create a custom enzyme set:

1. In the left of the dialog, choose your enzymes library from the

restriction enzyme library list.

2. To quickly add an enzyme form a custom set, simply double-click on

the name of the enzyme in the enzyme list. The enzyme will appear on

your custom list on the right.

3. To remove an enzyme from your custom enzyme set, select an enzyme

name from your custom list on the right and click Remove.

♦ Note: You can type in notes about the lane. The note field is limited to 255

characters.

After the digestion, the results will be displayed on the selected lane, replacing the gel

bands of the previous enzyme settings.

6.4 Adjusting gel display

This section describes options available for adjusting various displaying attributes of

gels.

Gel position and size

You can move the gel image (frame) within the map window just as with any other

screen objects. All associated elements of the gel, such as lanes, bands, labels, and

legends, will move together with the gel frame.

To resize the gel frame, select the gel first, click at the lower-right corner of the gel

and start to drag. Resizing a gel has the following effects:

1. The width of gel lanes changes proportionally with the width of the gel to

maintain a constant number of lanes.

112

2. Increasing the height of the gel reveals more bands on the gel, if present, but does

not alter the relative migration distance of bands on the gel. To adjust band

positions, use Gel | Position Bands, described below.

Band positioning

The positions of gel bands on a gel depend on both gel concentration and running

duration. NoeClone simulates these parameters by allowing you to directly adjust the

migration distances of bands. For example, use Gel |Position Bands | Separate More

to make bands separate better, and use Gel | Position Bands | Move Bands down to

move bands further away from the loading well. Note that all the bands on the gel

change proportionally.

Band size labeling

The sizes of bands in a selected lane, whether loaded with standard markers or with

digestion samples, can be labeled on the left side of the gel. The lane number to be

labeled can be specified in the Modify and Existing Gel dialog box.

6.5 Describing gel as text

NoeClone keeps track of each band, representing each DNA fragment from a

digestion, of the gel. This makes it possible to obtain another highly useful view of

the digestion, namely a text summary of fragment information after a digestion. To do

this, select the current gel and choosing Gel | Describe Gel As Text produces a text

description of every band in each lane of the gel. Below is an example of a gel

description.

113

114

Chapter 7 Managing data and files

Plasmid maps and cloning flowcharts created in NoeClone projects can be saved and

retrieved. NoeClone has the unique capability in supporting both file-based and

database-based data persistency. NoeClone projects can be saved as individual files or

to a centralized relational database. The support for database-oriented data

management is an appealing feature for corporations or laboratories to host all cloning

related molecules in a central system, making it easy to efficiently track projects for

multiple users. The support for saving cloning projects as individual files provides

flexibility and portability for sharing projects with colleagues and transferring them

between computers. The same project can be saved both as a file and as a record in

the database.

NoeClone also supports various commonly used graphic formats for exporting

drawings and diagrams for presentation or publication. Standard printing functions are

provided to allow printing of graphic and text output.

7.1 Working with relational databases

A relational database can reside either on the same machine where NoeClone is

installed or on a remote computer server. Once a database is set up (see Chapter 1,

Installations), NoeClone can be configured to connect to it, after which projects can

be saved to and retrieved from the database.

Connecting to database

A local relational database is installed automatically when NoeClone is installed on

your computer. If you wish to connect to a different database, for example a database

on a remote server, use Database | Connect To Database…. When the connection

dialog box appears, enter the database name, type, connection URL, username and

password, then click OK to make the connection.

115

Saving projects to database

Use File|Save Project To Database to save the current project to the current database

Opening projects from database

116

If you know the name of the project you wish to open, you can use File | Open

Project From Database… to see a list of projects in the database and select the

desired one to open. Additionally, you can enter a keyword to search projects in the

database to identify the desired project and open it.

Switch database

NoeClone can connect to four types of database, HSQLDB as the local database

binding with NoeClone when installed. It also can connect to oralce, mysql, sqlserver,

which installed on your local machine or the remote server.

There are some examples to show how to connect to different databases.

example1:

If your remote database is mysql , please choose “mysql” in the database type option.

And input the correct parameters

Database name the database instance name

117

host IP address of the machine you want to connect

port The default port of mysql is 3306

Database user name Create one user for remote connection on mysql

Database password Password to the user above

example2:

This example show how to operate data on the remote oracle database server, first

choose “oracle” in the database type option.

