Next Generation Sequencing in Science and Medicine The Presidential Commission for the Study of Bioethical Issues 28 February 2011 Washington D.C. Jim.

Next Generation Sequencing in Science and

MedicineThe Presidential Commission

for the Study of Bioethical Issues

28 February 2011Washington D.C.

Jim Evans MD, Ph.DUniversity of North Carolina at Chapel Hill

DNA Has Only Two Jobs

• It serves as a store of information– Ensuring that information is passed

on to each new cell upon division (and the next generation)

• It directs the synthesis of proteins– Which are necessary to carry out

the functions of a living organism

DNA’s Structure Explains How it Accomplishes Both Jobs

Thymine (T) Guanine (G)

A

TG

C

G

T

CA

Adenine (A) Cytosine (C)Always binds to Always binds to

As a double helix, each DNA molecule contains a copy of itself

DNA Serves as a Store of Information

DNA’s Structure Explains How it Accomplishes Both Jobs

• It is the order of the bases that provides the instructions for protein synthesis

• One stretch of DNA directs the synthesis of one type of protein, another stretch directs the synthesis of another type of protein

DNA Directs the Synthesis of Proteins

T

G

CA

We call a stretch of DNA that directs the synthesis of one particular protein a Gene

Gene #1 Gene #2 Gene #3

DNA Sequencing

• You have 3 billion bases arrayed in a unique order, with ~20,000 genes that direct the synthesis of all the proteins that comprise you

• “Sequencing” DNA is simply the elucidation of the order of the bases in an organism’s DNA strand

• The unique order of your bases greatly influences your health, e.g.– What disease you are more - or less - prone to– How you will react to different medications

• A human “genome” is about 6 feet of DNA– And each of your cells contains two copies of your

genome

A Human DNA Sequence• ~1/1,000,000th of the

Human Genome• Interspersed with

genes• And

“polymorphisms” which differ between people– Are sometimes

important, influencing traits

– or medically important characteristics

atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttgttcaactcatccaggattagatccgtagatcgtaggaaatatctcggataattaacagatacacacccttagaccatttaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgacgtttccaggctacacacacactgacagatagacagattcaaattcagtcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcatatatccaggaaaatccctgggaaaaattggctacgtaccgtattaactaggatctccgatggtacccattaagacacccaaaataggtaacaggtagacatattgatacccatagaggatagatttaggacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccagctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcgccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcacacacacactgacagagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgcagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgagagtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctggactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca

Sequencing DNA

• Early techniques were developed in the 1970’s• A variety of approaches now exist• The biggest limitation to sequencing is that the genome is big

– So carrying out these reactions for an entire genome is slow and expensive

Next Generation Sequencing

• Takes advantage of miniaturization to engage in massively parallel analysis– Essentially carrying out millions of sequencing

reactions simultaneously in each of 10 million tiny wells

• Sophisticated computer analysis of huge amounts of information allows “assembly" of a given sequence

$795 in 1977(=$2,800 in current $)

Accelerating Technology & Plummeting Cost

Next Generation Sequencing

Genomics’ Long Term Promise

• An avalanche of Genome Wide Association Studies (GWAS) in common diseases

• WGS is now a practical reality

• Will shed light on the genetic underpinnings of every disease imaginable

Ultimately transforming Medical Science

Medical Science = Medical Practice

• Medical Science is the indispensible foundation of Medical Practice• But medical practice is far more complex

– More variables– Individual values matter – and they differ

• Theory alone is insufficient to guide practice• Time-line for translation is long• Successful translation into practice

is not guaranteed by scientific understanding– See sickle cell disease

• It’s far more expensive• The stakes are much higher in Medical Practice

– Because the power to harm is real and potent

Where Does the Clinical Promise of Genomics Lie?

Probably not in risk assessment for common disease

• Common diseases have many factors, of which genetics is only one

• The bulk of any individual’s genetic risk for common disease is modest– Thus assessing genetic risk

only “nudges” that risk slightly

• Few data to suggest that knowledge of one’s genomic status for common disease is useful or is effective in changing behavior

Genetics

DietExercise

Smoking

Diabetes

Hypertension

Probably not in simply assessing risk

What’s The Right Nail For Sequencing Technology?

• As a diagnostic tool in enigmatic patients

• As a public health tool to identify those apparently well individuals with dramatically increased risk of preventable disease

Next Generation Sequencing as a Clinical Diagnostic Tool

• 47 yo female with sudden cardiac arrest

• Resuscitated successfully• EKG reveals “Long QT Syndrome”

– High risk for sudden death– Dozens of genes implicated

• Application of NGS to detect mutation

• Thereby guiding patient’s treatment and prevention of death in family members

? ?