Then input the correct parameters

In this example, the database name is “XE”, the remote oracle server IP address is

118

“192.168.1.27” , and we use the default orcale port “1521”.

example3:

This example shows how to operate data on the remote SQLServer database server,

first choose “SQLServer” in the database type option.

Then input the correct parameters

In this example, the database name is “npnc2”, the remote oracle server IP address is

“192.168.1.27”, and we use the default orcale port “1433”.

119

Blast analysis against sequences in local databases

NoeClone provides a unique and special function for you to identify molecules, and

therefore associated cloning projects, using any DNA sequence as a query to search

for sequences similar to the query sequence. This is achieved through the classic and

familiar BLAST search method, which returns sequences in the NoeClone database

with different degrees of similarity to a query sequence of your interest.

Use Analyze | Blast Local Database to bring up a simple dialog box for you to enter

or select a query sequence. You can select a molecule in the project as the query

sequence, or paste in a sequence from the clipboard, and then start the search.

NoeClone automatically maintains and updates the Blast database from the NoeClone

database. The output is in the same format as the familiar Blast output, as in the

example below:

120

121

7.2 Working with files

Saving and retrieving map documents

Use File | Save Project As or File | Save Project to save the map document in

NoeClone native format. The ‘Save As' command brings up the standard file dialog

box for you to enter the name of the file. You should use this command if you are

saving a new file for the first time, or if you want to save the file under a name

different from the current file name. If you have made changes to a file that already

exists on disk, use Save instead.

122

Note that the sequence of the map, if available, is saved with the map.

Use File | Open Project to open a NoeClone native file. A new map window will be

created to contain the map.

Converting files created by CloneMap and NoeClone

Note: Plasmid data files created by CloneMap or NoeClone can be opened by

NoeClone. However, some minor alterations may occur due to changes in map

representation in different programs.

Saving graphic files

To save the map as a graphic file, choose File | Save Map View As Graphics or File

| Save Sequence View As Graphics. As a standard file format, graphic files can be

opened by most other Windows drawing programs, and is supported in NoeClone as a

way of communicating with other programs.

Saving sequence files

The File | Save Sequence File command let you choose which nucleic acid sequence

to save in your computer disk. NoeClone can save different types of files (File

format: .seq, .gb, .sqr, .gcg, .txt, abi, .embl, .fasta).

The save sequence dialog

7.3 Printing files

Printing plasmid maps

123

NoeClone supports the standard printing scheme. Before printing, set the page by

using Page Layout from the File menu. To print a map document, choose Print Map

from the File menu.

7.4 Program preferences

Program preferences

Several global parameters can be set in the Preferences dialog box, available from

Edit | Program Options. Since these parameters are stored to the disk, they take

effect even when you exit the program and re-launch it. The following options are

available in the Preference dialog box:

♦ The options of show features

♦ Program home directory

The program options dialog

124

Chapter 8 Summary of menu commands This chapter contains a summary of menu commands in NoeClone.

8.1 File menu

The File menu contains commands for managing projects, such as creating, saving,

retrieving, and printing maps and text files.

New Project... Open the New project dialog box for you to define a new project.

Open Project... Open a project file.

Open Project From Database... Opens a project from the currently connected

NoeClone database, and makes it the active project.

Open Sequence To Project Opens a sequence file in current project. The sequences

can be from file, data accession number or clipboard.

Close Project Close the current project.

Close File Close the File you opened.

Import From Other Programs Open the files which were created by CloneMap or

NoeClone.

Save Project As... Save the current project with a new name. The standard file dialog

box is presented for entering a new name. You can select the format of the file to be

saved by choosing appropriate file extensions.

Save Project Saves the current project using the same name as when the file was last

saved. The old file with the same name is overwritten.

125

Save Project To Database Saves the current project to the currently connected

NoeClone database.

Save Sequence File... Save the selected sequence to the disk. The format of the saved

file will be GenBank, EMBL, FASTA, GCG and XML.

Save Map View As Graphics... Save the selected map as a graphic file.

Save Sequence View As Graphics Save the selected sequence as a graphic file.

Page Layout Sets up the page for printing. It is important to do this every time when

you change printers.

Print Map Prints the current map project.

Exit Exit NoeClone

8.2 Edit menu

The Edit menu contains commands editing functions involving the Windows

clipboard and selection in program documents.

Copy Copies the currently selected items in the active window to the clipboard. The

affected items can be selected text in a text window, or select map features or drawing

objects in a map window. Copies items can later be pasted back to a document.

Paste Pastes clipboard storage to the current window.

Clear Clears any selected feature or map.

Copy Map As Graphics Copies the map window content into Windows clipboard as

a metafile, which can be pasted into other programs.

Paste Graphics Pastes graphic in the clipboard.

126

Select All Selects all the items in the active window.

Select All In Current Map Selects all the items in the current map.

Select All Special A submenu containing several items for selecting all items of a

particular type, as follows:

Select All Sites Selects all the sites from the current map.

Select All Regions Selects all regions from the current map.

Select All Text Selects all text from the current map.

Edit Libraries A submenu containing several items for edit libraries which are used

in NoeClone.

Program Options... Open a preference dialog box to define several default

parameters control NoeClone’s behavior when opening a DNA sequence file. These

parameters are saved when you exit the program and will take effect the next time you

run the program.

8.3 Project menu

The project menu contains commands for defining and editing the current project.

Add Molecule As New Page Opens a molecule sequence file in a new page. The

sequences can be from file, data accession number or clipboard.

Add Molecule To Current Page Opens a molecule sequence file in current page.

The sequences can be from file, data accession number or clipboard.

Add New Text Page Create a new text page.

Add Text Page From File Open text file to create a new text page.

View Project Note Show the note of the current project.

127

Hide/Show Project Overview Pane allows you hide or show the overview pane.

Hide/Show Feature Table Pane allows you hide or show feature table pane.

Project Properties... Open a dialog box to show and edit project options.

8.4 Molecule menu

Molecule menu contains commands for controlling the screen properties of maps and

maps features.

Add/Edit Features... Opens the features dialog box for entering and editing features.

Annotate Feature... Open a dialog box for annotate feature.

Extract Sequence From Features Show the sequence of the selected feature in a

new window.

View Feature Table Display the feature table.

View Sequence Display the sequence in the window.

Format Sequence View Open a dialog box for modifying the sequence view options

Double/Single Strand Change the strand style between double and single.

Translate Selected Translate the selected sequence in the sequence view area.

Molecule Properties... Open a dialog box to view and edit molecule properties.

128

8.5 Map menu

The map menu contains commands for defining and editing plasmid maps in the map

window.

Map View Option A submenu containing several items for modifies the parameters

governing the appearance of the current map.

Summarize Restriction Sites A submenu containing open a new text window

containing a summary of the restriction sites in the current map.

Linear Map... Linearizes the current circular map to a linear form. Linerization takes

places at a site specified by the user from a dialog box. If the current map is already in

linear form, this command is changed to Circularize, which can be used in the same

way to circularize the linear map.

Scale Maps... Map scale open a dialog lets you specify the number of basepairs per

screen pixel when drawing the map. This provides an easy way to draw proportional

maps.

Align Sites Name Aligns a group of sites names along a reference line specified by

five menu items.

Distribute Sites Name Distributes a group of text labels evenly along the width or

height of selected items.

Calculate Site Name Positions Calculates the best site of the names positions

8.6 Clone menu

Clone menu contains commands related to cloning functions

129

Define Fragments... Opens the define fragments dialog box in which you can define

an insertion fragment to be used as the insert or the vector for a subsequent cloning

step.

Copy Selection As Fragment Copies the selected sequence or the sequence between

two enzyme sites as a fragment.

Modify Fragment Ends... Opens a dialog let you edit the ends of the fragments for a

subsequent cloning step.

Ligate Two Fragments... Opens the ligation dialog box in which you specify the

details of the ligation reaction.

High-Throughput Cloning... Opens the dialog box in which you can ligate multiple

fragments.

Gateway Cloning Opens the dialog box to assist with Gateway cloning. Gateway is a

registered trademark of Invitrogen Corporation.

TOPO Cloning Opens the dialog box to assist with TOPO cloning.

Insert Fragment... Open the quick insert dialog box for inserting a map fragment.

Delete Fragment... Open the delete dialog box for deleting a map fragment. You

enter the start and end locations of the fragment to be deleted in this dialog box.

Invert Fragment... Open the inversion dialog box for inverting a map fragment.

Find Compatible Sites... Find sites in the current map that are compatible with a

given site.

Duplicate Map Creates a map which is same with the selected one.

PCR Fragment... Open the dialog box for PCR fragment.

130

8.7 Analyze menu

Analysis menu contains commands that make use of the sequences in the map, such

as digestion, sequence conversion, and translation.