?? ?

Next Generation Sequencing as a Public Health Tool

• ~0.25% of US women (375,000) carry a mutation in BRCA1/2– At very high risk of breast and ovarian

cancer• 85% lifetime breast cancer risk• 25-50% lifetime ovarian cancer cancer

• Knowledge of risk allows prevention– Currently we only can identify such

women once several family members have developed cancer

• NGS allows population screening for high risk preventable disorders– Cancer predisposition, cardiac disease,

etc.– ~1-2% of population carry such mutations

• 3-6 million individuals in the US with preventable disorders if identified

Challenges to Harnessing NGS in Clinical Medicine & Public Health

• Accuracy– 99.99% accuracy x 3 billion nucleotides– = 300,000 errors per patient

• Interpretation of the variants we find

• Storage and access in the medical record

• Education of patients and public

• Issues of consent and reporting

• Education of providers

Incidental Information• Upon WGS we discover many things we weren't

looking for, which we can do nothing about– Some are trivial or indeed beneficial– But some are problematic– And we will occasionally discover lethal, untreatable

late onset conditions

• Some wish to know such information; others do not• We must grapple with how to inform patients about

such information– protect patients from harm but also allow

individual autonomy and choice

Low risk incidental information

Medium risk incidental information

High risk incidental

information

PGx variants and common risk SNPs with no proven

clinical utility

APOECarrier status for severe

recessive diseases

Huntington diseasePrion

diseasesetc.

In the Clinical Arena, Genetic Information Presents Few Qualitatively New Challenges

• Genetic tests affect others– Infectious Disease

• Provide probabilistic information to the asymptomatic– Cholesterol

• Our genome cannot be changed– Nor can much of what we discover medically

• Insurance discrimination– Actually better for genetics than the rest of medicine

• Unexpected results, FPs/FNs– Are a routine part of all clinical care

• DNA is “uniquely identifiable”– Zip code + DOB + spouse’s first name

ATGGTCCTATGGATCTCTTTAAAGGGCCTTAGTACTTACCGTAACTTTAGCCGGTAGCTTAATCGTGCCTAGGTCGATTGCCTAGGCTTAGCTAGCTTGG

Jim’s Whole Genome Sequence!!

Eschewing Genetic Exceptionalism

Challenges to Realizing Genomic Medicine• Creation of a centralized, evidence-based, iterative process

to define clinically significant genomic findings • Thorough health-oriented phenotypic annotation of variants• Enabling realistic shared decision making among a range of

providers, technology interfaces and patients• Understanding the ethical dimensions, patient preferences &

values regarding returning incidental results• Maintaining a sober focus on evidence

Life is short, the art long, opportunity fleeting, experience

delusive, judgment difficult

A Human DNA Sequence• ~1/1,000,000th of the

Human Genome• Interspersed with

genes• And

“polymorphisms” which differ between people– Are sometimes

important, influencing traits

– or medically important characteristics

atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttgttcaactcatccagga/taaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgacgtttccaggctacacacacactgacagatagacagattcaaattcagtcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcatatatccaggaaaatccctgggaaaaattggctacgtaccgta/gacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccagctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggc/gccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcacacacacactgacagagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgcagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgagagtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctggactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca

DNA basicsMx of sequencingKey to next gen is massive parallelism and ITGraph with drop in cost. Use my computer electronics slideReal promise rsrch, drug targets , need to keep a realistic focus; timeline is long,Impatience to applyEarly applications of Genomic technologyArrays -Clinical Dx - consumer application. Slide on DTC with problems. GAO data. RR. Problems slideSoon sequencing will supersede arraysClinical Application: real clinical use will be dx Why?Genetic heterogeneity examplesPublic health applicationProblems:Vast data sets. incidental infoBinning to handleRisky info (reintroduce GE here)Come back to bin with risk stratification now revealed. ?Somewhere: slide on evidence and practice (lidocaine) in context of to understand clinical Sequencing need to understand some important medical principles like EBMUse the science not equal to medicine slide.Discourage genetic exceptionalism in clinical medicine except where waranted…but we’re used to dealing with privat and complex information. Address the fact that clinical genomic testing is very different from research. Need focus on evidenceFinish up with ethical challenges, including IP,

“We have discovered the secret of life”

February 28, 1953