Convert Sequence... Open a dialog box containing commands for converting

sequences, including complement, reverse, and reverse-complement.

Digest... Open the enzyme selection dialog box. You can select the enzymes to have

their sites displayed on the map associated with a sequence. The enzymes you

selected can be saved as enzyme filters, which can be accessed quickly using menu

commands.

Translate... Open a translation dialog to translate DNA sequence to protein sequence.

Find ORF... Searches open reading frames in the map. Identified ORFs are shown as

region features.

Find Sub-Sequence... Open a dialog to find sub-sequence.

Analyze Primers... Open a dialog box to calculate parameters for a primer sequence.

Blast Local Database... Open a dialog box to calculate parameters for a primer

sequence.

Multiple Sequence Alignment... Open a dialog box to conduct multiple sequence

alignment using the popular ClustalW method.

8.8 Gel menu

The Gel menu organizes commands related to gel function in NoeClone.

131

Create New Gel... Initiates the creation of new gel frame, by prompting you to click

somewhere in the map window.

Clear Gel... Empties all the bands and lanes in the selected gel.

Load Selected Lane... Load the current loading map onto the selected lane in the gel.

Clear Bands In Selected Lane... Remove the bands in the selected lane.

Add New Lane... Add new lane in the selected gel.

Delete Selected Lane... Delete selected lane in current gel.

Position Bands A submenu contains modify the position of the bands in the lane.

Select Bands For Cloning Define the selected bands as a cloning fragment.

Describe Gel As Text Lists every band in the lane as text description in a new text

window.

Gel Properties... Sets the numbers of lanes and notes for the current gel.

8.9 Window menu

The Window menu provides a means for organizing multiple windows on the screen.

All window titles, which are the same as project names, are listed under the Window

menu, below the two standard window management functions (Cascade and Tile).

Choosing an item from the list brings the corresponding window to the front. This

makes it easy to activate a particular window when many windows are open. The item

corresponding to the front-most window is check-marked.

8.10 Database menu

Database Browser... Brings up the database browser in your default web broswer.

132

Connect To Database... Brings up the database connection dialog box for NoeClone

to connect to a NoeClone database.

8.11 Language menu

The language menu allows you select the language in NoeClone.

8.12 Help menu

NoeClone Help... Brings up on-line help.

About NoeClone... Shows some information about NoeClone, including its the

version number and the address of its publisher.

133

Index active window, 25, 26, 27, 100 Add sites manually, 34, 39 Adding sites manually Sites, 34, 39 Align Labels, 37 Circular/linear map conversion, 45 Circularize, 29, 34, 45, 46, 102 clipboard, 21, 28, 47, 48, 49, 51, 52, 69, 73, 81, 82, 100 Cloning basics, 21 example, 30 Cloning basics, 21 Cloning example, 30 color, 37, 42, 43 Color, 42, 43 Color pop-up menu, 37, 42, 43 Cut command, 54, 55, 61 Cut Frequency, 54 Cutter size, 54 Cutter size., 54 Deleting regions, 43 Deleting sites, 37 Distribute Labels, 37 Drawing object, 22 Enzyme filters, 53, 54, 55, 59, 104 enzyme library, 51, 53, 60, 61 Feature table, 51 file format, 50, 97 filters, 55 Font, 36 Gene Style, 41 Gene Thickness, 42 graphic frontend, 23 Label Positions, 37 Linearize, 34, 45 Linkage between map and sequence, 26 Map document, 23 Map features, 20, 22 Map fragment, 22 Map notes, 46 Map object, 22 Map scale, 33, 45

134

Map size, 33 Metafile, 100 Moving a map, 44 new map without sequence, 33 Numbering system, 27 Open sequence, 51 Open..., 96 Page Setup, 97 Page Setup, 97 PICT, 22, 23, 96, 97 Plasmid form, 34 Plasmid map, 20, 22, 29, 96 Plasmid name, 33 Plasmid size, 33 preferences, 28, 97 Print..., 97 Region, 29, 38, 43, 100 Region direction, 38 Region list, 43 Region position, 43 Regions deleting, 43 report, 56 Resizing a map, 44, 45 Save files, 96 Sequence features, 22 Shading pattern, 42 Site Style, 36 sites, 34 Sites Adding sites manually, 34, 39 deleting, 37 status box, 23, 24 Text document, 23 Tutorial, 28 Window organizations

NoeClone - SJTU

Documents